Review





Similar Products

95
Thermo Fisher gene exp cox1 mm04225243 g1
Gene Exp Cox1 Mm04225243 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cox1/pm41998139-328-19--1?v=Thermo+Fisher
Average 95 stars, based on 1 article reviews
gene exp cox1 mm04225243 g1 - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

94
OriGene gtcttgagtccagatttgcagcc origene mp211819 primers for cox1
Gtcttgagtccagatttgcagcc Origene Mp211819 Primers For Cox1, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cox1/pm42234557-282-110-111?v=OriGene
Average 94 stars, based on 1 article reviews
gtcttgagtccagatttgcagcc origene mp211819 primers for cox1 - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

86
Huabio Inc cox1
A939572 inhibits OC differentiation by modulating arachidonic acid metabolism. (A) Integrated transcriptomic and metabolomic analysis. (B) Heatmap of PGD2‐related metabolites. i indicates inhibitor‐treated samples, NC indicates control samples. (C, D) GSEA of arachidonic acid and mineralization‐related metabolites. (E) PGD2 concentrations in cell measured by ELISA in each group ( n = 6). (F, G) Western blots showing HPGDS, <t>COX1</t> and COX2 protein levels in OCs treated with A939572. (H) Western blots showing c‐Fos and NFATc1 protein levels in BMDMs treated with varying concentrations of PGD2. (I) Changes in OC‐related markers following RANKL stimulation at different time points, with or without 0.625 μM PGD2 treatment. (J) RT‐qPCR analysis of OC‐related markers in response to different concentrations of PGD2. (K) TRAP staining and F‐actin immunofluorescence staining of OCs treated with or without PGD2; TRAP staining, Scale bars, 100 μm; F‐actin immunofluorescence staining, Scale bars, 100 μm. (L) Quantification of nuclei numbers of TRAP‐positive multinuclear cells ( n = 3). Data are presented as mean ± SD. NS, not significant ( p > 0.05), * p ≤ 0.05, ** p < 0.01, *** p < 0.001. Source numerical and statistical data are provided.
Cox1, supplied by Huabio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cox1/pmc13170736-44-7-9?v=Huabio+Inc
Average 86 stars, based on 1 article reviews
cox1 - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

94
Cell Signaling Technology Inc anti cox1 polyclonal antibody
A939572 inhibits OC differentiation by modulating arachidonic acid metabolism. (A) Integrated transcriptomic and metabolomic analysis. (B) Heatmap of PGD2‐related metabolites. i indicates inhibitor‐treated samples, NC indicates control samples. (C, D) GSEA of arachidonic acid and mineralization‐related metabolites. (E) PGD2 concentrations in cell measured by ELISA in each group ( n = 6). (F, G) Western blots showing HPGDS, <t>COX1</t> and COX2 protein levels in OCs treated with A939572. (H) Western blots showing c‐Fos and NFATc1 protein levels in BMDMs treated with varying concentrations of PGD2. (I) Changes in OC‐related markers following RANKL stimulation at different time points, with or without 0.625 μM PGD2 treatment. (J) RT‐qPCR analysis of OC‐related markers in response to different concentrations of PGD2. (K) TRAP staining and F‐actin immunofluorescence staining of OCs treated with or without PGD2; TRAP staining, Scale bars, 100 μm; F‐actin immunofluorescence staining, Scale bars, 100 μm. (L) Quantification of nuclei numbers of TRAP‐positive multinuclear cells ( n = 3). Data are presented as mean ± SD. NS, not significant ( p > 0.05), * p ≤ 0.05, ** p < 0.01, *** p < 0.001. Source numerical and statistical data are provided.
Anti Cox1 Polyclonal Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cox1/pm41916686-48-33-36?v=Cell+Signaling+Technology+Inc
Average 94 stars, based on 1 article reviews
anti cox1 polyclonal antibody - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

