Review





Similar Products

90
MyBiosource Biotechnology cygb elisa kit mbs2890631
Cygb Elisa Kit Mbs2890631, supplied by MyBiosource Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cygb elisa kit mbs2890631/product/MyBiosource Biotechnology
Average 90 stars, based on 1 article reviews
cygb elisa kit mbs2890631 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Thermo Fisher rabbit polyclonal anti-cygb
Rabbit Polyclonal Anti Cygb, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit polyclonal anti-cygb/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
rabbit polyclonal anti-cygb - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology cygb sirna
Cygb Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cygb sirna/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
cygb sirna - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

90
Genechem lentivirus carrying the cygb cds (protein coding region) or short hairpin rna (shrna) sequences (ctcaacactgtcgtggagaacctgcatga)
Lentivirus Carrying The Cygb Cds (Protein Coding Region) Or Short Hairpin Rna (Shrna) Sequences (Ctcaacactgtcgtggagaacctgcatga), supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentivirus carrying the cygb cds (protein coding region) or short hairpin rna (shrna) sequences (ctcaacactgtcgtggagaacctgcatga)/product/Genechem
Average 90 stars, based on 1 article reviews
lentivirus carrying the cygb cds (protein coding region) or short hairpin rna (shrna) sequences (ctcaacactgtcgtggagaacctgcatga) - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

93
Proteintech cygb
Fig. 5 <t>CYGB</t> combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and <t>TFR</t> <t>antibodies</t> in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining
Cygb, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cygb/product/Proteintech
Average 93 stars, based on 1 article reviews
cygb - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

97
Proteintech blotting with cygb
Fig. 5 <t>CYGB</t> combined TFR to regulate ferroptosis. (A) <t>Western</t> <t>blotting</t> analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and TFR antibodies in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining
Blotting With Cygb, supplied by Proteintech, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/blotting with cygb/product/Proteintech
Average 97 stars, based on 1 article reviews
blotting with cygb - by Bioz Stars, 2026-02
97/100 stars
  Buy from Supplier

90
Proteintech cygb antibody
<t>CYGB</t> inhibited the proliferation, migration, and invasion of colorectal cancer cells. Cell cycle analysis of HCT116 ( A ) and SW620 cells ( B ) <t>with</t> <t>CYGB-overexpression.</t> The histogram represents the percentage of each phase of three repeats. The p value was indicated. Effects of CYGB on the migration of HCT116 ( C ) and SW620 cells ( D ) photographed at 0 and 72 h. ImageJ was used to analyze the wound scratch area. The histogram represents relative mobility. Effects of CYGB on the invasion ability of HCT116 ( E ) and SW620 cells ( F ). The histogram represents the number of invaded cells in each field, and the counts in at least five fields were calculated
Cygb Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cygb antibody/product/Proteintech
Average 90 stars, based on 1 article reviews
cygb antibody - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

Image Search Results


Fig. 5 CYGB combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and TFR antibodies in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining

Journal: Molecular and cellular biochemistry

Article Title: Cytoglobin augments ferroptosis through autophagic degradation of ferritin in colorectal cancer cells.

doi: 10.1007/s11010-024-05148-0

Figure Lengend Snippet: Fig. 5 CYGB combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and TFR antibodies in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining

Article Snippet: The separated proteins were separated in a 10% gel through sodium dodecyl sulfate–polyacrylamide gel electrophoresis and then transferred onto polyvinylidene difluoride membranes, blocked in 0.3% Tris-buffered saline with Tween 20 solution containing 5% nonfat dry milk, and further incubated with the primary antibodies LC3B (1:1000 dilution, #3868; Cell Signaling), β-Actin (1:20000 dilution, AC026; ABclonal), CYGB (1:1000 dilution, 60228-1-Ig; Proteintech), DDDDKTag (1:1000 dilution, HT201; TransGen), NCOA4 (1:1000 dilution, A5695; ABclonal), TFR (1:1000 dilution, #13113; Cell Signaling), FTH (1:1000 dilution, A19544; ABclonal), FTL (1:2000 dilution, A11241; ABclonal), PCBP1 (1:1000 dilution, A22141; ABclonal) and ACSL4 (1:1000 dilution, A20414; ABclonal).

