Structured Review

TaKaRa complementary dna cdna
Electrophoretic analysis of cross-reaction in the PCV2 LAMP assay. PCV2-BJ, PCV1, PPV, PRV, and PRRSV were used as targets for the PCV2 LAMP assay. From left to right: lane M, <t>DNA</t> Marker DL-2000; lane 1, DNA of PCV2-BJ; lane 2, DNA of PCV1; lane 3, DNA of PPV; lane 4, DNA of PRV; lane 5, <t>cDNA</t> of PRRSV; lane 6, DNA from healthy swine tissue.
Complementary Dna Cdna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 317 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/complementary dna cdna/product/TaKaRa
Average 94 stars, based on 317 article reviews
Price from $9.99 to $1999.99
complementary dna cdna - by Bioz Stars, 2020-09
94/100 stars

Images

1) Product Images from "Rapid detection of porcine circovirus type 2 by loop-mediated isothermal amplification"

Article Title: Rapid detection of porcine circovirus type 2 by loop-mediated isothermal amplification

Journal: Journal of Virological Methods

doi: 10.1016/j.jviromet.2008.01.023

Electrophoretic analysis of cross-reaction in the PCV2 LAMP assay. PCV2-BJ, PCV1, PPV, PRV, and PRRSV were used as targets for the PCV2 LAMP assay. From left to right: lane M, DNA Marker DL-2000; lane 1, DNA of PCV2-BJ; lane 2, DNA of PCV1; lane 3, DNA of PPV; lane 4, DNA of PRV; lane 5, cDNA of PRRSV; lane 6, DNA from healthy swine tissue.
Figure Legend Snippet: Electrophoretic analysis of cross-reaction in the PCV2 LAMP assay. PCV2-BJ, PCV1, PPV, PRV, and PRRSV were used as targets for the PCV2 LAMP assay. From left to right: lane M, DNA Marker DL-2000; lane 1, DNA of PCV2-BJ; lane 2, DNA of PCV1; lane 3, DNA of PPV; lane 4, DNA of PRV; lane 5, cDNA of PRRSV; lane 6, DNA from healthy swine tissue.

Techniques Used: Lamp Assay, Marker

2) Product Images from "Impact of Losing hRpn13 Pru or UCHL5 on Proteasome Clearance of Ubiquitinated Proteins and RA190 Cytotoxicity"

Article Title: Impact of Losing hRpn13 Pru or UCHL5 on Proteasome Clearance of Ubiquitinated Proteins and RA190 Cytotoxicity

