cyclin d1  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Name:
    Cyclin D1 Antibody 17H3L3
    Description:
    Cyclin D1 Monoclonal Antibody for Western Blot IF ICC Flow
    Catalog Number:
    701421
    Price:
    None
    Category:
    Antibodies Secondary Detection Reagents
    Applications:
    Cell Analysis|Cellular Imaging|ELISAs for Cell Biology & Signal Transduction|Flow Cytometry Antibodies & Secondary Detection|Immunofluorescence (IF)|Immunofluorescence Staining & Detection|Protein Assays and Analysis|Protein Biology|Western Blot Detection|Western Blotting|Flow Cytometry
    Buy from Supplier


    Structured Review

    Thermo Fisher cyclin d1
    ). (B) Sequences in CR2 are required for transcriptional activation. MCF-7 cells were cotransfected with a reporter construct ( HSP70-2 ) and plasmids encoding LAP1, LAP2, LIP, C/EBPβΔSpl (βSpl), derivatives of C/EBPβΔSpl lacking residues 24 to 40 [βSpl(Δ24-40)] or residues 1 to 23 [βSpl(Δ1-23)], or empty vector. Normalized promoter activity was determined 24 h later, and the fold increases in promoter activity relative to empty vector were calculated. The results are means ± the SD from three independent experiments. (C) Sequences in CR2 are involved in binding to <t>cyclin</t> D1. MCF-7 cells were cotransfected with plasmids encoding LAP1, LAP2, LIP, C/EBPβΔSpl (βSpl), derivatives of C/EBPβΔSpl [βSpl(Δ24-40) and βSpl(Δ1-23)], or empty vector, together with a plasmid encoding HA-tagged <t>cyclin</t> D1 (D1-HA) or empty vector. After 24 h, whole-cell lysates were prepared, and complex formation was assessed by IP with antibody to C/EBPβ, followed by IB with anti-HA antibody. The relative amounts of the C/EBPβ isoforms, C/EBPβΔSpl and its derivatives, and cyclin D1-HA in whole-cell lysates were assessed with the same antibodies. Densitometric analysis of immunoblots normalized to the anti-HA blot revealed that βSpl recovered 1.84 times more cyclin D1 than βSpl(Δ1-23). The results are representative of at least five independent experiments. (D) CR2 is sufficient for binding cyclin D1. MCF-7 cells were cotransfected with plasmids directing the expression of Gal4 fused to aa 1 to 40 [(1-40)-Gal4], 1 to 23 [(1-23)-Gal4], or 24 to 40 [(24-40)-Gal4] of LAP1, Gal4 alone, or empty vector together with a plasmid encoding HA-tagged cyclin D1 (D1-HA). After 24 h, whole-cell lysates were prepared, and complex formation was assessed by IP with antibody to Gal4 or HA, followed by IB with antibody to HA or Gal4, respectively. The relative amounts of the Gal4 fusions and cyclin D1-HA in whole-cell lysates were assessed by IP, followed by IB with antibody to Gal4 or the HA epitope. Densitometric analysis of immunoblots normalized to the anti-HA blot revealed that (1-40)-Gal4 recovered 2.45 times more cyclin D1 than (24-40)-Gal4. The results are representative of at least three independent experiments. (E) CR2 engages in intramolecular interactions within LAP1. MCF-7 cells were cotransfected with plasmids encoding LAP1, deletion mutants of LAP1 lacking aa 132 to 146, 154 to 192, or 199 to 242 designated LAP1ΔCR5, LAP1ΔCR6, and LAP1ΔCR7, respectively, together with Myc-tagged EGFP fused to aa 24 to 40 of LAP1 [EGFP-(24-40)] or EGFP alone. After 24 h, whole-cell lysates were prepared, and complex formation was assessed by IP with antibody to C/EBPβ, followed by IB with antibody to the Myc tag. The relative amounts of LAP1 and its deletion mutants or the EGFP fusion in whole-cell lysates were assessed with the same antibodies. The results are representative of at least three independent experiments. (F) CR2 binds CR7 and cyclin D1 disrupts this interaction. MCF-7 cells were cotransfected with plasmids directing the expression of Myc-tagged EGFP fused to aa 24 to 40 [EGFP-(24-40)], together with plasmids directing the expression of Gal4 fused with aa 132 to 153, 154 to 198, or 199 to 242 designated CR5-Gal4, CR6-Gal4, and CR7-Gal4, respectively, or Gal4 or CR7-Gal4 plus cyclin D1-HA (D1-HA). After 24 h, whole-cell lysates were prepared, and complex formation was assessed by IP with antibody to Gal4, followed by IB with antibody to the Myc tag. The relative amounts of the EGFP and Gal4 fusions in whole-cell lysates were assessed with the same antibodies, and the expression of cyclin D1-HA was assessed with antibody to the HA epitope. The results are representative of at least three independent experiments. (G) Potential intramolecular interactions within C/EBPβΔSpl cannot take place. Same analyses as in panel F, except that CR7-Gal4 and a derivative missing the first 6 aa of CR7 [CR7(Δ200-205)-Gal4] were analyzed.
    Cyclin D1 Monoclonal Antibody for Western Blot IF ICC Flow
    https://www.bioz.com/result/cyclin d1/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cyclin d1 - by Bioz Stars, 2021-05
    86/100 stars

    Images

    1) Product Images from "Cyclin D1 and C/EBPβ LAP1 Operate in a Common Pathway To Promote Mammary Epithelial Cell Differentiation"

    Article Title: Cyclin D1 and C/EBPβ LAP1 Operate in a Common Pathway To Promote Mammary Epithelial Cell Differentiation

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.00039-14

    ). (B) Sequences in CR2 are required for transcriptional activation. MCF-7 cells were cotransfected with a reporter construct ( HSP70-2 ) and plasmids encoding LAP1, LAP2, LIP, C/EBPβΔSpl (βSpl), derivatives of C/EBPβΔSpl lacking residues 24 to 40 [βSpl(Δ24-40)] or residues 1 to 23 [βSpl(Δ1-23)], or empty vector. Normalized promoter activity was determined 24 h later, and the fold increases in promoter activity relative to empty vector were calculated. The results are means ± the SD from three independent experiments. (C) Sequences in CR2 are involved in binding to cyclin D1. MCF-7 cells were cotransfected with plasmids encoding LAP1, LAP2, LIP, C/EBPβΔSpl (βSpl), derivatives of C/EBPβΔSpl [βSpl(Δ24-40) and βSpl(Δ1-23)], or empty vector, together with a plasmid encoding HA-tagged cyclin D1 (D1-HA) or empty vector. After 24 h, whole-cell lysates were prepared, and complex formation was assessed by IP with antibody to C/EBPβ, followed by IB with anti-HA antibody. The relative amounts of the C/EBPβ isoforms, C/EBPβΔSpl and its derivatives, and cyclin D1-HA in whole-cell lysates were assessed with the same antibodies. Densitometric analysis of immunoblots normalized to the anti-HA blot revealed that βSpl recovered 1.84 times more cyclin D1 than βSpl(Δ1-23). The results are representative of at least five independent experiments. (D) CR2 is sufficient for binding cyclin D1. MCF-7 cells were cotransfected with plasmids directing the expression of Gal4 fused to aa 1 to 40 [(1-40)-Gal4], 1 to 23 [(1-23)-Gal4], or 24 to 40 [(24-40)-Gal4] of LAP1, Gal4 alone, or empty vector together with a plasmid encoding HA-tagged cyclin D1 (D1-HA). After 24 h, whole-cell lysates were prepared, and complex formation was assessed by IP with antibody to Gal4 or HA, followed by IB with antibody to HA or Gal4, respectively. The relative amounts of the Gal4 fusions and cyclin D1-HA in whole-cell lysates were assessed by IP, followed by IB with antibody to Gal4 or the HA epitope. Densitometric analysis of immunoblots normalized to the anti-HA blot revealed that (1-40)-Gal4 recovered 2.45 times more cyclin D1 than (24-40)-Gal4. The results are representative of at least three independent experiments. (E) CR2 engages in intramolecular interactions within LAP1. MCF-7 cells were cotransfected with plasmids encoding LAP1, deletion mutants of LAP1 lacking aa 132 to 146, 154 to 192, or 199 to 242 designated LAP1ΔCR5, LAP1ΔCR6, and LAP1ΔCR7, respectively, together with Myc-tagged EGFP fused to aa 24 to 40 of LAP1 [EGFP-(24-40)] or EGFP alone. After 24 h, whole-cell lysates were prepared, and complex formation was assessed by IP with antibody to C/EBPβ, followed by IB with antibody to the Myc tag. The relative amounts of LAP1 and its deletion mutants or the EGFP fusion in whole-cell lysates were assessed with the same antibodies. The results are representative of at least three independent experiments. (F) CR2 binds CR7 and cyclin D1 disrupts this interaction. MCF-7 cells were cotransfected with plasmids directing the expression of Myc-tagged EGFP fused to aa 24 to 40 [EGFP-(24-40)], together with plasmids directing the expression of Gal4 fused with aa 132 to 153, 154 to 198, or 199 to 242 designated CR5-Gal4, CR6-Gal4, and CR7-Gal4, respectively, or Gal4 or CR7-Gal4 plus cyclin D1-HA (D1-HA). After 24 h, whole-cell lysates were prepared, and complex formation was assessed by IP with antibody to Gal4, followed by IB with antibody to the Myc tag. The relative amounts of the EGFP and Gal4 fusions in whole-cell lysates were assessed with the same antibodies, and the expression of cyclin D1-HA was assessed with antibody to the HA epitope. The results are representative of at least three independent experiments. (G) Potential intramolecular interactions within C/EBPβΔSpl cannot take place. Same analyses as in panel F, except that CR7-Gal4 and a derivative missing the first 6 aa of CR7 [CR7(Δ200-205)-Gal4] were analyzed.
    Figure Legend Snippet: ). (B) Sequences in CR2 are required for transcriptional activation. MCF-7 cells were cotransfected with a reporter construct ( HSP70-2 ) and plasmids encoding LAP1, LAP2, LIP, C/EBPβΔSpl (βSpl), derivatives of C/EBPβΔSpl lacking residues 24 to 40 [βSpl(Δ24-40)] or residues 1 to 23 [βSpl(Δ1-23)], or empty vector. Normalized promoter activity was determined 24 h later, and the fold increases in promoter activity relative to empty vector were calculated. The results are means ± the SD from three independent experiments. (C) Sequences in CR2 are involved in binding to cyclin D1. MCF-7 cells were cotransfected with plasmids encoding LAP1, LAP2, LIP, C/EBPβΔSpl (βSpl), derivatives of C/EBPβΔSpl [βSpl(Δ24-40) and βSpl(Δ1-23)], or empty vector, together with a plasmid encoding HA-tagged cyclin D1 (D1-HA) or empty vector. After 24 h, whole-cell lysates were prepared, and complex formation was assessed by IP with antibody to C/EBPβ, followed by IB with anti-HA antibody. The relative amounts of the C/EBPβ isoforms, C/EBPβΔSpl and its derivatives, and cyclin D1-HA in whole-cell lysates were assessed with the same antibodies. Densitometric analysis of immunoblots normalized to the anti-HA blot revealed that βSpl recovered 1.84 times more cyclin D1 than βSpl(Δ1-23). The results are representative of at least five independent experiments. (D) CR2 is sufficient for binding cyclin D1. MCF-7 cells were cotransfected with plasmids directing the expression of Gal4 fused to aa 1 to 40 [(1-40)-Gal4], 1 to 23 [(1-23)-Gal4], or 24 to 40 [(24-40)-Gal4] of LAP1, Gal4 alone, or empty vector together with a plasmid encoding HA-tagged cyclin D1 (D1-HA). After 24 h, whole-cell lysates were prepared, and complex formation was assessed by IP with antibody to Gal4 or HA, followed by IB with antibody to HA or Gal4, respectively. The relative amounts of the Gal4 fusions and cyclin D1-HA in whole-cell lysates were assessed by IP, followed by IB with antibody to Gal4 or the HA epitope. Densitometric analysis of immunoblots normalized to the anti-HA blot revealed that (1-40)-Gal4 recovered 2.45 times more cyclin D1 than (24-40)-Gal4. The results are representative of at least three independent experiments. (E) CR2 engages in intramolecular interactions within LAP1. MCF-7 cells were cotransfected with plasmids encoding LAP1, deletion mutants of LAP1 lacking aa 132 to 146, 154 to 192, or 199 to 242 designated LAP1ΔCR5, LAP1ΔCR6, and LAP1ΔCR7, respectively, together with Myc-tagged EGFP fused to aa 24 to 40 of LAP1 [EGFP-(24-40)] or EGFP alone. After 24 h, whole-cell lysates were prepared, and complex formation was assessed by IP with antibody to C/EBPβ, followed by IB with antibody to the Myc tag. The relative amounts of LAP1 and its deletion mutants or the EGFP fusion in whole-cell lysates were assessed with the same antibodies. The results are representative of at least three independent experiments. (F) CR2 binds CR7 and cyclin D1 disrupts this interaction. MCF-7 cells were cotransfected with plasmids directing the expression of Myc-tagged EGFP fused to aa 24 to 40 [EGFP-(24-40)], together with plasmids directing the expression of Gal4 fused with aa 132 to 153, 154 to 198, or 199 to 242 designated CR5-Gal4, CR6-Gal4, and CR7-Gal4, respectively, or Gal4 or CR7-Gal4 plus cyclin D1-HA (D1-HA). After 24 h, whole-cell lysates were prepared, and complex formation was assessed by IP with antibody to Gal4, followed by IB with antibody to the Myc tag. The relative amounts of the EGFP and Gal4 fusions in whole-cell lysates were assessed with the same antibodies, and the expression of cyclin D1-HA was assessed with antibody to the HA epitope. The results are representative of at least three independent experiments. (G) Potential intramolecular interactions within C/EBPβΔSpl cannot take place. Same analyses as in panel F, except that CR7-Gal4 and a derivative missing the first 6 aa of CR7 [CR7(Δ200-205)-Gal4] were analyzed.

    Techniques Used: Activation Assay, Construct, Plasmid Preparation, Activity Assay, Binding Assay, Western Blot, Expressing

