ctrl shrna  (Millipore)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Name:
    MISSION shRNA Product Offerings
    Description:
    Sigma Aldrich is a global supplier of leading RNA interference RNAi tools The MISSION TRC shRNA libraries are a comprehensive collection of 150 000 pre cloned shRNA constructs targeting 15 000 human and 15 000 mouse genes These lentiviral based constructs allow flexible delivery of long or short term silencing in a broad range of mammalian cell types including primary and non dividing cells The MISSION TRC shRNA libraries provide solutions for pathway elucidation target identification and are ideal for high content screens The libraries are offered with a variety of options and formats Entire libraries gene family sets target sets or individual clones are available as bacterial glycerol stocks purified DNA and lentiviral transduction particles To find more information including protocols references and frequently asked questions visit the RNAi website
    Catalog Number:
    shrna
    Price:
    None
    Buy from Supplier


    Structured Review

    Millipore ctrl shrna
    MISSION shRNA Product Offerings
    Sigma Aldrich is a global supplier of leading RNA interference RNAi tools The MISSION TRC shRNA libraries are a comprehensive collection of 150 000 pre cloned shRNA constructs targeting 15 000 human and 15 000 mouse genes These lentiviral based constructs allow flexible delivery of long or short term silencing in a broad range of mammalian cell types including primary and non dividing cells The MISSION TRC shRNA libraries provide solutions for pathway elucidation target identification and are ideal for high content screens The libraries are offered with a variety of options and formats Entire libraries gene family sets target sets or individual clones are available as bacterial glycerol stocks purified DNA and lentiviral transduction particles To find more information including protocols references and frequently asked questions visit the RNAi website
    https://www.bioz.com/result/ctrl shrna/product/Millipore
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ctrl shrna - by Bioz Stars, 2021-03
    97/100 stars

    Images

    1) Product Images from "Testicular Lmcd1 regulates phagocytosis by Sertoli cells through modulation of NFAT1/Txlna signaling pathway"

    Article Title: Testicular Lmcd1 regulates phagocytosis by Sertoli cells through modulation of NFAT1/Txlna signaling pathway

    Journal: Aging Cell

    doi: 10.1111/acel.13217

    Lmcd1 depletion compromises TXLNA‐mediated testicular phagocytosis. (a) Expression levels of different key factors essential for testicular phagocytosis in Lmcd1 siRNA‐treated testis were determined using RT‐qPCR. ** p
    Figure Legend Snippet: Lmcd1 depletion compromises TXLNA‐mediated testicular phagocytosis. (a) Expression levels of different key factors essential for testicular phagocytosis in Lmcd1 siRNA‐treated testis were determined using RT‐qPCR. ** p

    Techniques Used: Expressing, Quantitative RT-PCR

    Effects of ablation of Lmcd1 expression in vivo on testicular morphology and GC apoptosis. (a) Schematic representation of the experimental procedures used in the in vivo siRNA treatment. (b) Effects of endogenous Lmcd1 knockdown in testis by in vivo siRNA treatment were confirmed by RT‐qPCR at transcriptional level. (c) Effects of endogenous Lmcd1 knockdown in testis by in vivo siRNA treatment were confirmed by immunohistochemistry at translational level. Scale bar, 25 μm. (d) Effect of in vivo siRNA treatment on mouse testicular morphology was evaluated in H E‐stained transverse testis sections. Scale bar, 25 μm. Asterisks denote vacuoles. (e) Effect of in vivo siRNA treatment on GC apoptosis was assessed using TUNEL staining, followed by the quantification of TUNEL‐positive cells (right panel)
    Figure Legend Snippet: Effects of ablation of Lmcd1 expression in vivo on testicular morphology and GC apoptosis. (a) Schematic representation of the experimental procedures used in the in vivo siRNA treatment. (b) Effects of endogenous Lmcd1 knockdown in testis by in vivo siRNA treatment were confirmed by RT‐qPCR at transcriptional level. (c) Effects of endogenous Lmcd1 knockdown in testis by in vivo siRNA treatment were confirmed by immunohistochemistry at translational level. Scale bar, 25 μm. (d) Effect of in vivo siRNA treatment on mouse testicular morphology was evaluated in H E‐stained transverse testis sections. Scale bar, 25 μm. Asterisks denote vacuoles. (e) Effect of in vivo siRNA treatment on GC apoptosis was assessed using TUNEL staining, followed by the quantification of TUNEL‐positive cells (right panel)

    Techniques Used: Expressing, In Vivo, Quantitative RT-PCR, Immunohistochemistry, Staining, TUNEL Assay

    Functional relevance and paracrine control of LMCD1 expression during testicular phagocytosis. (a) Effect of siRNA treatment on testicular phagocytosis in vivo was evaluated using Oil Red O staining. (b) Upper panel: Representative pictures of residual body (RB) binding and phagocytized by Ctrl siRNA or Lmcd1 siRNA‐treated 15P‐1 cells 6 h after addition of RBs. Arrowheads denote the ingested and plasma membrane‐bound RBs, whereas arrows denote the cells with no phagocytized RBs. Lower panel: Kinetics of RB binding and phagocytosis by SCs (the binding and phagocytosis index) were calculated as the ratio of positive green signals/nuclei number in each well. Quantitative values were presented as mean ± SD of three independent experiments (* p
    Figure Legend Snippet: Functional relevance and paracrine control of LMCD1 expression during testicular phagocytosis. (a) Effect of siRNA treatment on testicular phagocytosis in vivo was evaluated using Oil Red O staining. (b) Upper panel: Representative pictures of residual body (RB) binding and phagocytized by Ctrl siRNA or Lmcd1 siRNA‐treated 15P‐1 cells 6 h after addition of RBs. Arrowheads denote the ingested and plasma membrane‐bound RBs, whereas arrows denote the cells with no phagocytized RBs. Lower panel: Kinetics of RB binding and phagocytosis by SCs (the binding and phagocytosis index) were calculated as the ratio of positive green signals/nuclei number in each well. Quantitative values were presented as mean ± SD of three independent experiments (* p

    Techniques Used: Functional Assay, Expressing, In Vivo, Staining, Binding Assay

    2) Product Images from "Noradrenaline from Locus Coeruleus Neurons Acts on Pedunculo-Pontine Neurons to Prevent REM Sleep and Induces Its Loss-Associated Effects in Rats"

    Article Title: Noradrenaline from Locus Coeruleus Neurons Acts on Pedunculo-Pontine Neurons to Prevent REM Sleep and Induces Its Loss-Associated Effects in Rats