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.00122-20

Generation of a cell line expressing truncated hRpn13 (trRpn13) competent for binding UCHL5 but not proteasome. (A) Schematic representation of the hRpn13-expressing ADRM1 gene highlighting and labeling each forward strand exon, including noncoding exon 1 and gRNA-targeted exon 2. Exons 3 to 10, as well as the ATG codon in exon 3 encoding M109, are also indicated. (B) Structure of hRpn13 (PDB 2KR0) highlighting exons of the ADRM1 gene colored as displayed in panel A. Exons 1 to 4 and 8 to 10 express the hRpn13 Pru and DEUBAD domains, respectively, with exon 7 yielding a helix that bridges these two structural domains. Exons 5 and 6 express parts of the protein that are intrinsically disordered and are omitted from this figure. The side chain heavy atoms are displayed (pink) for M109, which is located at the end of a helix encoded by exon 3. (C, top) Whole-cell extract from HCT116 (WT) or trRpn13 cells was resolved and analyzed by immunoprobing for hRpn13, hRpn2, or hRpt3, as indicated, with β-actin used as a loading control. (Bottom) Proteasomes from WT or trRpn13 whole-cell extract were immunoprecipitated (IP) with anti-Rpt3 antibodies and immunoprobed for hRpn13 or hRpn2 as a positive control. (D) Total RNA from HCT116 (WT) or trRpn13 was reverse transcribed to cDNA and subjected to PCR for evaluation with primers targeting the indicated ADRM1 exon junctions. PCR products were run on a 1% agarose gel and visualized by SYBR safe DNA gel stain. (E) Sashimi plot depicting normalized coverage for the ADRM1 gene that expresses hRpn13 in HCT116 trRpn13 or WT cells. (Top) Counts-per-minute (CPM)-normalized expression is shown along the y axis for the length of the gene along the x axis. Reads spanning splice junctions are depicted as arcs annotated with CPM-normalized counts. (Bottom) Schematic of the primary transcript (ENST00000253003) for the gene from the Ensembl database, version 75, with exons shown as boxes, introns shown as lines, and arrows indicating the direction of transcription. Numbers at the bottom denote the chromosomal coordinates along chromosome 20. (F) Sanger sequencing analysis of hRpn13 cDNA from WT or trRpn13 cells denoting the location of the two sgRNAs (red arrows), 5′ UTR, which includes exon 1 (gray arrow), and protein-coding exon 2 and exon 3 (yellow bars). An expansion is included in the lower panel showing the 5′ and 3′ portions from the deletion of exon 2. This image was generated by using Geneious. (G) Lysates from WT, Δ hRpn13 , or trRpn13 cells were immunoprobed for UCHL5, hRpn13, or β-actin (as a loading control). (H) Lysates from WT, Δ hRpn13 , or trRpn13 cells treated for 30 min with the cross-linker DSP were subjected to immunoprecipitation with anti-Rpn13 antibodies, and the immunoprecipitants were immunoprobed for UCHL5 or hRpn13 as indicated. Immunoblots of the whole-cell extract (WCE) are included as indicated in the lower panels for UCHL5, hRpn13, or β-actin (as a loading control).
Figure Legend Snippet: Generation of a cell line expressing truncated hRpn13 (trRpn13) competent for binding UCHL5 but not proteasome. (A) Schematic representation of the hRpn13-expressing ADRM1 gene highlighting and labeling each forward strand exon, including noncoding exon 1 and gRNA-targeted exon 2. Exons 3 to 10, as well as the ATG codon in exon 3 encoding M109, are also indicated. (B) Structure of hRpn13 (PDB 2KR0) highlighting exons of the ADRM1 gene colored as displayed in panel A. Exons 1 to 4 and 8 to 10 express the hRpn13 Pru and DEUBAD domains, respectively, with exon 7 yielding a helix that bridges these two structural domains. Exons 5 and 6 express parts of the protein that are intrinsically disordered and are omitted from this figure. The side chain heavy atoms are displayed (pink) for M109, which is located at the end of a helix encoded by exon 3. (C, top) Whole-cell extract from HCT116 (WT) or trRpn13 cells was resolved and analyzed by immunoprobing for hRpn13, hRpn2, or hRpt3, as indicated, with β-actin used as a loading control. (Bottom) Proteasomes from WT or trRpn13 whole-cell extract were immunoprecipitated (IP) with anti-Rpt3 antibodies and immunoprobed for hRpn13 or hRpn2 as a positive control. (D) Total RNA from HCT116 (WT) or trRpn13 was reverse transcribed to cDNA and subjected to PCR for evaluation with primers targeting the indicated ADRM1 exon junctions. PCR products were run on a 1% agarose gel and visualized by SYBR safe DNA gel stain. (E) Sashimi plot depicting normalized coverage for the ADRM1 gene that expresses hRpn13 in HCT116 trRpn13 or WT cells. (Top) Counts-per-minute (CPM)-normalized expression is shown along the y axis for the length of the gene along the x axis. Reads spanning splice junctions are depicted as arcs annotated with CPM-normalized counts. (Bottom) Schematic of the primary transcript (ENST00000253003) for the gene from the Ensembl database, version 75, with exons shown as boxes, introns shown as lines, and arrows indicating the direction of transcription. Numbers at the bottom denote the chromosomal coordinates along chromosome 20. (F) Sanger sequencing analysis of hRpn13 cDNA from WT or trRpn13 cells denoting the location of the two sgRNAs (red arrows), 5′ UTR, which includes exon 1 (gray arrow), and protein-coding exon 2 and exon 3 (yellow bars). An expansion is included in the lower panel showing the 5′ and 3′ portions from the deletion of exon 2. This image was generated by using Geneious. (G) Lysates from WT, Δ hRpn13 , or trRpn13 cells were immunoprobed for UCHL5, hRpn13, or β-actin (as a loading control). (H) Lysates from WT, Δ hRpn13 , or trRpn13 cells treated for 30 min with the cross-linker DSP were subjected to immunoprecipitation with anti-Rpn13 antibodies, and the immunoprecipitants were immunoprobed for UCHL5 or hRpn13 as indicated. Immunoblots of the whole-cell extract (WCE) are included as indicated in the lower panels for UCHL5, hRpn13, or β-actin (as a loading control).

Techniques Used: Expressing, Binding Assay, Labeling, Immunoprecipitation, Positive Control, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining, Sequencing, Generated, Western Blot

3) Product Images from "The Mitochondrial Endonuclease M20 Participates in the Down-Regulation of Mitochondrial DNA in Pollen Cells"

Article Title: The Mitochondrial Endonuclease M20 Participates in the Down-Regulation of Mitochondrial DNA in Pollen Cells

Journal: Plant Physiology

doi: 10.1104/pp.18.00754

Generation of the atm20 mutant using CRISPR/Cas9 technology. A, Schematic diagram of the CRISPR construct containing a Cas9 expression cassette driven by an enhanced CaMV 35S promoter and an sgRNA controlled by the AtU6-26 promoter. B, A 4-bp deletion was detected in genomic DNA and cDNA of a T1 transformant (d4 mutation). The target sequence is shaded in blue, and the (PCI/PINT associated module) PAM domain is shaded in red. C, The 4-bp deletion causes a frame-shift within AtM20 and may lead to early translational termination. D, A smaller product (AtM20Δ) of AtM20 due to base deletion and early termination was detected in plants with the d4 mutation (top), and the mutation inactivates its nucleolytic activity in vitro (bottom). Arrowheads indicate the molecular products of AtM20 and AtM20Δ.
Figure Legend Snippet: Generation of the atm20 mutant using CRISPR/Cas9 technology. A, Schematic diagram of the CRISPR construct containing a Cas9 expression cassette driven by an enhanced CaMV 35S promoter and an sgRNA controlled by the AtU6-26 promoter. B, A 4-bp deletion was detected in genomic DNA and cDNA of a T1 transformant (d4 mutation). The target sequence is shaded in blue, and the (PCI/PINT associated module) PAM domain is shaded in red. C, The 4-bp deletion causes a frame-shift within AtM20 and may lead to early translational termination. D, A smaller product (AtM20Δ) of AtM20 due to base deletion and early termination was detected in plants with the d4 mutation (top), and the mutation inactivates its nucleolytic activity in vitro (bottom). Arrowheads indicate the molecular products of AtM20 and AtM20Δ.

