Journal: bioRxiv

Article Title: The nucleus accumbens shell regulates hedonic feeding via a rostral hotspot

doi: 10.1101/2025.05.24.655907

Figure Lengend Snippet: a. CRISPR/Cas9-based strategy to generate a Stard5-2A-Flp0 knock-in mouse (abbreviated Stard5-Flp). A double-stranded (ds) DNA knock-in template expressing the Flp0 recombinase (dark green bands), the RAKR and T2A self-cleaving peptide (light green bands) and Stard5 homology arms spanning exon 6 and the 3’UTR of the Stard5 gene (black bands) was used to create the model. The guide (g)RNA (red triangle) targets the stop codon (blue) of the Stard5 gene (Chromosome 7) at its most expressed transcript in the NAc (Stard5-201; see ). Knock-in was achieved by homologous recombination. b. Left: Surgery schematic for the validation of the Stard5-Flp mouse. An AAV expressing a flp-dependent vector (jGCaMP8m) was injected into the rostral or caudal medNAcSh, dorsal striatum or NAc core of Stard5-Flp mice. c . Top: Representative coronal images and zoom-in showing successful expression of a Flp-dependent fluorophore in the rostral medNAchSh of Stard5-Flp mice, with very minimal expression in Stard5-Flp negative mice (few cells) indicating a minor Flp leak of the AAV. Close to no expression could be detected in the caudal medNAcSh, NAc core or dorsal striatum (dStr) after injection directly into those regions, confirming that, within the striatal complex, Stard5 expression is primarily confined to the medNAcSh. d. Surgery schematics of Stard5-Flp mice injected with a flp-dependent calcium indicator (FRT- jGCaMP8m) and implanted with unilateral optic fibers in the rostral medNAcSh to image calcium photometry signals. e. Representative coronal image of rostral medNAcSh Stard5-Flp mice expressing FRT-jGCaMP8m and implanted with an optic fiber. f. Top: Protocol for the unpredicted reward behavioral task: 30 rewards were available for 10 s at random intervals. Bottom: Protocol for the unpredicted shock behavioral task: 10 shocks (0.4 mA) were available for 1 s at random intervals. g. Left: Average calcium activity in Stard5+ neurons (all trials) shown as normalized fluorescence (ΔF/F0, %) in the rostral medNAcSh over time aligned to the onset of reward consumption, i.e. first lick onset (0 s). Grey shading represents the ∼10 s epoch for reward consumption. Right: Heatmap showing calcium activity across individual trials (each row represents an animal) aligned to reward consumption. Thin dotted line: end of reward access. h. Quantification of the data in (g.) depicts a significant decrease in rostral medNAcSh Stard5 cell activity upon reward consumption, as shown by a significant decrease in ΔF/F0 minima in the 0 to 5 s reward epoch vs. −6 to −1 s pre-reward epoch. Paired t-test, t(7) = 4.630, p = 0.0024. N = 8 mice. i. Left: Average calcium activity in Stard5+ neurons (all trials) shown as normalized fluorescence (ΔF/F0, %) in the rostral medNAcSh over time aligned to shock onset (0 s). Grey shading: shock epoch. Right: Heatmap showing calcium activity across individual trials (each row represents a trial) aligned to shock onset. Thin dotted line: end of reward access. j. Quantification of the data in (i.) depicts a significant increase in rostral medNAcSh Stard5 cell activity upon shock exposure, as shown by a significant increase in ΔF/F0 maxima in the 0 to 5 s shock epoch vs. −6 to −1 s pre-shock epoch. Paired t-test, t(6) = 3.305, p = 0.0163. N = 7 mice. Data is mean ± SEM. *p<0.05; **p<0.01; ***p<0.001. See also Supplementary Figures S4, S5, S6 .

Article Snippet: The injection mix contained IDTE buffer pH 7.5, annealed Alt-R™ CRISPR-Cas9 crRNA and tracrRNA (50 ng/μl), Alt-R S.p.Hifi-Cas9 Nuclease V3 (50 ng/μl), Alt-R™ HDR Enhancer V2 (1uM), and Alt-R™ HDR Donor Block double-stranded template (20 ng/μl) from IDT.

Techniques: CRISPR, Knock-In, Expressing, Homologous Recombination, Biomarker Discovery, Plasmid Preparation, Injection, Activity Assay, Fluorescence

Journal: eLife

Article Title: ME3BP-7 is a targeted cytotoxic agent that rapidly kills pancreatic cancer cells expressing high levels of monocarboxylate transporter MCT1

doi: 10.7554/eLife.94488

Figure Lengend Snippet: ( A ) Strategy for CRISPR-based knockout of SLC16A1 in MIA PaCa-2 cells. Created using BioRender.com . ( B ) Table of knockout clones. ( C ) Immunohistochemical analyses performed on representative KO clones with monoclonal mouse antibody against MCT1 (1:2000 dilution). ( D ) IHC performed with MCT1 antibody on pooled monoclonal MCT1 KO cells used to test the MCT1-specific activity of 3BP and ME3BP-7. ( E, F ) Comparison of cell growth over time of MIA PaCa-2 and MIA PaCa-2 MCT1 KO in the absence and presence of 3BP (50 µM) normalized to time point 0 hr. Data are represented as the mean ± SD of two technical replicates. ( G ) Dose-response curves of MIA PaCa-2 cells and MIA PaCa-2 MCT1 KO at 36 hr. Cell viability normalized to the number of cells at 0 hr. Data represent the mean ± SD of two technical replicates.

Article Snippet: Alt-R CRISPR Cas9 crRNAs ( ACCATGCCATTCAGGCTAGT , IDT; SEQ ID NO:1) and Alt-R CRISPR-Cas9 tracrRNA (1072532, IDT) were resuspended in Nuclease-Free Duplex Buffer (IDT) at a concentration of 100 μM.

Techniques: CRISPR, Knock-Out, Clone Assay, Immunohistochemical staining, Activity Assay, Comparison