cycle sequencing kits  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher cycle sequencing kits
    Cycle Sequencing Kits, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cycle sequencing kits/product/Thermo Fisher
    Average 99 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    cycle sequencing kits - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: On the genomics of immunoglobulins in the gray, short-tailed opossum Monodelphis domestica
    Article Snippet: .. PCR products were cloned using TOPO TA cloning Kit (Invitrogen, Carsbad, CA) and sequenced using BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA). .. Sequences were analyzed using Sequencher 3.0 (Gene Codes, Ann Arbor, MI) and compared with the GenBank database and the MonDom5 assembly using the BLAST algorithm ( ).

    Amplification:

    Article Title: On the genomics of immunoglobulins in the gray, short-tailed opossum Monodelphis domestica
    Article Snippet: These primers amplified a 855 bp fragment from M. domestica genomic DNA, which was cloned and sequenced. .. PCR products were cloned using TOPO TA cloning Kit (Invitrogen, Carsbad, CA) and sequenced using BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA).

    Article Title: p53 mutations in classic and pleomorphic invasive lobular carcinoma of the breast
    Article Snippet: Sequencing and mutation analysis For the detection of mutations, genomic DNA was amplified with primers flanking exons 4, 5, 6, 7, 8 and 9 of the TP53 gene (Table ). .. The PCR conditions were set up as follows; initial denaturation at 94°C for 3 min, 35 cycles at 94°C for 1 min (denaturation), 60°C for 30 s (annealing) and 72°C for 45 s (extension), followed by a final extension at 72°C for 5 min. Then, PCR products were sequenced in both sense and antisense directions using the BigDye Terminator v1.1 sequencing kit on ABI 3130 (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions.

    Article Title: Immunoglobulin gene rearrangement IGHV3-48 is a predictive marker of histological transformation into aggressive lymphoma in follicular lymphomas
    Article Snippet: .. IGH rearrangement sequencing and identification PCR products were sequenced in forward and reverse reads, using the same primers as for PCR amplification and the Big-Dye® Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) . .. Sequencing was carried out with an ABI 3500xL DNA Sequencer (Applied Biosystems).

    Article Title: Analysis of Genetic Alterations in Tunisian Patients with Lung Adenocarcinoma
    Article Snippet: Mutation Analysis Exon 2 of KRAS and exons 18–21 of EGFR were amplified in 53 of the 73 cases by polymerase chain reaction (PCR) assay using the primers indicated in . .. PCR product was purified using exonuclease and then submitted to sequencing using an ABI PRISM 3100-Avant automated DNA sequencer with the BigDye Terminator Cycle Sequencing reaction kit v1.1. (catalog number 4337450, Thermo Fisher Scientific, Monza, Italy).

    Article Title: Mice with Alopecia, Osteoporosis, and Systemic Amyloidosis Due to Mutation in Zdhhc13, a Gene Coding for Palmitoyl Acyltransferase
    Article Snippet: .. Amplification conditions were an initial denaturation of 4 min. at 94°C, followed by 20 cycles of touchdown PCR in 30 s at 94°C, 30 s at 65°C (decrease 0.5°C per cycle), 40 s at 72°C; and a final 20 cycles in 30 s at 94°C, 30 s at 55°C, followed by 40 s at 72°C and then a final extension at 72°C for 5 min. All amplified PCR fragments were digested with shrimp alkaline phosphatase and Exo I to remove unincorporated primers and sequenced using the BigDye Terminator Cycle Sequencing Kit v1.1/3.1 (Applied Biosystems, Foster City, CA, USA) following the manufacturer's instructions. .. Sequencing products were separated on either ABI PRISM 3100 Genetic Analyzer or ABI PRISM 3700 DNA Analyzer (Applied Biosystems).

    Article Title: Analysis of human MDM4 variants in papillary thyroid carcinomas reveals new potential markers of cancer properties
    Article Snippet: Genetic analysis of TP53 mutation, BRAF mutations and ret/PTC rearrangements Analysis of the TP53 gene status was performed as follows: exons 5, 6, 7, and 8 of p53 gene were sequentially amplified by polymerase chain reaction (PCR) assay with the use of AmpliTaq Gold (Applied Biosystems) and following primer sets: exon 5 sense: TTCCTCTTCCTACAGTACTC; exon 5 antisense: GCCCCAGCTGTTCAC; exon 6 sense: ACTGATTGCTCTTAG; exon 6 antisense: AGTTGCAAACCAGAC; exon 7 sense: AGTTGTGTTATCTCCTAG; exon 7 antisense: CAAGTGGCTCCTGAC; exon 8 sense: TCCTATCCTGAGTAG; exon 8 antisense: GTCCTGCTTGCTTAC. .. Purified PCR products were sequenced in both directions with the use of the BigDye terminator Cycle sequencing Kit (version 1.1, Applied Biosystems) and an ABI Genetic Analyzer (Model 3130, Applied Biosystems).

    Modification:

    Article Title: Criteria for effective design, construction, and gene knockdown by shRNA vectors
    Article Snippet: Sequencing reactions were 12.5 uL total volume containing 1 × BigDye Terminator v1.1 Cycle Sequencing Ready Reaction Mix (Applied Biosystems), 0.26 ug of DNA and 3.75 pmole of primer. .. Modified sequencing reactions substituted part or all of the BigDye v1.1 chemistry with ABI Prism dGTP BigDye Terminator Ready Reaction Mix (Applied Biosystems).

    Selection:

    Article Title: Analysis of Genetic Alterations in Tunisian Patients with Lung Adenocarcinoma
    Article Snippet: PCR product was purified using exonuclease and then submitted to sequencing using an ABI PRISM 3100-Avant automated DNA sequencer with the BigDye Terminator Cycle Sequencing reaction kit v1.1. (catalog number 4337450, Thermo Fisher Scientific, Monza, Italy). .. The MassARRAY (Sequenom) testing was carried out on 20 cases, and the selection of the methodology to be used was done on the basis of the amount of tumor tissue available.

    Article Title: Antibiotic Resistance Profiling, Analysis of Virulence Aspects and Molecular Genotyping of Staphylococcus aureus Isolated in Sicily, Italy
    Article Snippet: The selection was performed in such a way that at least one isolate for each pulsotype and different year, if available, could be analyzed. .. The purified samples were used for sequencing using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) followed by capillary electrophoresis on the ABI Prism 310 Genetic Analyzer (Applied Biosystems) as described in D'Andrea et al. ( ).

    Mutagenesis:

    Article Title: p53 mutations in classic and pleomorphic invasive lobular carcinoma of the breast
    Article Snippet: Paragraph title: Sequencing and mutation analysis ... The PCR conditions were set up as follows; initial denaturation at 94°C for 3 min, 35 cycles at 94°C for 1 min (denaturation), 60°C for 30 s (annealing) and 72°C for 45 s (extension), followed by a final extension at 72°C for 5 min. Then, PCR products were sequenced in both sense and antisense directions using the BigDye Terminator v1.1 sequencing kit on ABI 3130 (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions.

    Article Title: Analysis of Genetic Alterations in Tunisian Patients with Lung Adenocarcinoma
    Article Snippet: Paragraph title: 2.2.2. Mutation Analysis ... PCR product was purified using exonuclease and then submitted to sequencing using an ABI PRISM 3100-Avant automated DNA sequencer with the BigDye Terminator Cycle Sequencing reaction kit v1.1. (catalog number 4337450, Thermo Fisher Scientific, Monza, Italy).

