cutsmarttm buffer  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    CutSmart Buffer
    Description:
    CutSmart Buffer 5 0 ml
    Catalog Number:
    b7204s
    Price:
    24
    Size:
    5 0 ml
    Category:
    Buffers
    Buy from Supplier


    Structured Review

    New England Biolabs cutsmarttm buffer
    CutSmart Buffer
    CutSmart Buffer 5 0 ml
    https://www.bioz.com/result/cutsmarttm buffer/product/New England Biolabs
    Average 95 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    cutsmarttm buffer - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Multiplexed precision genome editing with trackable genomic barcodes in yeast
    Article Snippet: Paragraph title: Barcoded guide-donor library cloning ... 5 ug of each PCR-cleaned reaction was cut with 2 uL of AscI (NEB) and 2 uL of NotI (NEB), 10 uL of 10× CutSmart buffer (NEB), and incubated at 37°C for 1 hour followed by 20 minutes of heat inactivation at 80°C.

    Centrifugation:

    Article Title: Long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele‐specific MYC expression in HeLa cells
    Article Snippet: .. The cytoplasmic components were removed by centrifugation and the nuclear pellets were dissolved in 1× cutsmart buffer (NEB) containing 0.3% SDS. .. Then, 2% Triton X‐100 was added and incubated for an hour.

    Amplification:

    Article Title: Genetic variants of major genes contributing to phosphate and calcium homeostasis and their association with serum parameters in pigs
    Article Snippet: .. Digestion of amplification products was performed using 10 μl PCR product, 2 μl CutSmart Buffer (New England BioLabs), and 1 U of restriction enzyme and filled up with aqua dest to a final volume of 20 μl. .. The reaction conditions were 16 h (for PTH1R and TRAFD1 ) or 2 h (for STC1 ) at 37 °C for incubation and 20 min at 65 °C for enzyme inactivation.

    Article Title: Comprehensive comparative analysis of 5’ end RNA sequencing methods
    Article Snippet: We made this switch because this oligo is compatible with HiSeq2500, MiSeq, and NextSeq sequencers (lllumina), while the original one requires a custom sequencing primer with an annealing temperature that is only suitable for the HiSeq2000. ( 3 ) We used a PCR primer with sequence compatible to dT oligo and 5’ TSO, 5′-CTACACGACGCTCTTCCGATCT-3′, for cDNA amplification. .. We then eliminated the polyA/T end of the double stranded cDNA by mixing with 1x CutSmart buffer, 10 units of SalI (New England BioLabs) and heating at 37⁰C for 60 minutes.

    Article Title: Cryptic Plutella species show deep divergence despite the capacity to hybridize
    Article Snippet: Genomic DNA was quantified using a Qubit 2.0 fluorometer (Invitrogen) and 200 ng digested with 10 units of high fidelity SbfI in Cutsmart Buffer (NEB) for 1 h at 37 °C, then heat inactivated at 80 °C for 20 min. One microlitre of P1 adapter (100nM) with a 6-base molecular identifier (MID) (top strand 5′ -TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGxxxxxxTGCA- 3′ , bottom strand 5′ -[P]xxxxxxCTGTCTCTTATACACATCTGACGCTGCCGACGA- 3′ , x represents sites for MIDs) were then added using 0.5 µL T4 DNA ligase (Promega), 1 nM ATP and Cutsmart buffer. .. Libraries were amplified using KAPA HiFi Hotstart Readymix (Kapa Biosystems) and Nextera i7 and i5 indexed primers with PCR conditions: 95 °C for 3 min, two cycles of 98 °C for 20 s, 54 °C for 15 s, 72 °C for 1 min, then 15 cycles of 98 °C for 20 s, 65 °C for 15 s, 72 °C for 1 min followed by a final extension of 72 °C for 5 min.

    Article Title: Multiplexed precision genome editing with trackable genomic barcodes in yeast
    Article Snippet: The guide-donor oligos were amplified using KAPA HiFi polymerase as directed by the manufacturer in 50 uL total reaction volume with an initial denaturation of 98°C for 1 min, and then 15 cycles of 98°C 10s, 60°C 20s, and 72°C 30s. .. 5 ug of each PCR-cleaned reaction was cut with 2 uL of AscI (NEB) and 2 uL of NotI (NEB), 10 uL of 10× CutSmart buffer (NEB), and incubated at 37°C for 1 hour followed by 20 minutes of heat inactivation at 80°C.

    Synthesized:

    Article Title: Comprehensive comparative analysis of 5’ end RNA sequencing methods
    Article Snippet: We synthesized cDNA from 10 ng K-562 total RNA plus 0.64 μl 1/500× dilution of pooled original, uncapped ERCC spike-in RNA following a published protocol , combined with reverse transcription-PCR conditions based on SMART-Seq2 and the following modifications. ( 1 ) We used a 5’ biotin blocked dT oligo that contains a SalI restriction site (shown as underlined), 5′-/5Biosg/CTACACGACGCTCTTCCGATCT GTCGACT (30)VN–3’. ( 2 ) We used a 5’ template switching oligo (TSO) containing an Illumina adaptor sequence, 5′-CUACACGACGCUCUUCCGAUCUNNNNNGGG – noting all bases are RNA. .. We then eliminated the polyA/T end of the double stranded cDNA by mixing with 1x CutSmart buffer, 10 units of SalI (New England BioLabs) and heating at 37⁰C for 60 minutes.

    Incubation:

    Article Title: A method for measuring the distribution of the shortest telomeres in cells and tissues
    Article Snippet: To ligate TeSLA-T (TeSLA-T 1–6) to each telomere overhang, 1000 units of T4 DNA ligase (New England Biolabs), 1 mM ATP, and 10−3 μM of TeSLA-Ts were added to a final volume of 20 μl in 1× CutSmart buffer (New England Biolabs) with 50 ng of isolated genomic DNA (without RE digestion). .. The inactivated mixture including two units of Cvi AII in 10 μl 1× CutSmart buffer was incubated at 25 °C for 2 h to generate genomic DNA fragments with 5′ AT overhangs.

    Article Title: Genetic variants of major genes contributing to phosphate and calcium homeostasis and their association with serum parameters in pigs
    Article Snippet: Digestion of amplification products was performed using 10 μl PCR product, 2 μl CutSmart Buffer (New England BioLabs), and 1 U of restriction enzyme and filled up with aqua dest to a final volume of 20 μl. .. The reaction conditions were 16 h (for PTH1R and TRAFD1 ) or 2 h (for STC1 ) at 37 °C for incubation and 20 min at 65 °C for enzyme inactivation.

    Article Title: RNA cytosine methylation and methyltransferases mediate chromatin organization and 5-azacytidine response and resistance in leukaemia
    Article Snippet: .. The DNA (2 μg) was incubated with 3 μl of Nla III restriction enzyme (10,000 units/ml) 37 °C overnight in the CutSmart™ Buffer (NEB Inc., Ipswich, MA), and the enzyme was inactivated by incubation at 65 °C for 20 min. .. The fragmented DNA was then incubated with anti-5-mC and anti-5-hmC antibodies in IP buffer for 6 h at 4 °C.

    Article Title: Decreased Enhancer-Promoter Proximity Accompanying Enhancer Activation
    Article Snippet: Cells were then disrupted on ice with a Dounce homogenizer (pestle B; 2 × 20 strokes) and cell suspensions centrifuged at 2000 g for 5 min. Supernatants were removed, the cell pellets were washed twice with 100 μL of 1 × CutSmart buffer (New England Biolabs), and resuspended in 100 μL of 1 × CutSmart buffer and divided into two Eppendorf tubes. .. 1 × CutSmart buffer (337 μL) was added to each tube, and the mixture was incubated for 10 min at 65°C with 0.1% SDS.

    Article Title: Long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele‐specific MYC expression in HeLa cells
    Article Snippet: Chromosome conformation capture Adherent cultured cells were made single‐cell suspension and fixed by adding formaldehyde to a final concentration of 2% followed by incubation for 10 min at room temperature. .. The cytoplasmic components were removed by centrifugation and the nuclear pellets were dissolved in 1× cutsmart buffer (NEB) containing 0.3% SDS.

    Article Title: Multiplexed precision genome editing with trackable genomic barcodes in yeast
    Article Snippet: .. 5 ug of each PCR-cleaned reaction was cut with 2 uL of AscI (NEB) and 2 uL of NotI (NEB), 10 uL of 10× CutSmart buffer (NEB), and incubated at 37°C for 1 hour followed by 20 minutes of heat inactivation at 80°C. .. Reactions were column-cleaned and 400 ng of each insert was ligated with T4 DNA ligase into 1 ug of recipient vector ( > 7:1 insert:vector) treated with NotI, AscI, as well as CIP (NEB) – either pKR216 ( SEC14 library) or pKR348 (natural variants library) – in a total volume of 20 uL.