    Constitutively active mutant of LAP1. (A) Two acidic amino acids in CR2 are required for transcriptional induction by C/EBPβΔSpl. Alanine scanning mutagenesis was performed on aa 24 to 40 in the context of C/EBPβΔSpl. MCF-7 cells were cotransfected with a reporter construct ( HSP70-2 ) and plasmids directing the expression of C/EBPβΔSpl (βSpl), its mutant derivatives (alanine substitution is indicated), or empty vector. Normalized promoter activity was determined 24 h later, and the fold increases in promoter activity relative to empty vector were calculated. The results are means ± the SD from three independent experiments. (B) Two amino acids in CR2 are necessary for its interaction with CR7. MCF-7 cells were cotransfected with plasmids directing the expression of Gal4 fused to amino acids 199 to 242 of LAP1 (CR7-Gal4), together with plasmids directing the expression of Myc-tagged EGFP alone or fused to aa 24 to 40 of LAP1 [EGFP-(24-40)] or derivatives of EGFP-(24-40) bearing alanine substitutions at residues E32, D34, or both designated EGFP-(24-40;32A), EGFP-(24-40;34A), and EGFP-(24-40;32A,34A). After 24 h, whole-cell lysates were prepared, and complex formation was assessed by IP with antibody to Gal4, followed by IB with antibody to the Myc epitope tag. The relative amounts of the EGFP and Gal4 fusions in whole-cell lysates were assessed with the same antibodies. The results are representative of three independent experiments. (C) Model depicting the functional interaction between cyclin D1 and LAP1, and the action of a constitutively active mutant of LAP1. In the inactive state for LAP1, CR7 binding to CR2 masks E32 and D34 in CR2; the presence of either of these acidic amino acids is required for the interaction between CR2 and CR7. Cyclin D1 binding to CR2 in LAP1 disrupts the intramolecular interaction between CR2 and CR7. This event exposes E32 and D34, permitting them to participate in the interaction with a putative transcriptional coactivator (purple, left). In the constitutively active mutant of LAP1 (C/EBPβΔSpl), the intramolecular interaction between CR2 and CR7 do not take place. Consequently, E32 and D34 are constitutively exposed, and the presence of both E32 and D34 allows CR2 to interact with a putative transcriptional coactivator (right). (D) Alanine substitution at amino acids E32 and D34 in LAP1 relieves the autoinhibited state and enhances its interaction with cyclin D1. MCF-7 cells were cotransfected with plasmids encoding LAP1, a derivative of LAP1 bearing alanine substitutions as amino acids E32 and D34 [LAP1(32A,34A)], or empty vector together with a plasmid encoding HA-tagged cyclin D1 (D1-HA). After 24 h, whole-cell lysates were prepared, and complex formation was assessed by IP with antibody to C/EBPβ, followed by IB with anti-HA antibody. The relative amounts of LAP1, its mutant derivative, and cyclin D1 in whole-cell lysates were assessed with the same antibodies. The results are representative of three independent experiments. (E) C/EBPβΔSpl represents a constitutively active mutant of LAP1 that does not require cyclin D1 to effect transcription. C33A cells were infected with viruses directing the expression of one of two shRNA to cyclin D1 (shD1-1 and shD1-2) or an irrelevant shRNA (shCtrl). Subsequently, the cells were cotransfected with a reporter construct ( HSP70-2 ), together with plasmids encoding cyclin D1-HA, C/EBPβΔSpl (βSpl), or empty vector. Normalized promoter activity was determined 24 h later, and the fold increases in promoter activity relative to empty vector were calculated. The results are means ± the SD from three independent experiments. The relative amounts of C/EBPβΔSpl and cyclin D1 under conditions where cyclin D1 was knocked down, as well as α-tubulin as a loading control, were assessed by IB (inset).
    Figure Legend Snippet: Constitutively active mutant of LAP1. (A) Two acidic amino acids in CR2 are required for transcriptional induction by C/EBPβΔSpl. Alanine scanning mutagenesis was performed on aa 24 to 40 in the context of C/EBPβΔSpl. MCF-7 cells were cotransfected with a reporter construct ( HSP70-2 ) and plasmids directing the expression of C/EBPβΔSpl (βSpl), its mutant derivatives (alanine substitution is indicated), or empty vector. Normalized promoter activity was determined 24 h later, and the fold increases in promoter activity relative to empty vector were calculated. The results are means ± the SD from three independent experiments. (B) Two amino acids in CR2 are necessary for its interaction with CR7. MCF-7 cells were cotransfected with plasmids directing the expression of Gal4 fused to amino acids 199 to 242 of LAP1 (CR7-Gal4), together with plasmids directing the expression of Myc-tagged EGFP alone or fused to aa 24 to 40 of LAP1 [EGFP-(24-40)] or derivatives of EGFP-(24-40) bearing alanine substitutions at residues E32, D34, or both designated EGFP-(24-40;32A), EGFP-(24-40;34A), and EGFP-(24-40;32A,34A). After 24 h, whole-cell lysates were prepared, and complex formation was assessed by IP with antibody to Gal4, followed by IB with antibody to the Myc epitope tag. The relative amounts of the EGFP and Gal4 fusions in whole-cell lysates were assessed with the same antibodies. The results are representative of three independent experiments. (C) Model depicting the functional interaction between cyclin D1 and LAP1, and the action of a constitutively active mutant of LAP1. In the inactive state for LAP1, CR7 binding to CR2 masks E32 and D34 in CR2; the presence of either of these acidic amino acids is required for the interaction between CR2 and CR7. Cyclin D1 binding to CR2 in LAP1 disrupts the intramolecular interaction between CR2 and CR7. This event exposes E32 and D34, permitting them to participate in the interaction with a putative transcriptional coactivator (purple, left). In the constitutively active mutant of LAP1 (C/EBPβΔSpl), the intramolecular interaction between CR2 and CR7 do not take place. Consequently, E32 and D34 are constitutively exposed, and the presence of both E32 and D34 allows CR2 to interact with a putative transcriptional coactivator (right). (D) Alanine substitution at amino acids E32 and D34 in LAP1 relieves the autoinhibited state and enhances its interaction with cyclin D1. MCF-7 cells were cotransfected with plasmids encoding LAP1, a derivative of LAP1 bearing alanine substitutions as amino acids E32 and D34 [LAP1(32A,34A)], or empty vector together with a plasmid encoding HA-tagged cyclin D1 (D1-HA). After 24 h, whole-cell lysates were prepared, and complex formation was assessed by IP with antibody to C/EBPβ, followed by IB with anti-HA antibody. The relative amounts of LAP1, its mutant derivative, and cyclin D1 in whole-cell lysates were assessed with the same antibodies. The results are representative of three independent experiments. (E) C/EBPβΔSpl represents a constitutively active mutant of LAP1 that does not require cyclin D1 to effect transcription. C33A cells were infected with viruses directing the expression of one of two shRNA to cyclin D1 (shD1-1 and shD1-2) or an irrelevant shRNA (shCtrl). Subsequently, the cells were cotransfected with a reporter construct ( HSP70-2 ), together with plasmids encoding cyclin D1-HA, C/EBPβΔSpl (βSpl), or empty vector. Normalized promoter activity was determined 24 h later, and the fold increases in promoter activity relative to empty vector were calculated. The results are means ± the SD from three independent experiments. The relative amounts of C/EBPβΔSpl and cyclin D1 under conditions where cyclin D1 was knocked down, as well as α-tubulin as a loading control, were assessed by IB (inset).

    Techniques Used: Mutagenesis, Construct, Expressing, Plasmid Preparation, Activity Assay, Functional Assay, Binding Assay, Infection, shRNA

    C/EBPβ isoform-specific contribution to mammary epithelial cell differentiation. (A) LAP1, but not LAP2 or LIP, rescues differentiation of C/EBP β −/− MECs in a cyclin D1-dependent manner. C/EBP β −/− MECs were infected with retroviruses directing the expression of LAP1, LAP2, LIP, or empty vector. LAP1s, a derivative of LAP1, from which only LAP1 can be synthesized was also included. Also included was LAP1 plus one of two shRNAs to cyclin D1 (shD1-3 and shD1-4) or an irrelevant shRNA (shCtrl). Infected cells were plated on an extracellular matrix (Matrigel) in the absence or presence of lactogenic hormones (insulin, prolactin, and hydrocortisone) and allowed to differentiate for 6 days. mRNA levels for β- casein normalized to GAPDH mRNA were determined by quantitative RT-PCR. The results are means ± the SD from three independent experiments. (B) Same analyses as in panel A, except whey acid protein (WAP) was analyzed. (C) For the experiments shown in panels A and B, the expression of the C/EBPβ isoforms, LAP1s, and degree of knockdown of cyclin D1 were assessed by IB using antibodies to C/EBPβ and cyclin D1. α-Tubulin was used as a loading control.
    Figure Legend Snippet: C/EBPβ isoform-specific contribution to mammary epithelial cell differentiation. (A) LAP1, but not LAP2 or LIP, rescues differentiation of C/EBP β −/− MECs in a cyclin D1-dependent manner. C/EBP β −/− MECs were infected with retroviruses directing the expression of LAP1, LAP2, LIP, or empty vector. LAP1s, a derivative of LAP1, from which only LAP1 can be synthesized was also included. Also included was LAP1 plus one of two shRNAs to cyclin D1 (shD1-3 and shD1-4) or an irrelevant shRNA (shCtrl). Infected cells were plated on an extracellular matrix (Matrigel) in the absence or presence of lactogenic hormones (insulin, prolactin, and hydrocortisone) and allowed to differentiate for 6 days. mRNA levels for β- casein normalized to GAPDH mRNA were determined by quantitative RT-PCR. The results are means ± the SD from three independent experiments. (B) Same analyses as in panel A, except whey acid protein (WAP) was analyzed. (C) For the experiments shown in panels A and B, the expression of the C/EBPβ isoforms, LAP1s, and degree of knockdown of cyclin D1 were assessed by IB using antibodies to C/EBPβ and cyclin D1. α-Tubulin was used as a loading control.

    Techniques Used: Cell Differentiation, Infection, Expressing, Plasmid Preparation, Synthesized, shRNA, Quantitative RT-PCR

    Dominant-negative mutant of LAP1. (A) C/EBPβΔSpl(32A,34A) blocks cyclin D1-mediated activation of LAP1. MCF-7 cells were cotransfected with a reporter construct ( HSP70-2 ), together with empty vector, C/EBPβΔSpl(32A,34A), HA-tagged cyclin D1 (D1-HA), or both cyclin D1-HA and C/EBPβΔSpl(32A,34A). Normalized promoter activity was determined 24 h later, and the fold increases in promoter activity relative to empty vector were calculated. The results are means ± the SD from three independent experiments. (B) The mutation of amino acids E32 and D34 in C/EBPβΔSpl does not influence its ability to interact with cyclin D1. MCF-7 cells were cotransfected with plasmids encoding cyclin D1-HA, together with empty vector or plasmids directing the expression of C/EBPβΔSpl (βSpl) or derivative bearing alanine substitutions at residues E32, D34, or both designated βSpl(32A), βSpl(34A), and βSpl(32A,34A). After 24 h, whole-cell lysates were prepared, and complex formation was assessed by IP with antibody to C/EBPβ, followed by IB with anti-HA antibody. The relative amounts of C/EBPβΔSpl, its derivatives, and cyclin D1-HA in whole-cell lysates were assessed with the same antibodies. The results are representative of at least three independent experiments.
    Figure Legend Snippet: Dominant-negative mutant of LAP1. (A) C/EBPβΔSpl(32A,34A) blocks cyclin D1-mediated activation of LAP1. MCF-7 cells were cotransfected with a reporter construct ( HSP70-2 ), together with empty vector, C/EBPβΔSpl(32A,34A), HA-tagged cyclin D1 (D1-HA), or both cyclin D1-HA and C/EBPβΔSpl(32A,34A). Normalized promoter activity was determined 24 h later, and the fold increases in promoter activity relative to empty vector were calculated. The results are means ± the SD from three independent experiments. (B) The mutation of amino acids E32 and D34 in C/EBPβΔSpl does not influence its ability to interact with cyclin D1. MCF-7 cells were cotransfected with plasmids encoding cyclin D1-HA, together with empty vector or plasmids directing the expression of C/EBPβΔSpl (βSpl) or derivative bearing alanine substitutions at residues E32, D34, or both designated βSpl(32A), βSpl(34A), and βSpl(32A,34A). After 24 h, whole-cell lysates were prepared, and complex formation was assessed by IP with antibody to C/EBPβ, followed by IB with anti-HA antibody. The relative amounts of C/EBPβΔSpl, its derivatives, and cyclin D1-HA in whole-cell lysates were assessed with the same antibodies. The results are representative of at least three independent experiments.

    Techniques Used: Dominant Negative Mutation, Activation Assay, Construct, Plasmid Preparation, Activity Assay, Mutagenesis, Expressing

    Cyclin D1 engages C/EBPβ in an isoform-specific manner. (A) Cyclin D1 interacts with LAP1 but not LAP2 or LIP. C/EBP β −/− MECs were cotransfected with plasmids encoding the three C/EBPβ isoforms, HA-tagged cyclin D1 (D1-HA), or empty vector as indicated. After 24 h, whole-cell lysates were prepared, and complex formation was assessed by immunoprecipitation (IP) with antibody directed against C/EBPβ, followed by immunoblotting (IB) with anti-HA antibody. The relative amounts of cyclin D1-HA, LAP1, LAP2, and LIP in whole-cell lysates were assessed by IB with the same antibodies (left). That the C/EBPβ antibody can immunoprecipitate the three C/EBPβ isoforms with equal efficiency is also shown (right). The results are representative of at least five independent experiments. (B) Endogenous cyclin D1 and C/EBPβ interact. Whole-cell lysates were prepared from MCF-7 cells as described in Materials and Methods, and complex formation was assessed by IP with antibody directed against C/EBPβ, followed by IB with anti-cyclin D1 antibody. The levels of cyclin D1, LAP1, LAP2, and LIP in whole-cell lysates as input are also shown. The results are representative of five independent experiments. (C) Cyclin D1 is recruited to a cyclin D1-responsive promoter in a LAP1-dependent manner. C/EBP β −/− MECs were infected with retroviruses directing the expression of LAP1, LAP2, LIP, or empty vector. Subsequently, cells were subjected to ChIP with antibody to C/EBPβ, cyclin D1, or IgG as a control. For the precipitated DNA, sequences spanning the cyclin D1 response element (C/EBPβ site) in the promoter of Hsc70 and 4 kb downstream of this element were analyzed by PCR; one-tenth of the lysate used for ChIP was also subjected to PCR (Input). The results are representative of at least four independent experiments. (D) Cyclin D1 effects transcriptional induction in a LAP1-dependent manner. MCF-7 cells were cotransfected with a wild-type (top left) or mutant (top right) HSP70-2 promoter-reporter construct and plasmids directing the expression of LAP1, LAP2, LIP, or empty vector (lanes 1 to 4), increasing amounts of cyclin D1-HA (indicated; lanes 5 to 8), or a saturating amount of cyclin D1-HA, together with LAP1, LAP2, or LIP (lanes 9 to 11). Normalized promoter activity was determined 24 h later, and the fold increases in promoter activity relative to empty vector were calculated. The results are means ± the standard deviations (SD) from three independent experiments. Also shown are the relative levels of endogenous and exogenous cyclin D1 and C/EBPβ under the conditions described above (bottom).
    Figure Legend Snippet: Cyclin D1 engages C/EBPβ in an isoform-specific manner. (A) Cyclin D1 interacts with LAP1 but not LAP2 or LIP. C/EBP β −/− MECs were cotransfected with plasmids encoding the three C/EBPβ isoforms, HA-tagged cyclin D1 (D1-HA), or empty vector as indicated. After 24 h, whole-cell lysates were prepared, and complex formation was assessed by immunoprecipitation (IP) with antibody directed against C/EBPβ, followed by immunoblotting (IB) with anti-HA antibody. The relative amounts of cyclin D1-HA, LAP1, LAP2, and LIP in whole-cell lysates were assessed by IB with the same antibodies (left). That the C/EBPβ antibody can immunoprecipitate the three C/EBPβ isoforms with equal efficiency is also shown (right). The results are representative of at least five independent experiments. (B) Endogenous cyclin D1 and C/EBPβ interact. Whole-cell lysates were prepared from MCF-7 cells as described in Materials and Methods, and complex formation was assessed by IP with antibody directed against C/EBPβ, followed by IB with anti-cyclin D1 antibody. The levels of cyclin D1, LAP1, LAP2, and LIP in whole-cell lysates as input are also shown. The results are representative of five independent experiments. (C) Cyclin D1 is recruited to a cyclin D1-responsive promoter in a LAP1-dependent manner. C/EBP β −/− MECs were infected with retroviruses directing the expression of LAP1, LAP2, LIP, or empty vector. Subsequently, cells were subjected to ChIP with antibody to C/EBPβ, cyclin D1, or IgG as a control. For the precipitated DNA, sequences spanning the cyclin D1 response element (C/EBPβ site) in the promoter of Hsc70 and 4 kb downstream of this element were analyzed by PCR; one-tenth of the lysate used for ChIP was also subjected to PCR (Input). The results are representative of at least four independent experiments. (D) Cyclin D1 effects transcriptional induction in a LAP1-dependent manner. MCF-7 cells were cotransfected with a wild-type (top left) or mutant (top right) HSP70-2 promoter-reporter construct and plasmids directing the expression of LAP1, LAP2, LIP, or empty vector (lanes 1 to 4), increasing amounts of cyclin D1-HA (indicated; lanes 5 to 8), or a saturating amount of cyclin D1-HA, together with LAP1, LAP2, or LIP (lanes 9 to 11). Normalized promoter activity was determined 24 h later, and the fold increases in promoter activity relative to empty vector were calculated. The results are means ± the standard deviations (SD) from three independent experiments. Also shown are the relative levels of endogenous and exogenous cyclin D1 and C/EBPβ under the conditions described above (bottom).

    Techniques Used: Plasmid Preparation, Immunoprecipitation, Infection, Expressing, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Mutagenesis, Construct, Activity Assay

    2) Product Images from "Expression of Human Papillomavirus-Related Proteins and Its Clinical Implication in Tonsillar Squamous Cell Carcinoma"

    Article Title: Expression of Human Papillomavirus-Related Proteins and Its Clinical Implication in Tonsillar Squamous Cell Carcinoma

    Journal: Korean Journal of Pathology

    doi: 10.4132/KoreanJPathol.2012.46.2.177

    Survival curves obtained using the Kaplan-Meier method by the log-rank test. (A, C) Disease free survival for cyclin D1 and Bcl-2. (B, D) Overall survival for cyclin D1 and Bcl-2.
    Figure Legend Snippet: Survival curves obtained using the Kaplan-Meier method by the log-rank test. (A, C) Disease free survival for cyclin D1 and Bcl-2. (B, D) Overall survival for cyclin D1 and Bcl-2.

    Techniques Used:

    Representative photomicrographs of an tonsillar squamous cell carcinoma stained with antibodies against (A) p16, (B) cyclin D1, (C) Bcl-2, and (D) human papillomavirus (HPV) in situ hybridization. All of staining results are interpreted as positive.
    Figure Legend Snippet: Representative photomicrographs of an tonsillar squamous cell carcinoma stained with antibodies against (A) p16, (B) cyclin D1, (C) Bcl-2, and (D) human papillomavirus (HPV) in situ hybridization. All of staining results are interpreted as positive.