    Article Title: Mice with Alopecia, Osteoporosis, and Systemic Amyloidosis Due to Mutation in Zdhhc13, a Gene Coding for Palmitoyl Acyltransferase
    Article Snippet: Paragraph title: Identification of the Mutant Gene ... Amplification conditions were an initial denaturation of 4 min. at 94°C, followed by 20 cycles of touchdown PCR in 30 s at 94°C, 30 s at 65°C (decrease 0.5°C per cycle), 40 s at 72°C; and a final 20 cycles in 30 s at 94°C, 30 s at 55°C, followed by 40 s at 72°C and then a final extension at 72°C for 5 min. All amplified PCR fragments were digested with shrimp alkaline phosphatase and Exo I to remove unincorporated primers and sequenced using the BigDye Terminator Cycle Sequencing Kit v1.1/3.1 (Applied Biosystems, Foster City, CA, USA) following the manufacturer's instructions.

    Article Title: Analysis of human MDM4 variants in papillary thyroid carcinomas reveals new potential markers of cancer properties
    Article Snippet: Paragraph title: Genetic analysis of TP53 mutation, BRAF mutations and ret/PTC rearrangements ... Purified PCR products were sequenced in both directions with the use of the BigDye terminator Cycle sequencing Kit (version 1.1, Applied Biosystems) and an ABI Genetic Analyzer (Model 3130, Applied Biosystems).

    Article Title: A Novel KCNJ2 Mutation Identified in an Autistic Proband Affects the Single Channel Properties of Kir2.1
    Article Snippet: Sequencing reactions were performed on both strands using the BigDye Terminator Cycle Sequencing kit v1.1 and an automated ABI-3130 DNA sequencer (Applied Biosystems, Foster City, CA, USA). .. Mutation detection was performed using ChromasPro v1.34 (Technelysium Ltd.) software.

    Polymerase Chain Reaction:

    Article Title: On the genomics of immunoglobulins in the gray, short-tailed opossum Monodelphis domestica
    Article Snippet: .. PCR products were cloned using TOPO TA cloning Kit (Invitrogen, Carsbad, CA) and sequenced using BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA). .. Sequences were analyzed using Sequencher 3.0 (Gene Codes, Ann Arbor, MI) and compared with the GenBank database and the MonDom5 assembly using the BLAST algorithm ( ).

    Article Title: p53 mutations in classic and pleomorphic invasive lobular carcinoma of the breast
    Article Snippet: .. The PCR conditions were set up as follows; initial denaturation at 94°C for 3 min, 35 cycles at 94°C for 1 min (denaturation), 60°C for 30 s (annealing) and 72°C for 45 s (extension), followed by a final extension at 72°C for 5 min. Then, PCR products were sequenced in both sense and antisense directions using the BigDye Terminator v1.1 sequencing kit on ABI 3130 (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. .. The sequences were analyzed using Mutation Surveyor software (SoftGenetics,LLC., State College, PA, USA).

    Article Title: Immunoglobulin gene rearrangement IGHV3-48 is a predictive marker of histological transformation into aggressive lymphoma in follicular lymphomas
    Article Snippet: .. IGH rearrangement sequencing and identification PCR products were sequenced in forward and reverse reads, using the same primers as for PCR amplification and the Big-Dye® Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) . .. Sequencing was carried out with an ABI 3500xL DNA Sequencer (Applied Biosystems).

    Article Title: Analysis of Genetic Alterations in Tunisian Patients with Lung Adenocarcinoma
    Article Snippet: .. PCR product was purified using exonuclease and then submitted to sequencing using an ABI PRISM 3100-Avant automated DNA sequencer with the BigDye Terminator Cycle Sequencing reaction kit v1.1. (catalog number 4337450, Thermo Fisher Scientific, Monza, Italy). .. Each exon was sequenced on both strands, amplified, and then sequenced again on both strands to eliminate the risk of PCR artifacts.

    Article Title: Antibiotic Resistance Profiling, Analysis of Virulence Aspects and Molecular Genotyping of Staphylococcus aureus Isolated in Sicily, Italy
    Article Snippet: PCR products derived from the seven housekeeping genes (arcc , aroe , glpf , gmk , pta , tpi , yqil ) were treated with HT ExoSAP-IT (Affymetrix) following the manufacturer's instruction. .. The purified samples were used for sequencing using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) followed by capillary electrophoresis on the ABI Prism 310 Genetic Analyzer (Applied Biosystems) as described in D'Andrea et al. ( ).

    Article Title: Mice with Alopecia, Osteoporosis, and Systemic Amyloidosis Due to Mutation in Zdhhc13, a Gene Coding for Palmitoyl Acyltransferase
    Article Snippet: .. Amplification conditions were an initial denaturation of 4 min. at 94°C, followed by 20 cycles of touchdown PCR in 30 s at 94°C, 30 s at 65°C (decrease 0.5°C per cycle), 40 s at 72°C; and a final 20 cycles in 30 s at 94°C, 30 s at 55°C, followed by 40 s at 72°C and then a final extension at 72°C for 5 min. All amplified PCR fragments were digested with shrimp alkaline phosphatase and Exo I to remove unincorporated primers and sequenced using the BigDye Terminator Cycle Sequencing Kit v1.1/3.1 (Applied Biosystems, Foster City, CA, USA) following the manufacturer's instructions. .. Sequencing products were separated on either ABI PRISM 3100 Genetic Analyzer or ABI PRISM 3700 DNA Analyzer (Applied Biosystems).

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: DNA sequencing The cycle sequencing reaction (20 μl) was performed with the Cycle Sequencing Mix (8 μl) from the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems), containing ∼0.3 pmol of the template and 4 pmol of the sequencing primer (20-mer), in the presence of 40 pmol or 1 nmol of 4-propynyl-1-(β-D-ribofuranosyl)pyrrole-2-carbaldehyde 5′-triphosphate (d Pa′ TP) (40 pmol for DNA fragments containing one Ds base and 1 nmol for DNAs with two Ds bases) or 1 nmol of dd Pa′ TP. .. After 25 cycles of PCR (96°C, 10 s; 50°C, 5 s; 60°C, 4 min), the residual dye terminators were removed from the reaction with CENTRI-SEP columns (Princeton Separations), and the solutions were dried.

    Article Title: Analysis of human MDM4 variants in papillary thyroid carcinomas reveals new potential markers of cancer properties
    Article Snippet: .. Purified PCR products were sequenced in both directions with the use of the BigDye terminator Cycle sequencing Kit (version 1.1, Applied Biosystems) and an ABI Genetic Analyzer (Model 3130, Applied Biosystems). .. Sequence data were analyzed by means of SeqScape software (version 2.1, Applied Biosystems) followed by manual review.

    Article Title: HylA, an Alternative Hydrolase for Initiation of Catabolism of the Phenylurea Herbicide Linuron in Variovorax sp. Strains
    Article Snippet: .. Amplicons were purified with the Qiaquick PCR purification kit (Qiagen) according to the manufacturer's instructions and sequenced using the BigDye Terminator cycle sequencing kit (Applied Biosystems) as described by the manufacturer. .. The sequencing reaction was performed on a thermocycler UNOII (Biometra, Germany).

    TA Cloning:

    Article Title: On the genomics of immunoglobulins in the gray, short-tailed opossum Monodelphis domestica
    Article Snippet: .. PCR products were cloned using TOPO TA cloning Kit (Invitrogen, Carsbad, CA) and sequenced using BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA). .. Sequences were analyzed using Sequencher 3.0 (Gene Codes, Ann Arbor, MI) and compared with the GenBank database and the MonDom5 assembly using the BLAST algorithm ( ).