Techniques Used: Mutagenesis, CRISPR, Construct, Expressing, Sequencing, Activity Assay, In Vitro

4) Product Images from "The Mitochondrial Endonuclease M20 Participates in the Down-Regulation of Mitochondrial DNA in Pollen Cells"

Article Title: The Mitochondrial Endonuclease M20 Participates in the Down-Regulation of Mitochondrial DNA in Pollen Cells

Journal: Plant Physiology

doi: 10.1104/pp.18.00754

Generation of the atm20 mutant using CRISPR/Cas9 technology. A, Schematic diagram of the CRISPR construct containing a Cas9 expression cassette driven by an enhanced CaMV 35S promoter and an sgRNA controlled by the AtU6-26 promoter. B, A 4-bp deletion was detected in genomic DNA and cDNA of a T1 transformant (d4 mutation). The target sequence is shaded in blue, and the (PCI/PINT associated module) PAM domain is shaded in red. C, The 4-bp deletion causes a frame-shift within AtM20 and may lead to early translational termination. D, A smaller product (AtM20Δ) of AtM20 due to base deletion and early termination was detected in plants with the d4 mutation (top), and the mutation inactivates its nucleolytic activity in vitro (bottom). Arrowheads indicate the molecular products of AtM20 and AtM20Δ.
Figure Legend Snippet: Generation of the atm20 mutant using CRISPR/Cas9 technology. A, Schematic diagram of the CRISPR construct containing a Cas9 expression cassette driven by an enhanced CaMV 35S promoter and an sgRNA controlled by the AtU6-26 promoter. B, A 4-bp deletion was detected in genomic DNA and cDNA of a T1 transformant (d4 mutation). The target sequence is shaded in blue, and the (PCI/PINT associated module) PAM domain is shaded in red. C, The 4-bp deletion causes a frame-shift within AtM20 and may lead to early translational termination. D, A smaller product (AtM20Δ) of AtM20 due to base deletion and early termination was detected in plants with the d4 mutation (top), and the mutation inactivates its nucleolytic activity in vitro (bottom). Arrowheads indicate the molecular products of AtM20 and AtM20Δ.

Techniques Used: Mutagenesis, CRISPR, Construct, Expressing, Sequencing, Activity Assay, In Vitro

5) Product Images from "Photosystem II antenna complexes CP26 and CP29 are essential for nonphotochemical quenching in Chlamydomonas reinhardtii, et al. Photosystem II antenna complexes CP26 and CP29 are essential for nonphotochemical quenching in Chlamydomonas reinhardtii"

Article Title: Photosystem II antenna complexes CP26 and CP29 are essential for nonphotochemical quenching in Chlamydomonas reinhardtii, et al. Photosystem II antenna complexes CP26 and CP29 are essential for nonphotochemical quenching in Chlamydomonas reinhardtii

Journal: Plant, Cell & Environment

doi: 10.1111/pce.13680

CP26‐ and CP29‐targeted gene disruption in Chlamydomonas reinhardtii by CRISPR/Cas9 genome editing. (a) DNA sequence alignment of wild type (Wt) and mutants on cp26 ( k6 ) and cp29 ( k9 ) obtained by CRISPR/Cas9 genome editing. The 20‐bp target sequence of sgRNA is reported before the red‐coloured PAM sequence. In the case of k9 mutant, insertions ( k9‐1 ) or deletions were induced ( k9‐2 ) by non‐homologous repair, whereas in the case of k6 mutant, a Cas9‐mediated hygromycin resistance cassette insertion was obtained in the target site. Double‐mutant k69 was obtained by hygromycin resistance cassette insertion in a k9 background. (b) PCR amplification of cp26 and cp29 CDS sequences from Wt, k6 , k9 , and k69 cDNA. In the case of k6 and k69 mutants, the cp26 CDS cannot be amplified due to hygromycin cassette insertion. (c) SDS‐PAGE analysis of Wt and mutant strains performed with the Tris‐Tricine buffer system. Fifteen microgram of Chl was loaded in each lane. Molecular weight (MW) markers are indicated on the left. CP26 and CP29 bands are marked. (d) Immunoblot with specific antibodies directed against CP26 and CP29 on the same lanes of (c). Immunoblot against CP43 was added as control of the loading. (e) qRT‐PCR on cp26 and cp29 genes in Wt and mutant strains. rack1 gene was used as control for qRT‐PCR (see details in Figure S3 )
Figure Legend Snippet: CP26‐ and CP29‐targeted gene disruption in Chlamydomonas reinhardtii by CRISPR/Cas9 genome editing. (a) DNA sequence alignment of wild type (Wt) and mutants on cp26 ( k6 ) and cp29 ( k9 ) obtained by CRISPR/Cas9 genome editing. The 20‐bp target sequence of sgRNA is reported before the red‐coloured PAM sequence. In the case of k9 mutant, insertions ( k9‐1 ) or deletions were induced ( k9‐2 ) by non‐homologous repair, whereas in the case of k6 mutant, a Cas9‐mediated hygromycin resistance cassette insertion was obtained in the target site. Double‐mutant k69 was obtained by hygromycin resistance cassette insertion in a k9 background. (b) PCR amplification of cp26 and cp29 CDS sequences from Wt, k6 , k9 , and k69 cDNA. In the case of k6 and k69 mutants, the cp26 CDS cannot be amplified due to hygromycin cassette insertion. (c) SDS‐PAGE analysis of Wt and mutant strains performed with the Tris‐Tricine buffer system. Fifteen microgram of Chl was loaded in each lane. Molecular weight (MW) markers are indicated on the left. CP26 and CP29 bands are marked. (d) Immunoblot with specific antibodies directed against CP26 and CP29 on the same lanes of (c). Immunoblot against CP43 was added as control of the loading. (e) qRT‐PCR on cp26 and cp29 genes in Wt and mutant strains. rack1 gene was used as control for qRT‐PCR (see details in Figure S3 )