    Journal: eNeuro

    doi: 10.1523/ENEURO.0108-16.2016

    Under stereotaxic surgery, either TH-shRNA or Ctrl-shRNA was microinjected into the right and the left LC, respectively, in the same rat in three groups (I, II, and III). a , b , Eight days after injection, the left and right LCs were punched from group I ( n = 5) and group II ( n = 4) rats to estimate TH mRNA ( a ) and TH protein ( b ), respectively. c , Group III ( n = 5) rat brains were taken out, and sections containing LC were immunostained with anti-TH antibodies. a , For the normalization of TH gene expression, both GAPDH and TBP were taken as reference genes. Taking the TH mRNA expression in the Ctrl-shRNA injected rats as 100%, the percentage change TH mRNA expression in TH-shRNA injected rats was estimated. The histogram shows that the TH mRNA was significantly downregulated by ∼74% (*** p
    Figure Legend Snippet: Under stereotaxic surgery, either TH-shRNA or Ctrl-shRNA was microinjected into the right and the left LC, respectively, in the same rat in three groups (I, II, and III). a , b , Eight days after injection, the left and right LCs were punched from group I ( n = 5) and group II ( n = 4) rats to estimate TH mRNA ( a ) and TH protein ( b ), respectively. c , Group III ( n = 5) rat brains were taken out, and sections containing LC were immunostained with anti-TH antibodies. a , For the normalization of TH gene expression, both GAPDH and TBP were taken as reference genes. Taking the TH mRNA expression in the Ctrl-shRNA injected rats as 100%, the percentage change TH mRNA expression in TH-shRNA injected rats was estimated. The histogram shows that the TH mRNA was significantly downregulated by ∼74% (*** p

    Techniques Used: shRNA, Injection, Expressing

    Percentage (±SEM) of total recording time spent in waking state, NREMS, and REMS 8 d after TH-shRNA or Ctrl-shRNA microinjection into the LC and Sal or NA microinjection into the PPT (on the day of recording), and 21 d after TH-shRNA microinjection. a–c , The histograms show analyses of total recording periods of 12 h (10:00 A.M. to 10:00 P.M.; a ), 8 h (10:00 A.M. to 6:00 P.M.; b ), and 4 h (6:00 to 10:00 P.M.; c ). Abbreviations are as in the text. *Compared with baseline values and Ctrl-shRNA injection; $compared with TH-shRNA injection into LC and NA injection into PPT or 3 weeks after the injection of TH-shRNA into LC. Significance level: *** p
    Figure Legend Snippet: Percentage (±SEM) of total recording time spent in waking state, NREMS, and REMS 8 d after TH-shRNA or Ctrl-shRNA microinjection into the LC and Sal or NA microinjection into the PPT (on the day of recording), and 21 d after TH-shRNA microinjection. a–c , The histograms show analyses of total recording periods of 12 h (10:00 A.M. to 10:00 P.M.; a ), 8 h (10:00 A.M. to 6:00 P.M.; b ), and 4 h (6:00 to 10:00 P.M.; c ). Abbreviations are as in the text. *Compared with baseline values and Ctrl-shRNA injection; $compared with TH-shRNA injection into LC and NA injection into PPT or 3 weeks after the injection of TH-shRNA into LC. Significance level: *** p

    Techniques Used: shRNA, Injection

    Changes in REMS frequency per hour (top) and REMS duration/episode (s; bottom) during the recording of TH-shRNA or Ctrl-shRNA 8 d after microinjection into LC and Sal or NA microinjection into PPT (on the recording day), and 21 d after TH-shRNA microinjection. a–d , The histograms show analyses for the total recording period of 12 h (10:00 A.M. to 10:00 P.M.; a , c ), and 8 h (10:00 A.M. to 6:00 P.M.) and 4 h (6:00 to 10:00 P.M.; b , d ). Abbreviations are as in the text. *Compared with baseline and Ctrl-shRNA; $compared with TH-shRNA injection into LC and NA injection into PPT or 3 weeks after the injection of TH-shRNA into the LC. Significance level: *** p
    Figure Legend Snippet: Changes in REMS frequency per hour (top) and REMS duration/episode (s; bottom) during the recording of TH-shRNA or Ctrl-shRNA 8 d after microinjection into LC and Sal or NA microinjection into PPT (on the recording day), and 21 d after TH-shRNA microinjection. a–d , The histograms show analyses for the total recording period of 12 h (10:00 A.M. to 10:00 P.M.; a , c ), and 8 h (10:00 A.M. to 6:00 P.M.) and 4 h (6:00 to 10:00 P.M.; b , d ). Abbreviations are as in the text. *Compared with baseline and Ctrl-shRNA; $compared with TH-shRNA injection into LC and NA injection into PPT or 3 weeks after the injection of TH-shRNA into the LC. Significance level: *** p

    Techniques Used: shRNA, Injection

    a , Representative SleepSign-recorded simultaneous traces of EEG, EOG, and EMG showing waking state, NREMS, and REMS episodes in one rat treated with TH-shRNA injection into LC and injected with saline or NA into the PPT (as labeled on the figure). b , The power spectrum of average FFT (Fast Fourier Transformation) of EEG of all the REMS episodes during the 10:00 A.M. to 10:00 P.M. recording period of one rat under different conditions. Dashed line shows the data of the rat with TH-shRNA injection into LC and saline injection into PPT (total number of episodes of REMS = 131 ± 10), while the continuous line shows TH-shRNA injection into LC and NA injection into PPT (total number of episodes of REMS = 91 ± 13). It shows that the theta waves (5–7.5 Hz) peaked in the background of other frequencies. The histogram in the inset shows the average power of the theta waves (5–7.5 Hz) only of the rats shown in the line plot under the two conditions. It shows that the average power of theta waves was comparable under the two treatment conditions.
    Figure Legend Snippet: a , Representative SleepSign-recorded simultaneous traces of EEG, EOG, and EMG showing waking state, NREMS, and REMS episodes in one rat treated with TH-shRNA injection into LC and injected with saline or NA into the PPT (as labeled on the figure). b , The power spectrum of average FFT (Fast Fourier Transformation) of EEG of all the REMS episodes during the 10:00 A.M. to 10:00 P.M. recording period of one rat under different conditions. Dashed line shows the data of the rat with TH-shRNA injection into LC and saline injection into PPT (total number of episodes of REMS = 131 ± 10), while the continuous line shows TH-shRNA injection into LC and NA injection into PPT (total number of episodes of REMS = 91 ± 13). It shows that the theta waves (5–7.5 Hz) peaked in the background of other frequencies. The histogram in the inset shows the average power of the theta waves (5–7.5 Hz) only of the rats shown in the line plot under the two conditions. It shows that the average power of theta waves was comparable under the two treatment conditions.