    Construct:

    Article Title: Criteria for effective design, construction, and gene knockdown by shRNA vectors
    Article Snippet: Sequencing reactions were 12.5 uL total volume containing 1 × BigDye Terminator v1.1 Cycle Sequencing Ready Reaction Mix (Applied Biosystems), 0.26 ug of DNA and 3.75 pmole of primer. .. The shRNA vectors used to assess sequencing efficacy were constructed as stem loop hairpins as described above and contain the following target sequences: pHSPG-shTLR4, AGGTGATTGTTGTGGTGTC; pHSPG-shmutTLR4, AGGTGATTCTTGTGGTGTC; pHSPG-shmCNN3, AGGAATGAGCGTGTATGGG; and pHSPG-shTLR2, GTATGAACTGGACTTCTCC.

    Purification:

    Article Title: Analysis of Genetic Alterations in Tunisian Patients with Lung Adenocarcinoma
    Article Snippet: .. PCR product was purified using exonuclease and then submitted to sequencing using an ABI PRISM 3100-Avant automated DNA sequencer with the BigDye Terminator Cycle Sequencing reaction kit v1.1. (catalog number 4337450, Thermo Fisher Scientific, Monza, Italy). .. Each exon was sequenced on both strands, amplified, and then sequenced again on both strands to eliminate the risk of PCR artifacts.

    Article Title: Antibiotic Resistance Profiling, Analysis of Virulence Aspects and Molecular Genotyping of Staphylococcus aureus Isolated in Sicily, Italy
    Article Snippet: .. The purified samples were used for sequencing using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) followed by capillary electrophoresis on the ABI Prism 310 Genetic Analyzer (Applied Biosystems) as described in D'Andrea et al. ( ). .. The sequences were then analyzed using the ABI3130 Genetic Analyzer (Applied Biosystems).

    Article Title: Analysis of human MDM4 variants in papillary thyroid carcinomas reveals new potential markers of cancer properties
    Article Snippet: .. Purified PCR products were sequenced in both directions with the use of the BigDye terminator Cycle sequencing Kit (version 1.1, Applied Biosystems) and an ABI Genetic Analyzer (Model 3130, Applied Biosystems). .. Sequence data were analyzed by means of SeqScape software (version 2.1, Applied Biosystems) followed by manual review.

    Article Title: HylA, an Alternative Hydrolase for Initiation of Catabolism of the Phenylurea Herbicide Linuron in Variovorax sp. Strains
    Article Snippet: .. Amplicons were purified with the Qiaquick PCR purification kit (Qiagen) according to the manufacturer's instructions and sequenced using the BigDye Terminator cycle sequencing kit (Applied Biosystems) as described by the manufacturer. .. The sequencing reaction was performed on a thermocycler UNOII (Biometra, Germany).

    Electrophoresis:

    Article Title: Antibiotic Resistance Profiling, Analysis of Virulence Aspects and Molecular Genotyping of Staphylococcus aureus Isolated in Sicily, Italy
    Article Snippet: .. The purified samples were used for sequencing using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) followed by capillary electrophoresis on the ABI Prism 310 Genetic Analyzer (Applied Biosystems) as described in D'Andrea et al. ( ). .. The sequences were then analyzed using the ABI3130 Genetic Analyzer (Applied Biosystems).

    Sequencing:

    Article Title: On the genomics of immunoglobulins in the gray, short-tailed opossum Monodelphis domestica
    Article Snippet: .. PCR products were cloned using TOPO TA cloning Kit (Invitrogen, Carsbad, CA) and sequenced using BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA). .. Sequences were analyzed using Sequencher 3.0 (Gene Codes, Ann Arbor, MI) and compared with the GenBank database and the MonDom5 assembly using the BLAST algorithm ( ).

    Article Title: The Association of SERPINE2 Gene with COPD in a Chinese Han Population
    Article Snippet: .. Sequencing was performed using the BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems), and analyzed on an ABI PRISM 3100 DNA sequencer (Applied Biosystems, Foster City, CA, USA). ..

    Article Title: p53 mutations in classic and pleomorphic invasive lobular carcinoma of the breast
    Article Snippet: .. The PCR conditions were set up as follows; initial denaturation at 94°C for 3 min, 35 cycles at 94°C for 1 min (denaturation), 60°C for 30 s (annealing) and 72°C for 45 s (extension), followed by a final extension at 72°C for 5 min. Then, PCR products were sequenced in both sense and antisense directions using the BigDye Terminator v1.1 sequencing kit on ABI 3130 (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. .. The sequences were analyzed using Mutation Surveyor software (SoftGenetics,LLC., State College, PA, USA).

    Article Title: Immunoglobulin gene rearrangement IGHV3-48 is a predictive marker of histological transformation into aggressive lymphoma in follicular lymphomas
    Article Snippet: .. IGH rearrangement sequencing and identification PCR products were sequenced in forward and reverse reads, using the same primers as for PCR amplification and the Big-Dye® Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) . .. Sequencing was carried out with an ABI 3500xL DNA Sequencer (Applied Biosystems).

    Article Title: Analysis of Genetic Alterations in Tunisian Patients with Lung Adenocarcinoma
    Article Snippet: .. PCR product was purified using exonuclease and then submitted to sequencing using an ABI PRISM 3100-Avant automated DNA sequencer with the BigDye Terminator Cycle Sequencing reaction kit v1.1. (catalog number 4337450, Thermo Fisher Scientific, Monza, Italy). .. Each exon was sequenced on both strands, amplified, and then sequenced again on both strands to eliminate the risk of PCR artifacts.

    Article Title: Mice with Alopecia, Osteoporosis, and Systemic Amyloidosis Due to Mutation in Zdhhc13, a Gene Coding for Palmitoyl Acyltransferase
    Article Snippet: .. Amplification conditions were an initial denaturation of 4 min. at 94°C, followed by 20 cycles of touchdown PCR in 30 s at 94°C, 30 s at 65°C (decrease 0.5°C per cycle), 40 s at 72°C; and a final 20 cycles in 30 s at 94°C, 30 s at 55°C, followed by 40 s at 72°C and then a final extension at 72°C for 5 min. All amplified PCR fragments were digested with shrimp alkaline phosphatase and Exo I to remove unincorporated primers and sequenced using the BigDye Terminator Cycle Sequencing Kit v1.1/3.1 (Applied Biosystems, Foster City, CA, USA) following the manufacturer's instructions. .. Sequencing products were separated on either ABI PRISM 3100 Genetic Analyzer or ABI PRISM 3700 DNA Analyzer (Applied Biosystems).

    Article Title: Criteria for effective design, construction, and gene knockdown by shRNA vectors
    Article Snippet: .. Sequencing reactions were 12.5 uL total volume containing 1 × BigDye Terminator v1.1 Cycle Sequencing Ready Reaction Mix (Applied Biosystems), 0.26 ug of DNA and 3.75 pmole of primer. .. LTRa primer (sequence CGCGAACAGAAGCGAGAA) that binds the HSPG vector approximately 120 bp downstream from the inserted hairpin was used in all sequencing reactions.

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: .. DNA sequencing The cycle sequencing reaction (20 μl) was performed with the Cycle Sequencing Mix (8 μl) from the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems), containing ∼0.3 pmol of the template and 4 pmol of the sequencing primer (20-mer), in the presence of 40 pmol or 1 nmol of 4-propynyl-1-(β-D-ribofuranosyl)pyrrole-2-carbaldehyde 5′-triphosphate (d Pa′ TP) (40 pmol for DNA fragments containing one Ds base and 1 nmol for DNAs with two Ds bases) or 1 nmol of dd Pa′ TP. .. After 25 cycles of PCR (96°C, 10 s; 50°C, 5 s; 60°C, 4 min), the residual dye terminators were removed from the reaction with CENTRI-SEP columns (Princeton Separations), and the solutions were dried.