Techniques Used: CRISPR, Sequencing, Mutagenesis, Polymerase Chain Reaction, Amplification, SDS Page, Molecular Weight, Quantitative RT-PCR

Related Articles

Amplification:

Article Title: Photosystem II antenna complexes CP26 and CP29 are essential for nonphotochemical quenching in Chlamydomonas reinhardtii, et al. Photosystem II antenna complexes CP26 and CP29 are essential for nonphotochemical quenching in Chlamydomonas reinhardtii
Article Snippet: .. Complementary DNA (cDNA) was synthesized from total RNA by using 2X reverse transcription master premix (ELPiS Biotech, Daejeon, Korea) and amplified using SYBR premix (Takara, Kusatsu, Japan) in a Thermal Cycler Dice Real Time System TP 8200 (Takara, Kusatsu, Japan). .. The gene for the “receptor for activated C kinase 1 (RACK1)” was used as a reference and was amplified with the forward primer 5′‐GGCTGGGACAAGATGGTCAA‐3′ and reverse primer 5′‐GAGAAGCACAGGCAGTGGAT‐3′.

Quantitative RT-PCR:

Article Title: MsrA Suppresses Inflammatory Activation of Microglia and Oxidative Stress to Prevent Demyelination via Inhibition of the NOX2-MAPKs/NF-κB Signaling Pathway
Article Snippet: .. RT-qPCR Total RNA was extracted using Trizol (15596026, Invitrogen, Carlsbad, California, USA), which was reversely transcribed into complementary DNA (cDNA) using the RT kit (RR047A, Takara Bio Inc., Otsu, Shiga, Japan). .. Using the SYBR Premix EX Taq kit (RR420A, Takara Bio Inc., Otsu, Shiga, Japan), RT-qPCR was performed on an ABI 7500 instrument (Applied Biosystems, Foster City, CA, USA).

Synthesized:

Article Title: Photosystem II antenna complexes CP26 and CP29 are essential for nonphotochemical quenching in Chlamydomonas reinhardtii, et al. Photosystem II antenna complexes CP26 and CP29 are essential for nonphotochemical quenching in Chlamydomonas reinhardtii
Article Snippet: .. Complementary DNA (cDNA) was synthesized from total RNA by using 2X reverse transcription master premix (ELPiS Biotech, Daejeon, Korea) and amplified using SYBR premix (Takara, Kusatsu, Japan) in a Thermal Cycler Dice Real Time System TP 8200 (Takara, Kusatsu, Japan). .. The gene for the “receptor for activated C kinase 1 (RACK1)” was used as a reference and was amplified with the forward primer 5′‐GGCTGGGACAAGATGGTCAA‐3′ and reverse primer 5′‐GAGAAGCACAGGCAGTGGAT‐3′.

Article Title: Impact of Losing hRpn13 Pru or UCHL5 on Proteasome Clearance of Ubiquitinated Proteins and RA190 Cytotoxicity
Article Snippet: .. Complementary DNA (cDNA) was synthesized by using the Smarter RACE 5′/3′ kit (634860; Clontech). .. PCRs were performed with synthesized cDNA as the template, SeqAmp DNA polymerase (638509; Clontech), and PCR buffer (638526; Clontech).