    Techniques Used: Staining, In Situ Hybridization

    3) Product Images from "MicroRNA-941 regulates the proliferation of breast cancer cells by altering histone H3 Ser 10 phosphorylation"

    Article Title: MicroRNA-941 regulates the proliferation of breast cancer cells by altering histone H3 Ser 10 phosphorylation

    Journal: Scientific Reports

    doi: 10.1038/s41598-020-74847-7

    Inhibition of microRNA-941 decreased the proliferation of MDA-MB-231 cells. ( A ) Quantitative real-time PCR of hsa-miR-941 after transfected with MiR-941 inhibitor for 24 h in MDA-MB-231 cells. ( B ) MTT assay of MiR-941 inhibitor on the proliferation of MDA-MB-231 cells. ( C ) Western blots and densitometric analysis of p21 and Cyclin D1 in MiR-941 inhibitor transfected MDA-MB-231 cells for 24 h. Three independent experiments were performed for each cell type. All values expressed as mean ± S.E.M. $ p
    Figure Legend Snippet: Inhibition of microRNA-941 decreased the proliferation of MDA-MB-231 cells. ( A ) Quantitative real-time PCR of hsa-miR-941 after transfected with MiR-941 inhibitor for 24 h in MDA-MB-231 cells. ( B ) MTT assay of MiR-941 inhibitor on the proliferation of MDA-MB-231 cells. ( C ) Western blots and densitometric analysis of p21 and Cyclin D1 in MiR-941 inhibitor transfected MDA-MB-231 cells for 24 h. Three independent experiments were performed for each cell type. All values expressed as mean ± S.E.M. $ p

    Techniques Used: Inhibition, Multiple Displacement Amplification, Real-time Polymerase Chain Reaction, Transfection, MTT Assay, Western Blot

    4) Product Images from "14-3-3? Plays a Role in Cardiac Ventricular Compaction by Regulating the Cardiomyocyte Cell Cycle"

    Article Title: 14-3-3? Plays a Role in Cardiac Ventricular Compaction by Regulating the Cardiomyocyte Cell Cycle

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.00829-12

    Deletion of 14-3-3ε downregulates cyclin E1 while upregulating cyclin D1 and p27 Kip1 through transcriptional and possibly posttranscriptional mechanisms. (a to i) Western blot analyses were performed on E18.5 hearts. (a) Significant upregulation
    Figure Legend Snippet: Deletion of 14-3-3ε downregulates cyclin E1 while upregulating cyclin D1 and p27 Kip1 through transcriptional and possibly posttranscriptional mechanisms. (a to i) Western blot analyses were performed on E18.5 hearts. (a) Significant upregulation

    Techniques Used: Western Blot

    5) Product Images from "Inhibiting Cycloxygenase and Ornithine Decarboxylase by Diclofenac and Alpha-Difluoromethylornithine Blocks Cutaneous SCCs by Targeting Akt-ERK Axis"

    Article Title: Inhibiting Cycloxygenase and Ornithine Decarboxylase by Diclofenac and Alpha-Difluoromethylornithine Blocks Cutaneous SCCs by Targeting Akt-ERK Axis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0080076

    Akt over-expression resists the effect of DFMO+diclofenac. Treatment of myr-flag-Akt overexpressing cells with DFMO and diclofenac resisted the changes in the levels of p-Akt ser-473 and cyclin D1 as compared to empty vector control and wild type A431 cells.
    Figure Legend Snippet: Akt over-expression resists the effect of DFMO+diclofenac. Treatment of myr-flag-Akt overexpressing cells with DFMO and diclofenac resisted the changes in the levels of p-Akt ser-473 and cyclin D1 as compared to empty vector control and wild type A431 cells.

    Techniques Used: Over Expression, Plasmid Preparation

    DFMO+diclofenac treatment reduces proliferation and migration in A431 cells. (A) Clonogenic cell survival assay in DFMO+diclofenac treated A431 cells after 10 days as compared to their single agent treatments and vehicle-treated control. (B) Western blot analysis of p-Akt (ser-473), p-ERK, cyclin D1, Bcl-2 and COX-2 in the combined treatment group of DFMO and diclofenac as compared to control and their individual treatments. These cells retained their epithelial phenotype, as marked by increased E-cadherin expression. (C) Cell migration assay in DFMO+diclofenac combination treatment as compared to control or individual treatments after 12 h. (D) Representative pictures of A431 cells treated with the ODC and COX-2 inhibitors after 24 h of treatment. (E) Cell cycle analysis show significant accumulation of cells in G2/M phase with a concomitant reduction in G1 phase in DFMO+diclofenac treated A431 cells.
    Figure Legend Snippet: DFMO+diclofenac treatment reduces proliferation and migration in A431 cells. (A) Clonogenic cell survival assay in DFMO+diclofenac treated A431 cells after 10 days as compared to their single agent treatments and vehicle-treated control. (B) Western blot analysis of p-Akt (ser-473), p-ERK, cyclin D1, Bcl-2 and COX-2 in the combined treatment group of DFMO and diclofenac as compared to control and their individual treatments. These cells retained their epithelial phenotype, as marked by increased E-cadherin expression. (C) Cell migration assay in DFMO+diclofenac combination treatment as compared to control or individual treatments after 12 h. (D) Representative pictures of A431 cells treated with the ODC and COX-2 inhibitors after 24 h of treatment. (E) Cell cycle analysis show significant accumulation of cells in G2/M phase with a concomitant reduction in G1 phase in DFMO+diclofenac treated A431 cells.

    Techniques Used: Migration, Clonogenic Cell Survival Assay, Western Blot, Expressing, Cell Migration Assay, Cell Cycle Assay

    DFMO+diclofenac decreases proliferation and induce cell death by apoptosis in human epidermoid xenografts. (A) Tissue sections from A431 xenograft tumors were stained for PCNA or TUNEL. DFMO+diclofenac treatment on expression levels of PCNA and TUNEL-positive apoptotic cells as compared to vehicle and their individual treatments. (B) Western blot analysis was done by randomly selecting two individual samples from each group. The effect of ODC and COX-2 inhibitors treated as single agents and in combination on the expression of cyclin D1 and apoptotic marker proteins. The bar diagram represents relative expression level of these proteins the error bars demonstrate the standard error between two individual samples selected from each group. (cyclin D1: @ = NS, # = 0.04, $ = 0.001, = 0.01, ? = 0.05; Bcl-2: @ = NS, # = 0.04, $ = 0.01, = 0.05, ? = 0.05; cleaved caspase-3: @ = 0.005, # = 0.007, $ = 0.002, = 0.004 ? = NS). @ - significant when DFMO alone compared to vehicle-treated control, #- significant when diclofenac alone compared to vehicle-treated control, $ - significant when DFMO+diclofenac compared to vehicle, and ?-significant when DFMO+diclofenac compared to single treatment of DFMO and diclofenac respectively. Identical β-actin loading controls are denoted by symbol ‘†’ ‘¥’ ‘‡’ and ‘€’ in various figures.
    Figure Legend Snippet: DFMO+diclofenac decreases proliferation and induce cell death by apoptosis in human epidermoid xenografts. (A) Tissue sections from A431 xenograft tumors were stained for PCNA or TUNEL. DFMO+diclofenac treatment on expression levels of PCNA and TUNEL-positive apoptotic cells as compared to vehicle and their individual treatments. (B) Western blot analysis was done by randomly selecting two individual samples from each group. The effect of ODC and COX-2 inhibitors treated as single agents and in combination on the expression of cyclin D1 and apoptotic marker proteins. The bar diagram represents relative expression level of these proteins the error bars demonstrate the standard error between two individual samples selected from each group. (cyclin D1: @ = NS, # = 0.04, $ = 0.001, = 0.01, ? = 0.05; Bcl-2: @ = NS, # = 0.04, $ = 0.01, = 0.05, ? = 0.05; cleaved caspase-3: @ = 0.005, # = 0.007, $ = 0.002, = 0.004 ? = NS). @ - significant when DFMO alone compared to vehicle-treated control, #- significant when diclofenac alone compared to vehicle-treated control, $ - significant when DFMO+diclofenac compared to vehicle, and ?-significant when DFMO+diclofenac compared to single treatment of DFMO and diclofenac respectively. Identical β-actin loading controls are denoted by symbol ‘†’ ‘¥’ ‘‡’ and ‘€’ in various figures.

    Techniques Used: Staining, TUNEL Assay, Expressing, Western Blot, Marker

    6) Product Images from "Epigenetic inactivation of galanin receptors in salivary duct carcinoma of the parotid gland: Potential utility as biomarkers for prognosis"

    Article Title: Epigenetic inactivation of galanin receptors in salivary duct carcinoma of the parotid gland: Potential utility as biomarkers for prognosis

    Journal: Oncology Letters

    doi: 10.3892/ol.2018.8525

    Correlation between GALR methylation and expression of downstream proteins. Correlation between GALR1 methylation status and (A) p27 Kip1 , (B) p57 Kip2 , and (C) cyclin D1. Correlation between GALR2 methylation status and (D) p27 Kip1 , (E) p57 Kip2 and (F) cyclin D1. Asterisks mean significant differences (**P
    Figure Legend Snippet: Correlation between GALR methylation and expression of downstream proteins. Correlation between GALR1 methylation status and (A) p27 Kip1 , (B) p57 Kip2 , and (C) cyclin D1. Correlation between GALR2 methylation status and (D) p27 Kip1 , (E) p57 Kip2 and (F) cyclin D1. Asterisks mean significant differences (**P

    Techniques Used: Methylation, Expressing

    7) Product Images from "Triiodothyronine induces hepatocyte proliferation by Protein Kinase A-Dependent β-Catenin Activation in Rodents"

    Article Title: Triiodothyronine induces hepatocyte proliferation by Protein Kinase A-Dependent β-Catenin Activation in Rodents

    Journal: Hepatology (Baltimore, Md.)

    doi: 10.1002/hep.26775

    Blockade of Protein Kinase A impairs T3's effect on β-catenin, Cyclin-D1 and hepatocyte proliferation in mice A. A representative western blot using pooled samples from three wells per condition (left) shows increased levels of pSer675-β-catenin and pSer133-CREB in primary mouse hepatocytes after 30 minutes of T3 treatment. Inclusion of PKA inhibitor H89 (1 μM) in the media 30 minutes prior to the addition of T3 (100 nM) showed a notable decrease in pSer675-β-catenin and pSer133-CREB levels. Densitometry on the representative WB (right) shows an increase in pSer675-β-catenin and pSer133-CREB after T3 treatment, which was blocked by H89 treatment. (I.O.D. – integrated optical density). B. A representative western blot shows a decrease in the hepatic levels of pSer675-β-catenin and Cyclin-D1 when H89 was injected twice IP in 3-day T3 fed mice as compared to 3 day T3 only group. Gapdh verifies equal loading. Each lane represents an individual sample. C. A representative micrograph (200×) illustrates a decrease in the number of Cyclin-D1-positive hepatocytes when H89 was injected twice to the 3-day T3-fed mice as compared to T3 only group. Three or more mice per group were used for this study. D. Quantification of the Cyclin-D1-positive hepatocytes shows a significant decrease in positive cells in H89+T3 as compared to T3 only group (*p
    Figure Legend Snippet: Blockade of Protein Kinase A impairs T3's effect on β-catenin, Cyclin-D1 and hepatocyte proliferation in mice A. A representative western blot using pooled samples from three wells per condition (left) shows increased levels of pSer675-β-catenin and pSer133-CREB in primary mouse hepatocytes after 30 minutes of T3 treatment. Inclusion of PKA inhibitor H89 (1 μM) in the media 30 minutes prior to the addition of T3 (100 nM) showed a notable decrease in pSer675-β-catenin and pSer133-CREB levels. Densitometry on the representative WB (right) shows an increase in pSer675-β-catenin and pSer133-CREB after T3 treatment, which was blocked by H89 treatment. (I.O.D. – integrated optical density). B. A representative western blot shows a decrease in the hepatic levels of pSer675-β-catenin and Cyclin-D1 when H89 was injected twice IP in 3-day T3 fed mice as compared to 3 day T3 only group. Gapdh verifies equal loading. Each lane represents an individual sample. C. A representative micrograph (200×) illustrates a decrease in the number of Cyclin-D1-positive hepatocytes when H89 was injected twice to the 3-day T3-fed mice as compared to T3 only group. Three or more mice per group were used for this study. D. Quantification of the Cyclin-D1-positive hepatocytes shows a significant decrease in positive cells in H89+T3 as compared to T3 only group (*p

    Techniques Used: Mouse Assay, Western Blot, Injection

    Lack of β-catenin in hepatocytes impairs hepatocyte proliferation and Cyclin-D1 expression in response to T3 diet A. Representative microphotographs showing immunohistochemical staining for BrdU in the WT and KO livers after T3-treatment for 4 days (200×). Several BrdU-positive hepatocyte nuclei are observed in livers of WT mice fed T3 for 4 days. KO after T3 treatment lack BrdU staining in the hepatocytes although BrdU-positive non-parenchymal cells are evident, similar to WT livers. At least three WT and KO were used throughout this study. B. A significant (*p
    Figure Legend Snippet: Lack of β-catenin in hepatocytes impairs hepatocyte proliferation and Cyclin-D1 expression in response to T3 diet A. Representative microphotographs showing immunohistochemical staining for BrdU in the WT and KO livers after T3-treatment for 4 days (200×). Several BrdU-positive hepatocyte nuclei are observed in livers of WT mice fed T3 for 4 days. KO after T3 treatment lack BrdU staining in the hepatocytes although BrdU-positive non-parenchymal cells are evident, similar to WT livers. At least three WT and KO were used throughout this study. B. A significant (*p

    Techniques Used: Expressing, Immunohistochemistry, Staining, Mouse Assay, BrdU Staining

    T3 induced β-catenin activation via Ser675-phosphorylation A. qRT-PCR analysis of β-catenin expression (normalized to cyclophilin A) in C57BL6 mice treated with T3 for 4 days shows no change. Error bars represent the standard error (S.E.) of TaqMan RT-PCR performed in triplicates. B. Representative western blots show T3 feeding for 4 days does not lead to a notable increase in total β-catenin when compared to basal diet fed mice. However Cyclin-D1 levels are consistently increased. GSK3β-Ser9 levels remain unaffected at 4 days of T3 treatment. Gapdh verifies equal loading. Each lane represents an individual sample. C. Immunoprecipitation studies from three representative livers show no change in association of β-catenin and E-cadherin in the livers of 4 days T3- versus basal diet-fed C57BL/6 mice. D. Representative western blot shows a noteworthy increase in pSer675-β-catenin levels in 4 days T3-fed as compared to control diet-fed C57BL/6 mice. Gapdh verified equal loading.
    Figure Legend Snippet: T3 induced β-catenin activation via Ser675-phosphorylation A. qRT-PCR analysis of β-catenin expression (normalized to cyclophilin A) in C57BL6 mice treated with T3 for 4 days shows no change. Error bars represent the standard error (S.E.) of TaqMan RT-PCR performed in triplicates. B. Representative western blots show T3 feeding for 4 days does not lead to a notable increase in total β-catenin when compared to basal diet fed mice. However Cyclin-D1 levels are consistently increased. GSK3β-Ser9 levels remain unaffected at 4 days of T3 treatment. Gapdh verifies equal loading. Each lane represents an individual sample. C. Immunoprecipitation studies from three representative livers show no change in association of β-catenin and E-cadherin in the livers of 4 days T3- versus basal diet-fed C57BL/6 mice. D. Representative western blot shows a noteworthy increase in pSer675-β-catenin levels in 4 days T3-fed as compared to control diet-fed C57BL/6 mice. Gapdh verified equal loading.

    Techniques Used: Activation Assay, Quantitative RT-PCR, Expressing, Mouse Assay, Reverse Transcription Polymerase Chain Reaction, Western Blot, Immunoprecipitation

    Blockade of Protein Kinase A impairs T3's effect on β-catenin, Cyclin-D1 and hepatocyte proliferation in rats A. Representative microphotographs (200×) illustrate the effect of H89 on T3-induced rat hepatocyte proliferation by BrdU immunohistochemistry. H89 was given 1 hour prior to a single dose of T3 (20 μg/100 g) and the rats were sacrificed 24 hours later. Minimum four rats per group were used for this entire study. B. Quantification of BrdU positive hepatocytes in A shows a significant (*p
    Figure Legend Snippet: Blockade of Protein Kinase A impairs T3's effect on β-catenin, Cyclin-D1 and hepatocyte proliferation in rats A. Representative microphotographs (200×) illustrate the effect of H89 on T3-induced rat hepatocyte proliferation by BrdU immunohistochemistry. H89 was given 1 hour prior to a single dose of T3 (20 μg/100 g) and the rats were sacrificed 24 hours later. Minimum four rats per group were used for this entire study. B. Quantification of BrdU positive hepatocytes in A shows a significant (*p

    Techniques Used: Immunohistochemistry

    Activation of β-catenin signaling in rat livers after T3-feeding Immunostaining shows β-catenin localizing to the hepatocyte membrane in the control livers, while it accumulates in the hepatocyte cytoplasm in T3-fed rats at 2 days. A progressive shift of β-catenin stabilization from zone I towards zone II along with nuclear translocation of β-catenin-positive is observed at day 4 of T3 feeding. A concomitant increase in the number of GS-positive cells around central vein is observed at 4 days after T3. Progressive Cyclin-D1 nuclear staining is evident in zone I at 2 days, and in zone I and II at 4 days of T3 feeding as compared to the control livers. Four rats per group were used for this study.
    Figure Legend Snippet: Activation of β-catenin signaling in rat livers after T3-feeding Immunostaining shows β-catenin localizing to the hepatocyte membrane in the control livers, while it accumulates in the hepatocyte cytoplasm in T3-fed rats at 2 days. A progressive shift of β-catenin stabilization from zone I towards zone II along with nuclear translocation of β-catenin-positive is observed at day 4 of T3 feeding. A concomitant increase in the number of GS-positive cells around central vein is observed at 4 days after T3. Progressive Cyclin-D1 nuclear staining is evident in zone I at 2 days, and in zone I and II at 4 days of T3 feeding as compared to the control livers. Four rats per group were used for this study.