    Article Title: Analysis of human MDM4 variants in papillary thyroid carcinomas reveals new potential markers of cancer properties
    Article Snippet: .. Purified PCR products were sequenced in both directions with the use of the BigDye terminator Cycle sequencing Kit (version 1.1, Applied Biosystems) and an ABI Genetic Analyzer (Model 3130, Applied Biosystems). .. Sequence data were analyzed by means of SeqScape software (version 2.1, Applied Biosystems) followed by manual review.

    Article Title: HylA, an Alternative Hydrolase for Initiation of Catabolism of the Phenylurea Herbicide Linuron in Variovorax sp. Strains
    Article Snippet: .. Amplicons were purified with the Qiaquick PCR purification kit (Qiagen) according to the manufacturer's instructions and sequenced using the BigDye Terminator cycle sequencing kit (Applied Biosystems) as described by the manufacturer. .. The sequencing reaction was performed on a thermocycler UNOII (Biometra, Germany).

    Article Title: A Novel KCNJ2 Mutation Identified in an Autistic Proband Affects the Single Channel Properties of Kir2.1
    Article Snippet: .. Sequencing reactions were performed on both strands using the BigDye Terminator Cycle Sequencing kit v1.1 and an automated ABI-3130 DNA sequencer (Applied Biosystems, Foster City, CA, USA). .. Mutation detection was performed using ChromasPro v1.34 (Technelysium Ltd.) software.

    shRNA:

    Article Title: Criteria for effective design, construction, and gene knockdown by shRNA vectors
    Article Snippet: Paragraph title: Sequencing of shRNA vectors ... Sequencing reactions were 12.5 uL total volume containing 1 × BigDye Terminator v1.1 Cycle Sequencing Ready Reaction Mix (Applied Biosystems), 0.26 ug of DNA and 3.75 pmole of primer.

    DNA Sequencing:

    Article Title: The Association of SERPINE2 Gene with COPD in a Chinese Han Population
    Article Snippet: Paragraph title: DNA sequencing ... Sequencing was performed using the BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems), and analyzed on an ABI PRISM 3100 DNA sequencer (Applied Biosystems, Foster City, CA, USA).

    Article Title: Mice with Alopecia, Osteoporosis, and Systemic Amyloidosis Due to Mutation in Zdhhc13, a Gene Coding for Palmitoyl Acyltransferase
    Article Snippet: Amplification conditions were an initial denaturation of 4 min. at 94°C, followed by 20 cycles of touchdown PCR in 30 s at 94°C, 30 s at 65°C (decrease 0.5°C per cycle), 40 s at 72°C; and a final 20 cycles in 30 s at 94°C, 30 s at 55°C, followed by 40 s at 72°C and then a final extension at 72°C for 5 min. All amplified PCR fragments were digested with shrimp alkaline phosphatase and Exo I to remove unincorporated primers and sequenced using the BigDye Terminator Cycle Sequencing Kit v1.1/3.1 (Applied Biosystems, Foster City, CA, USA) following the manufacturer's instructions. .. Raw sequencing data were analyzed with the DNA Sequencing Analysis Software v3.7 (Applied Biosystems).

    Article Title: Criteria for effective design, construction, and gene knockdown by shRNA vectors
    Article Snippet: Sequencing of shRNA vectors DNA sequencing was done at the UNC-CH Genome Analysis Facility. .. Sequencing reactions were 12.5 uL total volume containing 1 × BigDye Terminator v1.1 Cycle Sequencing Ready Reaction Mix (Applied Biosystems), 0.26 ug of DNA and 3.75 pmole of primer.

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: .. DNA sequencing The cycle sequencing reaction (20 μl) was performed with the Cycle Sequencing Mix (8 μl) from the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems), containing ∼0.3 pmol of the template and 4 pmol of the sequencing primer (20-mer), in the presence of 40 pmol or 1 nmol of 4-propynyl-1-(β-D-ribofuranosyl)pyrrole-2-carbaldehyde 5′-triphosphate (d Pa′ TP) (40 pmol for DNA fragments containing one Ds base and 1 nmol for DNAs with two Ds bases) or 1 nmol of dd Pa′ TP. .. After 25 cycles of PCR (96°C, 10 s; 50°C, 5 s; 60°C, 4 min), the residual dye terminators were removed from the reaction with CENTRI-SEP columns (Princeton Separations), and the solutions were dried.

    Article Title: A Novel KCNJ2 Mutation Identified in an Autistic Proband Affects the Single Channel Properties of Kir2.1
    Article Snippet: Comprehensive mutational analyses of KCNJ2 and KCNJ10 were performed using polymerase chain reactions (PCRs) and DNA sequencing. .. Sequencing reactions were performed on both strands using the BigDye Terminator Cycle Sequencing kit v1.1 and an automated ABI-3130 DNA sequencer (Applied Biosystems, Foster City, CA, USA).

    DNA Purification:

    Article Title: A Novel KCNJ2 Mutation Identified in an Autistic Proband Affects the Single Channel Properties of Kir2.1
    Article Snippet: For each participant genomic DNA was obtained using the Wizard genomic DNA purification kit (Promega, Madison, WI, USA) from venous blood. .. Sequencing reactions were performed on both strands using the BigDye Terminator Cycle Sequencing kit v1.1 and an automated ABI-3130 DNA sequencer (Applied Biosystems, Foster City, CA, USA).

    Touchdown PCR:

    Article Title: Mice with Alopecia, Osteoporosis, and Systemic Amyloidosis Due to Mutation in Zdhhc13, a Gene Coding for Palmitoyl Acyltransferase
    Article Snippet: .. Amplification conditions were an initial denaturation of 4 min. at 94°C, followed by 20 cycles of touchdown PCR in 30 s at 94°C, 30 s at 65°C (decrease 0.5°C per cycle), 40 s at 72°C; and a final 20 cycles in 30 s at 94°C, 30 s at 55°C, followed by 40 s at 72°C and then a final extension at 72°C for 5 min. All amplified PCR fragments were digested with shrimp alkaline phosphatase and Exo I to remove unincorporated primers and sequenced using the BigDye Terminator Cycle Sequencing Kit v1.1/3.1 (Applied Biosystems, Foster City, CA, USA) following the manufacturer's instructions. .. Sequencing products were separated on either ABI PRISM 3100 Genetic Analyzer or ABI PRISM 3700 DNA Analyzer (Applied Biosystems).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Analysis of human MDM4 variants in papillary thyroid carcinomas reveals new potential markers of cancer properties
    Article Snippet: Purified PCR products were sequenced in both directions with the use of the BigDye terminator Cycle sequencing Kit (version 1.1, Applied Biosystems) and an ABI Genetic Analyzer (Model 3130, Applied Biosystems). .. Screening for ret/PTC 1 and ret/PTC 3 rearrangements was performed by RT-PCR using primers spanning the breakpoints, as previously described [ ].

    Quantitative RT-PCR:

    Article Title: Analysis of human MDM4 variants in papillary thyroid carcinomas reveals new potential markers of cancer properties
    Article Snippet: Purified PCR products were sequenced in both directions with the use of the BigDye terminator Cycle sequencing Kit (version 1.1, Applied Biosystems) and an ABI Genetic Analyzer (Model 3130, Applied Biosystems). .. Search for mutations of BRAF was conducted by single-stranded conformational polymorphism (SSCP) screening of real-time (RT)-PCR products of exons 15, followed by sequencing, as previously described [ ].