    Modification:

    Article Title: RNA cytosine methylation and methyltransferases mediate chromatin organization and 5-azacytidine response and resistance in leukaemia
    Article Snippet: Paragraph title: Crosslink-assistant DNA modification immunoprecipitation assay ... The DNA (2 μg) was incubated with 3 μl of Nla III restriction enzyme (10,000 units/ml) 37 °C overnight in the CutSmart™ Buffer (NEB Inc., Ipswich, MA), and the enzyme was inactivated by incubation at 65 °C for 20 min.

    Article Title: Comprehensive comparative analysis of 5’ end RNA sequencing methods
    Article Snippet: We then eliminated the polyA/T end of the double stranded cDNA by mixing with 1x CutSmart buffer, 10 units of SalI (New England BioLabs) and heating at 37⁰C for 60 minutes. .. We made the sequencing library with a modified NexteraXT (Illumina) protocol with the following modifications in addition. ( 1 ) We used 0.125 ng cDNA in ½ volume of a standard NexteraXT reaction. ( 2 ) We used the modified Nextera Index 1 primer, 5′-CAAGCAGAAGACGGCATACGAGATxrefXXGTCTCGTGGGCTCGGAGA*T*G-3′ with phosphorothioate bonds (denoted by *) and inverted end bases for protection; the 8 “X” bases indicate in-line index sequences that enable pooling samples.

    Article Title: Cryptic Plutella species show deep divergence despite the capacity to hybridize
    Article Snippet: RADseq library preparation and sequencing Libraries were prepared for restriction-site-associated DNA sequencing (RADseq) according to a protocol modified from Baird et al. [ ]. .. Genomic DNA was quantified using a Qubit 2.0 fluorometer (Invitrogen) and 200 ng digested with 10 units of high fidelity SbfI in Cutsmart Buffer (NEB) for 1 h at 37 °C, then heat inactivated at 80 °C for 20 min. One microlitre of P1 adapter (100nM) with a 6-base molecular identifier (MID) (top strand 5′ -TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGxxxxxxTGCA- 3′ , bottom strand 5′ -[P]xxxxxxCTGTCTCTTATACACATCTGACGCTGCCGACGA- 3′ , x represents sites for MIDs) were then added using 0.5 µL T4 DNA ligase (Promega), 1 nM ATP and Cutsmart buffer.

    Transformation Assay:

    Article Title: Entirely enzymatic nanofabrication of DNA–protein conjugates
    Article Snippet: MOSIC oligonucleotides production The plasmids enclosing the oligonucleotide pseudogenes (GeneArt, Thermo Fisher) were transformed by heat shock in subcloning efficient Dh5α (Invitrogen) and grown overnight in 10 ml LB media supplemented with 100 μg/ml ampicillin. .. 20 ug of the obtained plasmid were digested for 4 h with BsaI-HF (NEB) in 100 μl with the addition of 10 μl of CutSmart buffer (NEB) and the psudogenes extracted from a 0.7% agarose gel, 0.5× TAE, using illustra GFX PCR DNA and gel band purification kit (GE Healthcare).

    Electroporation:

    Article Title: Multiplexed precision genome editing with trackable genomic barcodes in yeast
    Article Snippet: 5 ug of each PCR-cleaned reaction was cut with 2 uL of AscI (NEB) and 2 uL of NotI (NEB), 10 uL of 10× CutSmart buffer (NEB), and incubated at 37°C for 1 hour followed by 20 minutes of heat inactivation at 80°C. .. 1 uL of each reaction was then electroporated into 20 uL NEB 10-beta in 0.1 cm-gap electroporation cuvettes (Bio-Rad) with the Bio-Rad GenePulser electroporator using the settings 1.7 kV, 200 Omega, and 25 μF.

    Ligation:

    Article Title: A method for measuring the distribution of the shortest telomeres in cells and tissues
    Article Snippet: TeSLA for TL measurement Before starting the TeSLA procedure, we make stocks of short double-stranded 5′ AT and TA overhang adapters for ligation at genomic and subtelomeric regions. .. To ligate TeSLA-T (TeSLA-T 1–6) to each telomere overhang, 1000 units of T4 DNA ligase (New England Biolabs), 1 mM ATP, and 10−3 μM of TeSLA-Ts were added to a final volume of 20 μl in 1× CutSmart buffer (New England Biolabs) with 50 ng of isolated genomic DNA (without RE digestion).

    Article Title: Multiplexed precision genome editing with trackable genomic barcodes in yeast
    Article Snippet: 5 ug of each PCR-cleaned reaction was cut with 2 uL of AscI (NEB) and 2 uL of NotI (NEB), 10 uL of 10× CutSmart buffer (NEB), and incubated at 37°C for 1 hour followed by 20 minutes of heat inactivation at 80°C. .. Ligation reactions were ethanol precipitated by adding 80 uL 100% EtOH and 2 uL of 5M NaOAc pH 5.2 with 1 uL of glycoblue (Ambion), incubated on ice for 10 minutes and spun at 13.2 krpm for 5 min, washed with 70% ethanol, and then re-suspended in 3 uL of nuclease-free water (IDT).

    Cell Culture:

    Article Title: RNA cytosine methylation and methyltransferases mediate chromatin organization and 5-azacytidine response and resistance in leukaemia
    Article Snippet: DNA was isolated from cultured cells or mononuclear bone marrow cells using a Qiagen DNAeasy kit (catalogue # 69506, Valencia, CA). .. The DNA (2 μg) was incubated with 3 μl of Nla III restriction enzyme (10,000 units/ml) 37 °C overnight in the CutSmart™ Buffer (NEB Inc., Ipswich, MA), and the enzyme was inactivated by incubation at 65 °C for 20 min.

    Article Title: Long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele‐specific MYC expression in HeLa cells
    Article Snippet: Chromosome conformation capture Adherent cultured cells were made single‐cell suspension and fixed by adding formaldehyde to a final concentration of 2% followed by incubation for 10 min at room temperature. .. The cytoplasmic components were removed by centrifugation and the nuclear pellets were dissolved in 1× cutsmart buffer (NEB) containing 0.3% SDS.

    DNA Sequencing:

    Article Title: Cryptic Plutella species show deep divergence despite the capacity to hybridize
    Article Snippet: RADseq library preparation and sequencing Libraries were prepared for restriction-site-associated DNA sequencing (RADseq) according to a protocol modified from Baird et al. [ ]. .. Genomic DNA was quantified using a Qubit 2.0 fluorometer (Invitrogen) and 200 ng digested with 10 units of high fidelity SbfI in Cutsmart Buffer (NEB) for 1 h at 37 °C, then heat inactivated at 80 °C for 20 min. One microlitre of P1 adapter (100nM) with a 6-base molecular identifier (MID) (top strand 5′ -TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGxxxxxxTGCA- 3′ , bottom strand 5′ -[P]xxxxxxCTGTCTCTTATACACATCTGACGCTGCCGACGA- 3′ , x represents sites for MIDs) were then added using 0.5 µL T4 DNA ligase (Promega), 1 nM ATP and Cutsmart buffer.

    Sequencing:

    Article Title: Enhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery
    Article Snippet: Analysis of HDR by HindIII restriction digestion HindIII directly cleaves PCR DNA containing the newly integrated HindIII restriction sequence as the result of successful HDR. .. The reaction consisted of 200 ng of PCR DNA and 10 units of HindIII High Fidelity in CutSmart Buffer (NEB, Ipswich, MA).

    Article Title: Comprehensive comparative analysis of 5’ end RNA sequencing methods
    Article Snippet: We made this switch because this oligo is compatible with HiSeq2500, MiSeq, and NextSeq sequencers (lllumina), while the original one requires a custom sequencing primer with an annealing temperature that is only suitable for the HiSeq2000. ( 3 ) We used a PCR primer with sequence compatible to dT oligo and 5’ TSO, 5′-CTACACGACGCTCTTCCGATCT-3′, for cDNA amplification. .. We then eliminated the polyA/T end of the double stranded cDNA by mixing with 1x CutSmart buffer, 10 units of SalI (New England BioLabs) and heating at 37⁰C for 60 minutes.