    Techniques Used: Activation Assay, Immunostaining, Translocation Assay, Staining

    8) Product Images from "The Diagnostic Usefulness of HMGA2, Survivin, CEACAM6, and SFN/14-3-3 δ in Follicular Thyroid Carcinoma"

    Article Title: The Diagnostic Usefulness of HMGA2, Survivin, CEACAM6, and SFN/14-3-3 δ in Follicular Thyroid Carcinoma

    Journal: Journal of Pathology and Translational Medicine

    doi: 10.4132/jptm.2015.01.31

    Representative immunohistochemical results in follicular thyroid carcinoma (FTC). Galectin 3 (A), cytokeratin 19 (C), survivin (F), CEACAM6 (G), and SFN/14-3-3 δ (H) are only occasionally expressed or not expressed. However, Hector Battifora mesothelial 1 (B), HMGA2 (E), and cyclin D1 (D) show diffuse positivity in many FTC cases.
    Figure Legend Snippet: Representative immunohistochemical results in follicular thyroid carcinoma (FTC). Galectin 3 (A), cytokeratin 19 (C), survivin (F), CEACAM6 (G), and SFN/14-3-3 δ (H) are only occasionally expressed or not expressed. However, Hector Battifora mesothelial 1 (B), HMGA2 (E), and cyclin D1 (D) show diffuse positivity in many FTC cases.

    Techniques Used: Immunohistochemistry

    9) Product Images from "M?ller cell activation, proliferation and migration following laser injury"

    Article Title: M?ller cell activation, proliferation and migration following laser injury

    Journal: Molecular Vision

    doi:

    Western blot analysis of Müller cell- and cell cycle marker expression. Western blots were performed and analyzed to confirm our immunohistochemical findings. Antibodies, targeted against Cral-BP ( A ), GFAP ( B ), nestin ( C ), vimentin ( D ), GS ( E ), Cyclin D1 ( F ), and Cyclin D3 ( G ), were used. A significant increase in the expression of the markers Cral-BP, GFAP, nestin, Cyclin D1, and Cyclin D3 was observed. Asterisks denote the following levels of confidence: *≤0.05, **≤0.01, and ***≤0.001.
    Figure Legend Snippet: Western blot analysis of Müller cell- and cell cycle marker expression. Western blots were performed and analyzed to confirm our immunohistochemical findings. Antibodies, targeted against Cral-BP ( A ), GFAP ( B ), nestin ( C ), vimentin ( D ), GS ( E ), Cyclin D1 ( F ), and Cyclin D3 ( G ), were used. A significant increase in the expression of the markers Cral-BP, GFAP, nestin, Cyclin D1, and Cyclin D3 was observed. Asterisks denote the following levels of confidence: *≤0.05, **≤0.01, and ***≤0.001.

    Techniques Used: Western Blot, Marker, Expressing, Immunohistochemistry

    Expression of cell cycle markers. Cell bodies in the inner nuclear layer (INL) reentered the cell cycle, began to proliferate, and migrated to the ONL following laser injury. The cell cycle marker Cyclin D1 and the Müller cell nuclear marker and cell cycle marker Cyclin D3 were used to identify proliferative cells. Cyclin D1 staining was elevated within 24 h after laser injury and localized within the injury site only. Cyclin D3 expression was increased at days 2 and 3 postinjury ( H , I ). Positive cells normally found in the INL were now located in the outer nuclear layer, indicated by arrows H and I (ONL; H - J ). The scale bars represent 75 μm.
    Figure Legend Snippet: Expression of cell cycle markers. Cell bodies in the inner nuclear layer (INL) reentered the cell cycle, began to proliferate, and migrated to the ONL following laser injury. The cell cycle marker Cyclin D1 and the Müller cell nuclear marker and cell cycle marker Cyclin D3 were used to identify proliferative cells. Cyclin D1 staining was elevated within 24 h after laser injury and localized within the injury site only. Cyclin D3 expression was increased at days 2 and 3 postinjury ( H , I ). Positive cells normally found in the INL were now located in the outer nuclear layer, indicated by arrows H and I (ONL; H - J ). The scale bars represent 75 μm.

    Techniques Used: Expressing, Marker, Staining

    Laser injury stimulates Müller glia proliferation. Antibodies, targeted against GS ( A , C ; green), GFAP ( B , D ; green), Cyclin D1 ( A , B ; red), and Cyclin D3 ( C , D ; red) were applied at two days postretinal injury. Müller glia within the injury site stain positive for the cell cycle markers Cyclin D1 and D3, indicating that laser burn induces a reentry into the cell cycle and subsequent glial cell proliferation. The scale bar represents 75 μm. Abbreviation: outer nuclear layer (ONL). Insets are higher power views of the indicated region. Arrows point to positively labeled nuclei in A , B i, and ii, C, and D.
    Figure Legend Snippet: Laser injury stimulates Müller glia proliferation. Antibodies, targeted against GS ( A , C ; green), GFAP ( B , D ; green), Cyclin D1 ( A , B ; red), and Cyclin D3 ( C , D ; red) were applied at two days postretinal injury. Müller glia within the injury site stain positive for the cell cycle markers Cyclin D1 and D3, indicating that laser burn induces a reentry into the cell cycle and subsequent glial cell proliferation. The scale bar represents 75 μm. Abbreviation: outer nuclear layer (ONL). Insets are higher power views of the indicated region. Arrows point to positively labeled nuclei in A , B i, and ii, C, and D.

    Techniques Used: Staining, Labeling

    10) Product Images from "Thyroid Hormone Receptor β Agonist Induces β-Catenin-Dependent Hepatocyte Proliferation in Mice: Implications in Hepatic Regeneration"

    Article Title: Thyroid Hormone Receptor β Agonist Induces β-Catenin-Dependent Hepatocyte Proliferation in Mice: Implications in Hepatic Regeneration

    Journal: Gene expression

    doi: 10.3727/105221616X691631

    T3- and GC-1-induced proliferation is blunted in the absence of redundant Wnt coreceptors LRP5-6 in hepatocytes. (A) BrdU and cyclin D1 immunohistochemistry shows decreased staining of hepatocytes in LRP5-6-LKO as compared to littermate controls in response
    Figure Legend Snippet: T3- and GC-1-induced proliferation is blunted in the absence of redundant Wnt coreceptors LRP5-6 in hepatocytes. (A) BrdU and cyclin D1 immunohistochemistry shows decreased staining of hepatocytes in LRP5-6-LKO as compared to littermate controls in response

    Techniques Used: Immunohistochemistry, Staining

    Increased hepatocyte proliferation and cyclin D1 expression after partial hepatectomy in mice pretreated with T3- or GC-1-supplemented diet for 8 days. (A) Immunohistochemistry for BrdU shows increased numbers of hepatocyte staining positive after 8 days
    Figure Legend Snippet: Increased hepatocyte proliferation and cyclin D1 expression after partial hepatectomy in mice pretreated with T3- or GC-1-supplemented diet for 8 days. (A) Immunohistochemistry for BrdU shows increased numbers of hepatocyte staining positive after 8 days

    Techniques Used: Expressing, Mouse Assay, Immunohistochemistry, Staining

    Mechanism of T3/GC-1-induced β-catenin activation leading to cyclin D1 expression and cell proliferation. In hepatocytes, T3/GC-1 appears to activate β-catenin via PKA-dependent mechanism as well as through canonical Wnt signaling. It
    Figure Legend Snippet: Mechanism of T3/GC-1-induced β-catenin activation leading to cyclin D1 expression and cell proliferation. In hepatocytes, T3/GC-1 appears to activate β-catenin via PKA-dependent mechanism as well as through canonical Wnt signaling. It

    Techniques Used: Activation Assay, Expressing

    Comparison of T3 diet-supplemented versus GC-1-injected mice. (A) Immunohistochemistry for BrdU and cyclin D1 shows increased staining in the T3 and GC-1 treatment groups when compared with respective controls (100×). (B) Bar graphs showing average
    Figure Legend Snippet: Comparison of T3 diet-supplemented versus GC-1-injected mice. (A) Immunohistochemistry for BrdU and cyclin D1 shows increased staining in the T3 and GC-1 treatment groups when compared with respective controls (100×). (B) Bar graphs showing average

    Techniques Used: Injection, Mouse Assay, Immunohistochemistry, Staining

    11) Product Images from "Thyroid Hormone Receptor β Agonist Induces β-Catenin-Dependent Hepatocyte Proliferation in Mice: Implications in Hepatic Regeneration"

    Article Title: Thyroid Hormone Receptor β Agonist Induces β-Catenin-Dependent Hepatocyte Proliferation in Mice: Implications in Hepatic Regeneration

    Journal: Gene expression

    doi: 10.3727/105221616X691631

    T3- and GC-1-induced proliferation is blunted in the absence of redundant Wnt coreceptors LRP5-6 in hepatocytes. (A) BrdU and cyclin D1 immunohistochemistry shows decreased staining of hepatocytes in LRP5-6-LKO as compared to littermate controls in response
    Figure Legend Snippet: T3- and GC-1-induced proliferation is blunted in the absence of redundant Wnt coreceptors LRP5-6 in hepatocytes. (A) BrdU and cyclin D1 immunohistochemistry shows decreased staining of hepatocytes in LRP5-6-LKO as compared to littermate controls in response

    Techniques Used: Immunohistochemistry, Staining

    Increased hepatocyte proliferation and cyclin D1 expression after partial hepatectomy in mice pretreated with T3- or GC-1-supplemented diet for 8 days. (A) Immunohistochemistry for BrdU shows increased numbers of hepatocyte staining positive after 8 days
    Figure Legend Snippet: Increased hepatocyte proliferation and cyclin D1 expression after partial hepatectomy in mice pretreated with T3- or GC-1-supplemented diet for 8 days. (A) Immunohistochemistry for BrdU shows increased numbers of hepatocyte staining positive after 8 days

    Techniques Used: Expressing, Mouse Assay, Immunohistochemistry, Staining

    Mechanism of T3/GC-1-induced β-catenin activation leading to cyclin D1 expression and cell proliferation. In hepatocytes, T3/GC-1 appears to activate β-catenin via PKA-dependent mechanism as well as through canonical Wnt signaling. It
    Figure Legend Snippet: Mechanism of T3/GC-1-induced β-catenin activation leading to cyclin D1 expression and cell proliferation. In hepatocytes, T3/GC-1 appears to activate β-catenin via PKA-dependent mechanism as well as through canonical Wnt signaling. It

    Techniques Used: Activation Assay, Expressing

    Comparison of T3 diet-supplemented versus GC-1-injected mice. (A) Immunohistochemistry for BrdU and cyclin D1 shows increased staining in the T3 and GC-1 treatment groups when compared with respective controls (100×). (B) Bar graphs showing average
    Figure Legend Snippet: Comparison of T3 diet-supplemented versus GC-1-injected mice. (A) Immunohistochemistry for BrdU and cyclin D1 shows increased staining in the T3 and GC-1 treatment groups when compared with respective controls (100×). (B) Bar graphs showing average

    Techniques Used: Injection, Mouse Assay, Immunohistochemistry, Staining

    12) Product Images from "Skeletal Muscle Mass Recovery from Atrophy in IL-6 Knockout Mice"

    Article Title: Skeletal Muscle Mass Recovery from Atrophy in IL-6 Knockout Mice

    Journal: Acta physiologica (Oxford, England)

    doi: 10.1111/j.1748-1716.2011.02281.x

    The effect of reloading on cyclin D1 in the gastrocnemius muscle of wild-type and IL-6 KO. A) The effect of 10 days of hindlimb suspension on cyclin D1 mRNA abundance in the gastrocnemius muscle. B) The effect of 1 day of reloading following 10 days of hindlimb suspension on cyclin D1 mRNA abundance in the gastrocnemius muscle. C) The effect of 7 days of reloading following 10 days of hindlimb suspension on cyclin D1 mRNA abundance in the gastrocnemius muscle. D). Upper representative western blot of cyclinD1 protein. Lower Quantified cyclinD1 protein expression after 1 day of reloading. Values are means ± SE, n = 4–6 per group. ME, main effect.
    Figure Legend Snippet: The effect of reloading on cyclin D1 in the gastrocnemius muscle of wild-type and IL-6 KO. A) The effect of 10 days of hindlimb suspension on cyclin D1 mRNA abundance in the gastrocnemius muscle. B) The effect of 1 day of reloading following 10 days of hindlimb suspension on cyclin D1 mRNA abundance in the gastrocnemius muscle. C) The effect of 7 days of reloading following 10 days of hindlimb suspension on cyclin D1 mRNA abundance in the gastrocnemius muscle. D). Upper representative western blot of cyclinD1 protein. Lower Quantified cyclinD1 protein expression after 1 day of reloading. Values are means ± SE, n = 4–6 per group. ME, main effect.

    Techniques Used: Western Blot, Expressing

    13) Product Images from "Alterations in Morphology and Adult Neurogenesis in the Dentate Gyrus of Patched1 Heterozygous Mice"

    Article Title: Alterations in Morphology and Adult Neurogenesis in the Dentate Gyrus of Patched1 Heterozygous Mice

    Journal: Frontiers in Molecular Neuroscience

    doi: 10.3389/fnmol.2018.00168

    Shh pathway activation induces DG cells proliferation by increasing TLX and Cyclin D1 expression. (A) TLX mRNA relative expression in Ptch1 +/− mice at 2 and 8 months of age. (B) Cyclin D1 relative expression in Ptch1 +/− mice at 2 and 8 months. The number of mice used per test is indicated in the graphs (n). Data are reported as mean ± SEM * p
    Figure Legend Snippet: Shh pathway activation induces DG cells proliferation by increasing TLX and Cyclin D1 expression. (A) TLX mRNA relative expression in Ptch1 +/− mice at 2 and 8 months of age. (B) Cyclin D1 relative expression in Ptch1 +/− mice at 2 and 8 months. The number of mice used per test is indicated in the graphs (n). Data are reported as mean ± SEM * p

    Techniques Used: Activation Assay, Expressing, Mouse Assay

    14) Product Images from "Clostridioides difficile Toxin A-Induced Wnt/β-Catenin Pathway Inhibition Is Mediated by Rac1 Glucosylation"

    Article Title: Clostridioides difficile Toxin A-Induced Wnt/β-Catenin Pathway Inhibition Is Mediated by Rac1 Glucosylation

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2020.01998

    TcdA downregulates β-catenin target genes ( cMYC and cyclin D1 ) and reduces cyclin D1 protein in the ileum of the treated mice. (A) CCND1 and (B) cMYC mRNA expression in the ileum of mice treated with phosphate-buffered saline (PBS; control) or TcdA (10 μg) for 4 h, as evaluated by qPCR. Bars represent the means ± SEM of five mice in each group; Student’s t -test. (C) Percentage of the cells showing positive cyclin D1 immunostaining. Data are the means ± SEM; Student’s t -test. (D) Representative immunohistochemical images of cyclin D1 levels in the ilea of mice challenged with PBS (control) or TcdA (10 μg). (E) Percentage of the cells showing positive cMYC immunostaining. Data are the means ± SEM; Student’s t -test. (F) Representative immunohistochemical images of cMYC expression in mouse ilea challenged with PBS (control) or TcdA (10 μg).
    Figure Legend Snippet: TcdA downregulates β-catenin target genes ( cMYC and cyclin D1 ) and reduces cyclin D1 protein in the ileum of the treated mice. (A) CCND1 and (B) cMYC mRNA expression in the ileum of mice treated with phosphate-buffered saline (PBS; control) or TcdA (10 μg) for 4 h, as evaluated by qPCR. Bars represent the means ± SEM of five mice in each group; Student’s t -test. (C) Percentage of the cells showing positive cyclin D1 immunostaining. Data are the means ± SEM; Student’s t -test. (D) Representative immunohistochemical images of cyclin D1 levels in the ilea of mice challenged with PBS (control) or TcdA (10 μg). (E) Percentage of the cells showing positive cMYC immunostaining. Data are the means ± SEM; Student’s t -test. (F) Representative immunohistochemical images of cMYC expression in mouse ilea challenged with PBS (control) or TcdA (10 μg).