    Techniques Used: shRNA, Injection, Labeling, Transformation Assay

    a , Diagrammatic representation of rat brain atlas sections through PPT (left) and LC (right) showing implantation of guide cannulae for microinjections into respective sites. b , c , Photomicrographs of representative histological hemisections of experimental rat brains through ( b ) PPT (neutral red stained) and ( c ) LC (TH antibody immunostained) aligned against corresponding rat brain atlas hemisection have been shown. Reconstructed microinjection on-target sites of NA into PPT ( n = 5) have been shown (open circle) on the right half of the brain atlas hemisection ( b ). As the TH-shRNA was microinjected into the LC during surgery and the injector cannula was removed, it was extremely difficult to trace the extension of the cannula tract on the histological sections. Hence, we confirmed the microinjection site by identifying very few TH-positive neurons in the anatomical LC site (as marked). 4V, 4th ventricle; Aq-, aqueduct; DMTg, dorsomedial tegmental area; MnR, medial raphe nucleus; Pn, pontine nuclei; RIP, raphe interpositus nucleus; scp, superior cerebellar penducle.
    Figure Legend Snippet: a , Diagrammatic representation of rat brain atlas sections through PPT (left) and LC (right) showing implantation of guide cannulae for microinjections into respective sites. b , c , Photomicrographs of representative histological hemisections of experimental rat brains through ( b ) PPT (neutral red stained) and ( c ) LC (TH antibody immunostained) aligned against corresponding rat brain atlas hemisection have been shown. Reconstructed microinjection on-target sites of NA into PPT ( n = 5) have been shown (open circle) on the right half of the brain atlas hemisection ( b ). As the TH-shRNA was microinjected into the LC during surgery and the injector cannula was removed, it was extremely difficult to trace the extension of the cannula tract on the histological sections. Hence, we confirmed the microinjection site by identifying very few TH-positive neurons in the anatomical LC site (as marked). 4V, 4th ventricle; Aq-, aqueduct; DMTg, dorsomedial tegmental area; MnR, medial raphe nucleus; Pn, pontine nuclei; RIP, raphe interpositus nucleus; scp, superior cerebellar penducle.

    Techniques Used: Staining, shRNA

    Changes in REMS frequency per hour (top) and REMS duration per episode (s; bottom) 24 h after TH-siRNA or Ctrl-siRNA microinjection into LC. a–d , Analyses for the total period of 12 h (10:00 A.M. to 10:00 P.M.; a , c ), 8 h (10:00 A.M. to 6:00 P.M.; b , d ), and 4 h (6:00 to 10:00 P.M.; b , d ) are shown. *Compared with baseline and Ctrl-siRNA values. Significance level: *** p
    Figure Legend Snippet: Changes in REMS frequency per hour (top) and REMS duration per episode (s; bottom) 24 h after TH-siRNA or Ctrl-siRNA microinjection into LC. a–d , Analyses for the total period of 12 h (10:00 A.M. to 10:00 P.M.; a , c ), 8 h (10:00 A.M. to 6:00 P.M.; b , d ), and 4 h (6:00 to 10:00 P.M.; b , d ) are shown. *Compared with baseline and Ctrl-siRNA values. Significance level: *** p

    Techniques Used:

    a , Diagrammatic representation of protocol of experiment 3. b , Percentage (mean ± SEM) changes in Na-K ATPase activity in the brain homogenate of rats deprived of REMS after microinjection of TH-siRNA or Ctrl-siRNA bilaterally into the LC compared with the Na-K ATPase activity of FMC rats taken as 100%. c , Percentage (mean ± SEM) changes in Na-K ATPase activity in the brain homogenate of rats deprived of REMS after microinjection of TH-shRNA or Ctrl-shRNA bilaterally into the LC compared with Na-K ATPase activity in FMC rats taken as 100%. d , Percentage (mean ± SEM) change in TH protein expression in the brains of rats deprived of REMS for 96 h after the microinjection of TH-shRNA and Ctrl-shRNA bilaterally into the LC relative to FMC control taken as 100% are shown. *Compared with FMC; $compared with Ctrl-shRNA/Ctrl-siRNA in LC and subjected to REMSD. Significance level: *** p
    Figure Legend Snippet: a , Diagrammatic representation of protocol of experiment 3. b , Percentage (mean ± SEM) changes in Na-K ATPase activity in the brain homogenate of rats deprived of REMS after microinjection of TH-siRNA or Ctrl-siRNA bilaterally into the LC compared with the Na-K ATPase activity of FMC rats taken as 100%. c , Percentage (mean ± SEM) changes in Na-K ATPase activity in the brain homogenate of rats deprived of REMS after microinjection of TH-shRNA or Ctrl-shRNA bilaterally into the LC compared with Na-K ATPase activity in FMC rats taken as 100%. d , Percentage (mean ± SEM) change in TH protein expression in the brains of rats deprived of REMS for 96 h after the microinjection of TH-shRNA and Ctrl-shRNA bilaterally into the LC relative to FMC control taken as 100% are shown. *Compared with FMC; $compared with Ctrl-shRNA/Ctrl-siRNA in LC and subjected to REMSD. Significance level: *** p

    Techniques Used: Activity Assay, shRNA, Expressing

    a , A representative photomicrograph of a neutral red-stained histological hemisection through LC showing the TH-siRNA microinjection site aligned with the corresponding hemisection of the rat brain atlas is shown. On-target microinjection sites (open circles) from five rat brains have been reconstructed on the left hemisection, which also shows one off-target site (black solid circle). 4V, 4th ventricle; DMTg, dorsomedial tegmental area; RIP, raphe interpositus nucleus. b–d , Percentage (±SEM) of time spent in waking state, NREMS, and REMS 24 h after TH-siRNA or Ctrl-siRNA microinjection into LC during the total recording period of 12 h (10:00 A.M. to 10:00 P.M.; b ), 8 h (10:00 A.M. to 6:00 P.M.; c ), and 4 h (6:00 to 10:00 P.M.; d ) are shown. *Compared with baseline and Ctrl-siRNA values. Significance level: *** p
    Figure Legend Snippet: a , A representative photomicrograph of a neutral red-stained histological hemisection through LC showing the TH-siRNA microinjection site aligned with the corresponding hemisection of the rat brain atlas is shown. On-target microinjection sites (open circles) from five rat brains have been reconstructed on the left hemisection, which also shows one off-target site (black solid circle). 4V, 4th ventricle; DMTg, dorsomedial tegmental area; RIP, raphe interpositus nucleus. b–d , Percentage (±SEM) of time spent in waking state, NREMS, and REMS 24 h after TH-siRNA or Ctrl-siRNA microinjection into LC during the total recording period of 12 h (10:00 A.M. to 10:00 P.M.; b ), 8 h (10:00 A.M. to 6:00 P.M.; c ), and 4 h (6:00 to 10:00 P.M.; d ) are shown. *Compared with baseline and Ctrl-siRNA values. Significance level: *** p

    Techniques Used: Staining

    Related Articles

    Stable Transfection:

    Article Title: Tumor-Suppressive Activity of Lunatic Fringe in Prostate through Differential Modulation of Notch Receptor Activation 1
    Article Snippet: DU-145 cells were transfected with the LFNG-shRNA plasmid or the scrambled shRNA plasmid using FuGENE 6 Transfection Reagent (Promega, Madison, WI). .. Stable cell lines expressing LFNG-shRNA or scrambled shRNA were established by selection with 1 µg/ml Puromycin (Sigma, St Louis, MO). .. DU-145 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% FBS.