    Article Title: Cryptic Plutella species show deep divergence despite the capacity to hybridize
    Article Snippet: Paragraph title: RADseq library preparation and sequencing ... Genomic DNA was quantified using a Qubit 2.0 fluorometer (Invitrogen) and 200 ng digested with 10 units of high fidelity SbfI in Cutsmart Buffer (NEB) for 1 h at 37 °C, then heat inactivated at 80 °C for 20 min. One microlitre of P1 adapter (100nM) with a 6-base molecular identifier (MID) (top strand 5′ -TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGxxxxxxTGCA- 3′ , bottom strand 5′ -[P]xxxxxxCTGTCTCTTATACACATCTGACGCTGCCGACGA- 3′ , x represents sites for MIDs) were then added using 0.5 µL T4 DNA ligase (Promega), 1 nM ATP and Cutsmart buffer.

    Article Title: Multiplexed precision genome editing with trackable genomic barcodes in yeast
    Article Snippet: We amplified subpools with a forward primer harboring an AscI restriction site at its 3′-end and a reverse primer with a NotI site at its 5′-end followed by a degenerate barcode encoding a pseudo-random sequence (either NNNVHTGNNNVHTGNNNVHTGNNNVHTGNNN or NNNTGVHNNNTGVHNNNTGVHNNNTGVHNNN) that excludes illegal restriction sites (NotI, AscI, and BspQI), followed by subpool-specific priming sequence. .. 5 ug of each PCR-cleaned reaction was cut with 2 uL of AscI (NEB) and 2 uL of NotI (NEB), 10 uL of 10× CutSmart buffer (NEB), and incubated at 37°C for 1 hour followed by 20 minutes of heat inactivation at 80°C.

    Antiviral Assay:

    Article Title: Rapid Screening for CRISPR-Directed Editing of the Drosophila Genome Using white Coconversion
    Article Snippet: .. The following restriction digestions were used: armi sgRNA-1 DSB: an Ava II site 6 bp away; 5 µl of PCR digested with Ava II [0.2 U/µl final concentration (f.c.)] in 0.5× CutSmart Buffer (New England Biolabs, Inc., Ipswich, MA) in 10 µl final volume (f.v.) at 37° for 2 hr; armi sgRNA-2/3 DSBs: a BstNI site 1 bp (sgRNA-2) or 1 bp (sgRNA-3) away; 5 µl of PCR with Bst NI (0.5 U/µl f.c.) in 1× NEBuffer 3.1 (NEB) in 10.5 µl f.v. at 60° for 1 hr; armi sgRNA-4 DSB: no restriction enzyme site nearby; digested with T7E1 as described below; armi sgRNA-5/6 DSBs: a PmlI site 17 bp (sgRNA-5) or 11 bp (sgRNA-6) away; 10 µl PCR with Eco 72I (0.5 U/µl f.c., Thermo Fisher) in 12.5 µl f.v. at room temperature for 1 hr; zuc sgRNA-1 DSB: a BccI site 9 bp away; 5 µl of PCR with Bcc I (0.5 U/µl f.c.) in 0.5× CutSmart Buffer in 10 µl f.v. at 37° for 1 hr; zuc sgRNA-2 DSB: a Hpy CH4III site 7 bp away; 5 µl of PCR with Hpy CH4III (0.25 U/µl f.c.) in 0.5× CutSmart Buffer in 10 µl f.v. at 37° for 2 hr. .. T7 endonuclease I (T7E1) digestion: To complement the restriction enzyme digestion, the same PCR products were denatured, reannealed to form heteroduplex, and digested with the mismatch-specific, sequence-independent T7E1.

    Methylation:

    Article Title: RNA cytosine methylation and methyltransferases mediate chromatin organization and 5-azacytidine response and resistance in leukaemia
    Article Snippet: Crosslink-assisted DNA modification IP assay was modified from the previously published methylated DNA IP protocol . .. The DNA (2 μg) was incubated with 3 μl of Nla III restriction enzyme (10,000 units/ml) 37 °C overnight in the CutSmart™ Buffer (NEB Inc., Ipswich, MA), and the enzyme was inactivated by incubation at 65 °C for 20 min.

    Isolation:

    Article Title: A method for measuring the distribution of the shortest telomeres in cells and tissues
    Article Snippet: .. To ligate TeSLA-T (TeSLA-T 1–6) to each telomere overhang, 1000 units of T4 DNA ligase (New England Biolabs), 1 mM ATP, and 10−3 μM of TeSLA-Ts were added to a final volume of 20 μl in 1× CutSmart buffer (New England Biolabs) with 50 ng of isolated genomic DNA (without RE digestion). .. The inactivated mixture including two units of Cvi AII in 10 μl 1× CutSmart buffer was incubated at 25 °C for 2 h to generate genomic DNA fragments with 5′ AT overhangs.

    Subcloning:

    Article Title: Entirely enzymatic nanofabrication of DNA–protein conjugates
    Article Snippet: MOSIC oligonucleotides production The plasmids enclosing the oligonucleotide pseudogenes (GeneArt, Thermo Fisher) were transformed by heat shock in subcloning efficient Dh5α (Invitrogen) and grown overnight in 10 ml LB media supplemented with 100 μg/ml ampicillin. .. 20 ug of the obtained plasmid were digested for 4 h with BsaI-HF (NEB) in 100 μl with the addition of 10 μl of CutSmart buffer (NEB) and the psudogenes extracted from a 0.7% agarose gel, 0.5× TAE, using illustra GFX PCR DNA and gel band purification kit (GE Healthcare).

    Purification:

    Article Title: Comprehensive comparative analysis of 5’ end RNA sequencing methods
    Article Snippet: We then eliminated the polyA/T end of the double stranded cDNA by mixing with 1x CutSmart buffer, 10 units of SalI (New England BioLabs) and heating at 37⁰C for 60 minutes. .. We purified this product by using 0.7x volume AMPureXP SPRI beads (Beckman Coulter Genomics) following vendor protocol.

    Article Title: Cryptic Plutella species show deep divergence despite the capacity to hybridize
    Article Snippet: Genomic DNA was quantified using a Qubit 2.0 fluorometer (Invitrogen) and 200 ng digested with 10 units of high fidelity SbfI in Cutsmart Buffer (NEB) for 1 h at 37 °C, then heat inactivated at 80 °C for 20 min. One microlitre of P1 adapter (100nM) with a 6-base molecular identifier (MID) (top strand 5′ -TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGxxxxxxTGCA- 3′ , bottom strand 5′ -[P]xxxxxxCTGTCTCTTATACACATCTGACGCTGCCGACGA- 3′ , x represents sites for MIDs) were then added using 0.5 µL T4 DNA ligase (Promega), 1 nM ATP and Cutsmart buffer. .. DNA purification between steps was performed using a MinElute PCR purification kit (Qiagen).

    Article Title: Entirely enzymatic nanofabrication of DNA–protein conjugates
    Article Snippet: .. 20 ug of the obtained plasmid were digested for 4 h with BsaI-HF (NEB) in 100 μl with the addition of 10 μl of CutSmart buffer (NEB) and the psudogenes extracted from a 0.7% agarose gel, 0.5× TAE, using illustra GFX PCR DNA and gel band purification kit (GE Healthcare). ..

    Article Title: Multiplexed precision genome editing with trackable genomic barcodes in yeast
    Article Snippet: Reactions were column-cleaned with the Qiagen QIAquick PCR purification kit. .. 5 ug of each PCR-cleaned reaction was cut with 2 uL of AscI (NEB) and 2 uL of NotI (NEB), 10 uL of 10× CutSmart buffer (NEB), and incubated at 37°C for 1 hour followed by 20 minutes of heat inactivation at 80°C.

    Article Title: The ATP-dependent chromatin remodeling enzymes CHD6, CHD7, and CHD8 exhibit distinct nucleosome binding and remodeling activities
    Article Snippet: .. 100 ng of chromatinized pGIE-0 plasmid (∼46 nm nucleosome, final concentration) and 25 units of HaeIII restriction enzyme (New England Biolabs, R0108T) were mixed with 0–30 nm (concentration varied by experiment) purified CHD enzyme in in 1× New England Biolabs CutSmart buffer (20 mm Tris acetate (pH 7.9) at 25 °C, 50 mm potassium acetate, 10 mm magnesium acetate, and 100 μg/ml BSA; New England Biolabs, B7204S) on ice (with or without 3 mm ATP, final concentration). ..

    Polymerase Chain Reaction:

    Article Title: Enhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery
    Article Snippet: .. The reaction consisted of 200 ng of PCR DNA and 10 units of HindIII High Fidelity in CutSmart Buffer (NEB, Ipswich, MA). .. The product was resolved on 2% agarose gel containing SYBR gold (Life technologies, Carlsbad, CA).

