datp 14 biotin  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 80

    Structured Review

    Thermo Fisher datp 14 biotin
    Datp 14 Biotin, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 80/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/datp 14 biotin/product/Thermo Fisher
    Average 80 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    datp 14 biotin - by Bioz Stars, 2020-01
    80/100 stars

    Images

    Related Articles

    Nucleic Acid Electrophoresis:

    Article Title: Dynamics of Single DNA Looping and Cleavage by Sau3AI and Effect of Tension Applied to the DNA
    Article Snippet: The 10,845-bp fragment was produced by digesting pBACe3.6 with BsrGI (NEB) and labeled using the Klenow fragment of Escherichia coli DNA polymerase I, exo− (NEB) to incorporate dATP-14-biotin (Invitrogen). .. To isolate the desired products the samples were separated by gel electrophoresis and purified using a gel extraction kit (Qiagen).

    Negative Control:

    Article Title: Dynamics of Single DNA Looping and Cleavage by Sau3AI and Effect of Tension Applied to the DNA
    Article Snippet: .. Bacteriophage phiX174 DNA, used as a negative control template, was purchased from NEB and was labeled by digesting with XhoI and end labeling with dATP-14-biotin (Invitrogen). .. The DNA was then digested with StuI, purified using the Promega (Madison, WI) Wizard DNA clean-up kit, and end labeled with dUTP-11-DIG.

    Amplification:

    Article Title: Dynamics of Single DNA Looping and Cleavage by Sau3AI and Effect of Tension Applied to the DNA
    Article Snippet: The PCR fragment was generated by amplification of a sequence from pFastBac HT-b (Invitrogen, Carlsbad, CA) using the primers 5′-GTGGTATGGCTGATTATGATC and 5′GCAGCCTGAATGGCGAATGG and was labeled by incorporation of 20 μ M of dUTP-11-DIG (Roche, Indianapolis, IN) and 200 μ M each of dATP, dCTP, dGTP, dTTP in the PCR. .. The 10,845-bp fragment was produced by digesting pBACe3.6 with BsrGI (NEB) and labeled using the Klenow fragment of Escherichia coli DNA polymerase I, exo− (NEB) to incorporate dATP-14-biotin (Invitrogen).

    Article Title: DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force
    Article Snippet: The PCR fragment was generated by amplification of a sequence from pFastBac HT-b (Invitrogen) using the primers d(GTGGTATGGCTGATTATGATC) and d(GCAGCCTGAATGGCGAATGG) and was labeled by incorporation of 20 µM of dUTP-11-DIG (Roche) and 200 µM each of dATP, dCTP, dGTP, dTTP in the PCR. .. The 10 845 bp fragment was produced by digesting pBACe3.6 (Children's Hospital of Oakland Research Institute) with BsrGI (New England Biolabs, ‘NEB’) and end labeling by using the Klenow fragment of Escherichia coli DNA polymerase I, exo− , (NEB) to incorporate dATP-14-biotin (Invitrogen).

    Agarose Gel Electrophoresis:

    Article Title: DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force
    Article Snippet: The 10 845 bp fragment was produced by digesting pBACe3.6 (Children's Hospital of Oakland Research Institute) with BsrGI (New England Biolabs, ‘NEB’) and end labeling by using the Klenow fragment of Escherichia coli DNA polymerase I, exo− , (NEB) to incorporate dATP-14-biotin (Invitrogen). .. To isolate the desired product the samples were run on a 1% agarose gel in 1× TAE buffer and purified using the Qiagen Gel Extraction kit.

    Generated:

    Article Title: Dynamics of Single DNA Looping and Cleavage by Sau3AI and Effect of Tension Applied to the DNA
    Article Snippet: The PCR fragment was generated by amplification of a sequence from pFastBac HT-b (Invitrogen, Carlsbad, CA) using the primers 5′-GTGGTATGGCTGATTATGATC and 5′GCAGCCTGAATGGCGAATGG and was labeled by incorporation of 20 μ M of dUTP-11-DIG (Roche, Indianapolis, IN) and 200 μ M each of dATP, dCTP, dGTP, dTTP in the PCR. .. The 10,845-bp fragment was produced by digesting pBACe3.6 with BsrGI (NEB) and labeled using the Klenow fragment of Escherichia coli DNA polymerase I, exo− (NEB) to incorporate dATP-14-biotin (Invitrogen).