    Techniques Used: Mouse Assay, Expressing, Real-time Polymerase Chain Reaction, Immunostaining, Immunohistochemistry

    Mechanism of inhibition of Wnt/β-catenin signaling by TcdA. In IECs, Wnt3a binds to the frizzled (FZD) receptor and its coreceptor lymphoid enhancer factor (LRP), recruiting disheveled (Dvl), which in turn inhibits the adenomatous polyposis coli (APC)/glycogen synthase kinase 3 beta (GSK3β)/Axin complex, which degrade β-catenin. Upon inhibition of the APC/GSK3β/APC complex, β-catenin accumulates in the cytoplasm and is translocated into the nucleus, with Rac1 serving as a promoter of this translocation, where it activates LEF/TCF to promote the transcription of target genes, such as cyclin D1 and cMYC . Both cyclin D1 and cMYC are involved in the induction of cell proliferation. TcdA [composed of glucosyltransferase domain (GDT), cysteine protease domain (CPD), translocation membrane domain (TMD), and C-terminal combined repetitive oligopeptide (CROP)] binds to a cell receptor by CROP and is endocytosed. Then, GDT is released into the cytosol, where it inhibits Rac1, resulting in a decrease in β-catenin translocation to the nucleus with a consequent reduction in the genic expression of the target genes and cell proliferation. However, upregulation of Rac1, in the presence of Wnt3a activity, decreases TcdA-induced inhibition of Wnt3a/β-catenin signaling and proliferation. APC, adenomatous polyposis coli; CPD, cysteine protease domain; CROPs, C-terminal combined repetitive oligopeptides; Dvl, disheveled; GSK3β, glycogen synthase kinase 3 beta; GTD, glucosyltransferase domain; LEF, lymphoid enhancer factor; LRP, low-density-lipoprotein-related protein; TCF, T cell factor protein; and TMD, translocation membrane domain.
    Figure Legend Snippet: Mechanism of inhibition of Wnt/β-catenin signaling by TcdA. In IECs, Wnt3a binds to the frizzled (FZD) receptor and its coreceptor lymphoid enhancer factor (LRP), recruiting disheveled (Dvl), which in turn inhibits the adenomatous polyposis coli (APC)/glycogen synthase kinase 3 beta (GSK3β)/Axin complex, which degrade β-catenin. Upon inhibition of the APC/GSK3β/APC complex, β-catenin accumulates in the cytoplasm and is translocated into the nucleus, with Rac1 serving as a promoter of this translocation, where it activates LEF/TCF to promote the transcription of target genes, such as cyclin D1 and cMYC . Both cyclin D1 and cMYC are involved in the induction of cell proliferation. TcdA [composed of glucosyltransferase domain (GDT), cysteine protease domain (CPD), translocation membrane domain (TMD), and C-terminal combined repetitive oligopeptide (CROP)] binds to a cell receptor by CROP and is endocytosed. Then, GDT is released into the cytosol, where it inhibits Rac1, resulting in a decrease in β-catenin translocation to the nucleus with a consequent reduction in the genic expression of the target genes and cell proliferation. However, upregulation of Rac1, in the presence of Wnt3a activity, decreases TcdA-induced inhibition of Wnt3a/β-catenin signaling and proliferation. APC, adenomatous polyposis coli; CPD, cysteine protease domain; CROPs, C-terminal combined repetitive oligopeptides; Dvl, disheveled; GSK3β, glycogen synthase kinase 3 beta; GTD, glucosyltransferase domain; LEF, lymphoid enhancer factor; LRP, low-density-lipoprotein-related protein; TCF, T cell factor protein; and TMD, translocation membrane domain.

    Techniques Used: Inhibition, Translocation Assay, Expressing, Activity Assay

    15) Product Images from "Cyclin D1 cooperates with p21 to regulate TGF?-mediated breast cancer cell migration and tumor local invasion"

    Article Title: Cyclin D1 cooperates with p21 to regulate TGF?-mediated breast cancer cell migration and tumor local invasion

    Journal: Breast Cancer Research : BCR

    doi: 10.1186/bcr3441

    TGFβ promotes cyclin D1 nuclear accumulation and co-localization with p21 . (A) MDA and SCP2 cells were treated with or without 5 ng/ml transforming growth factor beta (TGFβ) for 24 hours. Immunocytochemistry was performed using cyclin D1 (red) antibody and DAPI (blue). The scale bar is 10 µm. (B) MDA cells were immunostained using p21 (green) and cyclin D1 (red) antibodies. Co-localizaton (yellow) between p21 and cyclin D1 is represented by overlay. (C) MDA and SCP2 cells were treated with TGFβ for the indicated times. Cell lysates were analyzed by co-immunoprecipitation using an anti-cyclin D1 antibody. Immunoprecipitated cyclin D1 was subjected to Western blotting. (D) MDA, SUM149 and SUM159 cells were treated with TGFβ. Cell lysates were immunoprecipitated using an anti-p21 antibody and analyzed by immunoblotting using anti-cyclin D1 and anti-p21 antibodies.
    Figure Legend Snippet: TGFβ promotes cyclin D1 nuclear accumulation and co-localization with p21 . (A) MDA and SCP2 cells were treated with or without 5 ng/ml transforming growth factor beta (TGFβ) for 24 hours. Immunocytochemistry was performed using cyclin D1 (red) antibody and DAPI (blue). The scale bar is 10 µm. (B) MDA cells were immunostained using p21 (green) and cyclin D1 (red) antibodies. Co-localizaton (yellow) between p21 and cyclin D1 is represented by overlay. (C) MDA and SCP2 cells were treated with TGFβ for the indicated times. Cell lysates were analyzed by co-immunoprecipitation using an anti-cyclin D1 antibody. Immunoprecipitated cyclin D1 was subjected to Western blotting. (D) MDA, SUM149 and SUM159 cells were treated with TGFβ. Cell lysates were immunoprecipitated using an anti-p21 antibody and analyzed by immunoblotting using anti-cyclin D1 and anti-p21 antibodies.

    Techniques Used: Multiple Displacement Amplification, Immunocytochemistry, Immunoprecipitation, Western Blot

    Depletion of cyclin D1 and p21 prevents mammary tumor growth and local invasion . (A) Parental SCP2 and p21/cyclin D1 double knockdown SCP2 cells were implanted into the mammary fat pad of four- to six-week-old female Balb/c nude mice. Mammary tumor growth was measured from two sets of mice and quantified for the tumor size at the indicated times (six per group; error bars indicate SEM). (B) Representative photographs show hematoxylin and eosin staining of the mammary gland (tumor and surrounding tissues) of mice at eight weeks post-injection. (C) Representative photographs show PTGS2 staining of parental and p21/cyclin D1-depleted mammary tumor of mice at eight weeks post-injection. (D) Representative radiographs of skeletal lesions in two groups of mice (parental and p21/cyclin D1-depleted SCP2) were taken by X-ray using Faxitron. Parental and p21/cyclin D1-depleted SCP2 cells were injected in tibia. The lesions are highlighted by arrows.
    Figure Legend Snippet: Depletion of cyclin D1 and p21 prevents mammary tumor growth and local invasion . (A) Parental SCP2 and p21/cyclin D1 double knockdown SCP2 cells were implanted into the mammary fat pad of four- to six-week-old female Balb/c nude mice. Mammary tumor growth was measured from two sets of mice and quantified for the tumor size at the indicated times (six per group; error bars indicate SEM). (B) Representative photographs show hematoxylin and eosin staining of the mammary gland (tumor and surrounding tissues) of mice at eight weeks post-injection. (C) Representative photographs show PTGS2 staining of parental and p21/cyclin D1-depleted mammary tumor of mice at eight weeks post-injection. (D) Representative radiographs of skeletal lesions in two groups of mice (parental and p21/cyclin D1-depleted SCP2) were taken by X-ray using Faxitron. Parental and p21/cyclin D1-depleted SCP2 cells were injected in tibia. The lesions are highlighted by arrows.

    Techniques Used: Mouse Assay, Staining, Injection

    TGFβ induces cyclin D1 expression in highly migratory breast cancer cells . (A) MDA and SCP2 cells were stimulated with or without 5 ng/ml transforming growth factor beta (TGFβ) for the indicated times. Total cell lysates were subjected to immunoblot using cyclin D1, cyclin D2, cyclin A, cyclin B1, p21, p-Smad2, p-Smad3 and β-tubulin antibodies. Densitometry analysis of cyclin D1 protein expression was performed on four separate independent experiments (right panel). ( B and C) cyclin D1 mRNA levels were measured by real-time PCR (error bars indicate SEM; n = 3 independent experiments) for the indicated cell lines.
    Figure Legend Snippet: TGFβ induces cyclin D1 expression in highly migratory breast cancer cells . (A) MDA and SCP2 cells were stimulated with or without 5 ng/ml transforming growth factor beta (TGFβ) for the indicated times. Total cell lysates were subjected to immunoblot using cyclin D1, cyclin D2, cyclin A, cyclin B1, p21, p-Smad2, p-Smad3 and β-tubulin antibodies. Densitometry analysis of cyclin D1 protein expression was performed on four separate independent experiments (right panel). ( B and C) cyclin D1 mRNA levels were measured by real-time PCR (error bars indicate SEM; n = 3 independent experiments) for the indicated cell lines.

    Techniques Used: Expressing, Multiple Displacement Amplification, Real-time Polymerase Chain Reaction

    Cyclin D1 is required for TGFβ-mediated cell migration . (A) SCP2 cells were transfected with Scr or cyclin D1 siRNAs and then treated with or without 5 ng/ml transforming growth factor beta(TGFβ) for 24 hours. Total cell lysates were analyzed for cyclin D1 and β-tubulin by Western blotting. (B) Representative images of phase contrast and wound mask of transfected SCP2 cells stimulated without or with TGFβ for 0 and 24 hours in scratch/wound healing assay. The initial wound mask (black) and wound closure (grey) were measured using the Essen Instruments Scratch Wound Module. (C) Relative wound width was analyzed by the IncuCyte™software (Essen Bioscience) and quantified for the indicated times (error bars indicate SEM; n = 3 independent experiments). (D) SCP2 cells were treated with either vehicle (dimethyl sulfoxide, DMSO) or mitomycin C (Mito C) in the presence or absence of TGFβ. SCP2 cell migration was quantified using wound closure area at 24 hours (error bars indicate SEM; n = 3 independent experiments). (E) Representative images of transfected SCP2 cells stimulated with or without TGFβ for 0 and 24 hours in Transwell cell migration assay. Cells were stained with 0.2% crystal violet. (F) Transfected and migrated SCP2 cells in Transwell migration assay were stained with DRAQ5 fluorescent dye and quantified using fluorescent density at 24 hours (error bars indicate SEM; n = 3 independent experiments). (G) SCP2 cells were transfected with empty vector, Flag-p21, and HA-cyclin D1 separately or in combination. TGFβ-mediated cell migration was assessed using the Transwell (top panel) and wound healing (bottom panel) assays. Migration of the cells was quantified using fluorescent density (Transwell assay) and wound closure area (wound healing assay) at 24 hours (Error bars indicate SEM; n = 3 independent experiments).
    Figure Legend Snippet: Cyclin D1 is required for TGFβ-mediated cell migration . (A) SCP2 cells were transfected with Scr or cyclin D1 siRNAs and then treated with or without 5 ng/ml transforming growth factor beta(TGFβ) for 24 hours. Total cell lysates were analyzed for cyclin D1 and β-tubulin by Western blotting. (B) Representative images of phase contrast and wound mask of transfected SCP2 cells stimulated without or with TGFβ for 0 and 24 hours in scratch/wound healing assay. The initial wound mask (black) and wound closure (grey) were measured using the Essen Instruments Scratch Wound Module. (C) Relative wound width was analyzed by the IncuCyte™software (Essen Bioscience) and quantified for the indicated times (error bars indicate SEM; n = 3 independent experiments). (D) SCP2 cells were treated with either vehicle (dimethyl sulfoxide, DMSO) or mitomycin C (Mito C) in the presence or absence of TGFβ. SCP2 cell migration was quantified using wound closure area at 24 hours (error bars indicate SEM; n = 3 independent experiments). (E) Representative images of transfected SCP2 cells stimulated with or without TGFβ for 0 and 24 hours in Transwell cell migration assay. Cells were stained with 0.2% crystal violet. (F) Transfected and migrated SCP2 cells in Transwell migration assay were stained with DRAQ5 fluorescent dye and quantified using fluorescent density at 24 hours (error bars indicate SEM; n = 3 independent experiments). (G) SCP2 cells were transfected with empty vector, Flag-p21, and HA-cyclin D1 separately or in combination. TGFβ-mediated cell migration was assessed using the Transwell (top panel) and wound healing (bottom panel) assays. Migration of the cells was quantified using fluorescent density (Transwell assay) and wound closure area (wound healing assay) at 24 hours (Error bars indicate SEM; n = 3 independent experiments).

    Techniques Used: Migration, Transfection, Western Blot, Wound Healing Assay, Software, Cell Migration Assay, Staining, Transwell Migration Assay, Plasmid Preparation, Transwell Assay

    Cyclin D1 is a downstream mediator in TGFβ-regulated actin reorganization and invadopodia formation . (A) Scr siRNA- or cyclin D1 siRNA-transfected SCP2 cells were treated with or without 5 ng/ml transforming growth factor beta (TGFβ) for 24 hours. Immunocytochemistry was performed using F-actin (green) antibody, vimentin (red) antibody and DAPI (blue). Co-localizaton (yellow) between F-actin and vimentin is represented by overlay. The scale bar is 10 µm. (B) Scr siRNA- or cyclin D1 siRNA-transfected SCP2 cells were cultured on the top of growth factor-reduced Matrigel and then treated with or without 5 ng/ml TGFβ for 24 hours. Immunocytochemistry was performed using F-actin (green) and cyclin D1 (red) antibodies and DAPI (blue).
    Figure Legend Snippet: Cyclin D1 is a downstream mediator in TGFβ-regulated actin reorganization and invadopodia formation . (A) Scr siRNA- or cyclin D1 siRNA-transfected SCP2 cells were treated with or without 5 ng/ml transforming growth factor beta (TGFβ) for 24 hours. Immunocytochemistry was performed using F-actin (green) antibody, vimentin (red) antibody and DAPI (blue). Co-localizaton (yellow) between F-actin and vimentin is represented by overlay. The scale bar is 10 µm. (B) Scr siRNA- or cyclin D1 siRNA-transfected SCP2 cells were cultured on the top of growth factor-reduced Matrigel and then treated with or without 5 ng/ml TGFβ for 24 hours. Immunocytochemistry was performed using F-actin (green) and cyclin D1 (red) antibodies and DAPI (blue).

    Techniques Used: Transfection, Immunocytochemistry, Cell Culture

    16) Product Images from "Celecoxib targets breast cancer stem cells by inhibiting the synthesis of prostaglandin E2 and down-regulating the Wnt pathway activity"

    Article Title: Celecoxib targets breast cancer stem cells by inhibiting the synthesis of prostaglandin E2 and down-regulating the Wnt pathway activity

    Journal: Oncotarget

    doi: 10.18632/oncotarget.23250

    Celecoxib inhibits tumorigenesis in vivo by inhibiting the synthesis of PGE 2 and down-regulating the Wnt pathway activity (A) Photographs of excised tumors from two groups of NOD/SCID mice (N = 6 per group). (B) Tumor tissues were confirmed by H E staining, and normal breast tissues were used as negative control (magnification, ×100). (C) Tumor growth was measured with a caliper every three days, and tumors were weighted when the mice were sacrificed. (D and E) Proteins and RNAs were extracted from tumor tissues. Wnt pathway components (β-catenin, p-GSK-3β) and target genes ( MMP-2 , Survivin , AXIN-2 , CYCLIN-D1 and C-MYC ), and CSC marker (SOX-2) were evaluated by western-blot or RT-PCR. (F) IHC staining for Wnt pathway components, target genes and CSC marker (SOX-2) in sections of tumor tissues (magnification ×200). (G) PGE 2 levels in serum of the assayed animals were evaluated by PGE 2 ELISA kit. Scale bar = 100 μm. Data are presented as mean ± SD. * , P
    Figure Legend Snippet: Celecoxib inhibits tumorigenesis in vivo by inhibiting the synthesis of PGE 2 and down-regulating the Wnt pathway activity (A) Photographs of excised tumors from two groups of NOD/SCID mice (N = 6 per group). (B) Tumor tissues were confirmed by H E staining, and normal breast tissues were used as negative control (magnification, ×100). (C) Tumor growth was measured with a caliper every three days, and tumors were weighted when the mice were sacrificed. (D and E) Proteins and RNAs were extracted from tumor tissues. Wnt pathway components (β-catenin, p-GSK-3β) and target genes ( MMP-2 , Survivin , AXIN-2 , CYCLIN-D1 and C-MYC ), and CSC marker (SOX-2) were evaluated by western-blot or RT-PCR. (F) IHC staining for Wnt pathway components, target genes and CSC marker (SOX-2) in sections of tumor tissues (magnification ×200). (G) PGE 2 levels in serum of the assayed animals were evaluated by PGE 2 ELISA kit. Scale bar = 100 μm. Data are presented as mean ± SD. * , P

    Techniques Used: In Vivo, Activity Assay, Mouse Assay, Staining, Negative Control, Marker, Western Blot, Reverse Transcription Polymerase Chain Reaction, Immunohistochemistry, Enzyme-linked Immunosorbent Assay

    17) Product Images from "M?ller cell activation, proliferation and migration following laser injury"

    Article Title: M?ller cell activation, proliferation and migration following laser injury

    Journal: Molecular Vision

    doi:

    Western blot analysis of Müller cell- and cell cycle marker expression. Western blots were performed and analyzed to confirm our immunohistochemical findings. Antibodies, targeted against Cral-BP ( A ), GFAP ( B ), nestin ( C ), vimentin ( D ), GS ( E ), Cyclin D1 ( F ), and Cyclin D3 ( G ), were used. A significant increase in the expression of the markers Cral-BP, GFAP, nestin, Cyclin D1, and Cyclin D3 was observed. Asterisks denote the following levels of confidence: *≤0.05, **≤0.01, and ***≤0.001.
    Figure Legend Snippet: Western blot analysis of Müller cell- and cell cycle marker expression. Western blots were performed and analyzed to confirm our immunohistochemical findings. Antibodies, targeted against Cral-BP ( A ), GFAP ( B ), nestin ( C ), vimentin ( D ), GS ( E ), Cyclin D1 ( F ), and Cyclin D3 ( G ), were used. A significant increase in the expression of the markers Cral-BP, GFAP, nestin, Cyclin D1, and Cyclin D3 was observed. Asterisks denote the following levels of confidence: *≤0.05, **≤0.01, and ***≤0.001.