86
Cosmo Genetech Co cox1 amplicon
A939572 inhibits OC differentiation by modulating arachidonic acid metabolism. (A) Integrated transcriptomic and metabolomic analysis. (B) Heatmap of PGD2‐related metabolites. i indicates inhibitor‐treated samples, NC indicates control samples. (C, D) GSEA of arachidonic acid and mineralization‐related metabolites. (E) PGD2 concentrations in cell measured by ELISA in each group ( n = 6). (F, G) Western blots showing HPGDS, <t>COX1</t> and COX2 protein levels in OCs treated with A939572. (H) Western blots showing c‐Fos and NFATc1 protein levels in BMDMs treated with varying concentrations of PGD2. (I) Changes in OC‐related markers following RANKL stimulation at different time points, with or without 0.625 μM PGD2 treatment. (J) RT‐qPCR analysis of OC‐related markers in response to different concentrations of PGD2. (K) TRAP staining and F‐actin immunofluorescence staining of OCs treated with or without PGD2; TRAP staining, Scale bars, 100 μm; F‐actin immunofluorescence staining, Scale bars, 100 μm. (L) Quantification of nuclei numbers of TRAP‐positive multinuclear cells ( n = 3). Data are presented as mean ± SD. NS, not significant ( p > 0.05), * p ≤ 0.05, ** p < 0.01, *** p < 0.001. Source numerical and statistical data are provided.
Cox1 Amplicon, supplied by Cosmo Genetech Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cox1/pmc12933473-175-30-12?v=Cosmo+Genetech+Co
Average 86 stars, based on 1 article reviews
cox1 amplicon - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

95
Cell Signaling Technology Inc cox1
A939572 inhibits OC differentiation by modulating arachidonic acid metabolism. (A) Integrated transcriptomic and metabolomic analysis. (B) Heatmap of PGD2‐related metabolites. i indicates inhibitor‐treated samples, NC indicates control samples. (C, D) GSEA of arachidonic acid and mineralization‐related metabolites. (E) PGD2 concentrations in cell measured by ELISA in each group ( n = 6). (F, G) Western blots showing HPGDS, <t>COX1</t> and COX2 protein levels in OCs treated with A939572. (H) Western blots showing c‐Fos and NFATc1 protein levels in BMDMs treated with varying concentrations of PGD2. (I) Changes in OC‐related markers following RANKL stimulation at different time points, with or without 0.625 μM PGD2 treatment. (J) RT‐qPCR analysis of OC‐related markers in response to different concentrations of PGD2. (K) TRAP staining and F‐actin immunofluorescence staining of OCs treated with or without PGD2; TRAP staining, Scale bars, 100 μm; F‐actin immunofluorescence staining, Scale bars, 100 μm. (L) Quantification of nuclei numbers of TRAP‐positive multinuclear cells ( n = 3). Data are presented as mean ± SD. NS, not significant ( p > 0.05), * p ≤ 0.05, ** p < 0.01, *** p < 0.001. Source numerical and statistical data are provided.
Cox1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cox1/pm41745478-155-17-41?v=Cell+Signaling+Technology+Inc
Average 95 stars, based on 1 article reviews
cox1 - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

94
Cell Signaling Technology Inc anti cox 1 antibody
A939572 inhibits OC differentiation by modulating arachidonic acid metabolism. (A) Integrated transcriptomic and metabolomic analysis. (B) Heatmap of PGD2‐related metabolites. i indicates inhibitor‐treated samples, NC indicates control samples. (C, D) GSEA of arachidonic acid and mineralization‐related metabolites. (E) PGD2 concentrations in cell measured by ELISA in each group ( n = 6). (F, G) Western blots showing HPGDS, <t>COX1</t> and COX2 protein levels in OCs treated with A939572. (H) Western blots showing c‐Fos and NFATc1 protein levels in BMDMs treated with varying concentrations of PGD2. (I) Changes in OC‐related markers following RANKL stimulation at different time points, with or without 0.625 μM PGD2 treatment. (J) RT‐qPCR analysis of OC‐related markers in response to different concentrations of PGD2. (K) TRAP staining and F‐actin immunofluorescence staining of OCs treated with or without PGD2; TRAP staining, Scale bars, 100 μm; F‐actin immunofluorescence staining, Scale bars, 100 μm. (L) Quantification of nuclei numbers of TRAP‐positive multinuclear cells ( n = 3). Data are presented as mean ± SD. NS, not significant ( p > 0.05), * p ≤ 0.05, ** p < 0.01, *** p < 0.001. Source numerical and statistical data are provided.
Anti Cox 1 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cox1/pm41707855-53-13-16?v=Cell+Signaling+Technology+Inc
Average 94 stars, based on 1 article reviews
anti cox 1 antibody - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