    Article Title: DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force
    Article Snippet: The PCR fragment was generated by amplification of a sequence from pFastBac HT-b (Invitrogen) using the primers d(GTGGTATGGCTGATTATGATC) and d(GCAGCCTGAATGGCGAATGG) and was labeled by incorporation of 20 µM of dUTP-11-DIG (Roche) and 200 µM each of dATP, dCTP, dGTP, dTTP in the PCR. .. The 10 845 bp fragment was produced by digesting pBACe3.6 (Children's Hospital of Oakland Research Institute) with BsrGI (New England Biolabs, ‘NEB’) and end labeling by using the Klenow fragment of Escherichia coli DNA polymerase I, exo− , (NEB) to incorporate dATP-14-biotin (Invitrogen).

    Construct:

    Article Title: DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force
    Article Snippet: Paragraph title: DNA constructs ... PhiX174 DNA was purchased from NEB and was labeled by digesting with XhoI and end-labeling with dATP-14-biotin (Invitrogen).

    Article Title: Dynamics of Single DNA Looping and Cleavage by Sau3AI and Effect of Tension Applied to the DNA
    Article Snippet: The DNA construct was prepared by ligating a digoxygenin (DIG)-labeled polymerase chain reaction (PCR) fragment (4282 bp) to a 10,845-bp biotin-end-labeled restriction fragment of pBACe3.6 (Children's Hospital of Oakland Research Institute). .. The 10,845-bp fragment was produced by digesting pBACe3.6 with BsrGI (NEB) and labeled using the Klenow fragment of Escherichia coli DNA polymerase I, exo− (NEB) to incorporate dATP-14-biotin (Invitrogen).

    Purification:

    Article Title: DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force
    Article Snippet: The DNA was then digested by XbaI and purified using the Promega Wizard DNA clean up kit. .. PhiX174 DNA was purchased from NEB and was labeled by digesting with XhoI and end-labeling with dATP-14-biotin (Invitrogen).

    Article Title: Dynamics of Single DNA Looping and Cleavage by Sau3AI and Effect of Tension Applied to the DNA
    Article Snippet: The 10,845-bp fragment was produced by digesting pBACe3.6 with BsrGI (NEB) and labeled using the Klenow fragment of Escherichia coli DNA polymerase I, exo− (NEB) to incorporate dATP-14-biotin (Invitrogen). .. Both fragments were purified (Qiagen, Valencia, CA; PCR purification kit) and digested with XhoI (NEB).

    Article Title: DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force
    Article Snippet: The 10 845 bp fragment was produced by digesting pBACe3.6 (Children's Hospital of Oakland Research Institute) with BsrGI (New England Biolabs, ‘NEB’) and end labeling by using the Klenow fragment of Escherichia coli DNA polymerase I, exo− , (NEB) to incorporate dATP-14-biotin (Invitrogen). .. Both fragments were purified using the Qiagen PCR purification kit and digested with XhoI (NEB).

    Article Title: Dynamics of Single DNA Looping and Cleavage by Sau3AI and Effect of Tension Applied to the DNA
    Article Snippet: To isolate the desired products the samples were separated by gel electrophoresis and purified using a gel extraction kit (Qiagen). .. Bacteriophage phiX174 DNA, used as a negative control template, was purchased from NEB and was labeled by digesting with XhoI and end labeling with dATP-14-biotin (Invitrogen).

    Produced:

    Article Title: Dynamics of Single DNA Looping and Cleavage by Sau3AI and Effect of Tension Applied to the DNA
    Article Snippet: .. The 10,845-bp fragment was produced by digesting pBACe3.6 with BsrGI (NEB) and labeled using the Klenow fragment of Escherichia coli DNA polymerase I, exo− (NEB) to incorporate dATP-14-biotin (Invitrogen). .. Both fragments were purified (Qiagen, Valencia, CA; PCR purification kit) and digested with XhoI (NEB).

    Article Title: DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force
    Article Snippet: .. The 10 845 bp fragment was produced by digesting pBACe3.6 (Children's Hospital of Oakland Research Institute) with BsrGI (New England Biolabs, ‘NEB’) and end labeling by using the Klenow fragment of Escherichia coli DNA polymerase I, exo− , (NEB) to incorporate dATP-14-biotin (Invitrogen). .. Both fragments were purified using the Qiagen PCR purification kit and digested with XhoI (NEB).

    Article Title: Dynamics of Single DNA Looping and Cleavage by Sau3AI and Effect of Tension Applied to the DNA
    Article Snippet: The 10,845-bp fragment was produced by digesting pBACe3.6 with BsrGI (NEB) and labeled using the Klenow fragment of Escherichia coli DNA polymerase I, exo− (NEB) to incorporate dATP-14-biotin (Invitrogen). .. Bacteriophage phiX174 DNA, used as a negative control template, was purchased from NEB and was labeled by digesting with XhoI and end labeling with dATP-14-biotin (Invitrogen).