    Recombinant:

    Article Title: Antibiotic Resistance Profiling, Analysis of Virulence Aspects and Molecular Genotyping of Staphylococcus aureus Isolated in Sicily, Italy
    Article Snippet: Polymerase chain reaction (PCR) was performed in a 30 μL volume reaction containing 1.5 U of recombinant Taq DNA polymerase (Invitrogen, Life Technologies) as described in Randazzo et al. ( ). .. The purified samples were used for sequencing using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) followed by capillary electrophoresis on the ABI Prism 310 Genetic Analyzer (Applied Biosystems) as described in D'Andrea et al. ( ).

    Derivative Assay:

    Article Title: Antibiotic Resistance Profiling, Analysis of Virulence Aspects and Molecular Genotyping of Staphylococcus aureus Isolated in Sicily, Italy
    Article Snippet: PCR products derived from the seven housekeeping genes (arcc , aroe , glpf , gmk , pta , tpi , yqil ) were treated with HT ExoSAP-IT (Affymetrix) following the manufacturer's instruction. .. The purified samples were used for sequencing using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) followed by capillary electrophoresis on the ABI Prism 310 Genetic Analyzer (Applied Biosystems) as described in D'Andrea et al. ( ).

    Plasmid Preparation:

    Article Title: Criteria for effective design, construction, and gene knockdown by shRNA vectors
    Article Snippet: Sequencing reactions were 12.5 uL total volume containing 1 × BigDye Terminator v1.1 Cycle Sequencing Ready Reaction Mix (Applied Biosystems), 0.26 ug of DNA and 3.75 pmole of primer. .. LTRa primer (sequence CGCGAACAGAAGCGAGAA) that binds the HSPG vector approximately 120 bp downstream from the inserted hairpin was used in all sequencing reactions.

    Software:

    Article Title: p53 mutations in classic and pleomorphic invasive lobular carcinoma of the breast
    Article Snippet: The PCR conditions were set up as follows; initial denaturation at 94°C for 3 min, 35 cycles at 94°C for 1 min (denaturation), 60°C for 30 s (annealing) and 72°C for 45 s (extension), followed by a final extension at 72°C for 5 min. Then, PCR products were sequenced in both sense and antisense directions using the BigDye Terminator v1.1 sequencing kit on ABI 3130 (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. .. The sequences were analyzed using Mutation Surveyor software (SoftGenetics,LLC., State College, PA, USA).

    Article Title: Immunoglobulin gene rearrangement IGHV3-48 is a predictive marker of histological transformation into aggressive lymphoma in follicular lymphomas
    Article Snippet: IGH rearrangement sequencing and identification PCR products were sequenced in forward and reverse reads, using the same primers as for PCR amplification and the Big-Dye® Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) . .. Complete V-D-J rearrangements and the percentage of germline identity were identified using the IMGT/V-QUEST software ( http://www.imgt.org ).

    Article Title: Mice with Alopecia, Osteoporosis, and Systemic Amyloidosis Due to Mutation in Zdhhc13, a Gene Coding for Palmitoyl Acyltransferase
    Article Snippet: Amplification conditions were an initial denaturation of 4 min. at 94°C, followed by 20 cycles of touchdown PCR in 30 s at 94°C, 30 s at 65°C (decrease 0.5°C per cycle), 40 s at 72°C; and a final 20 cycles in 30 s at 94°C, 30 s at 55°C, followed by 40 s at 72°C and then a final extension at 72°C for 5 min. All amplified PCR fragments were digested with shrimp alkaline phosphatase and Exo I to remove unincorporated primers and sequenced using the BigDye Terminator Cycle Sequencing Kit v1.1/3.1 (Applied Biosystems, Foster City, CA, USA) following the manufacturer's instructions. .. Raw sequencing data were analyzed with the DNA Sequencing Analysis Software v3.7 (Applied Biosystems).

    Article Title: Analysis of human MDM4 variants in papillary thyroid carcinomas reveals new potential markers of cancer properties
    Article Snippet: Purified PCR products were sequenced in both directions with the use of the BigDye terminator Cycle sequencing Kit (version 1.1, Applied Biosystems) and an ABI Genetic Analyzer (Model 3130, Applied Biosystems). .. Sequence data were analyzed by means of SeqScape software (version 2.1, Applied Biosystems) followed by manual review.

    Article Title: A Novel KCNJ2 Mutation Identified in an Autistic Proband Affects the Single Channel Properties of Kir2.1
    Article Snippet: Flanking primers (Sigma-Aldrich, St. Louis, MO, USA) designed with the Oligo 6.0 software were used to amplify KCNJ2 and KCNJ10 coding sequences. .. Sequencing reactions were performed on both strands using the BigDye Terminator Cycle Sequencing kit v1.1 and an automated ABI-3130 DNA sequencer (Applied Biosystems, Foster City, CA, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher thermo sequenase kit
    DNA sequence of the hrpS promoter as determined by automated fluorescent capillary electrophoresis. A: Electropherogram depicts each nucleotide obtained from the Thermo <t>Sequenase</t> kit used to determine the nucleotide sequence from the DNA footprint. B : The area in the box is expanded to demonstrate how the sequence was read from left to right, with the four reactions aligned by Genemapper software. The sequence of DNA is reported below the peaks. C : Electropherogram illustrates the sequence of the same region of DNA as determined by the BigDye Terminator kit.
    Thermo Sequenase Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/thermo sequenase kit/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    thermo sequenase kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    94
    Thermo Fisher bigdye terminator version 3 1 cycle sequencing kit
    CAST promoter activity and calpastatin isoform expression in MG cells. A , RLM RACE was carried out using 5 μg of total RNA isolated from NFI-hyperphosphorylated (T98) or NFI-hypophosphorylated (U251) MG cells. Antisense primer targeting exon 14 of the CAST gene was used for reverse transcription. Nested PCR amplification was carried out with 5′-ligated outer and inner primers and antisense primers targeting exons 8 and 4 of the CAST gene, respectively. PCR products were electrophoresed in 3% Metaphor (FMC Bioproducts) agarose gel, visualized with ethidium bromide, excised, purified, and sequenced using the <t>BigDye</t> Terminator version 3.1 cycle sequencing kit (Thermo Fisher Scientific). Exon composition of the isolated DNA products based on sequence analysis is indicated on the right. B , domain composition of XL-containing (full-length/type II) and XL-less (type III) calpastatin isoforms. T98 ( C ) and U251 ( D ) MG cells were transiently transfected with luciferase reporter constructs containing the CP (∼2000 bp upstream of CAST exon 1), ALT (in intron 3 containing the NFI-binding sites; ∼4000 bp upstream of CAST exon 4), or empty vector (CNT). Luciferase activity was measured using the Luciferase Assay System (Promega) and the FLUOstar microplate reader (BMG LABTECH). Relative -fold change was calculated relative to the empty vector control. Scatter plots show data from three independent experiments. E , U251 MG cells were transiently transfected with luciferase reporter constructs containing the WT ALT or constructs containing mutation at C2 (ALT-C2*), C3 (ALt-C3*), or both C2 and C3 (ALT-C2*C3*) NFI-binding sites. Luciferase activity was measured 48 h post-transfection as described above. p values were obtained from one-way analysis of variance statistical analysis of three independent experiments. *, p
    Bigdye Terminator Version 3 1 Cycle Sequencing Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 307 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bigdye terminator version 3 1 cycle sequencing kit/product/Thermo Fisher
    Average 94 stars, based on 307 article reviews
    Price from $9.99 to $1999.99
    bigdye terminator version 3 1 cycle sequencing kit - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    99
    Thermo Fisher live dead fixable red dead cell stains
    DLP across Different Tissue Types Split by Viability: <t>Live</t> Cells ( n = 35,973, Green) and <t>Dead</t> Cells ( n = 8,877, Orange) (A) Violin plots showing the quality score of single-cell libraries across various tissue types, split by cell viability status (live or dead), with number of cells shown above the violin. Black lines show median. (B) Fraction of successful cells in a sample (quality > 0.75), split by cell viability. The size of the bubble represents the total number of successful cells. Violin and bubble colors indicate cell viability. (C) Example single-cell copy number profiles from cell lines, breast PDX, follicular lymphoma, and mouse synovial sarcoma. Colors correspond to integer HMM copy number states; black lines indicate segment medians. Arrows highlight regions of complex copy number change.
    Live Dead Fixable Red Dead Cell Stains, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/live dead fixable red dead cell stains/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    live dead fixable red dead cell stains - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    DNA sequence of the hrpS promoter as determined by automated fluorescent capillary electrophoresis. A: Electropherogram depicts each nucleotide obtained from the Thermo Sequenase kit used to determine the nucleotide sequence from the DNA footprint. B : The area in the box is expanded to demonstrate how the sequence was read from left to right, with the four reactions aligned by Genemapper software. The sequence of DNA is reported below the peaks. C : Electropherogram illustrates the sequence of the same region of DNA as determined by the BigDye Terminator kit.