    Techniques Used: Western Blot, Marker, Expressing, Immunohistochemistry

    Expression of cell cycle markers. Cell bodies in the inner nuclear layer (INL) reentered the cell cycle, began to proliferate, and migrated to the ONL following laser injury. The cell cycle marker Cyclin D1 and the Müller cell nuclear marker and cell cycle marker Cyclin D3 were used to identify proliferative cells. Cyclin D1 staining was elevated within 24 h after laser injury and localized within the injury site only. Cyclin D3 expression was increased at days 2 and 3 postinjury ( H , I ). Positive cells normally found in the INL were now located in the outer nuclear layer, indicated by arrows H and I (ONL; H - J ). The scale bars represent 75 μm.
    Figure Legend Snippet: Expression of cell cycle markers. Cell bodies in the inner nuclear layer (INL) reentered the cell cycle, began to proliferate, and migrated to the ONL following laser injury. The cell cycle marker Cyclin D1 and the Müller cell nuclear marker and cell cycle marker Cyclin D3 were used to identify proliferative cells. Cyclin D1 staining was elevated within 24 h after laser injury and localized within the injury site only. Cyclin D3 expression was increased at days 2 and 3 postinjury ( H , I ). Positive cells normally found in the INL were now located in the outer nuclear layer, indicated by arrows H and I (ONL; H - J ). The scale bars represent 75 μm.

    Techniques Used: Expressing, Marker, Staining

    Laser injury stimulates Müller glia proliferation. Antibodies, targeted against GS ( A , C ; green), GFAP ( B , D ; green), Cyclin D1 ( A , B ; red), and Cyclin D3 ( C , D ; red) were applied at two days postretinal injury. Müller glia within the injury site stain positive for the cell cycle markers Cyclin D1 and D3, indicating that laser burn induces a reentry into the cell cycle and subsequent glial cell proliferation. The scale bar represents 75 μm. Abbreviation: outer nuclear layer (ONL). Insets are higher power views of the indicated region. Arrows point to positively labeled nuclei in A , B i, and ii, C, and D.
    Figure Legend Snippet: Laser injury stimulates Müller glia proliferation. Antibodies, targeted against GS ( A , C ; green), GFAP ( B , D ; green), Cyclin D1 ( A , B ; red), and Cyclin D3 ( C , D ; red) were applied at two days postretinal injury. Müller glia within the injury site stain positive for the cell cycle markers Cyclin D1 and D3, indicating that laser burn induces a reentry into the cell cycle and subsequent glial cell proliferation. The scale bar represents 75 μm. Abbreviation: outer nuclear layer (ONL). Insets are higher power views of the indicated region. Arrows point to positively labeled nuclei in A , B i, and ii, C, and D.

    Techniques Used: Staining, Labeling

    18) Product Images from "CD10-positive mantle cell lymphoma: clinicopathologic and prognostic study of 30 cases"

    Article Title: CD10-positive mantle cell lymphoma: clinicopathologic and prognostic study of 30 cases

    Journal: Oncotarget

    doi: 10.18632/oncotarget.23571

    A representative case of CD10+ mantle cell lymphoma, blastoid variant The lymphoma cells grew in a diffuse pattern with blastoid morphology [( A ) and insert, H E, 400x and 1000x, respectively]. The lymphoma cells were PAX5+ ( B ), CD10+ ( C ), BCL6+ (subset, ( D ), Cyclin D1+ ( E ), and showed a high proliferation rate by Ki67 ( F ) (C–F), immunohistochemical stains, 400x). Flow cytometry study showed a kappa-restricted monoclonal B cell population that was positive for CD19, CD20, CD5, CD10, CD43, and negative for CD200 and CD23 ( G – L ).
    Figure Legend Snippet: A representative case of CD10+ mantle cell lymphoma, blastoid variant The lymphoma cells grew in a diffuse pattern with blastoid morphology [( A ) and insert, H E, 400x and 1000x, respectively]. The lymphoma cells were PAX5+ ( B ), CD10+ ( C ), BCL6+ (subset, ( D ), Cyclin D1+ ( E ), and showed a high proliferation rate by Ki67 ( F ) (C–F), immunohistochemical stains, 400x). Flow cytometry study showed a kappa-restricted monoclonal B cell population that was positive for CD19, CD20, CD5, CD10, CD43, and negative for CD200 and CD23 ( G – L ).

    Techniques Used: Variant Assay, Immunohistochemistry, Flow Cytometry, Cytometry

    19) Product Images from "Honokiol protects against epidural fibrosis by inhibiting fibroblast proliferation and extracellular matrix overproduction in rats post-laminectomy"

    Article Title: Honokiol protects against epidural fibrosis by inhibiting fibroblast proliferation and extracellular matrix overproduction in rats post-laminectomy

    Journal: International Journal of Molecular Medicine

    doi: 10.3892/ijmm.2020.4765

    Effects of honokiol on toxicity and proliferation of fibroblasts. (A) Chemical structure of honokiol. (B) Fibroblasts were incubated with various concentrations of honokiol for 72 h. (C) Fibroblasts were treated with 10 ng/ml TGF-β1, alone or with the indicated concentrations of honokiol for 72 h. (D) Effects of honokiol on cyclin D1, cyclin E and cyclin B1 induced by TGF-β1 were examined by western blot analysis. (E-G) Bar diagram of the cyclin D1, cyclin E and cyclin B1 expression. (H) The active DNA synthesis of fibroblasts was detected by EdU incorporation assay (×100 magnification). (I) Ratios of EdU-positive cells. Data are presented as the means ± SEM, ** P
    Figure Legend Snippet: Effects of honokiol on toxicity and proliferation of fibroblasts. (A) Chemical structure of honokiol. (B) Fibroblasts were incubated with various concentrations of honokiol for 72 h. (C) Fibroblasts were treated with 10 ng/ml TGF-β1, alone or with the indicated concentrations of honokiol for 72 h. (D) Effects of honokiol on cyclin D1, cyclin E and cyclin B1 induced by TGF-β1 were examined by western blot analysis. (E-G) Bar diagram of the cyclin D1, cyclin E and cyclin B1 expression. (H) The active DNA synthesis of fibroblasts was detected by EdU incorporation assay (×100 magnification). (I) Ratios of EdU-positive cells. Data are presented as the means ± SEM, ** P

    Techniques Used: Incubation, Western Blot, Expressing, DNA Synthesis

    20) Product Images from "Hair Follicle Disruption Facilitates Pathogenesis to UVB-Induced Cutaneous Inflammation and Basal Cell Carcinoma Development in Ptch+/− Mice"

    Article Title: Hair Follicle Disruption Facilitates Pathogenesis to UVB-Induced Cutaneous Inflammation and Basal Cell Carcinoma Development in Ptch+/− Mice

    Journal: The American Journal of Pathology

    doi: 10.1016/j.ajpath.2014.01.013

    Expression of biomarkers related to proliferation and apoptosis in tumors induced in hairless and haired Ptch +/− littermates. A: IHC staining of cyclin D1, immunofluorescence staining of PCNA, and TUNEL staining. B: Nuclear cyclin D1 and PCNA staining, as quantified in BCCs excised from hairless and haired mice. Data are represented as means ± SEM of at least three samples. AU, arbitrary unit.
    Figure Legend Snippet: Expression of biomarkers related to proliferation and apoptosis in tumors induced in hairless and haired Ptch +/− littermates. A: IHC staining of cyclin D1, immunofluorescence staining of PCNA, and TUNEL staining. B: Nuclear cyclin D1 and PCNA staining, as quantified in BCCs excised from hairless and haired mice. Data are represented as means ± SEM of at least three samples. AU, arbitrary unit.

    Techniques Used: Expressing, Immunohistochemistry, Staining, Immunofluorescence, TUNEL Assay, Mouse Assay

    21) Product Images from "TGM2 interference regulates the angiogenesis and apoptosis of colorectal cancer via Wnt/β-catenin pathway"

    Article Title: TGM2 interference regulates the angiogenesis and apoptosis of colorectal cancer via Wnt/β-catenin pathway

    Journal: Cell Cycle

    doi: 10.1080/15384101.2019.1609831

    TGM2-siRNA interference inhibited Wnt3a/β-catenin/Cyclin D1 pathway in colorectal cancer cells. RT-qPCR (a) and Western blot (b) were performed to detect the expression levels of Wnt3a, β-catenin, and Cyclin D1 in LoVo and HCT116 cells after TGM2-siRNA interference.
    Figure Legend Snippet: TGM2-siRNA interference inhibited Wnt3a/β-catenin/Cyclin D1 pathway in colorectal cancer cells. RT-qPCR (a) and Western blot (b) were performed to detect the expression levels of Wnt3a, β-catenin, and Cyclin D1 in LoVo and HCT116 cells after TGM2-siRNA interference.

    Techniques Used: Quantitative RT-PCR, Western Blot, Expressing

    22) Product Images from "Cyclin D1 as a diagnostic immunomarker for endometrial stromal sarcoma with YWHAE-FAM22 rearrangement"

    Article Title: Cyclin D1 as a diagnostic immunomarker for endometrial stromal sarcoma with YWHAE-FAM22 rearrangement

    Journal: The American journal of surgical pathology

    doi: 10.1097/PAS.0b013e31825fa931

    Cyclin D1 immunostaining in JAZF1 ESS. Panels A and B depict the H E and cyclin D1 immunostaining of a primary uterine JAZF1 ESS. Panel C and D depict the H E and cyclin D1 immunostaining of a pulmonary metastasis of a JAZF1 ESS. Panels
    Figure Legend Snippet: Cyclin D1 immunostaining in JAZF1 ESS. Panels A and B depict the H E and cyclin D1 immunostaining of a primary uterine JAZF1 ESS. Panel C and D depict the H E and cyclin D1 immunostaining of a pulmonary metastasis of a JAZF1 ESS. Panels

    Techniques Used: Immunostaining

    Cyclin D1 immunostaining in the low-grade spindle cell component of YWHAE-FAM22 ESS. The low-grade spindle cell component of YWHAE-FAM22 ESS (bottom right) displays weaker cyclin D1 immunostaining compared to the high-grade round cell component (A-C).
    Figure Legend Snippet: Cyclin D1 immunostaining in the low-grade spindle cell component of YWHAE-FAM22 ESS. The low-grade spindle cell component of YWHAE-FAM22 ESS (bottom right) displays weaker cyclin D1 immunostaining compared to the high-grade round cell component (A-C).

    Techniques Used: Immunostaining

    Representative images of cyclin D1 immunostaining in other uterine tumor. Absent or very focal cyclin D1 immunostaining is seen in the mesenchymal component of an adenosarcoma (A) and a carcinosarcoma (B). Panel C depicts a UES-U with diffuse cyclin D1
    Figure Legend Snippet: Representative images of cyclin D1 immunostaining in other uterine tumor. Absent or very focal cyclin D1 immunostaining is seen in the mesenchymal component of an adenosarcoma (A) and a carcinosarcoma (B). Panel C depicts a UES-U with diffuse cyclin D1

    Techniques Used: Immunostaining

    Cyclin D1 immunostaining in other uterine mesenchymal and mixed epithelial/mesenchymal tumors
    Figure Legend Snippet: Cyclin D1 immunostaining in other uterine mesenchymal and mixed epithelial/mesenchymal tumors

    Techniques Used: Immunostaining

    Scatter plot of the extent of cyclin D1 immunostaining (% moderate to strong nuclear staining) in a series of gynecologic mesenchymal and mixed epithelial and mesenchymal tumors (n = 310). ESS: endometrial stromal sarcoma; UES-U: undifferentiated endometrial
    Figure Legend Snippet: Scatter plot of the extent of cyclin D1 immunostaining (% moderate to strong nuclear staining) in a series of gynecologic mesenchymal and mixed epithelial and mesenchymal tumors (n = 310). ESS: endometrial stromal sarcoma; UES-U: undifferentiated endometrial

    Techniques Used: Immunostaining, Staining

    Cyclin D1 immunostaining in high-grade round cell component of YWHAE-FAM22 ESS. The representative H E and immunostaining images illustrate the diffuse strong nuclear cyclin D1 staining at low (A-D) and high (E-F) magnifications in the high-grade
    Figure Legend Snippet: Cyclin D1 immunostaining in high-grade round cell component of YWHAE-FAM22 ESS. The representative H E and immunostaining images illustrate the diffuse strong nuclear cyclin D1 staining at low (A-D) and high (E-F) magnifications in the high-grade

    Techniques Used: Immunostaining, Staining

    23) Product Images from "Immune Modulation in HLA-G Expressing Head and Neck Squamous Cell Carcinoma in Relation to Human Papilloma Virus Positivity: A Study From Northeast India"

    Article Title: Immune Modulation in HLA-G Expressing Head and Neck Squamous Cell Carcinoma in Relation to Human Papilloma Virus Positivity: A Study From Northeast India

    Journal: Frontiers in Oncology

    doi: 10.3389/fonc.2019.00058

    mRNA expression profile of immune regulatory molecules with HPV and HLA-G7 status. Samples were stratified with respect to HPV and HLA-G7 positivity and mean relative expressions of the target genes were compared. Data showed that when HPV was present with HLA-G7, all the immune regulatory molecules (IL-10 = 0.17 fold, PD1 = 0.49 fold, TGF-β = 0.23 fold, SOCS1 = 0.06 fold and SOCS3 = 0.03 fold) were downregulated whereas, inflammatory IFN-γ (2.97 fold) was overexpressed. In contrast, HPV negative with HLA-G7 samples showed upregulations of all the genes (IL-10 = 2.97 fold, PD1 = 8.95 fold, TGF-β = 14.07 fold, IFN-γ = 33.46 fold, SOCS1 = 1.40 fold and SOCS3 = 1.27 fold). However, HLA-G7 negative HPV positive samples showed downregulations of IFN-γ = 0.31 fold, PD1 = 0.43 fold, TGF-β = 0.05 fold, SOCS1 = 0.020 fold and SOCS3 = 0.005 fold while IL-10 level was comparable to healthy control (0.75 fold). In HLA-G7 and HPV negative samples, increased expressions of all the molecules were observed (IL-10 = 3.85 fold, PD1 = 4.79 fold, TGF-β = 30.18 fold, IFN-γ = 10.58 fold, respectively) except SOCS1 (0.25 fold) and SOCS3 (0.79 fold). Cyclin D1 was upregulated in all the cases but HPV positive HLA-G7 expressing tumors showed lowest expression of cyclin D1 (5.90 fold) as compared to HPV and HLA-G7 negative tumors (16.18 fold).
    Figure Legend Snippet: mRNA expression profile of immune regulatory molecules with HPV and HLA-G7 status. Samples were stratified with respect to HPV and HLA-G7 positivity and mean relative expressions of the target genes were compared. Data showed that when HPV was present with HLA-G7, all the immune regulatory molecules (IL-10 = 0.17 fold, PD1 = 0.49 fold, TGF-β = 0.23 fold, SOCS1 = 0.06 fold and SOCS3 = 0.03 fold) were downregulated whereas, inflammatory IFN-γ (2.97 fold) was overexpressed. In contrast, HPV negative with HLA-G7 samples showed upregulations of all the genes (IL-10 = 2.97 fold, PD1 = 8.95 fold, TGF-β = 14.07 fold, IFN-γ = 33.46 fold, SOCS1 = 1.40 fold and SOCS3 = 1.27 fold). However, HLA-G7 negative HPV positive samples showed downregulations of IFN-γ = 0.31 fold, PD1 = 0.43 fold, TGF-β = 0.05 fold, SOCS1 = 0.020 fold and SOCS3 = 0.005 fold while IL-10 level was comparable to healthy control (0.75 fold). In HLA-G7 and HPV negative samples, increased expressions of all the molecules were observed (IL-10 = 3.85 fold, PD1 = 4.79 fold, TGF-β = 30.18 fold, IFN-γ = 10.58 fold, respectively) except SOCS1 (0.25 fold) and SOCS3 (0.79 fold). Cyclin D1 was upregulated in all the cases but HPV positive HLA-G7 expressing tumors showed lowest expression of cyclin D1 (5.90 fold) as compared to HPV and HLA-G7 negative tumors (16.18 fold).

    Techniques Used: Expressing

    24) Product Images from "Tissue Nonspecific Alkaline Phosphatase Promotes Calvarial Progenitor Cell Cycle Progression and Cytokinesis via Erk1,2."

    Article Title: Tissue Nonspecific Alkaline Phosphatase Promotes Calvarial Progenitor Cell Cycle Progression and Cytokinesis via Erk1,2.

    Journal: Bone

    doi: 10.1016/j.bone.2018.10.013

    TNAP Deficient Cells Exhibit Aberrant Cyclin and Cytokinesis Protein Expression plus G2/M Arrest. (A) Cell cycle proteins cyclin B1 and cyclin D1 are reduced and cyclin E1 expression appears at all time points in synchronized MC3T3E1 TNAP shRNA expressing cells, as compared to control cells. Phosphorylation of cytokinesis related proteins AuroraB and Histone3 are also reduced in synchronized TNAP shRNA expressing cells. (B) MC3T3E1 TNAP shRNA expressing cells and (D) TNAP −/− primary cells show diminished proliferation compared to control cells after synchronization by serum starvation followed by serum stimulation. (D-F) MC3T3E1 TNAP shRNA expressing cells show more cells entering G2/M phase and fewer cells entering S phase after serum stimulation. (G-I) TNAP −/− primary cells show more cells in the G2/M phase and fewer cells entering S phase after serum stimulation. Solid black lines = controls cells. Dashed black lines = TNAP shRNA expressing or TNAP −/− cells. Data are represented as mean ± SD.
    Figure Legend Snippet: TNAP Deficient Cells Exhibit Aberrant Cyclin and Cytokinesis Protein Expression plus G2/M Arrest. (A) Cell cycle proteins cyclin B1 and cyclin D1 are reduced and cyclin E1 expression appears at all time points in synchronized MC3T3E1 TNAP shRNA expressing cells, as compared to control cells. Phosphorylation of cytokinesis related proteins AuroraB and Histone3 are also reduced in synchronized TNAP shRNA expressing cells. (B) MC3T3E1 TNAP shRNA expressing cells and (D) TNAP −/− primary cells show diminished proliferation compared to control cells after synchronization by serum starvation followed by serum stimulation. (D-F) MC3T3E1 TNAP shRNA expressing cells show more cells entering G2/M phase and fewer cells entering S phase after serum stimulation. (G-I) TNAP −/− primary cells show more cells in the G2/M phase and fewer cells entering S phase after serum stimulation. Solid black lines = controls cells. Dashed black lines = TNAP shRNA expressing or TNAP −/− cells. Data are represented as mean ± SD.