    Expressing:

    Article Title: Tumor-Suppressive Activity of Lunatic Fringe in Prostate through Differential Modulation of Notch Receptor Activation 1
    Article Snippet: DU-145 cells were transfected with the LFNG-shRNA plasmid or the scrambled shRNA plasmid using FuGENE 6 Transfection Reagent (Promega, Madison, WI). .. Stable cell lines expressing LFNG-shRNA or scrambled shRNA were established by selection with 1 µg/ml Puromycin (Sigma, St Louis, MO). .. DU-145 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% FBS.

    Article Title: PGC1? promotes tumor growth by inducing gene expression programs supporting lipogenesis
    Article Snippet: ATCC characterizes cell lines by short tandem repeat profiling. .. Lentiviral expression shRNA against PGC1α was obtained from Sigma. .. Lentivirus particles expressing shRNA against PGC1 were produced according to manufactures directions in 293T cells.

    Article Title: Molecular Depletion of Descending Serotonin Unmasks Its Novel Facilitatory Role in the Development of Persistent Pain
    Article Snippet: .. To determine effects of Tph-2 shRNA or scrambled shRNA on expression of Tph-2, or 5-HT in neurons transferred with GFP, free-floating tissue sections were incubated with rabbit anti-Tph-2 (1:2K, Millipore), anti 5-HT (1:5K, ImmunoStar) antibody overnight. .. After washes, the sections were incubated with AffiniPure biotinylated secondary IgG (1:800, Jackson ImmunoResearch Lab, West Grove, PA) for 1 h. Streptavidin-Alexa 568 or 674 (1:800, Molecular Probes, Eugene, OR) was used for fluorescence staining of Tph-2 or 5-HT.

    shRNA:

    Article Title: Tumor-Suppressive Activity of Lunatic Fringe in Prostate through Differential Modulation of Notch Receptor Activation 1
    Article Snippet: DU-145 cells were transfected with the LFNG-shRNA plasmid or the scrambled shRNA plasmid using FuGENE 6 Transfection Reagent (Promega, Madison, WI). .. Stable cell lines expressing LFNG-shRNA or scrambled shRNA were established by selection with 1 µg/ml Puromycin (Sigma, St Louis, MO). .. DU-145 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% FBS.

    Article Title: PGC1? promotes tumor growth by inducing gene expression programs supporting lipogenesis
    Article Snippet: ATCC characterizes cell lines by short tandem repeat profiling. .. Lentiviral expression shRNA against PGC1α was obtained from Sigma. .. Lentivirus particles expressing shRNA against PGC1 were produced according to manufactures directions in 293T cells.

    Article Title: Prolyl Hydroxylase Domain (PHD) 2 Affects Cell Migration and F-actin Formation via RhoA/Rho-associated Kinase-dependent Cofilin Phosphorylation *
    Article Snippet: For generating the 2.1.1-16 cell line, the following shRNA sequences were used: shPHD2.1 (forward), 5′-GGACTGGAAGAAGCACAAGCTTTCAAGAGAAGCTTGTGCTTCTTCCAGTCC-3′ and shPHD2.1 (reverse), 5′-GGACTGGAAGAAGCACAAGCTTCTCTTGAAAGCTTGTGCTTCTTCCAGTCC-3′. .. To obtain HeLa cells, which constitutively express a PHD2 shRNA targeting human PHD2 or a nontargeting control shRNA, pLKO.1-puro silencer plasmids encoding the respective shRNA sequence driven by the U6 promoter (Sigma) were used (PHD2 TRCN #1045 (forward), 5′-CCGGTGGAGATGGAAGATGTGTGACCTCGAGGTCACACATCTTCCATCTCCATTTTT-3′;PHD2 TRCN #1045 (reverse), 5′-AAAAATGGAGATGGAAGATGTGTGCCTCGAGGTCACACATCTTCCATCTCCACCGG-3′). .. For lentiviral transfection, viral particles were produced in HEK293T cells using the ViraPower lentiviral expression system according to the manufacturer's instructions (Invitrogen).

    Article Title: Characterization of the role of TMEM45A in cancer cell sensitivity to cisplatin
    Article Snippet: For the transduction, cells were seeded in 25 cm2 polystyrene flasks (Corning) at a density of 800,000 cells per flask. .. Cells were then transduced with short-hairpin RNA (shRNA) lentiviral particles (Sigma): empty vector as a control for RCC4 cells and shRNA targeting the luciferase (CCGGCGCTGAGTACTTCGAAATGTCCTCGAGGACATTTCGAAGTACTCAGCGTTTTT) as negative control for SQD9 cells (shCTL) or shRNA targeting TMEM45A mRNA, shRNA22 (CCGGGAGTTCCTTGTTCGGAACAATCTCGAGATTGTTCCGAACAAGGAACTCTTTTTTG) and shRNA 92 (CCGGGATGACTCTAAGTGTACTGTTCTCGAGAACAGTACACTTAGAGTCATCTTTTTTG). .. The transduction was performed with a multiplicity of infection (MOI) of 5 in fresh medium with serum containing protamine sulfate (0.06 mg/mL) (Sigma-Aldrich) for RCC4 cells.

    Article Title: Leucine-Rich Repeat Kinase 2 Controls the Ca2+/Nuclear Factor of Activated T Cells/IL-2 Pathway during Aspergillus Non-Canonical Autophagy in Dendritic Cells
    Article Snippet: NFAT nuclear translocation was detected by ONE-Glo™ Luciferase assay System (Promega, Madison, WI, USA) and the luminescence signal quantified with the GloMax® -Multi Detection System Luminometer module (Promega, Madison, WI, USA). .. shRNA Knockdown MISSION® Lentiviral Particles (Sigma-Aldrich, St. Louis, MO, USA) with the pLKO.1-puro vector containing shRNA sequences targeting NRON, CSE1L, sperm-associated antigen 9 (SPAG9), LRRK2 shRNA, PPP2R1A were used. .. Below details includes the gene reference identification number (NM ID) and The RNAi Consortium (TRC) clone identification number (clone ID) for the shRNA-lentiviral particles for targeting these genes (Table ).

    Article Title: β-Galactoside α2,6-Sialyltranferase 1 Promotes Transforming Growth Factor-β-mediated Epithelial-Mesenchymal Transition *
    Article Snippet: The shRNA-mediated silencing of St6gal1 was induced by the addition of 1 μg/ml DOX in the established cell line, and the cells cultured by DOX-free medium were used as the control in the present study. .. Endogenous ST6GAL1 in the human MDA-MB-231 cells was knocked down by introducing a shRNA sequence using lentiviral vectors from Sigma-Aldrich. .. The previously constructed ST6GAL1 - or ST3GAL4 -overexpressing lentiviral vectors (CSIV-TRE-CMV-3xFLAG- ST6GAL1 / ST3Gal4 -KT) ( ) were transfected into 293T cells with packaging plasmids by the calcium phosphate method for the preparation of viruses.