    Journal: Journal of Biomolecular Techniques : JBT

    Article Title: Identification of the DNA Bases of a DNase I Footprint by the Use of Dye Primer Sequencing on an Automated Capillary DNA Analysis Instrument

    doi:

    Figure Lengend Snippet: DNA sequence of the hrpS promoter as determined by automated fluorescent capillary electrophoresis. A: Electropherogram depicts each nucleotide obtained from the Thermo Sequenase kit used to determine the nucleotide sequence from the DNA footprint. B : The area in the box is expanded to demonstrate how the sequence was read from left to right, with the four reactions aligned by Genemapper software. The sequence of DNA is reported below the peaks. C : Electropherogram illustrates the sequence of the same region of DNA as determined by the BigDye Terminator kit.

    Article Snippet: The positive control reactions with pUC19 and the TAMRA-40 forward primer from the Thermo Sequenase kit were performed as described in the manual.

    Techniques: Sequencing, Electrophoresis, Software

    CAST promoter activity and calpastatin isoform expression in MG cells. A , RLM RACE was carried out using 5 μg of total RNA isolated from NFI-hyperphosphorylated (T98) or NFI-hypophosphorylated (U251) MG cells. Antisense primer targeting exon 14 of the CAST gene was used for reverse transcription. Nested PCR amplification was carried out with 5′-ligated outer and inner primers and antisense primers targeting exons 8 and 4 of the CAST gene, respectively. PCR products were electrophoresed in 3% Metaphor (FMC Bioproducts) agarose gel, visualized with ethidium bromide, excised, purified, and sequenced using the BigDye Terminator version 3.1 cycle sequencing kit (Thermo Fisher Scientific). Exon composition of the isolated DNA products based on sequence analysis is indicated on the right. B , domain composition of XL-containing (full-length/type II) and XL-less (type III) calpastatin isoforms. T98 ( C ) and U251 ( D ) MG cells were transiently transfected with luciferase reporter constructs containing the CP (∼2000 bp upstream of CAST exon 1), ALT (in intron 3 containing the NFI-binding sites; ∼4000 bp upstream of CAST exon 4), or empty vector (CNT). Luciferase activity was measured using the Luciferase Assay System (Promega) and the FLUOstar microplate reader (BMG LABTECH). Relative -fold change was calculated relative to the empty vector control. Scatter plots show data from three independent experiments. E , U251 MG cells were transiently transfected with luciferase reporter constructs containing the WT ALT or constructs containing mutation at C2 (ALT-C2*), C3 (ALt-C3*), or both C2 and C3 (ALT-C2*C3*) NFI-binding sites. Luciferase activity was measured 48 h post-transfection as described above. p values were obtained from one-way analysis of variance statistical analysis of three independent experiments. *, p

    Journal: The Journal of Biological Chemistry

    Article Title: Effects of nuclear factor I phosphorylation on calpastatin (CAST) gene variant expression and subcellular distribution in malignant glioma cells

    doi: 10.1074/jbc.RA118.004787

    Figure Lengend Snippet: CAST promoter activity and calpastatin isoform expression in MG cells. A , RLM RACE was carried out using 5 μg of total RNA isolated from NFI-hyperphosphorylated (T98) or NFI-hypophosphorylated (U251) MG cells. Antisense primer targeting exon 14 of the CAST gene was used for reverse transcription. Nested PCR amplification was carried out with 5′-ligated outer and inner primers and antisense primers targeting exons 8 and 4 of the CAST gene, respectively. PCR products were electrophoresed in 3% Metaphor (FMC Bioproducts) agarose gel, visualized with ethidium bromide, excised, purified, and sequenced using the BigDye Terminator version 3.1 cycle sequencing kit (Thermo Fisher Scientific). Exon composition of the isolated DNA products based on sequence analysis is indicated on the right. B , domain composition of XL-containing (full-length/type II) and XL-less (type III) calpastatin isoforms. T98 ( C ) and U251 ( D ) MG cells were transiently transfected with luciferase reporter constructs containing the CP (∼2000 bp upstream of CAST exon 1), ALT (in intron 3 containing the NFI-binding sites; ∼4000 bp upstream of CAST exon 4), or empty vector (CNT). Luciferase activity was measured using the Luciferase Assay System (Promega) and the FLUOstar microplate reader (BMG LABTECH). Relative -fold change was calculated relative to the empty vector control. Scatter plots show data from three independent experiments. E , U251 MG cells were transiently transfected with luciferase reporter constructs containing the WT ALT or constructs containing mutation at C2 (ALT-C2*), C3 (ALt-C3*), or both C2 and C3 (ALT-C2*C3*) NFI-binding sites. Luciferase activity was measured 48 h post-transfection as described above. p values were obtained from one-way analysis of variance statistical analysis of three independent experiments. *, p

    Article Snippet: The DNA was electrophoresed in a 3% MetaPhor agarose (FMC Bioproducts, Rockland, ME) gel, excised, purified (Monarch DNA extraction kit, New England Biolabs), and sequenced (BigDye Terminator® version 3.1 cycle sequencing kit, Thermo Fisher Scientific).

    Techniques: Activity Assay, Expressing, Isolation, Nested PCR, Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Purification, Sequencing, Transfection, Luciferase, Construct, Binding Assay, Plasmid Preparation, Mutagenesis

    DLP across Different Tissue Types Split by Viability: Live Cells ( n = 35,973, Green) and Dead Cells ( n = 8,877, Orange) (A) Violin plots showing the quality score of single-cell libraries across various tissue types, split by cell viability status (live or dead), with number of cells shown above the violin. Black lines show median. (B) Fraction of successful cells in a sample (quality > 0.75), split by cell viability. The size of the bubble represents the total number of successful cells. Violin and bubble colors indicate cell viability. (C) Example single-cell copy number profiles from cell lines, breast PDX, follicular lymphoma, and mouse synovial sarcoma. Colors correspond to integer HMM copy number states; black lines indicate segment medians. Arrows highlight regions of complex copy number change.