    Article Title: Genetic variants of major genes contributing to phosphate and calcium homeostasis and their association with serum parameters in pigs
    Article Snippet: .. Digestion of amplification products was performed using 10 μl PCR product, 2 μl CutSmart Buffer (New England BioLabs), and 1 U of restriction enzyme and filled up with aqua dest to a final volume of 20 μl. .. The reaction conditions were 16 h (for PTH1R and TRAFD1 ) or 2 h (for STC1 ) at 37 °C for incubation and 20 min at 65 °C for enzyme inactivation.

    Article Title: Rapid Screening for CRISPR-Directed Editing of the Drosophila Genome Using white Coconversion
    Article Snippet: .. The following restriction digestions were used: armi sgRNA-1 DSB: an Ava II site 6 bp away; 5 µl of PCR digested with Ava II [0.2 U/µl final concentration (f.c.)] in 0.5× CutSmart Buffer (New England Biolabs, Inc., Ipswich, MA) in 10 µl final volume (f.v.) at 37° for 2 hr; armi sgRNA-2/3 DSBs: a BstNI site 1 bp (sgRNA-2) or 1 bp (sgRNA-3) away; 5 µl of PCR with Bst NI (0.5 U/µl f.c.) in 1× NEBuffer 3.1 (NEB) in 10.5 µl f.v. at 60° for 1 hr; armi sgRNA-4 DSB: no restriction enzyme site nearby; digested with T7E1 as described below; armi sgRNA-5/6 DSBs: a PmlI site 17 bp (sgRNA-5) or 11 bp (sgRNA-6) away; 10 µl PCR with Eco 72I (0.5 U/µl f.c., Thermo Fisher) in 12.5 µl f.v. at room temperature for 1 hr; zuc sgRNA-1 DSB: a BccI site 9 bp away; 5 µl of PCR with Bcc I (0.5 U/µl f.c.) in 0.5× CutSmart Buffer in 10 µl f.v. at 37° for 1 hr; zuc sgRNA-2 DSB: a Hpy CH4III site 7 bp away; 5 µl of PCR with Hpy CH4III (0.25 U/µl f.c.) in 0.5× CutSmart Buffer in 10 µl f.v. at 37° for 2 hr. .. T7 endonuclease I (T7E1) digestion: To complement the restriction enzyme digestion, the same PCR products were denatured, reannealed to form heteroduplex, and digested with the mismatch-specific, sequence-independent T7E1.

    Article Title: Mixing alters the lytic activity of viruses in the dark ocean
    Article Snippet: Each 15 μL restriction digest contained 1.5 μL 10× CutSmart buffer (500 mmol/L K‐acetate, 200 mmol/L Tris‐acetate, 100 mmol/L Mg‐acetate, 1 mg/mL BSA, pH 7.9) and 0.5 μL of restriction enzyme Hha I (20,000 units/mL; Cat. No. R0139S, both from New England BioLabs, Ipswich, Massachusetts, USA). .. The amount of PCR products added to the restriction digests (1–12 μL) was standardized using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific).

    Article Title: Comprehensive comparative analysis of 5’ end RNA sequencing methods
    Article Snippet: We made this switch because this oligo is compatible with HiSeq2500, MiSeq, and NextSeq sequencers (lllumina), while the original one requires a custom sequencing primer with an annealing temperature that is only suitable for the HiSeq2000. ( 3 ) We used a PCR primer with sequence compatible to dT oligo and 5’ TSO, 5′-CTACACGACGCTCTTCCGATCT-3′, for cDNA amplification. .. We then eliminated the polyA/T end of the double stranded cDNA by mixing with 1x CutSmart buffer, 10 units of SalI (New England BioLabs) and heating at 37⁰C for 60 minutes.

    Article Title: Cryptic Plutella species show deep divergence despite the capacity to hybridize
    Article Snippet: Genomic DNA was quantified using a Qubit 2.0 fluorometer (Invitrogen) and 200 ng digested with 10 units of high fidelity SbfI in Cutsmart Buffer (NEB) for 1 h at 37 °C, then heat inactivated at 80 °C for 20 min. One microlitre of P1 adapter (100nM) with a 6-base molecular identifier (MID) (top strand 5′ -TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGxxxxxxTGCA- 3′ , bottom strand 5′ -[P]xxxxxxCTGTCTCTTATACACATCTGACGCTGCCGACGA- 3′ , x represents sites for MIDs) were then added using 0.5 µL T4 DNA ligase (Promega), 1 nM ATP and Cutsmart buffer. .. DNA purification between steps was performed using a MinElute PCR purification kit (Qiagen).

    Article Title: Entirely enzymatic nanofabrication of DNA–protein conjugates
    Article Snippet: .. 20 ug of the obtained plasmid were digested for 4 h with BsaI-HF (NEB) in 100 μl with the addition of 10 μl of CutSmart buffer (NEB) and the psudogenes extracted from a 0.7% agarose gel, 0.5× TAE, using illustra GFX PCR DNA and gel band purification kit (GE Healthcare). ..

    Article Title: Multiplexed precision genome editing with trackable genomic barcodes in yeast
    Article Snippet: .. 5 ug of each PCR-cleaned reaction was cut with 2 uL of AscI (NEB) and 2 uL of NotI (NEB), 10 uL of 10× CutSmart buffer (NEB), and incubated at 37°C for 1 hour followed by 20 minutes of heat inactivation at 80°C. .. Reactions were column-cleaned and 400 ng of each insert was ligated with T4 DNA ligase into 1 ug of recipient vector ( > 7:1 insert:vector) treated with NotI, AscI, as well as CIP (NEB) – either pKR216 ( SEC14 library) or pKR348 (natural variants library) – in a total volume of 20 uL.

    Immunoprecipitation:

    Article Title: RNA cytosine methylation and methyltransferases mediate chromatin organization and 5-azacytidine response and resistance in leukaemia
    Article Snippet: Paragraph title: Crosslink-assistant DNA modification immunoprecipitation assay ... The DNA (2 μg) was incubated with 3 μl of Nla III restriction enzyme (10,000 units/ml) 37 °C overnight in the CutSmart™ Buffer (NEB Inc., Ipswich, MA), and the enzyme was inactivated by incubation at 65 °C for 20 min.

    Plasmid Preparation:

    Article Title: Triggering autophagic cell death with a di-manganese(II) developmental therapeutic
    Article Snippet: .. Salmon testes DNA (D1626) and synthetic double stranded alternating co-polymers, Poly[d(G-C)2 ] (P9389) and Poly[d(A-T)2 ] (P0883) used in CD studies were purchased from Sigma Aldrich. pUC19 plasmid DNA (N3041), CutSmart® buffer (B7204), 100X BSA (B9000) and topoisomerase I (E. coli) (M0301) were all purchased from New England Biolabs. .. LC3 isoform LC3A rabbit monoclonal antibody (Cell Signalling) was kindly donated by Dr. Joanne Keenan while goat anti-rabbit conjugated Alex Fluor-647 (ThermoFisher) was donated by Dr. Clair Gallagher.

    Article Title: Di-copper metallodrugs promote NCI-60 chemotherapy via singlet oxygen and superoxide production with tandem TA/TA and AT/AT oligonucleotide discrimination
    Article Snippet: .. Doxorubicin (Dox) hydrochloride (D2975000), dihydroethidium (D7008), salmon testes DNA (D1626), synthetic double stranded alternating co-polymers, poly[d(G⋅C)2 ] (P9389) and poly[d(A⋅T)2 ] (P0883) and Micrococcus Lysodeikticus (D8259) were purchased from Sigma-Aldrich. pUC19 plasmid DNA (N3041), CutSmart® buffer (B7204), 100× bovine serum albumin (BSA) (B9000) and topoisomerase I (E. coli) (M0301) were all purchased from New England Biolabs. ..

    Article Title: Entirely enzymatic nanofabrication of DNA–protein conjugates
    Article Snippet: .. 20 ug of the obtained plasmid were digested for 4 h with BsaI-HF (NEB) in 100 μl with the addition of 10 μl of CutSmart buffer (NEB) and the psudogenes extracted from a 0.7% agarose gel, 0.5× TAE, using illustra GFX PCR DNA and gel band purification kit (GE Healthcare). ..