    Techniques Used: Expressing, shRNA

    25) Product Images from "MEK drives cyclin D1 hyperelevation during geroconversion"

    Article Title: MEK drives cyclin D1 hyperelevation during geroconversion

    Journal: Cell Death and Differentiation

    doi: 10.1038/cdd.2013.86

    Cyclin D1-positive and -negative senescence in MEL10 cells. ( a ) Proliferation. Mel10 cells were treated with 1 μ M PD0332991 (PD) with or without 5 nM rapamycin (R) for 5 days and counted. C: control (no treatment). Increase in
    Figure Legend Snippet: Cyclin D1-positive and -negative senescence in MEL10 cells. ( a ) Proliferation. Mel10 cells were treated with 1 μ M PD0332991 (PD) with or without 5 nM rapamycin (R) for 5 days and counted. C: control (no treatment). Increase in

    Techniques Used:

    Effects of MEK1 siRNA on senescence-associated cyclin D1 and RP. ( a ) Immunoblot analysis. HT-p21 cells, transfected with MEK1 siRNA or with lipofectamine alone (Mock), were split 4 days after transfection, treated with IPTG for 24 h and lysed.
    Figure Legend Snippet: Effects of MEK1 siRNA on senescence-associated cyclin D1 and RP. ( a ) Immunoblot analysis. HT-p21 cells, transfected with MEK1 siRNA or with lipofectamine alone (Mock), were split 4 days after transfection, treated with IPTG for 24 h and lysed.

    Techniques Used: Transfection

    Effects of cyclin D1 siRNA on p21-induced senescence in HT-p21 cells. ( a ) Immunoblot analysis. HT-p21 cells were transfected with siD1 or transfection reagent alone (mock), split 1 day after transfection and treated with IPTG. Non-transfected cells were
    Figure Legend Snippet: Effects of cyclin D1 siRNA on p21-induced senescence in HT-p21 cells. ( a ) Immunoblot analysis. HT-p21 cells were transfected with siD1 or transfection reagent alone (mock), split 1 day after transfection and treated with IPTG. Non-transfected cells were

    Techniques Used: Transfection

    Effect of MEK inhibitors on senescence-associated cyclin D1 and RP. ( a and b ) Immunoblot analysis. ( a ) HT-p21 cells were treated with 500 nM rapamycin (R), 20 μ M nutlin-3a (N) or 10 μ M U0126 (U) in the presence
    Figure Legend Snippet: Effect of MEK inhibitors on senescence-associated cyclin D1 and RP. ( a and b ) Immunoblot analysis. ( a ) HT-p21 cells were treated with 500 nM rapamycin (R), 20 μ M nutlin-3a (N) or 10 μ M U0126 (U) in the presence

    Techniques Used:

    MEK is required for cyclin D1-positive senescence in normal RPE cells. ( a ) Proliferation and RP. RPE cells were treated with 1 μ M PD0332991 for 7 days and one set of cells was counted. In the second set of cells, the drugs were washed
    Figure Legend Snippet: MEK is required for cyclin D1-positive senescence in normal RPE cells. ( a ) Proliferation and RP. RPE cells were treated with 1 μ M PD0332991 for 7 days and one set of cells was counted. In the second set of cells, the drugs were washed

    Techniques Used:

    Related Articles

    Incubation:

    Article Title: 14-3-3? Plays a Role in Cardiac Ventricular Compaction by Regulating the Cardiomyocyte Cell Cycle
    Article Snippet: .. Briefly, 30 or 50 μg protein was separated on sodium dodecyl sulfate (SDS)-polyacrylamide gels with a 4 to 15% or 8 to 16% gradient and was electroblotted onto nitrocellulose membranes, blocked with 5% milk, and incubated with primary antibodies against the following proteins at the indicated dilutions: 14-3-3ε (1:200; Santa Cruz Biotechnology), p21Cip1 (1:200; Abcam), p27Kip1 (1:500; BD Biosciences, San Jose, CA), p57Kip2 (1:100; Abcam), cyclin D1 (1:500; Thermo Fisher Scientific), cyclin D3 (1:400; Santa Cruz Biotechnology), Skp2 (1:200; Santa Cruz Biotechnology), p15Ink4b (1:1,000; Cell Signaling Technology), cyclin E1 (1:200; Abcam), Cdk2 (1:400; Santa Cruz Biotechnology), and GAPDH (1:2,000; Cell Signaling Technology). ..

    Article Title: Effects of naringin on reversing cisplatin resistance and the Wnt/ β-catenin pathway in human ovarian cancer SKOV3/CDDP cells
    Article Snippet: Western blottingBriefly, 8-µg protein samples that were prepared in ice-cold RIPA buffer were separated on 10% SDS gels, and then transferred onto PVDF membranes. .. The membranes were then blocked in 5% skimmed milk for 2 hours at room temperature, and then incubated overnight with primary antibody solutions for β-catenin, cyclin D1, c-Myc, and tubulin at 4°C. .. The following day, the membranes were incubated with HRP-conjugated secondary antibodies (1:5000) at room temperature for 2 hours.

    Article Title: Downregulation of histone-lysine N-methyltransferase EZH2 inhibits cell viability and enhances chemosensitivity in lung cancer cells
    Article Snippet: .. After washing with TBS-Tween, the membranes were incubated with primary antibodies against EZH2, cyclin D1, p21, C-caspase-3, C-caspase-9, N-cadherin, E-cadherin, vimentin and GAPDH overnight at 4°C. .. After washing, membranes were incubated with goat anti-rabbit secondary antibody (1:2,000; cat. no. 7074; Cell Signaling Technology, Inc.) at room temperature for 1 h. Protein bands were visualized using an enhanced chemiluminescence kit (cat. no. NCI4106; Thermo Fisher Scientific, Inc.) and scanned using the lmageQuant 4000 system (Cytiva).

    other:

    Article Title: Inhibition of circulating exosomal microRNA-15a-3p accelerates diabetic wound repair
    Article Snippet: The primer sequences were: miR-15a-3p, forward, CTGCAGGCCATATTG TGCTGCCTCA, reverse, GTGCAGGGTCCGAGGT; U6, forward, CTCGCTTCGGCAGCACA, reverse, AACGCTTCACGAATTTGCGT; Bcl-2 , forward, GATAACGGAGGCTGGGATGC, reverse, TCACTTGTGGCCCAGATAGG; Bax , forward, CCCTTTTGCTTCAGGGTTTC, reverse, GAGACACTCGCTCAGCTTCTTG; Cyclin D1 , forward, TTGCCCTCTGTGCCACAGAT, reverse, TCAGGTTCAGGCCTTGCACT; Cyclin D3 , forward, CTGGCCATGAACTACCTGGA, reverse, CCAGCAAATCATGTGCAATC; NOX5 , forward, AGTATCATGTACAGGCACCA, reverse, GTTGTCTTGGACACCTTCG; GAPDH, forward, CCGTTGAATTTGCCGTGA, reverse, TGATGACCCTTTTGGCTCCC.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Thermo Fisher cyclin d1
    Blockade of Protein Kinase A impairs T3's effect on β-catenin, <t>Cyclin-D1</t> and hepatocyte proliferation in mice A. A representative western blot using pooled samples from three wells per condition (left) shows increased levels of pSer675-β-catenin and pSer133-CREB in primary mouse hepatocytes after 30 minutes of T3 treatment. Inclusion of PKA inhibitor H89 (1 μM) in the media 30 minutes prior to the addition of T3 (100 nM) showed a notable decrease in pSer675-β-catenin and pSer133-CREB levels. Densitometry on the representative WB (right) shows an increase in pSer675-β-catenin and pSer133-CREB after T3 treatment, which was blocked by H89 treatment. (I.O.D. – integrated optical density). B. A representative western blot shows a decrease in the hepatic levels of pSer675-β-catenin and Cyclin-D1 when H89 was injected twice IP in 3-day T3 fed mice as compared to 3 day T3 only group. Gapdh verifies equal loading. Each lane represents an individual sample. C. A representative micrograph (200×) illustrates a decrease in the number of Cyclin-D1-positive hepatocytes when H89 was injected twice to the 3-day T3-fed mice as compared to T3 only group. Three or more mice per group were used for this study. D. Quantification of the Cyclin-D1-positive hepatocytes shows a significant decrease in positive cells in H89+T3 as compared to T3 only group (*p
    Cyclin D1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cyclin d1/product/Thermo Fisher
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cyclin d1 - by Bioz Stars, 2021-05
    94/100 stars
      Buy from Supplier

    93
    Thermo Fisher anti cyclind1 antibody
    Effects of VPA exposure in utero on the amount of cell cycle regulatory proteins and total acetylated histone H3 protein in the embryonic cerebral walls. A , Immunoblot analysis of <t>cyclinD1,</t> cyclin-dependent kinase (cdk) 2, cdk4, and p27 Kip1 in cerebral walls on E12. B , The amount of each protein in controls was considered to be 100%. C , The amount of total acetylated histone H3 protein in cerebral walls on E12. * p
    Anti Cyclind1 Antibody, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti cyclind1 antibody/product/Thermo Fisher
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti cyclind1 antibody - by Bioz Stars, 2021-05
    93/100 stars
      Buy from Supplier


    N/A
    Phospho Cyclin D1 Thr288 Polyclonal Antibody for Western Blot
      Buy from Supplier

    Image Search Results


    Blockade of Protein Kinase A impairs T3's effect on β-catenin, Cyclin-D1 and hepatocyte proliferation in mice A. A representative western blot using pooled samples from three wells per condition (left) shows increased levels of pSer675-β-catenin and pSer133-CREB in primary mouse hepatocytes after 30 minutes of T3 treatment. Inclusion of PKA inhibitor H89 (1 μM) in the media 30 minutes prior to the addition of T3 (100 nM) showed a notable decrease in pSer675-β-catenin and pSer133-CREB levels. Densitometry on the representative WB (right) shows an increase in pSer675-β-catenin and pSer133-CREB after T3 treatment, which was blocked by H89 treatment. (I.O.D. – integrated optical density). B. A representative western blot shows a decrease in the hepatic levels of pSer675-β-catenin and Cyclin-D1 when H89 was injected twice IP in 3-day T3 fed mice as compared to 3 day T3 only group. Gapdh verifies equal loading. Each lane represents an individual sample. C. A representative micrograph (200×) illustrates a decrease in the number of Cyclin-D1-positive hepatocytes when H89 was injected twice to the 3-day T3-fed mice as compared to T3 only group. Three or more mice per group were used for this study. D. Quantification of the Cyclin-D1-positive hepatocytes shows a significant decrease in positive cells in H89+T3 as compared to T3 only group (*p

    Journal: Hepatology (Baltimore, Md.)

    Article Title: Triiodothyronine induces hepatocyte proliferation by Protein Kinase A-Dependent β-Catenin Activation in Rodents

    doi: 10.1002/hep.26775

    Figure Lengend Snippet: Blockade of Protein Kinase A impairs T3's effect on β-catenin, Cyclin-D1 and hepatocyte proliferation in mice A. A representative western blot using pooled samples from three wells per condition (left) shows increased levels of pSer675-β-catenin and pSer133-CREB in primary mouse hepatocytes after 30 minutes of T3 treatment. Inclusion of PKA inhibitor H89 (1 μM) in the media 30 minutes prior to the addition of T3 (100 nM) showed a notable decrease in pSer675-β-catenin and pSer133-CREB levels. Densitometry on the representative WB (right) shows an increase in pSer675-β-catenin and pSer133-CREB after T3 treatment, which was blocked by H89 treatment. (I.O.D. – integrated optical density). B. A representative western blot shows a decrease in the hepatic levels of pSer675-β-catenin and Cyclin-D1 when H89 was injected twice IP in 3-day T3 fed mice as compared to 3 day T3 only group. Gapdh verifies equal loading. Each lane represents an individual sample. C. A representative micrograph (200×) illustrates a decrease in the number of Cyclin-D1-positive hepatocytes when H89 was injected twice to the 3-day T3-fed mice as compared to T3 only group. Three or more mice per group were used for this study. D. Quantification of the Cyclin-D1-positive hepatocytes shows a significant decrease in positive cells in H89+T3 as compared to T3 only group (*p

    Article Snippet: As expected, a strong nuclear staining for Cyclin-D1 was observed as early as 4 days after T3 treatment in the hepatocytes in the WT mice; au contraire , almost no cyclin-D1-positive hepatocytes were seen in the KO mice ( ).

    Techniques: Mouse Assay, Western Blot, Injection

    Lack of β-catenin in hepatocytes impairs hepatocyte proliferation and Cyclin-D1 expression in response to T3 diet A. Representative microphotographs showing immunohistochemical staining for BrdU in the WT and KO livers after T3-treatment for 4 days (200×). Several BrdU-positive hepatocyte nuclei are observed in livers of WT mice fed T3 for 4 days. KO after T3 treatment lack BrdU staining in the hepatocytes although BrdU-positive non-parenchymal cells are evident, similar to WT livers. At least three WT and KO were used throughout this study. B. A significant (*p

    Journal: Hepatology (Baltimore, Md.)

    Article Title: Triiodothyronine induces hepatocyte proliferation by Protein Kinase A-Dependent β-Catenin Activation in Rodents

    doi: 10.1002/hep.26775

    Figure Lengend Snippet: Lack of β-catenin in hepatocytes impairs hepatocyte proliferation and Cyclin-D1 expression in response to T3 diet A. Representative microphotographs showing immunohistochemical staining for BrdU in the WT and KO livers after T3-treatment for 4 days (200×). Several BrdU-positive hepatocyte nuclei are observed in livers of WT mice fed T3 for 4 days. KO after T3 treatment lack BrdU staining in the hepatocytes although BrdU-positive non-parenchymal cells are evident, similar to WT livers. At least three WT and KO were used throughout this study. B. A significant (*p

    Article Snippet: As expected, a strong nuclear staining for Cyclin-D1 was observed as early as 4 days after T3 treatment in the hepatocytes in the WT mice; au contraire , almost no cyclin-D1-positive hepatocytes were seen in the KO mice ( ).

    Techniques: Expressing, Immunohistochemistry, Staining, Mouse Assay, BrdU Staining

    T3 induced β-catenin activation via Ser675-phosphorylation A. qRT-PCR analysis of β-catenin expression (normalized to cyclophilin A) in C57BL6 mice treated with T3 for 4 days shows no change. Error bars represent the standard error (S.E.) of TaqMan RT-PCR performed in triplicates. B. Representative western blots show T3 feeding for 4 days does not lead to a notable increase in total β-catenin when compared to basal diet fed mice. However Cyclin-D1 levels are consistently increased. GSK3β-Ser9 levels remain unaffected at 4 days of T3 treatment. Gapdh verifies equal loading. Each lane represents an individual sample. C. Immunoprecipitation studies from three representative livers show no change in association of β-catenin and E-cadherin in the livers of 4 days T3- versus basal diet-fed C57BL/6 mice. D. Representative western blot shows a noteworthy increase in pSer675-β-catenin levels in 4 days T3-fed as compared to control diet-fed C57BL/6 mice. Gapdh verified equal loading.

    Journal: Hepatology (Baltimore, Md.)

    Article Title: Triiodothyronine induces hepatocyte proliferation by Protein Kinase A-Dependent β-Catenin Activation in Rodents

    doi: 10.1002/hep.26775

    Figure Lengend Snippet: T3 induced β-catenin activation via Ser675-phosphorylation A. qRT-PCR analysis of β-catenin expression (normalized to cyclophilin A) in C57BL6 mice treated with T3 for 4 days shows no change. Error bars represent the standard error (S.E.) of TaqMan RT-PCR performed in triplicates. B. Representative western blots show T3 feeding for 4 days does not lead to a notable increase in total β-catenin when compared to basal diet fed mice. However Cyclin-D1 levels are consistently increased. GSK3β-Ser9 levels remain unaffected at 4 days of T3 treatment. Gapdh verifies equal loading. Each lane represents an individual sample. C. Immunoprecipitation studies from three representative livers show no change in association of β-catenin and E-cadherin in the livers of 4 days T3- versus basal diet-fed C57BL/6 mice. D. Representative western blot shows a noteworthy increase in pSer675-β-catenin levels in 4 days T3-fed as compared to control diet-fed C57BL/6 mice. Gapdh verified equal loading.

    Article Snippet: As expected, a strong nuclear staining for Cyclin-D1 was observed as early as 4 days after T3 treatment in the hepatocytes in the WT mice; au contraire , almost no cyclin-D1-positive hepatocytes were seen in the KO mice ( ).