    Journal: Cell

    Article Title: Clonal Decomposition and DNA Replication States Defined by Scaled Single-Cell Genome Sequencing

    doi: 10.1016/j.cell.2019.10.026

    Figure Lengend Snippet: DLP across Different Tissue Types Split by Viability: Live Cells ( n = 35,973, Green) and Dead Cells ( n = 8,877, Orange) (A) Violin plots showing the quality score of single-cell libraries across various tissue types, split by cell viability status (live or dead), with number of cells shown above the violin. Black lines show median. (B) Fraction of successful cells in a sample (quality > 0.75), split by cell viability. The size of the bubble represents the total number of successful cells. Violin and bubble colors indicate cell viability. (C) Example single-cell copy number profiles from cell lines, breast PDX, follicular lymphoma, and mouse synovial sarcoma. Colors correspond to integer HMM copy number states; black lines indicate segment medians. Arrows highlight regions of complex copy number change.

    Article Snippet: Cell staining and dilution for spotting into nanowell chips Single-cell suspensions were fluorescently stained using a combination of CellTrace CFSE Cell Proliferation Kit (ThermoFisher) and LIVE/DEAD Fixable Red Dead Cell Stains (ThermoFisher), incubating for 20 min at 37°C.

    Techniques:

    Optimization of DLP+ Single-Cell Whole-Genome Sequencing Library Construction for the Open-Array Format, Related to Figure 2 Examples of (A) high-quality and (B) poor quality single-cell genome libraries from a diploid GM18507 lymphoblastoid (male) cell line. Colors correspond to integer HMM copy number states ( Ha et al., 2012 ); black lines indicate segment medians. (C) Random forest classifier feature importance, total mapped reads is of highest importance. Definitions of the features are in methods. (D) OC from 10 ten-fold cross-validation on Random Forest (AUC 0.997) (E) Quality score distribution over GM18507 cells of (i) the original MF-DLP data ( Zahn et al., 2017 )), (ii) lysis buffer types, (iii) Tn5 concentrations and increased lysis presoak times (iv) on-chip storage of isolated cells and nuclei that were dispensed into nanowells and stored either overnight or for 63 days prior to lysis and library construction, and (v) cell state (live or dead). Numbers of cells are indicated above each violin plot, where black lines show medians and dots indicate individual cells (green circle = live, orange diamond = dead, gray square = no cell state data). Grey background indicates where cells underwent heat lysis immediately after lysis buffer addition, and blue background indicates cells kept in lysis buffer for 19 h at 4°C before heat lysis. (F) Effect of cell dispensing method on total mapped reads, with active selection (cellenONE, spotted in a block of wells or a scatter pattern) or passive limiting dilution dispensing. Black lines show median. (G) Effect of protease concentration on cells. Quality scores of single-cell libraries built with a low, medium, or high concentration of protease in the lysis buffer and lysed for either 2 or 19 h, followed by library construction with a range of protease concentrations. (H) Distribution of coverage breadth of bootstrap sampling of GM18507 libraries using a 2 h and overnight presoak lysis compared to a microfluidic device (MF-DLP ( n = 122, ( Zahn et al., 2017 )), DLP+ 2 h ( n = 148), DLP+ overnight ( n = 133). (I) The effect of lysis time on coverage breadth of merged single-cell genomes. Bootstrap sampling of single-cell GM18507 libraries prepared using a 2 h and overnight cold lysis conditions; DLP+ 2 h ( n = 148), DLP+ overnight ( n = 133), MF-DLP Zahn et al. (2017) ( n = 122). Single-cell libraries were downsampled to a similar median coverage depth. Boxplots show median and quartiles, the whiskers show the remaining distribution, and dots indicate outliers. Lorenz curves shows coverage uniformity for merged single-cell genomes. Curves are median merged genomes. Experimental condition and number of merged cells are indicated in the plot. Dotted black line indicates perfectly uniform genome. (J) Distribution of fraction duplicate reads for GM18507 cells (2.2 nL Tn5, n = 587 (green); 3.5 nL Tn5, n = 571 (blue)) and on a microfluidic device ( n = 141, ( Zahn et al., 2017 ) (yellow)). The top column labels state the numbers of cells per condition. (K) Fraction duplicate reads versus coverage breadth of deeply sequenced GM18507 libraries (3.5 nL Tn5, n = 571), 10 HiSeqX lanes) with low quality (

    Journal: Cell

    Article Title: Clonal Decomposition and DNA Replication States Defined by Scaled Single-Cell Genome Sequencing

    doi: 10.1016/j.cell.2019.10.026

    Figure Lengend Snippet: Optimization of DLP+ Single-Cell Whole-Genome Sequencing Library Construction for the Open-Array Format, Related to Figure 2 Examples of (A) high-quality and (B) poor quality single-cell genome libraries from a diploid GM18507 lymphoblastoid (male) cell line. Colors correspond to integer HMM copy number states ( Ha et al., 2012 ); black lines indicate segment medians. (C) Random forest classifier feature importance, total mapped reads is of highest importance. Definitions of the features are in methods. (D) OC from 10 ten-fold cross-validation on Random Forest (AUC 0.997) (E) Quality score distribution over GM18507 cells of (i) the original MF-DLP data ( Zahn et al., 2017 )), (ii) lysis buffer types, (iii) Tn5 concentrations and increased lysis presoak times (iv) on-chip storage of isolated cells and nuclei that were dispensed into nanowells and stored either overnight or for 63 days prior to lysis and library construction, and (v) cell state (live or dead). Numbers of cells are indicated above each violin plot, where black lines show medians and dots indicate individual cells (green circle = live, orange diamond = dead, gray square = no cell state data). Grey background indicates where cells underwent heat lysis immediately after lysis buffer addition, and blue background indicates cells kept in lysis buffer for 19 h at 4°C before heat lysis. (F) Effect of cell dispensing method on total mapped reads, with active selection (cellenONE, spotted in a block of wells or a scatter pattern) or passive limiting dilution dispensing. Black lines show median. (G) Effect of protease concentration on cells. Quality scores of single-cell libraries built with a low, medium, or high concentration of protease in the lysis buffer and lysed for either 2 or 19 h, followed by library construction with a range of protease concentrations. (H) Distribution of coverage breadth of bootstrap sampling of GM18507 libraries using a 2 h and overnight presoak lysis compared to a microfluidic device (MF-DLP ( n = 122, ( Zahn et al., 2017 )), DLP+ 2 h ( n = 148), DLP+ overnight ( n = 133). (I) The effect of lysis time on coverage breadth of merged single-cell genomes. Bootstrap sampling of single-cell GM18507 libraries prepared using a 2 h and overnight cold lysis conditions; DLP+ 2 h ( n = 148), DLP+ overnight ( n = 133), MF-DLP Zahn et al. (2017) ( n = 122). Single-cell libraries were downsampled to a similar median coverage depth. Boxplots show median and quartiles, the whiskers show the remaining distribution, and dots indicate outliers. Lorenz curves shows coverage uniformity for merged single-cell genomes. Curves are median merged genomes. Experimental condition and number of merged cells are indicated in the plot. Dotted black line indicates perfectly uniform genome. (J) Distribution of fraction duplicate reads for GM18507 cells (2.2 nL Tn5, n = 587 (green); 3.5 nL Tn5, n = 571 (blue)) and on a microfluidic device ( n = 141, ( Zahn et al., 2017 ) (yellow)). The top column labels state the numbers of cells per condition. (K) Fraction duplicate reads versus coverage breadth of deeply sequenced GM18507 libraries (3.5 nL Tn5, n = 571), 10 HiSeqX lanes) with low quality (

    Article Snippet: Cell staining and dilution for spotting into nanowell chips Single-cell suspensions were fluorescently stained using a combination of CellTrace CFSE Cell Proliferation Kit (ThermoFisher) and LIVE/DEAD Fixable Red Dead Cell Stains (ThermoFisher), incubating for 20 min at 37°C.