    Article Title: Multiplexed precision genome editing with trackable genomic barcodes in yeast
    Article Snippet: NotI and AscI sites enable sticky end cloning into a multi-copy recipient vector, with the AscI site at the 3′-end of the guide RNA promoter. .. 5 ug of each PCR-cleaned reaction was cut with 2 uL of AscI (NEB) and 2 uL of NotI (NEB), 10 uL of 10× CutSmart buffer (NEB), and incubated at 37°C for 1 hour followed by 20 minutes of heat inactivation at 80°C.

    Article Title: The ATP-dependent chromatin remodeling enzymes CHD6, CHD7, and CHD8 exhibit distinct nucleosome binding and remodeling activities
    Article Snippet: .. 100 ng of chromatinized pGIE-0 plasmid (∼46 nm nucleosome, final concentration) and 25 units of HaeIII restriction enzyme (New England Biolabs, R0108T) were mixed with 0–30 nm (concentration varied by experiment) purified CHD enzyme in in 1× New England Biolabs CutSmart buffer (20 mm Tris acetate (pH 7.9) at 25 °C, 50 mm potassium acetate, 10 mm magnesium acetate, and 100 μg/ml BSA; New England Biolabs, B7204S) on ice (with or without 3 mm ATP, final concentration). ..

    Agarose Gel Electrophoresis:

    Article Title: Enhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery
    Article Snippet: The reaction consisted of 200 ng of PCR DNA and 10 units of HindIII High Fidelity in CutSmart Buffer (NEB, Ipswich, MA). .. The product was resolved on 2% agarose gel containing SYBR gold (Life technologies, Carlsbad, CA).

    Article Title: Entirely enzymatic nanofabrication of DNA–protein conjugates
    Article Snippet: .. 20 ug of the obtained plasmid were digested for 4 h with BsaI-HF (NEB) in 100 μl with the addition of 10 μl of CutSmart buffer (NEB) and the psudogenes extracted from a 0.7% agarose gel, 0.5× TAE, using illustra GFX PCR DNA and gel band purification kit (GE Healthcare). ..

    Spectrophotometry:

    Article Title: Mixing alters the lytic activity of viruses in the dark ocean
    Article Snippet: Each 15 μL restriction digest contained 1.5 μL 10× CutSmart buffer (500 mmol/L K‐acetate, 200 mmol/L Tris‐acetate, 100 mmol/L Mg‐acetate, 1 mg/mL BSA, pH 7.9) and 0.5 μL of restriction enzyme Hha I (20,000 units/mL; Cat. No. R0139S, both from New England BioLabs, Ipswich, Massachusetts, USA). .. The amount of PCR products added to the restriction digests (1–12 μL) was standardized using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific).

    Concentration Assay:

    Article Title: Rapid Screening for CRISPR-Directed Editing of the Drosophila Genome Using white Coconversion
    Article Snippet: .. The following restriction digestions were used: armi sgRNA-1 DSB: an Ava II site 6 bp away; 5 µl of PCR digested with Ava II [0.2 U/µl final concentration (f.c.)] in 0.5× CutSmart Buffer (New England Biolabs, Inc., Ipswich, MA) in 10 µl final volume (f.v.) at 37° for 2 hr; armi sgRNA-2/3 DSBs: a BstNI site 1 bp (sgRNA-2) or 1 bp (sgRNA-3) away; 5 µl of PCR with Bst NI (0.5 U/µl f.c.) in 1× NEBuffer 3.1 (NEB) in 10.5 µl f.v. at 60° for 1 hr; armi sgRNA-4 DSB: no restriction enzyme site nearby; digested with T7E1 as described below; armi sgRNA-5/6 DSBs: a PmlI site 17 bp (sgRNA-5) or 11 bp (sgRNA-6) away; 10 µl PCR with Eco 72I (0.5 U/µl f.c., Thermo Fisher) in 12.5 µl f.v. at room temperature for 1 hr; zuc sgRNA-1 DSB: a BccI site 9 bp away; 5 µl of PCR with Bcc I (0.5 U/µl f.c.) in 0.5× CutSmart Buffer in 10 µl f.v. at 37° for 1 hr; zuc sgRNA-2 DSB: a Hpy CH4III site 7 bp away; 5 µl of PCR with Hpy CH4III (0.25 U/µl f.c.) in 0.5× CutSmart Buffer in 10 µl f.v. at 37° for 2 hr. .. T7 endonuclease I (T7E1) digestion: To complement the restriction enzyme digestion, the same PCR products were denatured, reannealed to form heteroduplex, and digested with the mismatch-specific, sequence-independent T7E1.

    Article Title: Long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele‐specific MYC expression in HeLa cells
    Article Snippet: Cross‐linking was stopped by adding glycine to a final concentration of 1 M and incubating at room temperature for 5 min. .. The cytoplasmic components were removed by centrifugation and the nuclear pellets were dissolved in 1× cutsmart buffer (NEB) containing 0.3% SDS.

    Article Title: The ATP-dependent chromatin remodeling enzymes CHD6, CHD7, and CHD8 exhibit distinct nucleosome binding and remodeling activities
    Article Snippet: .. 100 ng of chromatinized pGIE-0 plasmid (∼46 nm nucleosome, final concentration) and 25 units of HaeIII restriction enzyme (New England Biolabs, R0108T) were mixed with 0–30 nm (concentration varied by experiment) purified CHD enzyme in in 1× New England Biolabs CutSmart buffer (20 mm Tris acetate (pH 7.9) at 25 °C, 50 mm potassium acetate, 10 mm magnesium acetate, and 100 μg/ml BSA; New England Biolabs, B7204S) on ice (with or without 3 mm ATP, final concentration). ..

    DNA Purification:

    Article Title: Cryptic Plutella species show deep divergence despite the capacity to hybridize
    Article Snippet: Genomic DNA was quantified using a Qubit 2.0 fluorometer (Invitrogen) and 200 ng digested with 10 units of high fidelity SbfI in Cutsmart Buffer (NEB) for 1 h at 37 °C, then heat inactivated at 80 °C for 20 min. One microlitre of P1 adapter (100nM) with a 6-base molecular identifier (MID) (top strand 5′ -TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGxxxxxxTGCA- 3′ , bottom strand 5′ -[P]xxxxxxCTGTCTCTTATACACATCTGACGCTGCCGACGA- 3′ , x represents sites for MIDs) were then added using 0.5 µL T4 DNA ligase (Promega), 1 nM ATP and Cutsmart buffer. .. DNA purification between steps was performed using a MinElute PCR purification kit (Qiagen).

    Lysis:

    Article Title: Long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele‐specific MYC expression in HeLa cells
    Article Snippet: Cell lysis was performed by adding 1 ml of cell lysis buffer (10 mM Tris‐HCl, pH 7.5, 10 mM NaCl, 5 mM MgCl2, 0.1 mM EGTA, 1 × protein inhibitor) and incubating for 30 min on ice. .. The cytoplasmic components were removed by centrifugation and the nuclear pellets were dissolved in 1× cutsmart buffer (NEB) containing 0.3% SDS.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs m taq i dna methyltransferase
    A total of 1225 tiled fluorescence microscopy images of a sample of E. coli genomic <t>DNA</t> labeled with Atto647N at sites reading 5′-TCGA-3′ using the M. <t>Taq</t> I DNA <t>methyltransferase</t> enzyme in order to direct labeling. The image contains approximately 500 megabases of genomic material and took of the order of 10 min to acquire.
    M Taq I Dna Methyltransferase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/m taq i dna methyltransferase/product/New England Biolabs
    Average 95 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    m taq i dna methyltransferase - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    New England Biolabs mmei digestion mix
    Schematic overview of droplet Tn-Seq. a A microfluidic device encapsulates single bacterial cells into droplets containing growth medium. Bacteria are allowed to grow within droplets, genomic DNA (gDNA) is isolated at the start of the experiment (t1) and after growth (t2). Importantly, while growth for each transposon mutant takes place in isolation, gDNA is isolated from the pooled population, enabling screening of all mutants simultaneously. b gDNA is then amplified with DNA polymerase <t>phi29,</t> digested with <t>MmeI,</t> an adapter is ligated, a ~180 bp fragment is produced which contains ~16 nucleotides of bacterial gDNA, defining the transposon-insertion location, followed by Illumina sequencing. Reads are demultiplexed based on the barcode in the adapter and a potential second barcode in primer 1, mapped to the genome, and fitness is calculated for each defined region.
    Mmei Digestion Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mmei digestion mix/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mmei digestion mix - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    New England Biolabs cutsmart buffer
    Lysates of N. gonorrhoeae fragments pECFP-N1 and damage DNA from VK2/E6E7 cells. A. DNA agarose gel showing the digestion of pECFP-N1 plasmid by HindIII (positive control, lane 2), MS11 P+ lysate (lane 3), and MS11 P+ HI lysate (lane 5). Lane 5 shows bacterial MS11 P+ lysate without pECFP-N1 and lane 1 shows uncut circular pECFP-N1. B. PFGE analysis of purified VK2/E6E7 genomic DNA treated for 24 h with: lane 1: PBS (negative control), lane 2: MS11 P+ lysate, lane 3: MS11 P+ HI lysate. Lane 4 shows bacterial MS11 P+ lysate without VK2/E6E7 genomic DNA. C. Graph showing quantification of DNA smears (measured directly underneath and below the band). Shown are smear pixel intensities of cellular DNA alone and cellular DNA exposed to bacterial lysates and HI bacterial lysates. D. PFGE showing genomic DNA subjected to commercial restriction enzymes for 24 h. Lane 1: DNA incubated with <t>CutSmart</t> reaction buffer (negative control). Lane 2: DNA incubated with NgoMIV. Lane 3: DNA incubated with MfeI, Lane 4: DNA incubated with NgoMIV and MfeI Lane 5: DNA incubated with NgoMIV and BamHI/KpnI/MfeI (BKM).
    Cutsmart Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 106 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cutsmart buffer/product/New England Biolabs
    Average 95 stars, based on 106 article reviews
    Price from $9.99 to $1999.99
    cutsmart buffer - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    A total of 1225 tiled fluorescence microscopy images of a sample of E. coli genomic DNA labeled with Atto647N at sites reading 5′-TCGA-3′ using the M. Taq I DNA methyltransferase enzyme in order to direct labeling. The image contains approximately 500 megabases of genomic material and took of the order of 10 min to acquire.