Article Title: Rapid detection of porcine circovirus type 2 by loop-mediated isothermal amplification
Article Snippet: .. Complementary DNA (cDNA) was synthesized using 15 μl of the eluted RNA with oligo(dT)18 primers and the reverse transcriptase kit (Takara Corp., Japan) according to the manufacturer's instructions. .. 2.3 Primer design and reaction protocol for LAMP and PCR The highly conserved sequences in the capsid protein-coding region of PCV2 were selected as the target for LAMP and PCR.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    TaKaRa human circakt3 cdna
    <t>circAKT3</t> expression is increased in CDDP-resistant GC cells and tissues. a Validated expression of 10 circRNAs in the tissues from 44 GC patients using RT-qPCR. b Expression levels of circAKT3 in CDDP-resistant and their matched sensitive parental cell lines (SGC7901CDDP, BGC823CDDP, SGC7901 and BGC823) normalized to GAPDH expression. c The existence of circAKT3 was validated by Sanger sequencing. The red arrow shows the “head-to-tail” splicing sites of circAKT3. d The existence of circAKT3 was validated in SGC7901CDDP and BGC823CDDP cell lines by RT-PCR. Divergent primers amplified circAKT3 in <t>cDNA</t> but not in genomic DNA (gDNA). GAPDH served as a negative control. e RNA from SGC7901CDDP and BGC823CDDP cells was treated with or without RNase R for RT-qPCR. The relative levels of circAKT3 and AKT3 mRNA were normalized to the values measured in the mock-treated cells. f Levels of small nucleolar RNA (U6, as a positive control for the nuclear fraction), GAPDH (positive control for cytoplasmic fraction), AKT3 mRNA and circRNAs from the nuclear and cytoplasmic fractions of SGC7901CDDP cells. g RNA stability of circular and linear transcripts of AKT3 and of 18S rRNA in SGC7901CDDP cells. h Representative images of RNA FISH of circAKT3 expression in SGC7901CDDP cells, which show that circAKT3 is predominantly localized to the cytoplasm. Nuclei were stained with DAPI. Scale bar, 10 μm. The results are presented as the mean ± SEM. * P
    Human Circakt3 Cdna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human circakt3 cdna/product/TaKaRa
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    human circakt3 cdna - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    93
    TaKaRa cdna lines
    Cell line panel screen of drug sensitivity identifies BCL2L1 expression as a marker of insensitivity to E7107. a Top five genes whose mRNA expression positively correlated with maximum effect of cell killing (Emax) of E7107 profiled in 478 cancer cell lines. Pearson’s correlation coefficient R and p values were calculated using R package Hmisc 4.1-0. Lower Emax value indicates more robust cell killing activity. b Heatmap demonstrating the positive correlation between Emax of E7107 and BCL2L1 mRNA expression in 478 cancer cell lines. The heatmap was sorted by Emax of E7107 in cancer cell lines from high (less sensitive) to low (more sensitive). c Box plots showing the distribution of Emax (%) of E7107 in two groups of profiled cell lines defined by expression levels of each BCL2 family genes. For each BCL2 family genes, cell lines with expression level higher than the third quartile are classified into “high” and cell lines with expression level lower than the first quartile are classified into “low.” p Values were calculated using Student’s t test. d Growth-inhibitory activity of E7107 in lung cancer cell lines A549 and NCIH1568 upon doxycycline-induced <t>shRNA</t> knockdown of BCL2L1 . Left, Western blot analysis of BCLxL(encoded by BCL2L1 ) knockdown; Right, Growth curves of two cell lines measured by CellTiter-Glo. Data represent means ± SD of biological triplicates. e Growth-inhibitory activity of E7107 in lung cancer cell lines NCIH2110 and NCIH1568 upon stable <t>cDNA</t> expression of BCL2L1 (BCLxL). Left, Western blot analysis of BCLxL(encoded by BCL2L1 ) overexpression; Right, Growth curves of two cell lines measured by CellTiter-Glo. Data represent means ± SD of biological triplicates
    Cdna Lines, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna lines/product/TaKaRa
    Average 93 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    cdna lines - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    85
    TaKaRa inducible gfp crumbs3a cdna
    <t>Crumbs3a</t> dynamics in polarized MDCK monolayers A) Time course showing induced <t>GFP-Crb3a</t> protein levels in MDCK cells following treatment with 50 ng/ml doxycycline for 1 hour. Cell lysates were produced at the indicated times post-treatment and subjected to immunoblot with the indicated antibodies. The left lane shows uninduced expression; actin is included as a loading control. B) Time course for doxycycline-induced GFP-Crb3a mRNA levels harvested from cells treated in parallel to (A), as detected by qRT-PCR. Transcript levels are normalized to GAPDH and shown relative to uninduced control levels. The experiment was performed in triplicate; averaged levels are shown with standard deviations. C) and D) Cell surface Crb3a internalization assays using cell surface biotinylation (see Methods). Residual cell surface biotin is cleaved by treatment with MESNA prior to cell lysis to reveal internalized pool of biotinylated proteins (see schematic in C). C) Endogenous Crb3a and 3x myc-Crb3a were isolated from parental (left immunoblot) and 3x myc-Crb3a (right immunoblot) cells at indicated time points and assayed for biotinylation. D) Graph of Crb3a internalization assay using 1x myc-Crb3a and 3x myc-Crb3a cells, performed as in (C) except that the biotinylated Crb3a signal intensities were normalized to myc immunoblot signal. Averaged levels obtained from two experiments are shown with standard deviations.
    Inducible Gfp Crumbs3a Cdna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/inducible gfp crumbs3a cdna/product/TaKaRa
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    inducible gfp crumbs3a cdna - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    85
    TaKaRa atxn8os cdna
    IRES activity of the <t>ATXN8OS</t> transcript. (A) ATXN8OS organization with promoter (open arrow), exons (open boxes) and functional splice donor sequences (GT) of D exons (D5, D4, D, D″ and D′) indicated. The CTG repeat tract is located in exon A. Transcription start site of exon D5 and exon D are represented by +1 and +801, respectively. (B) ATXN8OS RNA (NR_002717) generated from the splicing events represented by the wavy lines. The putative ORF initiated from AUG +1247 is indicated by the open boxes inside the RNA. The restriction enzymes and the cutting sites used to generate +801∼+1195 <t>cDNA</t> fragment of ATXN8OS are shown on the bottom of the cDNA. (C) The dual luciferase reporter plasmid had Renilla luciferase and firefly luciferase genes between the TK promoter and polyadenylation signal. The locations of Xba I, Xho I and Bam HI sites used for construction are shown on the top. (D) Relative luciferase activities generated by dual luciferase constructs with ECMV IRES and ATXN8OS +801∼+1195 cDNA fragment in HEK-293 and IMR-32 cells. Forty-eight hours following transfection, cells were harvested and luciferases activities were measured. IRES activity is expressed as percentages of the activity of the ECMV IRES, which was set at 100%. In addition, relative luciferase activities with ATXN8OS +801∼+953 and +953∼+1195 cDNA fragments were measured in HEK-293 cells, with IRES activity of +801∼+1195 set at 100%. Each value is the mean ± SD of three independent experiments each performed in duplicate.
    Atxn8os Cdna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atxn8os cdna/product/TaKaRa
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    atxn8os cdna - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    Image Search Results