    Techniques: Sequencing, Lysis, Chromatin Immunoprecipitation, Isolation, Selection, Blocking Assay, Concentration Assay, Sampling

    Feature-based Classifier of Cell Cycle State Flow sort gating for cell cycle analysis of G1, S, G2 phase and dead cells by DLP+. (A) Gate for cells. Side scatter area (SSC) versus forward scatter area (FSC) is used to gate out debris (gray) but not dead cells (red) because we will sort them. (B) Gate for single cells. On the cell gate in a, we can use FSC width versus FSC area to gate out doublets if needed for single-cell sorting in a plate. (C) Gate for live cells. On the gate in b, we use PI versus FSC to capture the live cells which are PI low. (D) Gate for non-apoptotic cells. On the live cell gate in c, we use Caspase 3/7 (APC-A versus FSC) to exclude apoptotic cells which are Caspase 3/7 high from our live cell population. (E) Gate for cell cycle phases in live cells. On the live cell gate established in a-d, we use the DNA content of the cells measured by Hoechst 33342 staining (V459/40-A)to gate the G1 (blue), S (orange), and G2 (green) phases of the cell cycle. (F) Gate for dead cells. On the gate for single cells established in b, we gate on the PI high, Caspase 3/7 high dead cells (red). (G) Example GM18507 cells in S phase and G2 with early replicating regions leading and late replicating regions lagging, including a cell from an unsorted experiment, showing we can detect these cells without preselecting the population. Colors correspond to integer HMM copy number states ( Ha et al., 2012 ); black lines indicate segment medians. (H) Overview of the process for calculating the top performing feature for classifying cell state, residual GC correlation after aggregate GC bias correction. Uncorrected cell data is corrected for sequencing specific GC bias using an aggregate correction curve calculated from merged library level read data. G1 phase cells show little residual correlation between GC and corrected read count, whereas S phase cells show high correlation due to GC rich early replicating regions. (I) F1 score (y axis) for a range of proportions of S-phase cells included in the calculation of aggregate GC correction during training. (J) Receive Operator Characteristic curve for the classifier showing true positive rate varying with false positive rate for a range of thresholds, and a dashed line showing a perfectly random classifier. (K) Violin plots showing the highest performing features, post-correction residual GC correlation (y axis), for each cell cycle state (x axis).

    Journal: Cell

    Article Title: Clonal Decomposition and DNA Replication States Defined by Scaled Single-Cell Genome Sequencing

    doi: 10.1016/j.cell.2019.10.026

    Figure Lengend Snippet: Feature-based Classifier of Cell Cycle State Flow sort gating for cell cycle analysis of G1, S, G2 phase and dead cells by DLP+. (A) Gate for cells. Side scatter area (SSC) versus forward scatter area (FSC) is used to gate out debris (gray) but not dead cells (red) because we will sort them. (B) Gate for single cells. On the cell gate in a, we can use FSC width versus FSC area to gate out doublets if needed for single-cell sorting in a plate. (C) Gate for live cells. On the gate in b, we use PI versus FSC to capture the live cells which are PI low. (D) Gate for non-apoptotic cells. On the live cell gate in c, we use Caspase 3/7 (APC-A versus FSC) to exclude apoptotic cells which are Caspase 3/7 high from our live cell population. (E) Gate for cell cycle phases in live cells. On the live cell gate established in a-d, we use the DNA content of the cells measured by Hoechst 33342 staining (V459/40-A)to gate the G1 (blue), S (orange), and G2 (green) phases of the cell cycle. (F) Gate for dead cells. On the gate for single cells established in b, we gate on the PI high, Caspase 3/7 high dead cells (red). (G) Example GM18507 cells in S phase and G2 with early replicating regions leading and late replicating regions lagging, including a cell from an unsorted experiment, showing we can detect these cells without preselecting the population. Colors correspond to integer HMM copy number states ( Ha et al., 2012 ); black lines indicate segment medians. (H) Overview of the process for calculating the top performing feature for classifying cell state, residual GC correlation after aggregate GC bias correction. Uncorrected cell data is corrected for sequencing specific GC bias using an aggregate correction curve calculated from merged library level read data. G1 phase cells show little residual correlation between GC and corrected read count, whereas S phase cells show high correlation due to GC rich early replicating regions. (I) F1 score (y axis) for a range of proportions of S-phase cells included in the calculation of aggregate GC correction during training. (J) Receive Operator Characteristic curve for the classifier showing true positive rate varying with false positive rate for a range of thresholds, and a dashed line showing a perfectly random classifier. (K) Violin plots showing the highest performing features, post-correction residual GC correlation (y axis), for each cell cycle state (x axis).

    Article Snippet: Cell staining and dilution for spotting into nanowell chips Single-cell suspensions were fluorescently stained using a combination of CellTrace CFSE Cell Proliferation Kit (ThermoFisher) and LIVE/DEAD Fixable Red Dead Cell Stains (ThermoFisher), incubating for 20 min at 37°C.

    Techniques: Flow Cytometry, Cell Cycle Assay, FACS, Staining, Sequencing

    DLP+ Produces High-Quality Libraries from Cells and Nuclei, while Dead Cells Drop Out with Low Read Count, Related to Figure 2 (A) Quality score distribution of optimized single-cell libraries, split by dead cells, live cells, and nuclei shows live cells and nuclei have a similar distribution, while dead cells have lower quality. Total mapped reads distribution (orange is cells with quality score less than 0.75, and green is cells with quality score higher than 0.75), cells with low read counts have low-quality score, vertical line represents 125,000 reads. (B) Heatmap of copy number profiles from cells and nuclei shows that cells (green in side bar) and nuclei (blue) cluster together using hierarchical clustering. (C) Sequencing metrics of single-cell and single-nucleus libraries produced from the same samples. (D) Example copy number profile from a nucleus and a cell derived from the same sample showing the same copy number clone type.

    Journal: Cell

    Article Title: Clonal Decomposition and DNA Replication States Defined by Scaled Single-Cell Genome Sequencing

    doi: 10.1016/j.cell.2019.10.026

    Figure Lengend Snippet: DLP+ Produces High-Quality Libraries from Cells and Nuclei, while Dead Cells Drop Out with Low Read Count, Related to Figure 2 (A) Quality score distribution of optimized single-cell libraries, split by dead cells, live cells, and nuclei shows live cells and nuclei have a similar distribution, while dead cells have lower quality. Total mapped reads distribution (orange is cells with quality score less than 0.75, and green is cells with quality score higher than 0.75), cells with low read counts have low-quality score, vertical line represents 125,000 reads. (B) Heatmap of copy number profiles from cells and nuclei shows that cells (green in side bar) and nuclei (blue) cluster together using hierarchical clustering. (C) Sequencing metrics of single-cell and single-nucleus libraries produced from the same samples. (D) Example copy number profile from a nucleus and a cell derived from the same sample showing the same copy number clone type.

    Article Snippet: Cell staining and dilution for spotting into nanowell chips Single-cell suspensions were fluorescently stained using a combination of CellTrace CFSE Cell Proliferation Kit (ThermoFisher) and LIVE/DEAD Fixable Red Dead Cell Stains (ThermoFisher), incubating for 20 min at 37°C.

    Techniques: Sequencing, Produced, Derivative Assay