|
Thermo Fisher
gene exp cox1 mm04225243 g1 Gene Exp Cox1 Mm04225243 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cox1/pm41998139-328-19--1?v=Thermo+Fisher Average 95 stars, based on 1 article reviews
gene exp cox1 mm04225243 g1 - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
|
OriGene
gtcttgagtccagatttgcagcc origene mp211819 primers for cox1 Gtcttgagtccagatttgcagcc Origene Mp211819 Primers For Cox1, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cox1/pm42234557-282-110-111?v=OriGene Average 94 stars, based on 1 article reviews
gtcttgagtccagatttgcagcc origene mp211819 primers for cox1 - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Huabio Inc
cox1 ![]() Cox1, supplied by Huabio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cox1/pmc13170736-44-7-9?v=Huabio+Inc Average 86 stars, based on 1 article reviews
cox1 - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
anti cox1 polyclonal antibody ![]() Anti Cox1 Polyclonal Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cox1/pm41916686-48-33-36?v=Cell+Signaling+Technology+Inc Average 94 stars, based on 1 article reviews
anti cox1 polyclonal antibody - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Cosmo Genetech Co
cox1 amplicon ![]() Cox1 Amplicon, supplied by Cosmo Genetech Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cox1/pmc12933473-175-30-12?v=Cosmo+Genetech+Co Average 86 stars, based on 1 article reviews
cox1 amplicon - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
cox1 ![]() Cox1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cox1/pm41745478-155-17-41?v=Cell+Signaling+Technology+Inc Average 95 stars, based on 1 article reviews
cox1 - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
anti cox 1 antibody ![]() Anti Cox 1 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cox1/pm41707855-53-13-16?v=Cell+Signaling+Technology+Inc Average 94 stars, based on 1 article reviews
anti cox 1 antibody - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Proteintech
anti cox1 ![]() Anti Cox1, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cox1/pm41673763-117-41-44?v=Proteintech Average 93 stars, based on 1 article reviews
anti cox1 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Macrogen
d immitis cox1 amplicons ![]() D Immitis Cox1 Amplicons, supplied by Macrogen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cox1/10__1017_slash_s0031182026101620-51-3-21?v=Macrogen Average 86 stars, based on 1 article reviews
d immitis cox1 amplicons - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
Journal: The FASEB Journal
Article Title: SCD1 Regulates Osteoclast Differentiation by Modulating Arachidonic Acid Metabolism and Mitochondrial Homeostasis
doi: 10.1096/fj.202600672R
Figure Lengend Snippet: A939572 inhibits OC differentiation by modulating arachidonic acid metabolism. (A) Integrated transcriptomic and metabolomic analysis. (B) Heatmap of PGD2‐related metabolites. i indicates inhibitor‐treated samples, NC indicates control samples. (C, D) GSEA of arachidonic acid and mineralization‐related metabolites. (E) PGD2 concentrations in cell measured by ELISA in each group ( n = 6). (F, G) Western blots showing HPGDS, COX1 and COX2 protein levels in OCs treated with A939572. (H) Western blots showing c‐Fos and NFATc1 protein levels in BMDMs treated with varying concentrations of PGD2. (I) Changes in OC‐related markers following RANKL stimulation at different time points, with or without 0.625 μM PGD2 treatment. (J) RT‐qPCR analysis of OC‐related markers in response to different concentrations of PGD2. (K) TRAP staining and F‐actin immunofluorescence staining of OCs treated with or without PGD2; TRAP staining, Scale bars, 100 μm; F‐actin immunofluorescence staining, Scale bars, 100 μm. (L) Quantification of nuclei numbers of TRAP‐positive multinuclear cells ( n = 3). Data are presented as mean ± SD. NS, not significant ( p > 0.05), * p ≤ 0.05, ** p < 0.01, *** p < 0.001. Source numerical and statistical data are provided.
Article Snippet: Antibodies against the following targets were used:
Techniques: Metabolomic, Control, Enzyme-linked Immunosorbent Assay, Western Blot, Quantitative RT-PCR, Staining, Immunofluorescence