    Polymerase Chain Reaction:

    Article Title: Dynamics of Single DNA Looping and Cleavage by Sau3AI and Effect of Tension Applied to the DNA
    Article Snippet: The PCR fragment was generated by amplification of a sequence from pFastBac HT-b (Invitrogen, Carlsbad, CA) using the primers 5′-GTGGTATGGCTGATTATGATC and 5′GCAGCCTGAATGGCGAATGG and was labeled by incorporation of 20 μ M of dUTP-11-DIG (Roche, Indianapolis, IN) and 200 μ M each of dATP, dCTP, dGTP, dTTP in the PCR. .. The 10,845-bp fragment was produced by digesting pBACe3.6 with BsrGI (NEB) and labeled using the Klenow fragment of Escherichia coli DNA polymerase I, exo− (NEB) to incorporate dATP-14-biotin (Invitrogen).

    Article Title: DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force
    Article Snippet: The PCR fragment was generated by amplification of a sequence from pFastBac HT-b (Invitrogen) using the primers d(GTGGTATGGCTGATTATGATC) and d(GCAGCCTGAATGGCGAATGG) and was labeled by incorporation of 20 µM of dUTP-11-DIG (Roche) and 200 µM each of dATP, dCTP, dGTP, dTTP in the PCR. .. The 10 845 bp fragment was produced by digesting pBACe3.6 (Children's Hospital of Oakland Research Institute) with BsrGI (New England Biolabs, ‘NEB’) and end labeling by using the Klenow fragment of Escherichia coli DNA polymerase I, exo− , (NEB) to incorporate dATP-14-biotin (Invitrogen).

    Article Title: Dynamics of Single DNA Looping and Cleavage by Sau3AI and Effect of Tension Applied to the DNA
    Article Snippet: Both fragments were purified (Qiagen, Valencia, CA; PCR purification kit) and digested with XhoI (NEB). .. Bacteriophage phiX174 DNA, used as a negative control template, was purchased from NEB and was labeled by digesting with XhoI and end labeling with dATP-14-biotin (Invitrogen).

    Incubation:

    Article Title: Dynamics of Single DNA Looping and Cleavage by Sau3AI and Effect of Tension Applied to the DNA
    Article Snippet: Bacteriophage phiX174 DNA, used as a negative control template, was purchased from NEB and was labeled by digesting with XhoI and end labeling with dATP-14-biotin (Invitrogen). .. A total of 5 μ l of diluted DNA (∼10–100 ng/ μ l) was mixed with 5 μ l of microspheres and incubated for ∼45 min at room temperature on a slowly rotating mixer; 5–10 μ l of these microspheres were diluted in 0.5 ml of PBS and loaded into a 1-ml syringe for injection into the sample chamber.

    Labeling:

    Article Title: DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force
    Article Snippet: .. PhiX174 DNA was purchased from NEB and was labeled by digesting with XhoI and end-labeling with dATP-14-biotin (Invitrogen). .. The DNA was then digested with StuI, purified using the Promega Wizard DNA clean up kit, and end-labeled with dUTP-11-DIG.

    Article Title: Dynamics of Single DNA Looping and Cleavage by Sau3AI and Effect of Tension Applied to the DNA
    Article Snippet: .. The 10,845-bp fragment was produced by digesting pBACe3.6 with BsrGI (NEB) and labeled using the Klenow fragment of Escherichia coli DNA polymerase I, exo− (NEB) to incorporate dATP-14-biotin (Invitrogen). .. Both fragments were purified (Qiagen, Valencia, CA; PCR purification kit) and digested with XhoI (NEB).

    Article Title: Dynamics of Single DNA Looping and Cleavage by Sau3AI and Effect of Tension Applied to the DNA
    Article Snippet: .. Bacteriophage phiX174 DNA, used as a negative control template, was purchased from NEB and was labeled by digesting with XhoI and end labeling with dATP-14-biotin (Invitrogen). .. The DNA was then digested with StuI, purified using the Promega (Madison, WI) Wizard DNA clean-up kit, and end labeled with dUTP-11-DIG.

    End Labeling:

    Article Title: DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force
    Article Snippet: .. PhiX174 DNA was purchased from NEB and was labeled by digesting with XhoI and end-labeling with dATP-14-biotin (Invitrogen). .. The DNA was then digested with StuI, purified using the Promega Wizard DNA clean up kit, and end-labeled with dUTP-11-DIG.