    Article Title: Molecular Depletion of Descending Serotonin Unmasks Its Novel Facilitatory Role in the Development of Persistent Pain
    Article Snippet: .. To determine effects of Tph-2 shRNA or scrambled shRNA on expression of Tph-2, or 5-HT in neurons transferred with GFP, free-floating tissue sections were incubated with rabbit anti-Tph-2 (1:2K, Millipore), anti 5-HT (1:5K, ImmunoStar) antibody overnight. .. After washes, the sections were incubated with AffiniPure biotinylated secondary IgG (1:800, Jackson ImmunoResearch Lab, West Grove, PA) for 1 h. Streptavidin-Alexa 568 or 674 (1:800, Molecular Probes, Eugene, OR) was used for fluorescence staining of Tph-2 or 5-HT.

    Selection:

    Article Title: Tumor-Suppressive Activity of Lunatic Fringe in Prostate through Differential Modulation of Notch Receptor Activation 1
    Article Snippet: DU-145 cells were transfected with the LFNG-shRNA plasmid or the scrambled shRNA plasmid using FuGENE 6 Transfection Reagent (Promega, Madison, WI). .. Stable cell lines expressing LFNG-shRNA or scrambled shRNA were established by selection with 1 µg/ml Puromycin (Sigma, St Louis, MO). .. DU-145 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% FBS.

    Sequencing:

    Article Title: Prolyl Hydroxylase Domain (PHD) 2 Affects Cell Migration and F-actin Formation via RhoA/Rho-associated Kinase-dependent Cofilin Phosphorylation *
    Article Snippet: For generating the 2.1.1-16 cell line, the following shRNA sequences were used: shPHD2.1 (forward), 5′-GGACTGGAAGAAGCACAAGCTTTCAAGAGAAGCTTGTGCTTCTTCCAGTCC-3′ and shPHD2.1 (reverse), 5′-GGACTGGAAGAAGCACAAGCTTCTCTTGAAAGCTTGTGCTTCTTCCAGTCC-3′. .. To obtain HeLa cells, which constitutively express a PHD2 shRNA targeting human PHD2 or a nontargeting control shRNA, pLKO.1-puro silencer plasmids encoding the respective shRNA sequence driven by the U6 promoter (Sigma) were used (PHD2 TRCN #1045 (forward), 5′-CCGGTGGAGATGGAAGATGTGTGACCTCGAGGTCACACATCTTCCATCTCCATTTTT-3′;PHD2 TRCN #1045 (reverse), 5′-AAAAATGGAGATGGAAGATGTGTGCCTCGAGGTCACACATCTTCCATCTCCACCGG-3′). .. For lentiviral transfection, viral particles were produced in HEK293T cells using the ViraPower lentiviral expression system according to the manufacturer's instructions (Invitrogen).

    Article Title: β-Galactoside α2,6-Sialyltranferase 1 Promotes Transforming Growth Factor-β-mediated Epithelial-Mesenchymal Transition *
    Article Snippet: The shRNA-mediated silencing of St6gal1 was induced by the addition of 1 μg/ml DOX in the established cell line, and the cells cultured by DOX-free medium were used as the control in the present study. .. Endogenous ST6GAL1 in the human MDA-MB-231 cells was knocked down by introducing a shRNA sequence using lentiviral vectors from Sigma-Aldrich. .. The previously constructed ST6GAL1 - or ST3GAL4 -overexpressing lentiviral vectors (CSIV-TRE-CMV-3xFLAG- ST6GAL1 / ST3Gal4 -KT) ( ) were transfected into 293T cells with packaging plasmids by the calcium phosphate method for the preparation of viruses.

    Transduction:

    Article Title: Characterization of the role of TMEM45A in cancer cell sensitivity to cisplatin
    Article Snippet: For the transduction, cells were seeded in 25 cm2 polystyrene flasks (Corning) at a density of 800,000 cells per flask. .. Cells were then transduced with short-hairpin RNA (shRNA) lentiviral particles (Sigma): empty vector as a control for RCC4 cells and shRNA targeting the luciferase (CCGGCGCTGAGTACTTCGAAATGTCCTCGAGGACATTTCGAAGTACTCAGCGTTTTT) as negative control for SQD9 cells (shCTL) or shRNA targeting TMEM45A mRNA, shRNA22 (CCGGGAGTTCCTTGTTCGGAACAATCTCGAGATTGTTCCGAACAAGGAACTCTTTTTTG) and shRNA 92 (CCGGGATGACTCTAAGTGTACTGTTCTCGAGAACAGTACACTTAGAGTCATCTTTTTTG). .. The transduction was performed with a multiplicity of infection (MOI) of 5 in fresh medium with serum containing protamine sulfate (0.06 mg/mL) (Sigma-Aldrich) for RCC4 cells.

    Plasmid Preparation:

    Article Title: Characterization of the role of TMEM45A in cancer cell sensitivity to cisplatin
    Article Snippet: For the transduction, cells were seeded in 25 cm2 polystyrene flasks (Corning) at a density of 800,000 cells per flask. .. Cells were then transduced with short-hairpin RNA (shRNA) lentiviral particles (Sigma): empty vector as a control for RCC4 cells and shRNA targeting the luciferase (CCGGCGCTGAGTACTTCGAAATGTCCTCGAGGACATTTCGAAGTACTCAGCGTTTTT) as negative control for SQD9 cells (shCTL) or shRNA targeting TMEM45A mRNA, shRNA22 (CCGGGAGTTCCTTGTTCGGAACAATCTCGAGATTGTTCCGAACAAGGAACTCTTTTTTG) and shRNA 92 (CCGGGATGACTCTAAGTGTACTGTTCTCGAGAACAGTACACTTAGAGTCATCTTTTTTG). .. The transduction was performed with a multiplicity of infection (MOI) of 5 in fresh medium with serum containing protamine sulfate (0.06 mg/mL) (Sigma-Aldrich) for RCC4 cells.

    Article Title: Leucine-Rich Repeat Kinase 2 Controls the Ca2+/Nuclear Factor of Activated T Cells/IL-2 Pathway during Aspergillus Non-Canonical Autophagy in Dendritic Cells
    Article Snippet: NFAT nuclear translocation was detected by ONE-Glo™ Luciferase assay System (Promega, Madison, WI, USA) and the luminescence signal quantified with the GloMax® -Multi Detection System Luminometer module (Promega, Madison, WI, USA). .. shRNA Knockdown MISSION® Lentiviral Particles (Sigma-Aldrich, St. Louis, MO, USA) with the pLKO.1-puro vector containing shRNA sequences targeting NRON, CSE1L, sperm-associated antigen 9 (SPAG9), LRRK2 shRNA, PPP2R1A were used. .. Below details includes the gene reference identification number (NM ID) and The RNAi Consortium (TRC) clone identification number (clone ID) for the shRNA-lentiviral particles for targeting these genes (Table ).