Techniques: Western Blot, Over Expression, Immunoprecipitation, Immunofluorescence, Staining

Fig. 5 CYGB combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and TFR antibodies in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining

Journal: Molecular and cellular biochemistry

Article Title: Cytoglobin augments ferroptosis through autophagic degradation of ferritin in colorectal cancer cells.

doi: 10.1007/s11010-024-05148-0

Figure Lengend Snippet: Fig. 5 CYGB combined TFR to regulate ferroptosis. (A) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. (B) The immunoprecipitation and immunoblotting were per- formed using FLAG-CYGB and TFR antibodies in HCT116. (C) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining

Article Snippet: The supernatant was collected for western blotting with CYGB (1:1000 dilution, 60228; Proteintech) and TFR (1:1000 dilution, #13113; Cell Signaling).

Techniques: Western Blot, Over Expression, Immunoprecipitation, Immunofluorescence, Staining

CYGB inhibited the proliferation, migration, and invasion of colorectal cancer cells. Cell cycle analysis of HCT116 ( A ) and SW620 cells ( B ) with CYGB-overexpression. The histogram represents the percentage of each phase of three repeats. The p value was indicated. Effects of CYGB on the migration of HCT116 ( C ) and SW620 cells ( D ) photographed at 0 and 72 h. ImageJ was used to analyze the wound scratch area. The histogram represents relative mobility. Effects of CYGB on the invasion ability of HCT116 ( E ) and SW620 cells ( F ). The histogram represents the number of invaded cells in each field, and the counts in at least five fields were calculated

Journal: Molecular and Cellular Biochemistry

Article Title: Cytoglobin augments ferroptosis through autophagic degradation of ferritin in colorectal cancer cells

doi: 10.1007/s11010-024-05148-0

Figure Lengend Snippet: CYGB inhibited the proliferation, migration, and invasion of colorectal cancer cells. Cell cycle analysis of HCT116 ( A ) and SW620 cells ( B ) with CYGB-overexpression. The histogram represents the percentage of each phase of three repeats. The p value was indicated. Effects of CYGB on the migration of HCT116 ( C ) and SW620 cells ( D ) photographed at 0 and 72 h. ImageJ was used to analyze the wound scratch area. The histogram represents relative mobility. Effects of CYGB on the invasion ability of HCT116 ( E ) and SW620 cells ( F ). The histogram represents the number of invaded cells in each field, and the counts in at least five fields were calculated

Article Snippet: The supernatant was collected for western blotting with CYGB (1:1000 dilution, 60228; Proteintech) and TFR (1:1000 dilution, #13113; Cell Signaling).

Techniques: Migration, Cell Cycle Assay, Over Expression

CYGB activated autophagy during ferroptosis induction. ( A ) Co-localization of CYGB and LAMP-1 in HCT116 cells. Immunofluorescence staining of CYGB and LAMP-1 was performed, and Pearson’s colocalization efficiency analysis of CYGB and LAMP-1 was indicated. ( B ) Representative images of lysosomes by LysoTracker™ staining in HCT116 with CYGB. Image J was used to analyze pictures and calculate the mean fluorescence intensity. ( C ) Morphological changes after CYGB-overexpression based on transmission electron microscopy examination in HCT116 cells. The black arrow indicates autophagic lysosomes. ( D ) The evaluation of cell viability after treatment of RSL3 on 1, 5 µM and Erastin 10, 20 µM on with bafilomycin A1 (100 nM) or the ferroptosis inhibitor ferrostatin-1 (10 µM) for 24 h. The evaluation of cell viability after combined treatment of RSL3 (2 µM) and Erastin (20 µM) and autophagy inducer rapamycin (1 µM) with bafilomycin A1 (100 µM) for 24 h. RAP, rapamycin; BAF, bafilomycin A1; CQ, chloroquine; Ferr-1, ferrostasin-1 in HCT116 ( E ) and SW620 cells ( F ). ( G ) Western blotting analysis of ACSL4, PCBP1, FTH, FTL and NCOA4 in HCT116 and SW620 with CYGB-overexpression. ( H ) Quantitative RT-PCR analysis of FTH and FTL in HCT116 and SW620 with CYGB-overexpression