    circAKT3 expression is increased in CDDP-resistant GC cells and tissues. a Validated expression of 10 circRNAs in the tissues from 44 GC patients using RT-qPCR. b Expression levels of circAKT3 in CDDP-resistant and their matched sensitive parental cell lines (SGC7901CDDP, BGC823CDDP, SGC7901 and BGC823) normalized to GAPDH expression. c The existence of circAKT3 was validated by Sanger sequencing. The red arrow shows the “head-to-tail” splicing sites of circAKT3. d The existence of circAKT3 was validated in SGC7901CDDP and BGC823CDDP cell lines by RT-PCR. Divergent primers amplified circAKT3 in cDNA but not in genomic DNA (gDNA). GAPDH served as a negative control. e RNA from SGC7901CDDP and BGC823CDDP cells was treated with or without RNase R for RT-qPCR. The relative levels of circAKT3 and AKT3 mRNA were normalized to the values measured in the mock-treated cells. f Levels of small nucleolar RNA (U6, as a positive control for the nuclear fraction), GAPDH (positive control for cytoplasmic fraction), AKT3 mRNA and circRNAs from the nuclear and cytoplasmic fractions of SGC7901CDDP cells. g RNA stability of circular and linear transcripts of AKT3 and of 18S rRNA in SGC7901CDDP cells. h Representative images of RNA FISH of circAKT3 expression in SGC7901CDDP cells, which show that circAKT3 is predominantly localized to the cytoplasm. Nuclei were stained with DAPI. Scale bar, 10 μm. The results are presented as the mean ± SEM. * P

    Journal: Molecular Cancer

    Article Title: Circular RNA AKT3 upregulates PIK3R1 to enhance cisplatin resistance in gastric cancer via miR-198 suppression

    doi: 10.1186/s12943-019-0969-3

    Figure Lengend Snippet: circAKT3 expression is increased in CDDP-resistant GC cells and tissues. a Validated expression of 10 circRNAs in the tissues from 44 GC patients using RT-qPCR. b Expression levels of circAKT3 in CDDP-resistant and their matched sensitive parental cell lines (SGC7901CDDP, BGC823CDDP, SGC7901 and BGC823) normalized to GAPDH expression. c The existence of circAKT3 was validated by Sanger sequencing. The red arrow shows the “head-to-tail” splicing sites of circAKT3. d The existence of circAKT3 was validated in SGC7901CDDP and BGC823CDDP cell lines by RT-PCR. Divergent primers amplified circAKT3 in cDNA but not in genomic DNA (gDNA). GAPDH served as a negative control. e RNA from SGC7901CDDP and BGC823CDDP cells was treated with or without RNase R for RT-qPCR. The relative levels of circAKT3 and AKT3 mRNA were normalized to the values measured in the mock-treated cells. f Levels of small nucleolar RNA (U6, as a positive control for the nuclear fraction), GAPDH (positive control for cytoplasmic fraction), AKT3 mRNA and circRNAs from the nuclear and cytoplasmic fractions of SGC7901CDDP cells. g RNA stability of circular and linear transcripts of AKT3 and of 18S rRNA in SGC7901CDDP cells. h Representative images of RNA FISH of circAKT3 expression in SGC7901CDDP cells, which show that circAKT3 is predominantly localized to the cytoplasm. Nuclei were stained with DAPI. Scale bar, 10 μm. The results are presented as the mean ± SEM. * P

    Article Snippet: For the construction of circAKT3 overexpression plasmids, human circAKT3 cDNA was amplified using PrimerSTAR Max DNA Polymerase Mix (Takara, RR036A, Japan) and inserted into the pCD5-ciR vector (Greenseed Biotech Co, Guangzhou, China).

    Techniques: Expressing, Quantitative RT-PCR, Sequencing, Reverse Transcription Polymerase Chain Reaction, Amplification, Negative Control, Positive Control, Fluorescence In Situ Hybridization, Staining

    Cell line panel screen of drug sensitivity identifies BCL2L1 expression as a marker of insensitivity to E7107. a Top five genes whose mRNA expression positively correlated with maximum effect of cell killing (Emax) of E7107 profiled in 478 cancer cell lines. Pearson’s correlation coefficient R and p values were calculated using R package Hmisc 4.1-0. Lower Emax value indicates more robust cell killing activity. b Heatmap demonstrating the positive correlation between Emax of E7107 and BCL2L1 mRNA expression in 478 cancer cell lines. The heatmap was sorted by Emax of E7107 in cancer cell lines from high (less sensitive) to low (more sensitive). c Box plots showing the distribution of Emax (%) of E7107 in two groups of profiled cell lines defined by expression levels of each BCL2 family genes. For each BCL2 family genes, cell lines with expression level higher than the third quartile are classified into “high” and cell lines with expression level lower than the first quartile are classified into “low.” p Values were calculated using Student’s t test. d Growth-inhibitory activity of E7107 in lung cancer cell lines A549 and NCIH1568 upon doxycycline-induced shRNA knockdown of BCL2L1 . Left, Western blot analysis of BCLxL(encoded by BCL2L1 ) knockdown; Right, Growth curves of two cell lines measured by CellTiter-Glo. Data represent means ± SD of biological triplicates. e Growth-inhibitory activity of E7107 in lung cancer cell lines NCIH2110 and NCIH1568 upon stable cDNA expression of BCL2L1 (BCLxL). Left, Western blot analysis of BCLxL(encoded by BCL2L1 ) overexpression; Right, Growth curves of two cell lines measured by CellTiter-Glo. Data represent means ± SD of biological triplicates