    Journal: ACS Nano

    Article Title: Combing of Genomic DNA from Droplets Containing Picograms of Material

    doi: 10.1021/nn5063497

    Figure Lengend Snippet: A total of 1225 tiled fluorescence microscopy images of a sample of E. coli genomic DNA labeled with Atto647N at sites reading 5′-TCGA-3′ using the M. Taq I DNA methyltransferase enzyme in order to direct labeling. The image contains approximately 500 megabases of genomic material and took of the order of 10 min to acquire.

    Article Snippet: To the molten agarose we added 10 μL of NEB cutsmart buffer, 10 μL of M.Taq I DNA methyltransferase (New England Biolabs) and 10 μL of 1 mM AdoEnYn cofactor (5′-[(S )-[(3S )-3-amino-3-carboxylpropyl](E )-pent-2-en-4-ynylsulfonio]-5′-deoxyadenosine).

    Techniques: Fluorescence, Microscopy, Labeling

    Schematic overview of droplet Tn-Seq. a A microfluidic device encapsulates single bacterial cells into droplets containing growth medium. Bacteria are allowed to grow within droplets, genomic DNA (gDNA) is isolated at the start of the experiment (t1) and after growth (t2). Importantly, while growth for each transposon mutant takes place in isolation, gDNA is isolated from the pooled population, enabling screening of all mutants simultaneously. b gDNA is then amplified with DNA polymerase phi29, digested with MmeI, an adapter is ligated, a ~180 bp fragment is produced which contains ~16 nucleotides of bacterial gDNA, defining the transposon-insertion location, followed by Illumina sequencing. Reads are demultiplexed based on the barcode in the adapter and a potential second barcode in primer 1, mapped to the genome, and fitness is calculated for each defined region.

    Journal: Nature Communications

    Article Title: Droplet Tn-Seq combines microfluidics with Tn-Seq for identifying complex single-cell phenotypes

    doi: 10.1038/s41467-019-13719-9

    Figure Lengend Snippet: Schematic overview of droplet Tn-Seq. a A microfluidic device encapsulates single bacterial cells into droplets containing growth medium. Bacteria are allowed to grow within droplets, genomic DNA (gDNA) is isolated at the start of the experiment (t1) and after growth (t2). Importantly, while growth for each transposon mutant takes place in isolation, gDNA is isolated from the pooled population, enabling screening of all mutants simultaneously. b gDNA is then amplified with DNA polymerase phi29, digested with MmeI, an adapter is ligated, a ~180 bp fragment is produced which contains ~16 nucleotides of bacterial gDNA, defining the transposon-insertion location, followed by Illumina sequencing. Reads are demultiplexed based on the barcode in the adapter and a potential second barcode in primer 1, mapped to the genome, and fitness is calculated for each defined region.

    Article Snippet: Beads were then dried for 3 min at room temperature, and DNA was eluted off the beads with 12.7 μl of dH2 O. (3) In all, 11.49 μl of phi29 amplified DNA was then added to a MmeI digestion mix (two units NEB MmeI enzyme, 50 μM SAM, 1× CutSmart Buffer) in a total volume of 20 μl, and incubated for 2.5 h at 37 °C followed by 20 min at 65 °C. (4) In all, 1 μl of alkaline phosphatase (NEB - M0290S Calf Intestinal, CIP) was added to the sample and incubated for 1 h at 37 °C. (5) In total, 10 μl of magnetic beads plus 20 μl PEG solution per sample were used to wash the sample followed by elution in 14.3 μl of dH2 O. (6) T4 DNA ligase (NEB M0202L) was used to ligate DNA adapter barcodes by adding 13.12 μl DNA to 1 μl of 1:5 diluted adapter, 1× T4 DNA Ligase Reaction Buffer, and 400 units T4 DNA ligase, followed by incubation at 16 °C for 16 h, 65 °C for 10 min, and held at 10 °C. (7) In all, 10 μl magnetic beads plus 20 μl PEG solution were used to wash the sample followed by elution in 36 μl of dH2 O. (8) Adapter ligated DNA was then PCR amplified using Q5 high-fidelity DNA polymerase (NEB – M0491L) by adding 34 μl of DNA to 1X Q5 reaction buffer, 10 mM dNTPs, 0.45 μM of each primer (P1-M6-GAT-MmeI; P2-ADPT-Tnseq-primer; Supplementary Data ), one unit Q5 DNA polymerase, and incubated at 98 °C for 30 s, and 18–22 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 15 s, followed by 72 °C for 2 min, and a 10 °C hold. (9) PCR products were gel purified and sequenced on an Illumina NextSeq 500 according to the manufacturer's protocol.

    Techniques: Isolation, Mutagenesis, Amplification, Produced, Sequencing

    Unbiased whole-genome amplification of low-quantity genomic DNA. a , b gDNA was prepared by two different methods for transposon sequencing. For the WGA sample, 10 ng of gDNA was amplified first with DNA polymerase phi29 before MmeI digestion and adapter ligation. For the standard sample, 1 μg of gDNA was digested with MmeI, followed by adapter ligation. There is a strong correlation between fitness values obtained from WGA preparation compared with standard Tn-Seq library preparation a , and WGA preparation is highly reproducible b .

    Journal: Nature Communications

    Article Title: Droplet Tn-Seq combines microfluidics with Tn-Seq for identifying complex single-cell phenotypes

    doi: 10.1038/s41467-019-13719-9

    Figure Lengend Snippet: Unbiased whole-genome amplification of low-quantity genomic DNA. a , b gDNA was prepared by two different methods for transposon sequencing. For the WGA sample, 10 ng of gDNA was amplified first with DNA polymerase phi29 before MmeI digestion and adapter ligation. For the standard sample, 1 μg of gDNA was digested with MmeI, followed by adapter ligation. There is a strong correlation between fitness values obtained from WGA preparation compared with standard Tn-Seq library preparation a , and WGA preparation is highly reproducible b .

    Article Snippet: Beads were then dried for 3 min at room temperature, and DNA was eluted off the beads with 12.7 μl of dH2 O. (3) In all, 11.49 μl of phi29 amplified DNA was then added to a MmeI digestion mix (two units NEB MmeI enzyme, 50 μM SAM, 1× CutSmart Buffer) in a total volume of 20 μl, and incubated for 2.5 h at 37 °C followed by 20 min at 65 °C. (4) In all, 1 μl of alkaline phosphatase (NEB - M0290S Calf Intestinal, CIP) was added to the sample and incubated for 1 h at 37 °C. (5) In total, 10 μl of magnetic beads plus 20 μl PEG solution per sample were used to wash the sample followed by elution in 14.3 μl of dH2 O. (6) T4 DNA ligase (NEB M0202L) was used to ligate DNA adapter barcodes by adding 13.12 μl DNA to 1 μl of 1:5 diluted adapter, 1× T4 DNA Ligase Reaction Buffer, and 400 units T4 DNA ligase, followed by incubation at 16 °C for 16 h, 65 °C for 10 min, and held at 10 °C. (7) In all, 10 μl magnetic beads plus 20 μl PEG solution were used to wash the sample followed by elution in 36 μl of dH2 O. (8) Adapter ligated DNA was then PCR amplified using Q5 high-fidelity DNA polymerase (NEB – M0491L) by adding 34 μl of DNA to 1X Q5 reaction buffer, 10 mM dNTPs, 0.45 μM of each primer (P1-M6-GAT-MmeI; P2-ADPT-Tnseq-primer; Supplementary Data ), one unit Q5 DNA polymerase, and incubated at 98 °C for 30 s, and 18–22 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 15 s, followed by 72 °C for 2 min, and a 10 °C hold. (9) PCR products were gel purified and sequenced on an Illumina NextSeq 500 according to the manufacturer's protocol.