93
Proteintech anti cox1
A939572 inhibits OC differentiation by modulating arachidonic acid metabolism. (A) Integrated transcriptomic and metabolomic analysis. (B) Heatmap of PGD2‐related metabolites. i indicates inhibitor‐treated samples, NC indicates control samples. (C, D) GSEA of arachidonic acid and mineralization‐related metabolites. (E) PGD2 concentrations in cell measured by ELISA in each group ( n = 6). (F, G) Western blots showing HPGDS, <t>COX1</t> and COX2 protein levels in OCs treated with A939572. (H) Western blots showing c‐Fos and NFATc1 protein levels in BMDMs treated with varying concentrations of PGD2. (I) Changes in OC‐related markers following RANKL stimulation at different time points, with or without 0.625 μM PGD2 treatment. (J) RT‐qPCR analysis of OC‐related markers in response to different concentrations of PGD2. (K) TRAP staining and F‐actin immunofluorescence staining of OCs treated with or without PGD2; TRAP staining, Scale bars, 100 μm; F‐actin immunofluorescence staining, Scale bars, 100 μm. (L) Quantification of nuclei numbers of TRAP‐positive multinuclear cells ( n = 3). Data are presented as mean ± SD. NS, not significant ( p > 0.05), * p ≤ 0.05, ** p < 0.01, *** p < 0.001. Source numerical and statistical data are provided.
Anti Cox1, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cox1/pm41673763-117-41-44?v=Proteintech
Average 93 stars, based on 1 article reviews
anti cox1 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

86
Macrogen d immitis cox1 amplicons
A939572 inhibits OC differentiation by modulating arachidonic acid metabolism. (A) Integrated transcriptomic and metabolomic analysis. (B) Heatmap of PGD2‐related metabolites. i indicates inhibitor‐treated samples, NC indicates control samples. (C, D) GSEA of arachidonic acid and mineralization‐related metabolites. (E) PGD2 concentrations in cell measured by ELISA in each group ( n = 6). (F, G) Western blots showing HPGDS, <t>COX1</t> and COX2 protein levels in OCs treated with A939572. (H) Western blots showing c‐Fos and NFATc1 protein levels in BMDMs treated with varying concentrations of PGD2. (I) Changes in OC‐related markers following RANKL stimulation at different time points, with or without 0.625 μM PGD2 treatment. (J) RT‐qPCR analysis of OC‐related markers in response to different concentrations of PGD2. (K) TRAP staining and F‐actin immunofluorescence staining of OCs treated with or without PGD2; TRAP staining, Scale bars, 100 μm; F‐actin immunofluorescence staining, Scale bars, 100 μm. (L) Quantification of nuclei numbers of TRAP‐positive multinuclear cells ( n = 3). Data are presented as mean ± SD. NS, not significant ( p > 0.05), * p ≤ 0.05, ** p < 0.01, *** p < 0.001. Source numerical and statistical data are provided.
D Immitis Cox1 Amplicons, supplied by Macrogen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cox1/10__1017_slash_s0031182026101620-51-3-21?v=Macrogen
Average 86 stars, based on 1 article reviews
d immitis cox1 amplicons - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