    Luciferase:

    Article Title: Characterization of the role of TMEM45A in cancer cell sensitivity to cisplatin
    Article Snippet: For the transduction, cells were seeded in 25 cm2 polystyrene flasks (Corning) at a density of 800,000 cells per flask. .. Cells were then transduced with short-hairpin RNA (shRNA) lentiviral particles (Sigma): empty vector as a control for RCC4 cells and shRNA targeting the luciferase (CCGGCGCTGAGTACTTCGAAATGTCCTCGAGGACATTTCGAAGTACTCAGCGTTTTT) as negative control for SQD9 cells (shCTL) or shRNA targeting TMEM45A mRNA, shRNA22 (CCGGGAGTTCCTTGTTCGGAACAATCTCGAGATTGTTCCGAACAAGGAACTCTTTTTTG) and shRNA 92 (CCGGGATGACTCTAAGTGTACTGTTCTCGAGAACAGTACACTTAGAGTCATCTTTTTTG). .. The transduction was performed with a multiplicity of infection (MOI) of 5 in fresh medium with serum containing protamine sulfate (0.06 mg/mL) (Sigma-Aldrich) for RCC4 cells.

    Negative Control:

    Article Title: Characterization of the role of TMEM45A in cancer cell sensitivity to cisplatin
    Article Snippet: For the transduction, cells were seeded in 25 cm2 polystyrene flasks (Corning) at a density of 800,000 cells per flask. .. Cells were then transduced with short-hairpin RNA (shRNA) lentiviral particles (Sigma): empty vector as a control for RCC4 cells and shRNA targeting the luciferase (CCGGCGCTGAGTACTTCGAAATGTCCTCGAGGACATTTCGAAGTACTCAGCGTTTTT) as negative control for SQD9 cells (shCTL) or shRNA targeting TMEM45A mRNA, shRNA22 (CCGGGAGTTCCTTGTTCGGAACAATCTCGAGATTGTTCCGAACAAGGAACTCTTTTTTG) and shRNA 92 (CCGGGATGACTCTAAGTGTACTGTTCTCGAGAACAGTACACTTAGAGTCATCTTTTTTG). .. The transduction was performed with a multiplicity of infection (MOI) of 5 in fresh medium with serum containing protamine sulfate (0.06 mg/mL) (Sigma-Aldrich) for RCC4 cells.

    Multiple Displacement Amplification:

    Article Title: β-Galactoside α2,6-Sialyltranferase 1 Promotes Transforming Growth Factor-β-mediated Epithelial-Mesenchymal Transition *
    Article Snippet: The shRNA-mediated silencing of St6gal1 was induced by the addition of 1 μg/ml DOX in the established cell line, and the cells cultured by DOX-free medium were used as the control in the present study. .. Endogenous ST6GAL1 in the human MDA-MB-231 cells was knocked down by introducing a shRNA sequence using lentiviral vectors from Sigma-Aldrich. .. The previously constructed ST6GAL1 - or ST3GAL4 -overexpressing lentiviral vectors (CSIV-TRE-CMV-3xFLAG- ST6GAL1 / ST3Gal4 -KT) ( ) were transfected into 293T cells with packaging plasmids by the calcium phosphate method for the preparation of viruses.

    Incubation:

    Article Title: Molecular Depletion of Descending Serotonin Unmasks Its Novel Facilitatory Role in the Development of Persistent Pain
    Article Snippet: .. To determine effects of Tph-2 shRNA or scrambled shRNA on expression of Tph-2, or 5-HT in neurons transferred with GFP, free-floating tissue sections were incubated with rabbit anti-Tph-2 (1:2K, Millipore), anti 5-HT (1:5K, ImmunoStar) antibody overnight. .. After washes, the sections were incubated with AffiniPure biotinylated secondary IgG (1:800, Jackson ImmunoResearch Lab, West Grove, PA) for 1 h. Streptavidin-Alexa 568 or 674 (1:800, Molecular Probes, Eugene, OR) was used for fluorescence staining of Tph-2 or 5-HT.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Millipore nontarget shrna control transduction particles
    In cells with PI3K activation, <t>PDK1</t> levels are a determinant of signaling, proliferation, transformation, and pathway inhibition. ( A ) Immunoblots of MCF7 cells grown with stable control <t>shRNA</t> [CTRL] or two separate PDK1 shRNA contructs [PDK1-1 and PDK1-2].
    Nontarget Shrna Control Transduction Particles, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nontarget shrna control transduction particles/product/Millipore
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    nontarget shrna control transduction particles - by Bioz Stars, 2021-03
    94/100 stars
      Buy from Supplier

    Image Search Results


    In cells with PI3K activation, PDK1 levels are a determinant of signaling, proliferation, transformation, and pathway inhibition. ( A ) Immunoblots of MCF7 cells grown with stable control shRNA [CTRL] or two separate PDK1 shRNA contructs [PDK1-1 and PDK1-2].

    Journal: Cancer research

    Article Title: PDK1 potentiates upstream lesions on the PI3K pathway in breast carcinoma

    doi: 10.1158/0008-5472.CAN-09-0820

    Figure Lengend Snippet: In cells with PI3K activation, PDK1 levels are a determinant of signaling, proliferation, transformation, and pathway inhibition. ( A ) Immunoblots of MCF7 cells grown with stable control shRNA [CTRL] or two separate PDK1 shRNA contructs [PDK1-1 and PDK1-2].

    Article Snippet: The shRNA lentiviral particles targeting PDK1 (SHVRS- ), and nontarget shRNA control transduction particles (SHC002V) were purchased from Sigma-Aldrich.

    Techniques: Activation Assay, Transformation Assay, Inhibition, Western Blot, shRNA

    Knockdown of TBX2 in metastatic human breast cancer cell lines abrogates tumor cell invasion. (A, B) Inhibition of TBX2 significantly reduces cell motility rates of (A) MDA-MB-435 tumor cells in in vitro scratch assays, and (B) of MDA-MB-157 breast cancer cells in Transwell migration assays (see Methods ). Data represent the mean ± S.D. (n = 3; ANOVA test). ( C ) MDA-MB-435 cells stably expressing TBX2-specific shRNA (+shTBX2) grow as non-invasive spheres in three-dimensional (3D) Matrigel, whereas MDA-MB-435 control tumor cells expressing non-target shRNA (+shCtrl) grow as spheroids that invade the surrounding extracellular matrix. (D, E) Transwell matrigel assays showing that knockdown of TBX2 significantly reduces invasion rates of ( D ) MDA-MB-435, and (E) MDA-MB-157 breast tumor cells. Data represent mean ± S.D. (n = 3; Student’s t -test). P values are indicated.