    Techniques: Whole Genome Amplification, Sequencing, Amplification, Ligation

    Lysates of N. gonorrhoeae fragments pECFP-N1 and damage DNA from VK2/E6E7 cells. A. DNA agarose gel showing the digestion of pECFP-N1 plasmid by HindIII (positive control, lane 2), MS11 P+ lysate (lane 3), and MS11 P+ HI lysate (lane 5). Lane 5 shows bacterial MS11 P+ lysate without pECFP-N1 and lane 1 shows uncut circular pECFP-N1. B. PFGE analysis of purified VK2/E6E7 genomic DNA treated for 24 h with: lane 1: PBS (negative control), lane 2: MS11 P+ lysate, lane 3: MS11 P+ HI lysate. Lane 4 shows bacterial MS11 P+ lysate without VK2/E6E7 genomic DNA. C. Graph showing quantification of DNA smears (measured directly underneath and below the band). Shown are smear pixel intensities of cellular DNA alone and cellular DNA exposed to bacterial lysates and HI bacterial lysates. D. PFGE showing genomic DNA subjected to commercial restriction enzymes for 24 h. Lane 1: DNA incubated with CutSmart reaction buffer (negative control). Lane 2: DNA incubated with NgoMIV. Lane 3: DNA incubated with MfeI, Lane 4: DNA incubated with NgoMIV and MfeI Lane 5: DNA incubated with NgoMIV and BamHI/KpnI/MfeI (BKM).

    Journal: PLoS ONE

    Article Title: Restriction Endonucleases from Invasive Neisseria gonorrhoeae Cause Double-Strand Breaks and Distort Mitosis in Epithelial Cells during Infection

    doi: 10.1371/journal.pone.0114208

    Figure Lengend Snippet: Lysates of N. gonorrhoeae fragments pECFP-N1 and damage DNA from VK2/E6E7 cells. A. DNA agarose gel showing the digestion of pECFP-N1 plasmid by HindIII (positive control, lane 2), MS11 P+ lysate (lane 3), and MS11 P+ HI lysate (lane 5). Lane 5 shows bacterial MS11 P+ lysate without pECFP-N1 and lane 1 shows uncut circular pECFP-N1. B. PFGE analysis of purified VK2/E6E7 genomic DNA treated for 24 h with: lane 1: PBS (negative control), lane 2: MS11 P+ lysate, lane 3: MS11 P+ HI lysate. Lane 4 shows bacterial MS11 P+ lysate without VK2/E6E7 genomic DNA. C. Graph showing quantification of DNA smears (measured directly underneath and below the band). Shown are smear pixel intensities of cellular DNA alone and cellular DNA exposed to bacterial lysates and HI bacterial lysates. D. PFGE showing genomic DNA subjected to commercial restriction enzymes for 24 h. Lane 1: DNA incubated with CutSmart reaction buffer (negative control). Lane 2: DNA incubated with NgoMIV. Lane 3: DNA incubated with MfeI, Lane 4: DNA incubated with NgoMIV and MfeI Lane 5: DNA incubated with NgoMIV and BamHI/KpnI/MfeI (BKM).

    Article Snippet: Portions of lysates were further heat inactivated (HI) at 95°C for 10 min. One µg of the commercial plasmid pECFP-N1 (Clonetech, CA, USA) was subjected to either MS11 P+ lysate or HI lysate together with CutSmart buffer (New England Biolabs, Ipswich, MA, USA) for 1 h. As controls, circular/uncut pECFP-N1 was used as well as HindIII (Roche, Mannheim, Germany) linearized pECFP-N1.

    Techniques: Agarose Gel Electrophoresis, Plasmid Preparation, Positive Control, Purification, Negative Control, Incubation

    Exo I III versus Exo T5 digestion of plasmid DNA. (A) Diagrams showing expected digestion results of various plasmid DNA species. A break in the circle denotes the nick on the DNA strand. (B and C) Plasmid pCI-HBc (2.5 ng) was mixed with 20 μl of mock PF DNA extracted from uninduced HepAD38 cells. The DNA mix was first treated with Nb.BbvCI (5 units) to nick the plasmid DNA specifically on the minus strand (B and C, lanes 5 to 8) or was left untreated (B and C, lanes 1 to 4) before digestion with Exo I III (5 units and 25 units, respectively) in two different buffers or with Exo T5 (5 units). The DNA samples were then resolved on an agarose gel, and HBc DNA was detected by Southern blotting using a riboprobe specific for the viral plus-strand (B) or minus-strand (C) DNA. The diagrams on the right of panel C depict the various DNA species and their migration on the gel. B3, 1× NEB buffer 3; BCS, 1× NEB buffer Cutsmart; PE, phenol extraction.

    Journal: Journal of Virology

    Article Title: Identification of an Intermediate in Hepatitis B Virus Covalently Closed Circular (CCC) DNA Formation and Sensitive and Selective CCC DNA Detection

    doi: 10.1128/JVI.00539-17

    Figure Lengend Snippet: Exo I III versus Exo T5 digestion of plasmid DNA. (A) Diagrams showing expected digestion results of various plasmid DNA species. A break in the circle denotes the nick on the DNA strand. (B and C) Plasmid pCI-HBc (2.5 ng) was mixed with 20 μl of mock PF DNA extracted from uninduced HepAD38 cells. The DNA mix was first treated with Nb.BbvCI (5 units) to nick the plasmid DNA specifically on the minus strand (B and C, lanes 5 to 8) or was left untreated (B and C, lanes 1 to 4) before digestion with Exo I III (5 units and 25 units, respectively) in two different buffers or with Exo T5 (5 units). The DNA samples were then resolved on an agarose gel, and HBc DNA was detected by Southern blotting using a riboprobe specific for the viral plus-strand (B) or minus-strand (C) DNA. The diagrams on the right of panel C depict the various DNA species and their migration on the gel. B3, 1× NEB buffer 3; BCS, 1× NEB buffer Cutsmart; PE, phenol extraction.

    Article Snippet: For exonuclease T5 (Exo T5) digestion, 20 μl PF DNA sample was treated with 0.5 μl (5 units) Exo T5 in 1× Cutsmart buffer (NEB) in a total volume of 23 μl ( ) at 37°C for 2 to 3 h. Phenol extraction was then used to remove the nucleases before qPCR.

    Techniques: Plasmid Preparation, Agarose Gel Electrophoresis, Southern Blot, Migration

    Exo I III versus Exo T5 digestion of HBV core and PF DNA. (A) Diagrams showing expected results of digestion with various HBV PF DNA species. Left, structures of known and potential HBV PF DNA species; middle and right, expected digestion products of the various DNA species. The DNA species in the rectangular box, with a covalently closed minus strand and an open plus strand, represents a potential intermediate during RC DNA to CCC DNA conversion that was identified in the current study (see the text for details). The black dot at the 5′ end of the minus strand of the PF-RC and PF-DSL DNA denotes the unknown modification of this end upon removal of the RT protein (deproteination; see the text for details). (B and C) HBV core DNA (0.3 μl) combined with mock PF DNA (20 μl) extracted from uninduced HepAD38 cells (B) or PF DNA (20 μl) extracted from induced HepAD38 cells (C) was treated with Exo I III (5 units and 25 units, respectively) (lanes 3 and 10) or Exo T5 (5 units) (lanes 6 and 13) in 1× NEB CutSmart buffer. Subsequently, MfeI-HF (10 units) was used to linearize CCC DNA (lanes 5, 7, 12, and 14) and Exo T5 (5 units) was used to digest the SS circular DNA (lanes 4 and 11). Heat treatment (95°C, 10 min) was used to denature RC DNA to SS linear DNA (lanes 2 and 9). The DNA samples were then resolved on an agarose gel, and the various HBV DNA species were detected by Southern blotting using a riboprobe specific for the plus-strand (lanes 1 to 7) or minus-strand (lanes 8 to 14) DNA. The diagrams on the sides depict the various DNA species and their migration on the gel. The positions of the various RC DNA species, CCC DNA species, and SS linear and circular DNA species are indicated by the schematic diagrams. Note that the linearized CCC DNA comigrates with the DSL DNA, a minor form present in both core DNA and PF DNA (lanes 1 and 8).