Journal: Molecular and Cellular Biochemistry

Article Title: Cytoglobin augments ferroptosis through autophagic degradation of ferritin in colorectal cancer cells

doi: 10.1007/s11010-024-05148-0

Figure Lengend Snippet: CYGB activated autophagy during ferroptosis induction. ( A ) Co-localization of CYGB and LAMP-1 in HCT116 cells. Immunofluorescence staining of CYGB and LAMP-1 was performed, and Pearson’s colocalization efficiency analysis of CYGB and LAMP-1 was indicated. ( B ) Representative images of lysosomes by LysoTracker™ staining in HCT116 with CYGB. Image J was used to analyze pictures and calculate the mean fluorescence intensity. ( C ) Morphological changes after CYGB-overexpression based on transmission electron microscopy examination in HCT116 cells. The black arrow indicates autophagic lysosomes. ( D ) The evaluation of cell viability after treatment of RSL3 on 1, 5 µM and Erastin 10, 20 µM on with bafilomycin A1 (100 nM) or the ferroptosis inhibitor ferrostatin-1 (10 µM) for 24 h. The evaluation of cell viability after combined treatment of RSL3 (2 µM) and Erastin (20 µM) and autophagy inducer rapamycin (1 µM) with bafilomycin A1 (100 µM) for 24 h. RAP, rapamycin; BAF, bafilomycin A1; CQ, chloroquine; Ferr-1, ferrostasin-1 in HCT116 ( E ) and SW620 cells ( F ). ( G ) Western blotting analysis of ACSL4, PCBP1, FTH, FTL and NCOA4 in HCT116 and SW620 with CYGB-overexpression. ( H ) Quantitative RT-PCR analysis of FTH and FTL in HCT116 and SW620 with CYGB-overexpression

Article Snippet: The supernatant was collected for western blotting with CYGB (1:1000 dilution, 60228; Proteintech) and TFR (1:1000 dilution, #13113; Cell Signaling).

Techniques: Immunofluorescence, Staining, Fluorescence, Over Expression, Transmission Assay, Electron Microscopy, Western Blot, Quantitative RT-PCR

CYGB combined TFR to regulate ferroptosis. ( A ) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. ( B ) The immunoprecipitation and immunoblotting were performed using FLAG-CYGB and TFR antibodies in HCT116. ( C ) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining

Journal: Molecular and Cellular Biochemistry

Article Title: Cytoglobin augments ferroptosis through autophagic degradation of ferritin in colorectal cancer cells

doi: 10.1007/s11010-024-05148-0

Figure Lengend Snippet: CYGB combined TFR to regulate ferroptosis. ( A ) Western blotting analysis of FLAG-CYGB-overexpression in HCT116 and SW620. ( B ) The immunoprecipitation and immunoblotting were performed using FLAG-CYGB and TFR antibodies in HCT116. ( C ) Co-localization of TFR and FLAG-CYGB in HCT116 cells based on immunofluorescence staining

Article Snippet: The supernatant was collected for western blotting with CYGB (1:1000 dilution, 60228; Proteintech) and TFR (1:1000 dilution, #13113; Cell Signaling).

Techniques: Western Blot, Over Expression, Immunoprecipitation, Immunofluorescence, Staining