    Journal: PLoS ONE

    Article Title: The T Box Transcription Factor TBX2 Promotes Epithelial-Mesenchymal Transition and Invasion of Normal and Malignant Breast Epithelial Cells

    doi: 10.1371/journal.pone.0041355

    Figure Lengend Snippet: Knockdown of TBX2 in metastatic human breast cancer cell lines abrogates tumor cell invasion. (A, B) Inhibition of TBX2 significantly reduces cell motility rates of (A) MDA-MB-435 tumor cells in in vitro scratch assays, and (B) of MDA-MB-157 breast cancer cells in Transwell migration assays (see Methods ). Data represent the mean ± S.D. (n = 3; ANOVA test). ( C ) MDA-MB-435 cells stably expressing TBX2-specific shRNA (+shTBX2) grow as non-invasive spheres in three-dimensional (3D) Matrigel, whereas MDA-MB-435 control tumor cells expressing non-target shRNA (+shCtrl) grow as spheroids that invade the surrounding extracellular matrix. (D, E) Transwell matrigel assays showing that knockdown of TBX2 significantly reduces invasion rates of ( D ) MDA-MB-435, and (E) MDA-MB-157 breast tumor cells. Data represent mean ± S.D. (n = 3; Student’s t -test). P values are indicated.

    Article Snippet: For stable TBX2 knockdown, MDA-MB-435 cells were initially transduced with 5 different TBX2 -specific shRNAs (Mission shRNA lentiviral particles; Sigma, TRCN0000232146-150) or control non-target shRNA (Sigma, SHC002V) at MOI = 5.

    Techniques: Inhibition, Multiple Displacement Amplification, In Vitro, Migration, Stable Transfection, Expressing, shRNA

    Knockdown of TBX2 reduces pulmonary metastasis of human MDA-MB-435 breast carcinoma cells. (A) Representative images of lungs harvested from athymic nu/nu Nude mice forty days after tail vein injection with MDA-MB-435 tumor cell clones expressing either control non-target shRNA (shCtrl) or TBX2-specific shRNA (shTBX2). Top panel: India ink staining of lungs shows the absence of surface lung metastases in mice injected with shTBX2-expressing MDA-MBA-435 tumor cells (Magnification 7x). Only the control group produced macroscopic lung nodules (asterixes) and an elevated number of micrometastases (white arrows). Bottom panel: H E stained paraffin-sections of representative lungs from each study group (Magnification: 40X). Dotted lines highlight lung metastases in the control group. (B) Quantification of total lung metastasis burden in the same sets of mice as in (A). Average numbers of lung surface metastases are shown; white column = mean of 5 control mice analyzed: black column = mean of 10 mice injected with two MDA-MB435-shTBX2 tumor cell clones. Data represent the mean ± S.D. (n≥5; Student t -test). (C) Inhibition of TBX2 does not significantly affect cell proliferation of MDA-MB-435 tumor cells. Equal numbers of control non-target shRNA and shTBX2-expressing cells were grown under sub-confluent conditions and counted every 3 days over a 9-day period. Error bars represent the mean ± S.D. (n = 3; Student t -test). (D) qPCR showing that stable knockdown of TBX2 does not significantly alter p21 mRNA expression levels in MDA-MB-435 tumor cells. Values were normalized to GAPDH and fold changes compared to the shRNA control group are shown. Error bars represent the mean ± SEM (n = 3; Student t- test). NS = not significant.

    Journal: PLoS ONE

    Article Title: The T Box Transcription Factor TBX2 Promotes Epithelial-Mesenchymal Transition and Invasion of Normal and Malignant Breast Epithelial Cells

    doi: 10.1371/journal.pone.0041355

    Figure Lengend Snippet: Knockdown of TBX2 reduces pulmonary metastasis of human MDA-MB-435 breast carcinoma cells. (A) Representative images of lungs harvested from athymic nu/nu Nude mice forty days after tail vein injection with MDA-MB-435 tumor cell clones expressing either control non-target shRNA (shCtrl) or TBX2-specific shRNA (shTBX2). Top panel: India ink staining of lungs shows the absence of surface lung metastases in mice injected with shTBX2-expressing MDA-MBA-435 tumor cells (Magnification 7x). Only the control group produced macroscopic lung nodules (asterixes) and an elevated number of micrometastases (white arrows). Bottom panel: H E stained paraffin-sections of representative lungs from each study group (Magnification: 40X). Dotted lines highlight lung metastases in the control group. (B) Quantification of total lung metastasis burden in the same sets of mice as in (A). Average numbers of lung surface metastases are shown; white column = mean of 5 control mice analyzed: black column = mean of 10 mice injected with two MDA-MB435-shTBX2 tumor cell clones. Data represent the mean ± S.D. (n≥5; Student t -test). (C) Inhibition of TBX2 does not significantly affect cell proliferation of MDA-MB-435 tumor cells. Equal numbers of control non-target shRNA and shTBX2-expressing cells were grown under sub-confluent conditions and counted every 3 days over a 9-day period. Error bars represent the mean ± S.D. (n = 3; Student t -test). (D) qPCR showing that stable knockdown of TBX2 does not significantly alter p21 mRNA expression levels in MDA-MB-435 tumor cells. Values were normalized to GAPDH and fold changes compared to the shRNA control group are shown. Error bars represent the mean ± SEM (n = 3; Student t- test). NS = not significant.

    Article Snippet: For stable TBX2 knockdown, MDA-MB-435 cells were initially transduced with 5 different TBX2 -specific shRNAs (Mission shRNA lentiviral particles; Sigma, TRCN0000232146-150) or control non-target shRNA (Sigma, SHC002V) at MOI = 5.

    Techniques: Multiple Displacement Amplification, Mouse Assay, Injection, Clone Assay, Expressing, shRNA, Staining, Produced, Inhibition, Real-time Polymerase Chain Reaction

    TBX2 imparts a mesenchymal phenotype on human breast cancer cells. (A) Western blot analysis shows efficient TBX2 knockdown in human MDA-MBA-435 tumor cells stably expressing TBX2-specific shRNA (shTBX2) as compared to cells expressing non-target shRNA (shCtrl). Actin was used as loading control. (B) Depletion of TBX2 in MDA-MB-435 tumor cells leads to a loss of the mesenchymal morphology characteristic for this breast carcinoma cell line. Representative images of high-density cell cultures are shown (40X magnification). (C) Inhibition of TBX2 in human MDA-MB-157 breast carcinoma cells through transient transfection with TBX2-targeted siRNAs (siTBX2) induces a ‘cobblestone’-like epithelial cell morphology. In contrast, MDA-MB-157 cells transiently transfected with scrambled siRNA control (siCtrl) exhibit a profound ‘spindle-like’ mesenchymal phenotype. Representative images of high-density cultures (40x magnification) of tumor cells three days post siRNA transfection are shown. (D, E) qPCR analysis of TBX2 and EMT marker expression in (D) MDA-MB-435 cells expressing shCtrl or shTBX2, and in (E) MDA-MB-157 cells 3 days post transfection with siCtrl or siTBX2. TBX2 knockdown leads to an upregulation of epithelial adhesion and tight junction genes (E-cad = E-cadherin ; ZO1 = zona occludens 1 ), whereas it results in loss of mesenchymal marker expression: N-cad = N-cadherin ; VIM = Vimentin ; FN1 = Fibronectin , and MMP3 = matrix metalloprotease 3 . Values were normalized to GAPDH and fold changes compared to the respective control groups are shown. Data represent the mean ± SEM (n = 3; Student t -test); p-values: *p