    Journal: Nature Communications

    Article Title: Sensitivity to splicing modulation of BCL2 family genes defines cancer therapeutic strategies for splicing modulators

    doi: 10.1038/s41467-018-08150-5

    Figure Lengend Snippet: Cell line panel screen of drug sensitivity identifies BCL2L1 expression as a marker of insensitivity to E7107. a Top five genes whose mRNA expression positively correlated with maximum effect of cell killing (Emax) of E7107 profiled in 478 cancer cell lines. Pearson’s correlation coefficient R and p values were calculated using R package Hmisc 4.1-0. Lower Emax value indicates more robust cell killing activity. b Heatmap demonstrating the positive correlation between Emax of E7107 and BCL2L1 mRNA expression in 478 cancer cell lines. The heatmap was sorted by Emax of E7107 in cancer cell lines from high (less sensitive) to low (more sensitive). c Box plots showing the distribution of Emax (%) of E7107 in two groups of profiled cell lines defined by expression levels of each BCL2 family genes. For each BCL2 family genes, cell lines with expression level higher than the third quartile are classified into “high” and cell lines with expression level lower than the first quartile are classified into “low.” p Values were calculated using Student’s t test. d Growth-inhibitory activity of E7107 in lung cancer cell lines A549 and NCIH1568 upon doxycycline-induced shRNA knockdown of BCL2L1 . Left, Western blot analysis of BCLxL(encoded by BCL2L1 ) knockdown; Right, Growth curves of two cell lines measured by CellTiter-Glo. Data represent means ± SD of biological triplicates. e Growth-inhibitory activity of E7107 in lung cancer cell lines NCIH2110 and NCIH1568 upon stable cDNA expression of BCL2L1 (BCLxL). Left, Western blot analysis of BCLxL(encoded by BCL2L1 ) overexpression; Right, Growth curves of two cell lines measured by CellTiter-Glo. Data represent means ± SD of biological triplicates

    Article Snippet: Inducible shRNA and cDNA lines generated by lentiviral transduction were cultured according to the manufacturer’s instructions utilizing Tet System Approved fetal bovine serum (Clontech) rather than standard sera.

    Techniques: Expressing, Marker, Activity Assay, shRNA, Western Blot, Over Expression

    Crumbs3a dynamics in polarized MDCK monolayers A) Time course showing induced GFP-Crb3a protein levels in MDCK cells following treatment with 50 ng/ml doxycycline for 1 hour. Cell lysates were produced at the indicated times post-treatment and subjected to immunoblot with the indicated antibodies. The left lane shows uninduced expression; actin is included as a loading control. B) Time course for doxycycline-induced GFP-Crb3a mRNA levels harvested from cells treated in parallel to (A), as detected by qRT-PCR. Transcript levels are normalized to GAPDH and shown relative to uninduced control levels. The experiment was performed in triplicate; averaged levels are shown with standard deviations. C) and D) Cell surface Crb3a internalization assays using cell surface biotinylation (see Methods). Residual cell surface biotin is cleaved by treatment with MESNA prior to cell lysis to reveal internalized pool of biotinylated proteins (see schematic in C). C) Endogenous Crb3a and 3x myc-Crb3a were isolated from parental (left immunoblot) and 3x myc-Crb3a (right immunoblot) cells at indicated time points and assayed for biotinylation. D) Graph of Crb3a internalization assay using 1x myc-Crb3a and 3x myc-Crb3a cells, performed as in (C) except that the biotinylated Crb3a signal intensities were normalized to myc immunoblot signal. Averaged levels obtained from two experiments are shown with standard deviations.

    Journal: Traffic (Copenhagen, Denmark)

    Article Title: Snail Destabilizes Cell Surface Crumbs3a

    doi: 10.1111/j.1600-0854.2012.01376.x

    Figure Lengend Snippet: Crumbs3a dynamics in polarized MDCK monolayers A) Time course showing induced GFP-Crb3a protein levels in MDCK cells following treatment with 50 ng/ml doxycycline for 1 hour. Cell lysates were produced at the indicated times post-treatment and subjected to immunoblot with the indicated antibodies. The left lane shows uninduced expression; actin is included as a loading control. B) Time course for doxycycline-induced GFP-Crb3a mRNA levels harvested from cells treated in parallel to (A), as detected by qRT-PCR. Transcript levels are normalized to GAPDH and shown relative to uninduced control levels. The experiment was performed in triplicate; averaged levels are shown with standard deviations. C) and D) Cell surface Crb3a internalization assays using cell surface biotinylation (see Methods). Residual cell surface biotin is cleaved by treatment with MESNA prior to cell lysis to reveal internalized pool of biotinylated proteins (see schematic in C). C) Endogenous Crb3a and 3x myc-Crb3a were isolated from parental (left immunoblot) and 3x myc-Crb3a (right immunoblot) cells at indicated time points and assayed for biotinylation. D) Graph of Crb3a internalization assay using 1x myc-Crb3a and 3x myc-Crb3a cells, performed as in (C) except that the biotinylated Crb3a signal intensities were normalized to myc immunoblot signal. Averaged levels obtained from two experiments are shown with standard deviations.