    Journal: Journal of Virology

    Article Title: Identification of an Intermediate in Hepatitis B Virus Covalently Closed Circular (CCC) DNA Formation and Sensitive and Selective CCC DNA Detection

    doi: 10.1128/JVI.00539-17

    Figure Lengend Snippet: Exo I III versus Exo T5 digestion of HBV core and PF DNA. (A) Diagrams showing expected results of digestion with various HBV PF DNA species. Left, structures of known and potential HBV PF DNA species; middle and right, expected digestion products of the various DNA species. The DNA species in the rectangular box, with a covalently closed minus strand and an open plus strand, represents a potential intermediate during RC DNA to CCC DNA conversion that was identified in the current study (see the text for details). The black dot at the 5′ end of the minus strand of the PF-RC and PF-DSL DNA denotes the unknown modification of this end upon removal of the RT protein (deproteination; see the text for details). (B and C) HBV core DNA (0.3 μl) combined with mock PF DNA (20 μl) extracted from uninduced HepAD38 cells (B) or PF DNA (20 μl) extracted from induced HepAD38 cells (C) was treated with Exo I III (5 units and 25 units, respectively) (lanes 3 and 10) or Exo T5 (5 units) (lanes 6 and 13) in 1× NEB CutSmart buffer. Subsequently, MfeI-HF (10 units) was used to linearize CCC DNA (lanes 5, 7, 12, and 14) and Exo T5 (5 units) was used to digest the SS circular DNA (lanes 4 and 11). Heat treatment (95°C, 10 min) was used to denature RC DNA to SS linear DNA (lanes 2 and 9). The DNA samples were then resolved on an agarose gel, and the various HBV DNA species were detected by Southern blotting using a riboprobe specific for the plus-strand (lanes 1 to 7) or minus-strand (lanes 8 to 14) DNA. The diagrams on the sides depict the various DNA species and their migration on the gel. The positions of the various RC DNA species, CCC DNA species, and SS linear and circular DNA species are indicated by the schematic diagrams. Note that the linearized CCC DNA comigrates with the DSL DNA, a minor form present in both core DNA and PF DNA (lanes 1 and 8).

    Article Snippet: For exonuclease T5 (Exo T5) digestion, 20 μl PF DNA sample was treated with 0.5 μl (5 units) Exo T5 in 1× Cutsmart buffer (NEB) in a total volume of 23 μl ( ) at 37°C for 2 to 3 h. Phenol extraction was then used to remove the nucleases before qPCR.

    Techniques: Countercurrent Chromatography, Modification, Agarose Gel Electrophoresis, Southern Blot, Migration

    Confirmation of the closed circular minus strand in the processed RC DNA by BmgBI or Nt.BbvCI and Exo I III digestion. (A and D) Diagrams showing expected results of digestion performed with various HBV PF DNA species. The short line intersecting the circle denotes the site of BmgBI digestion (A) or Nt.BbvCI nicking (D). The presence of the RNA (short gray line) at the 5′ end of the plus strand in RC DNA prevents BmgBI digestion (panel A; arrow blocked by a short line). The black dot at the 5′ end of the minus strand of the PF-RC DNA denotes the unknown modification of this end upon removal of the RT protein. The DNA species indicated in the rectangular box, with a covalently closed minus strand and an open plus strand, represents a potential intermediate during RC DNA to CCC DNA conversion that was identified in this study (see the text for details). (B and C) HBV core DNA (0.3 μl) combined with mock PF DNA (20 μl) extracted from uninduced HepAD38 cells (lanes 1 to 3) or PF DNA (lanes 4 to 6) extracted from induced HepAD38 cells was treated with BmgBI (5 units) in 1× NEB buffer 3 to linearize all supercoiled and nicked CCC DNA (lanes 2, 3, 5, and 6) or was mock treated (lanes 1 and 4). For lanes 3 and 6, the DNA samples were further digested with Exo I III after BmgBI treatment. The samples were then resolved on an agarose gel, and various HBV DNA species were detected by Southern blotting using a riboprobe specific for the viral plus-strand (B) or minus-strand (C) DNA. The diagrams on the right of panel C depict the various DNA species and their migration on the gel. (E) PF DNA extracted from induced HepAD38 cells was treated with Nt.BbvCI (5 units) in 1× NEB Cutsmart buffer to nick all CCC DNA (lanes 3, 4, 7, and 8) or mock treated (lanes 1 and 5). For lanes 4 and 8, the DNA samples were further digested with Exo I III after Nt.BbvCI treatment. The samples were then resolved on an agarose gel, and various HBV DNA species were detected by Southern blotting using a riboprobe specific for the viral plus-strand (lanes 1 to 4) or minus-strand (lanes 5 to 8) DNA. The diagrams on the right depict the various DNA species and their migration on the gel. Marker, the DNA marker lane. The size of the DNA markers is indicated (in kilobase pairs). The blank spaces between the lanes in panels B, C, and E indicate where other lanes from the same gel that were deemed nonessential for this work were cropped out during the preparation of the figure.

    Journal: Journal of Virology

    Article Title: Identification of an Intermediate in Hepatitis B Virus Covalently Closed Circular (CCC) DNA Formation and Sensitive and Selective CCC DNA Detection

    doi: 10.1128/JVI.00539-17

    Figure Lengend Snippet: Confirmation of the closed circular minus strand in the processed RC DNA by BmgBI or Nt.BbvCI and Exo I III digestion. (A and D) Diagrams showing expected results of digestion performed with various HBV PF DNA species. The short line intersecting the circle denotes the site of BmgBI digestion (A) or Nt.BbvCI nicking (D). The presence of the RNA (short gray line) at the 5′ end of the plus strand in RC DNA prevents BmgBI digestion (panel A; arrow blocked by a short line). The black dot at the 5′ end of the minus strand of the PF-RC DNA denotes the unknown modification of this end upon removal of the RT protein. The DNA species indicated in the rectangular box, with a covalently closed minus strand and an open plus strand, represents a potential intermediate during RC DNA to CCC DNA conversion that was identified in this study (see the text for details). (B and C) HBV core DNA (0.3 μl) combined with mock PF DNA (20 μl) extracted from uninduced HepAD38 cells (lanes 1 to 3) or PF DNA (lanes 4 to 6) extracted from induced HepAD38 cells was treated with BmgBI (5 units) in 1× NEB buffer 3 to linearize all supercoiled and nicked CCC DNA (lanes 2, 3, 5, and 6) or was mock treated (lanes 1 and 4). For lanes 3 and 6, the DNA samples were further digested with Exo I III after BmgBI treatment. The samples were then resolved on an agarose gel, and various HBV DNA species were detected by Southern blotting using a riboprobe specific for the viral plus-strand (B) or minus-strand (C) DNA. The diagrams on the right of panel C depict the various DNA species and their migration on the gel. (E) PF DNA extracted from induced HepAD38 cells was treated with Nt.BbvCI (5 units) in 1× NEB Cutsmart buffer to nick all CCC DNA (lanes 3, 4, 7, and 8) or mock treated (lanes 1 and 5). For lanes 4 and 8, the DNA samples were further digested with Exo I III after Nt.BbvCI treatment. The samples were then resolved on an agarose gel, and various HBV DNA species were detected by Southern blotting using a riboprobe specific for the viral plus-strand (lanes 1 to 4) or minus-strand (lanes 5 to 8) DNA. The diagrams on the right depict the various DNA species and their migration on the gel. Marker, the DNA marker lane. The size of the DNA markers is indicated (in kilobase pairs). The blank spaces between the lanes in panels B, C, and E indicate where other lanes from the same gel that were deemed nonessential for this work were cropped out during the preparation of the figure.

    Article Snippet: For exonuclease T5 (Exo T5) digestion, 20 μl PF DNA sample was treated with 0.5 μl (5 units) Exo T5 in 1× Cutsmart buffer (NEB) in a total volume of 23 μl ( ) at 37°C for 2 to 3 h. Phenol extraction was then used to remove the nucleases before qPCR.

    Techniques: Modification, Countercurrent Chromatography, Agarose Gel Electrophoresis, Southern Blot, Migration, Marker