Image Search Results


A939572 inhibits OC differentiation by modulating arachidonic acid metabolism. (A) Integrated transcriptomic and metabolomic analysis. (B) Heatmap of PGD2‐related metabolites. i indicates inhibitor‐treated samples, NC indicates control samples. (C, D) GSEA of arachidonic acid and mineralization‐related metabolites. (E) PGD2 concentrations in cell measured by ELISA in each group ( n = 6). (F, G) Western blots showing HPGDS, COX1 and COX2 protein levels in OCs treated with A939572. (H) Western blots showing c‐Fos and NFATc1 protein levels in BMDMs treated with varying concentrations of PGD2. (I) Changes in OC‐related markers following RANKL stimulation at different time points, with or without 0.625 μM PGD2 treatment. (J) RT‐qPCR analysis of OC‐related markers in response to different concentrations of PGD2. (K) TRAP staining and F‐actin immunofluorescence staining of OCs treated with or without PGD2; TRAP staining, Scale bars, 100 μm; F‐actin immunofluorescence staining, Scale bars, 100 μm. (L) Quantification of nuclei numbers of TRAP‐positive multinuclear cells ( n = 3). Data are presented as mean ± SD. NS, not significant ( p > 0.05), * p ≤ 0.05, ** p < 0.01, *** p < 0.001. Source numerical and statistical data are provided.

Journal: The FASEB Journal

Article Title: SCD1 Regulates Osteoclast Differentiation by Modulating Arachidonic Acid Metabolism and Mitochondrial Homeostasis

doi: 10.1096/fj.202600672R

Figure Lengend Snippet: A939572 inhibits OC differentiation by modulating arachidonic acid metabolism. (A) Integrated transcriptomic and metabolomic analysis. (B) Heatmap of PGD2‐related metabolites. i indicates inhibitor‐treated samples, NC indicates control samples. (C, D) GSEA of arachidonic acid and mineralization‐related metabolites. (E) PGD2 concentrations in cell measured by ELISA in each group ( n = 6). (F, G) Western blots showing HPGDS, COX1 and COX2 protein levels in OCs treated with A939572. (H) Western blots showing c‐Fos and NFATc1 protein levels in BMDMs treated with varying concentrations of PGD2. (I) Changes in OC‐related markers following RANKL stimulation at different time points, with or without 0.625 μM PGD2 treatment. (J) RT‐qPCR analysis of OC‐related markers in response to different concentrations of PGD2. (K) TRAP staining and F‐actin immunofluorescence staining of OCs treated with or without PGD2; TRAP staining, Scale bars, 100 μm; F‐actin immunofluorescence staining, Scale bars, 100 μm. (L) Quantification of nuclei numbers of TRAP‐positive multinuclear cells ( n = 3). Data are presented as mean ± SD. NS, not significant ( p > 0.05), * p ≤ 0.05, ** p < 0.01, *** p < 0.001. Source numerical and statistical data are provided.

Article Snippet: Antibodies against the following targets were used: COX1 (ET1610‐98, HUABIO), COX2 (ET1610‐23, HUABIO), HPGDS (ER60724, HUABIO), TOM20 (ET1609‐25, HUABIO), Tartrate Resistant Acid Phosphatase (TRAP; ab191406, Abcam), SCD1 (ab236868, Abcam), SP7 (ab209484, Abcam), Runx2 (ab133261, Abcam), p65 (8242, Cell Signaling Technology), phospho‐p65 (p‐p65; 3033, Cell Signaling Technology), p38 (9212, Cell Signaling Technology), phospho‐p38 (p‐p38; 4511, Cell Signaling Technology), JNK (9252, Cell Signaling Technology), phospho‐JNK (p‐JNK; 9255, Cell Signaling Technology), Erk (5013, Cell Signaling Technology), phospho‐Erk (p‐Erk; 4370, Cell Signaling Technology), Flag (14793S, Cell Signaling Technology), c‐Fos (31 254, Cell Signaling Technology), NDUFS4 (15849‐1‐APM, Proteintech), β‐actin (66009‐1‐Ig, Proteintech), NFATc1 (sc‐7294, Santa Cruz Biotechnology).

Techniques: Metabolomic, Control, Enzyme-linked Immunosorbent Assay, Western Blot, Quantitative RT-PCR, Staining, Immunofluorescence