    Techniques: Activation Assay, Quantitative RT-PCR, Expressing, Mouse Assay, Reverse Transcription Polymerase Chain Reaction, Western Blot, Immunoprecipitation

    Blockade of Protein Kinase A impairs T3's effect on β-catenin, Cyclin-D1 and hepatocyte proliferation in rats A. Representative microphotographs (200×) illustrate the effect of H89 on T3-induced rat hepatocyte proliferation by BrdU immunohistochemistry. H89 was given 1 hour prior to a single dose of T3 (20 μg/100 g) and the rats were sacrificed 24 hours later. Minimum four rats per group were used for this entire study. B. Quantification of BrdU positive hepatocytes in A shows a significant (*p

    Journal: Hepatology (Baltimore, Md.)

    Article Title: Triiodothyronine induces hepatocyte proliferation by Protein Kinase A-Dependent β-Catenin Activation in Rodents

    doi: 10.1002/hep.26775

    Figure Lengend Snippet: Blockade of Protein Kinase A impairs T3's effect on β-catenin, Cyclin-D1 and hepatocyte proliferation in rats A. Representative microphotographs (200×) illustrate the effect of H89 on T3-induced rat hepatocyte proliferation by BrdU immunohistochemistry. H89 was given 1 hour prior to a single dose of T3 (20 μg/100 g) and the rats were sacrificed 24 hours later. Minimum four rats per group were used for this entire study. B. Quantification of BrdU positive hepatocytes in A shows a significant (*p

    Article Snippet: As expected, a strong nuclear staining for Cyclin-D1 was observed as early as 4 days after T3 treatment in the hepatocytes in the WT mice; au contraire , almost no cyclin-D1-positive hepatocytes were seen in the KO mice ( ).

    Techniques: Immunohistochemistry

    Activation of β-catenin signaling in rat livers after T3-feeding Immunostaining shows β-catenin localizing to the hepatocyte membrane in the control livers, while it accumulates in the hepatocyte cytoplasm in T3-fed rats at 2 days. A progressive shift of β-catenin stabilization from zone I towards zone II along with nuclear translocation of β-catenin-positive is observed at day 4 of T3 feeding. A concomitant increase in the number of GS-positive cells around central vein is observed at 4 days after T3. Progressive Cyclin-D1 nuclear staining is evident in zone I at 2 days, and in zone I and II at 4 days of T3 feeding as compared to the control livers. Four rats per group were used for this study.

    Journal: Hepatology (Baltimore, Md.)

    Article Title: Triiodothyronine induces hepatocyte proliferation by Protein Kinase A-Dependent β-Catenin Activation in Rodents

    doi: 10.1002/hep.26775

    Figure Lengend Snippet: Activation of β-catenin signaling in rat livers after T3-feeding Immunostaining shows β-catenin localizing to the hepatocyte membrane in the control livers, while it accumulates in the hepatocyte cytoplasm in T3-fed rats at 2 days. A progressive shift of β-catenin stabilization from zone I towards zone II along with nuclear translocation of β-catenin-positive is observed at day 4 of T3 feeding. A concomitant increase in the number of GS-positive cells around central vein is observed at 4 days after T3. Progressive Cyclin-D1 nuclear staining is evident in zone I at 2 days, and in zone I and II at 4 days of T3 feeding as compared to the control livers. Four rats per group were used for this study.

    Article Snippet: As expected, a strong nuclear staining for Cyclin-D1 was observed as early as 4 days after T3 treatment in the hepatocytes in the WT mice; au contraire , almost no cyclin-D1-positive hepatocytes were seen in the KO mice ( ).

    Techniques: Activation Assay, Immunostaining, Translocation Assay, Staining

    Immunohistochemical characterization of hepatoblastoma (HB) in S45Y–β-catenin-S127A-YAP1 and S33Y-β-catenin-S127A-YAP1 mice. Representative immunohistochemical analysis of liver sections from wild-type (WT) mice as well as S45Y–β-catenin-S127A-YAP1 and S33Y–β-catenin-S127A-YAP1 mice at 9 to 10 weeks after hydrodynamic tail vein injection, showing HB to be positive for proliferation marker Ki-67 and β-catenin targets glutamine synthetase (GS) and cyclin D1. Arrowheads indicate the few Ki-67–positive cells in the WT liver. Scale bars = 100 μm.

    Journal: The American Journal of Pathology

    Article Title: β-Catenin and Yes-Associated Protein 1 Cooperate in Hepatoblastoma Pathogenesis

    doi: 10.1016/j.ajpath.2019.02.002

    Figure Lengend Snippet: Immunohistochemical characterization of hepatoblastoma (HB) in S45Y–β-catenin-S127A-YAP1 and S33Y-β-catenin-S127A-YAP1 mice. Representative immunohistochemical analysis of liver sections from wild-type (WT) mice as well as S45Y–β-catenin-S127A-YAP1 and S33Y–β-catenin-S127A-YAP1 mice at 9 to 10 weeks after hydrodynamic tail vein injection, showing HB to be positive for proliferation marker Ki-67 and β-catenin targets glutamine synthetase (GS) and cyclin D1. Arrowheads indicate the few Ki-67–positive cells in the WT liver. Scale bars = 100 μm.

    Article Snippet: Sustained GS expression and only a moderate decrease in cyclin D1 (which are both β-catenin–TCF4 targets) were observed, whereas YAP1 target proteins were dramatically reduced, as in dnTCF4 cohorts ( and ).

    Techniques: Immunohistochemistry, Mouse Assay, Injection, Marker

    Characterization of hepatoblastoma in S45Y–β-catenin-S127A-YAP1 and S33Y–β-catenin-S127A-YAP1 mice by analysis of liver lysates. Western blot analysis using lysates from the same groups of mice shows increased levels of β-catenin targets glutamine synthetase (GS), cyclin D1, and regucalcin, as well as YAP1 targets survivin, Cyr61, and jagged 1, compared with wild-type (WT) livers from age-matched mice. Glyceraldehyde-3–phosphate dehydrogenase (GAPDH) verified comparable loading. Molecular weights are indicated to the right of each blot. Arrows indicate the correct molecular weight band.

    Journal: The American Journal of Pathology

    Article Title: β-Catenin and Yes-Associated Protein 1 Cooperate in Hepatoblastoma Pathogenesis

    doi: 10.1016/j.ajpath.2019.02.002

    Figure Lengend Snippet: Characterization of hepatoblastoma in S45Y–β-catenin-S127A-YAP1 and S33Y–β-catenin-S127A-YAP1 mice by analysis of liver lysates. Western blot analysis using lysates from the same groups of mice shows increased levels of β-catenin targets glutamine synthetase (GS), cyclin D1, and regucalcin, as well as YAP1 targets survivin, Cyr61, and jagged 1, compared with wild-type (WT) livers from age-matched mice. Glyceraldehyde-3–phosphate dehydrogenase (GAPDH) verified comparable loading. Molecular weights are indicated to the right of each blot. Arrows indicate the correct molecular weight band.

    Article Snippet: Sustained GS expression and only a moderate decrease in cyclin D1 (which are both β-catenin–TCF4 targets) were observed, whereas YAP1 target proteins were dramatically reduced, as in dnTCF4 cohorts ( and ).

    Techniques: Mouse Assay, Western Blot, Molecular Weight

    Protein expression of Wnt and YAP1 targets in dnTEAD2 or dnTCF4 + S45Y–β-catenin-S127A-YAP1 or S33Y–β-catenin-S127A-YAP1 livers. A: Western blot analysis of β-catenin targets glutamine synthetase (GS), cyclin D1, and regucalcin, as well as YAP1 targets survivin, Cyr61, and jagged 1, with or without dnTEAD2 or dnTCF4 in S45Y–β-catenin-S127A-YAP1 mice. All targets that were increased in S45Y–β-catenin-S127A-YAP1 livers relative to wild type (WT) are notably decreased with co-introduction of dnTCF4 or dnTEAD2. Arrows indicate the correct molecular weight. Molecular weights of each protein are indicated to the right. Glyceraldehyde-3–phosphate dehydrogenase (GAPDH) verifies comparable protein loading. B: Western blot analysis of β-catenin targets GS, cyclin D1, and regucalcin, as well as YAP1 targets survivin, Cyr61, and jagged 1, with or without dnTEAD2 or dnTCF4 in S33Y–β-catenin-S127A-YAP1 mice. All targets that are increased in S33Y–β-catenin-S127A-YAP1 livers relative to WT are notably decreased with co-introduction of dnTCF4. However, GS is completely unaffected and cyclin D1 is only modestly affected in S33Y–β-catenin-S127A-YAP1-dnTEAD2 livers. Arrow indicates the correct molecular weight. Molecular weights of each protein are indicated to the right. GAPDH verifies comparable protein loading.

    Journal: The American Journal of Pathology

    Article Title: β-Catenin and Yes-Associated Protein 1 Cooperate in Hepatoblastoma Pathogenesis

    doi: 10.1016/j.ajpath.2019.02.002

    Figure Lengend Snippet: Protein expression of Wnt and YAP1 targets in dnTEAD2 or dnTCF4 + S45Y–β-catenin-S127A-YAP1 or S33Y–β-catenin-S127A-YAP1 livers. A: Western blot analysis of β-catenin targets glutamine synthetase (GS), cyclin D1, and regucalcin, as well as YAP1 targets survivin, Cyr61, and jagged 1, with or without dnTEAD2 or dnTCF4 in S45Y–β-catenin-S127A-YAP1 mice. All targets that were increased in S45Y–β-catenin-S127A-YAP1 livers relative to wild type (WT) are notably decreased with co-introduction of dnTCF4 or dnTEAD2. Arrows indicate the correct molecular weight. Molecular weights of each protein are indicated to the right. Glyceraldehyde-3–phosphate dehydrogenase (GAPDH) verifies comparable protein loading. B: Western blot analysis of β-catenin targets GS, cyclin D1, and regucalcin, as well as YAP1 targets survivin, Cyr61, and jagged 1, with or without dnTEAD2 or dnTCF4 in S33Y–β-catenin-S127A-YAP1 mice. All targets that are increased in S33Y–β-catenin-S127A-YAP1 livers relative to WT are notably decreased with co-introduction of dnTCF4. However, GS is completely unaffected and cyclin D1 is only modestly affected in S33Y–β-catenin-S127A-YAP1-dnTEAD2 livers. Arrow indicates the correct molecular weight. Molecular weights of each protein are indicated to the right. GAPDH verifies comparable protein loading.

    Article Snippet: Sustained GS expression and only a moderate decrease in cyclin D1 (which are both β-catenin–TCF4 targets) were observed, whereas YAP1 target proteins were dramatically reduced, as in dnTCF4 cohorts ( and ).

    Techniques: Expressing, Western Blot, Mouse Assay, Molecular Weight

    Characterization of livers in dnTEAD2 or dnTCF4 + S45Y–β-catenin-S127A-YAP1 or S33Y–β-catenin-S127A-YAP1 mice. A: Representative immunohistochemistry of liver sections shows lack of Ki-67–positive cells in the S45Y–β-catenin-YAP1-dnTEAD2 and S33Y–β-catenin-YAP1-dnTEAD2 groups. Cyclin D1 was normalized to its midzonal expression in S45Y/S33Y–β-catenin-YAP1-dnTEAD2 groups. Glutamine synthetase (GS) was normalized to its predominantly pericentral expression, with only a few random GS-positive hepatocytes ( arrowheads ) staying in the S45Y/S33Y–β-catenin-YAP1-dnTEAD2 groups. More frequent GS-positive cells and occasionally a few cell clusters of GS-positive hepatocytes are seen in the S33Y–β-catenin-YAP1-dnTEAD2 group. B: Representative immunohistochemistry of liver sections shows lack of Ki-67–positive cells in the S45Y–β-catenin-YAP1-dnTCF4 and S33Y–β-catenin-YAP1-dnTCF4 groups. Cyclin D1 was normalized to its midzonal expression in the S45Y/S33Y–β-catenin-YAP1-dnTCF4 groups, as was GS to its predominantly pericentral expression. Scale bars = 100 μm ( A and B ). Original magnification, ×100 ( A and B ).

    Journal: The American Journal of Pathology

    Article Title: β-Catenin and Yes-Associated Protein 1 Cooperate in Hepatoblastoma Pathogenesis

    doi: 10.1016/j.ajpath.2019.02.002

    Figure Lengend Snippet: Characterization of livers in dnTEAD2 or dnTCF4 + S45Y–β-catenin-S127A-YAP1 or S33Y–β-catenin-S127A-YAP1 mice. A: Representative immunohistochemistry of liver sections shows lack of Ki-67–positive cells in the S45Y–β-catenin-YAP1-dnTEAD2 and S33Y–β-catenin-YAP1-dnTEAD2 groups. Cyclin D1 was normalized to its midzonal expression in S45Y/S33Y–β-catenin-YAP1-dnTEAD2 groups. Glutamine synthetase (GS) was normalized to its predominantly pericentral expression, with only a few random GS-positive hepatocytes ( arrowheads ) staying in the S45Y/S33Y–β-catenin-YAP1-dnTEAD2 groups. More frequent GS-positive cells and occasionally a few cell clusters of GS-positive hepatocytes are seen in the S33Y–β-catenin-YAP1-dnTEAD2 group. B: Representative immunohistochemistry of liver sections shows lack of Ki-67–positive cells in the S45Y–β-catenin-YAP1-dnTCF4 and S33Y–β-catenin-YAP1-dnTCF4 groups. Cyclin D1 was normalized to its midzonal expression in the S45Y/S33Y–β-catenin-YAP1-dnTCF4 groups, as was GS to its predominantly pericentral expression. Scale bars = 100 μm ( A and B ). Original magnification, ×100 ( A and B ).

    Article Snippet: Sustained GS expression and only a moderate decrease in cyclin D1 (which are both β-catenin–TCF4 targets) were observed, whereas YAP1 target proteins were dramatically reduced, as in dnTCF4 cohorts ( and ).

    Techniques: Mouse Assay, Immunohistochemistry, Expressing

    Correlation between GALR methylation and expression of downstream proteins. Correlation between GALR1 methylation status and (A) p27 Kip1 , (B) p57 Kip2 , and (C) cyclin D1. Correlation between GALR2 methylation status and (D) p27 Kip1 , (E) p57 Kip2 and (F) cyclin D1. Asterisks mean significant differences (**P

    Journal: Oncology Letters

    Article Title: Epigenetic inactivation of galanin receptors in salivary duct carcinoma of the parotid gland: Potential utility as biomarkers for prognosis

    doi: 10.3892/ol.2018.8525

    Figure Lengend Snippet: Correlation between GALR methylation and expression of downstream proteins. Correlation between GALR1 methylation status and (A) p27 Kip1 , (B) p57 Kip2 , and (C) cyclin D1. Correlation between GALR2 methylation status and (D) p27 Kip1 , (E) p57 Kip2 and (F) cyclin D1. Asterisks mean significant differences (**P

    Article Snippet: For EGFR, according to the criteria for evaluating responsiveness of colorectal carcinoma to anti-EGFR treatment, a score of 0–2 was considered as EGFR negative and a score of 3 was considered as EGFR positive. p27 scoring was determined by the criteria of ovarian carcinoma: 1+ < 5%, 2+ 5–50%, 3+ > 50%; p57 was in accordance to vulva carcinoma criteria: 1+ < 10%, 2+ 10–50%, 3+ > 50%; and cyclin D1 was scored according to breast carcinoma criteria (− < 10%, + ≥10%).

    Techniques: Methylation, Expressing

    Effects of VPA exposure in utero on the amount of cell cycle regulatory proteins and total acetylated histone H3 protein in the embryonic cerebral walls. A , Immunoblot analysis of cyclinD1, cyclin-dependent kinase (cdk) 2, cdk4, and p27 Kip1 in cerebral walls on E12. B , The amount of each protein in controls was considered to be 100%. C , The amount of total acetylated histone H3 protein in cerebral walls on E12. * p

    Journal: The Journal of Neuroscience

    Article Title: In Utero Exposure to Valproic Acid Induces Neocortical Dysgenesis via Dysregulation of Neural Progenitor Cell Proliferation/Differentiation

    doi: 10.1523/JNEUROSCI.0229-16.2016

    Figure Lengend Snippet: Effects of VPA exposure in utero on the amount of cell cycle regulatory proteins and total acetylated histone H3 protein in the embryonic cerebral walls. A , Immunoblot analysis of cyclinD1, cyclin-dependent kinase (cdk) 2, cdk4, and p27 Kip1 in cerebral walls on E12. B , The amount of each protein in controls was considered to be 100%. C , The amount of total acetylated histone H3 protein in cerebral walls on E12. * p

    Article Snippet: The following antibodies were used for immunoblot analysis: anti-cyclinD1 antibody (1:250; RM-9104, Thermo Fischer Scientific, RRID: AB_720758; 4°C, overnight), anti-cyclin-dependent kinase (cdk) 2 antibody (1:250; sc-163, Santa Cruz Biotechnology, RRID: AB_631215; 4°C, overnight), anti-cdk4 antibody (1:250; sc-260, Santa Cruz Biotechnology, RRID: AB_631219; 4°C, overnight), and anti-p27Kip1 antibody (1:500; 610241, Becton Dickinson, RRID: AB_397636; 4°C, overnight).

    Techniques: In Utero