    Article Title: DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force
    Article Snippet: .. The 10 845 bp fragment was produced by digesting pBACe3.6 (Children's Hospital of Oakland Research Institute) with BsrGI (New England Biolabs, ‘NEB’) and end labeling by using the Klenow fragment of Escherichia coli DNA polymerase I, exo− , (NEB) to incorporate dATP-14-biotin (Invitrogen). .. Both fragments were purified using the Qiagen PCR purification kit and digested with XhoI (NEB).

    Article Title: Dynamics of Single DNA Looping and Cleavage by Sau3AI and Effect of Tension Applied to the DNA
    Article Snippet: .. Bacteriophage phiX174 DNA, used as a negative control template, was purchased from NEB and was labeled by digesting with XhoI and end labeling with dATP-14-biotin (Invitrogen). .. The DNA was then digested with StuI, purified using the Promega (Madison, WI) Wizard DNA clean-up kit, and end labeled with dUTP-11-DIG.

    Sequencing:

    Article Title: Dynamics of Single DNA Looping and Cleavage by Sau3AI and Effect of Tension Applied to the DNA
    Article Snippet: The PCR fragment was generated by amplification of a sequence from pFastBac HT-b (Invitrogen, Carlsbad, CA) using the primers 5′-GTGGTATGGCTGATTATGATC and 5′GCAGCCTGAATGGCGAATGG and was labeled by incorporation of 20 μ M of dUTP-11-DIG (Roche, Indianapolis, IN) and 200 μ M each of dATP, dCTP, dGTP, dTTP in the PCR. .. The 10,845-bp fragment was produced by digesting pBACe3.6 with BsrGI (NEB) and labeled using the Klenow fragment of Escherichia coli DNA polymerase I, exo− (NEB) to incorporate dATP-14-biotin (Invitrogen).

    Article Title: DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force
    Article Snippet: The PCR fragment was generated by amplification of a sequence from pFastBac HT-b (Invitrogen) using the primers d(GTGGTATGGCTGATTATGATC) and d(GCAGCCTGAATGGCGAATGG) and was labeled by incorporation of 20 µM of dUTP-11-DIG (Roche) and 200 µM each of dATP, dCTP, dGTP, dTTP in the PCR. .. The 10 845 bp fragment was produced by digesting pBACe3.6 (Children's Hospital of Oakland Research Institute) with BsrGI (New England Biolabs, ‘NEB’) and end labeling by using the Klenow fragment of Escherichia coli DNA polymerase I, exo− , (NEB) to incorporate dATP-14-biotin (Invitrogen).

    Gel Extraction:

    Article Title: Dynamics of Single DNA Looping and Cleavage by Sau3AI and Effect of Tension Applied to the DNA
    Article Snippet: The 10,845-bp fragment was produced by digesting pBACe3.6 with BsrGI (NEB) and labeled using the Klenow fragment of Escherichia coli DNA polymerase I, exo− (NEB) to incorporate dATP-14-biotin (Invitrogen). .. To isolate the desired products the samples were separated by gel electrophoresis and purified using a gel extraction kit (Qiagen).

    Article Title: DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force
    Article Snippet: The 10 845 bp fragment was produced by digesting pBACe3.6 (Children's Hospital of Oakland Research Institute) with BsrGI (New England Biolabs, ‘NEB’) and end labeling by using the Klenow fragment of Escherichia coli DNA polymerase I, exo− , (NEB) to incorporate dATP-14-biotin (Invitrogen). .. To isolate the desired product the samples were run on a 1% agarose gel in 1× TAE buffer and purified using the Qiagen Gel Extraction kit.

    Injection:

    Article Title: Dynamics of Single DNA Looping and Cleavage by Sau3AI and Effect of Tension Applied to the DNA
    Article Snippet: Bacteriophage phiX174 DNA, used as a negative control template, was purchased from NEB and was labeled by digesting with XhoI and end labeling with dATP-14-biotin (Invitrogen). .. A total of 5 μ l of diluted DNA (∼10–100 ng/ μ l) was mixed with 5 μ l of microspheres and incubated for ∼45 min at room temperature on a slowly rotating mixer; 5–10 μ l of these microspheres were diluted in 0.5 ml of PBS and loaded into a 1-ml syringe for injection into the sample chamber.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher biotin 14 datp
    Biotin 14 Datp, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 46 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/biotin 14 datp/product/Thermo Fisher
    Average 90 stars, based on 46 article reviews
    Price from $9.99 to $1999.99
    biotin 14 datp - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results