    Journal: PLoS ONE

    Article Title: The T Box Transcription Factor TBX2 Promotes Epithelial-Mesenchymal Transition and Invasion of Normal and Malignant Breast Epithelial Cells

    doi: 10.1371/journal.pone.0041355

    Figure Lengend Snippet: TBX2 imparts a mesenchymal phenotype on human breast cancer cells. (A) Western blot analysis shows efficient TBX2 knockdown in human MDA-MBA-435 tumor cells stably expressing TBX2-specific shRNA (shTBX2) as compared to cells expressing non-target shRNA (shCtrl). Actin was used as loading control. (B) Depletion of TBX2 in MDA-MB-435 tumor cells leads to a loss of the mesenchymal morphology characteristic for this breast carcinoma cell line. Representative images of high-density cell cultures are shown (40X magnification). (C) Inhibition of TBX2 in human MDA-MB-157 breast carcinoma cells through transient transfection with TBX2-targeted siRNAs (siTBX2) induces a ‘cobblestone’-like epithelial cell morphology. In contrast, MDA-MB-157 cells transiently transfected with scrambled siRNA control (siCtrl) exhibit a profound ‘spindle-like’ mesenchymal phenotype. Representative images of high-density cultures (40x magnification) of tumor cells three days post siRNA transfection are shown. (D, E) qPCR analysis of TBX2 and EMT marker expression in (D) MDA-MB-435 cells expressing shCtrl or shTBX2, and in (E) MDA-MB-157 cells 3 days post transfection with siCtrl or siTBX2. TBX2 knockdown leads to an upregulation of epithelial adhesion and tight junction genes (E-cad = E-cadherin ; ZO1 = zona occludens 1 ), whereas it results in loss of mesenchymal marker expression: N-cad = N-cadherin ; VIM = Vimentin ; FN1 = Fibronectin , and MMP3 = matrix metalloprotease 3 . Values were normalized to GAPDH and fold changes compared to the respective control groups are shown. Data represent the mean ± SEM (n = 3; Student t -test); p-values: *p

    Article Snippet: For stable TBX2 knockdown, MDA-MB-435 cells were initially transduced with 5 different TBX2 -specific shRNAs (Mission shRNA lentiviral particles; Sigma, TRCN0000232146-150) or control non-target shRNA (Sigma, SHC002V) at MOI = 5.

    Techniques: Western Blot, Multiple Displacement Amplification, Stable Transfection, Expressing, shRNA, Inhibition, Transfection, Real-time Polymerase Chain Reaction, Marker

    Nudt3 down-regulation increases expression of mRNAs implicated in cell motility. ( A ) RNA levels of nine mRNAs implicated in cell migration tested in MCF-7 cells expressing nontargeting shRNA (Con KD , open bar), shRNA against Nudt3 (Nudt3 KD , filled bar),

    Journal: RNA

    Article Title: Nudt3 is an mRNA decapping enzyme that modulates cell migration

    doi: 10.1261/rna.055699.115

    Figure Lengend Snippet: Nudt3 down-regulation increases expression of mRNAs implicated in cell motility. ( A ) RNA levels of nine mRNAs implicated in cell migration tested in MCF-7 cells expressing nontargeting shRNA (Con KD , open bar), shRNA against Nudt3 (Nudt3 KD , filled bar),

    Article Snippet: The human MCF-7 breast adenocarcinoma was a gift (Fang Liu, Rutgers). pLKO1 plasmids encoding shRNA (MISSION TRC shRNA) against Nudt3 (TRCN0000299497), Nudt4 (TRCN0000296266), FN (TRCN0000293839), and a nonmammalian shRNA control (SHC002V) were purchased from Sigma-Aldrich.

    Techniques: Expressing, Migration, shRNA

    Transplantation of CCND2-shRNA Mbs increases regeneration. ( A ) The number of eMHC+ fibers was significantly higher in muscles engrafted with CCND2-shRNA Mbs compared with muscles that received CTL-shRNA Mbs. (** P ≤ 0.004). ( B ) A significant increase

    Journal: Human Molecular Genetics

    Article Title: A high-content, high-throughput siRNA screen identifies cyclin D2 as a potent regulator of muscle progenitor cell fusion and a target to enhance muscle regeneration

    doi: 10.1093/hmg/ddt184

    Figure Lengend Snippet: Transplantation of CCND2-shRNA Mbs increases regeneration. ( A ) The number of eMHC+ fibers was significantly higher in muscles engrafted with CCND2-shRNA Mbs compared with muscles that received CTL-shRNA Mbs. (** P ≤ 0.004). ( B ) A significant increase

    Article Snippet: Infection conditions in tgGFP Mbs were optimized with MISSON TurboGFP Control Transduction particles (SHC003V) and non-targeting shRNA Control Transduction particles (SHC002V; Sigma) in 24-well plates for optimal growth conditions, viral dosage and puromycin selection concentration.

    Techniques: Transplantation Assay, shRNA, CTL Assay

    CCND2 expressions in vitro during differentiation and in response to siRNA treatment. ( A ) CCND2 mRNA profiles in C57 Mbs after switching to differentiation medium calculated as fold changes to the level of mRNA in untransfected Mbs. Transcript levels

    Journal: Human Molecular Genetics

    Article Title: A high-content, high-throughput siRNA screen identifies cyclin D2 as a potent regulator of muscle progenitor cell fusion and a target to enhance muscle regeneration

    doi: 10.1093/hmg/ddt184

    Figure Lengend Snippet: CCND2 expressions in vitro during differentiation and in response to siRNA treatment. ( A ) CCND2 mRNA profiles in C57 Mbs after switching to differentiation medium calculated as fold changes to the level of mRNA in untransfected Mbs. Transcript levels

    Article Snippet: Infection conditions in tgGFP Mbs were optimized with MISSON TurboGFP Control Transduction particles (SHC003V) and non-targeting shRNA Control Transduction particles (SHC002V; Sigma) in 24-well plates for optimal growth conditions, viral dosage and puromycin selection concentration.

    Techniques: In Vitro