    Article Snippet: Inducible GFP-Crumbs3a : cDNA was PCR amplified from mGFP-Crb3a ( ) and subcloned into pRetroX-Tight-Puro (Clontech).

    Techniques: Produced, Expressing, Quantitative RT-PCR, Lysis, Isolation

    IRES activity of the ATXN8OS transcript. (A) ATXN8OS organization with promoter (open arrow), exons (open boxes) and functional splice donor sequences (GT) of D exons (D5, D4, D, D″ and D′) indicated. The CTG repeat tract is located in exon A. Transcription start site of exon D5 and exon D are represented by +1 and +801, respectively. (B) ATXN8OS RNA (NR_002717) generated from the splicing events represented by the wavy lines. The putative ORF initiated from AUG +1247 is indicated by the open boxes inside the RNA. The restriction enzymes and the cutting sites used to generate +801∼+1195 cDNA fragment of ATXN8OS are shown on the bottom of the cDNA. (C) The dual luciferase reporter plasmid had Renilla luciferase and firefly luciferase genes between the TK promoter and polyadenylation signal. The locations of Xba I, Xho I and Bam HI sites used for construction are shown on the top. (D) Relative luciferase activities generated by dual luciferase constructs with ECMV IRES and ATXN8OS +801∼+1195 cDNA fragment in HEK-293 and IMR-32 cells. Forty-eight hours following transfection, cells were harvested and luciferases activities were measured. IRES activity is expressed as percentages of the activity of the ECMV IRES, which was set at 100%. In addition, relative luciferase activities with ATXN8OS +801∼+953 and +953∼+1195 cDNA fragments were measured in HEK-293 cells, with IRES activity of +801∼+1195 set at 100%. Each value is the mean ± SD of three independent experiments each performed in duplicate.

    Journal: PLoS ONE

    Article Title: Internal Ribosome Entry Segment Activity of ATXN8 Opposite Strand RNA

    doi: 10.1371/journal.pone.0073885

    Figure Lengend Snippet: IRES activity of the ATXN8OS transcript. (A) ATXN8OS organization with promoter (open arrow), exons (open boxes) and functional splice donor sequences (GT) of D exons (D5, D4, D, D″ and D′) indicated. The CTG repeat tract is located in exon A. Transcription start site of exon D5 and exon D are represented by +1 and +801, respectively. (B) ATXN8OS RNA (NR_002717) generated from the splicing events represented by the wavy lines. The putative ORF initiated from AUG +1247 is indicated by the open boxes inside the RNA. The restriction enzymes and the cutting sites used to generate +801∼+1195 cDNA fragment of ATXN8OS are shown on the bottom of the cDNA. (C) The dual luciferase reporter plasmid had Renilla luciferase and firefly luciferase genes between the TK promoter and polyadenylation signal. The locations of Xba I, Xho I and Bam HI sites used for construction are shown on the top. (D) Relative luciferase activities generated by dual luciferase constructs with ECMV IRES and ATXN8OS +801∼+1195 cDNA fragment in HEK-293 and IMR-32 cells. Forty-eight hours following transfection, cells were harvested and luciferases activities were measured. IRES activity is expressed as percentages of the activity of the ECMV IRES, which was set at 100%. In addition, relative luciferase activities with ATXN8OS +801∼+953 and +953∼+1195 cDNA fragments were measured in HEK-293 cells, with IRES activity of +801∼+1195 set at 100%. Each value is the mean ± SD of three independent experiments each performed in duplicate.

    Article Snippet: The ATXN8OS cDNA were then cloned into the Eco RI site of pEGFP-N1 (Clontech).

    Techniques: Activity Assay, Functional Assay, CTG Assay, Generated, Luciferase, Plasmid Preparation, Construct, Transfection

    Transient expression of ATXN8OS ORF-EGFP constructs in HEK-293 cells. (A) ORF-EGFP constructs. A 752-bp cDNA fragment containing exon D, C2 and portion of C1 was inserted into pEGFP-N1 MCS so that ATXN8OS ORF was fused in-frame with the EGFP gene to generate pCMV/+801. A +1∼+800 ATXN8OS fragment was inserted between CMV promoter and exon D of pCMV/+801 to generate pCMV/+1. In pATXN8OS/−114 and/−481, 114 and 481-bp ATXN8OS promoter fragments was used to replace the CMV promoter in pCMV/+1. (B) Real-time PCR quantification of ORF-EGFP RNA level relative to endogenous HPRT1 RNA. To normalize, expression level in pATXN8OS/−481 transfected cells is set as 1.0. (C) FACS analysis of EGFP fluorescence. Levels of EGFP were expressed as percentages of pIRES2-EGFP, which was set at 100%. Each value is the mean ± SD of three independent experiments each performed in duplicate.

    Journal: PLoS ONE

    Article Title: Internal Ribosome Entry Segment Activity of ATXN8 Opposite Strand RNA

    doi: 10.1371/journal.pone.0073885

    Figure Lengend Snippet: Transient expression of ATXN8OS ORF-EGFP constructs in HEK-293 cells. (A) ORF-EGFP constructs. A 752-bp cDNA fragment containing exon D, C2 and portion of C1 was inserted into pEGFP-N1 MCS so that ATXN8OS ORF was fused in-frame with the EGFP gene to generate pCMV/+801. A +1∼+800 ATXN8OS fragment was inserted between CMV promoter and exon D of pCMV/+801 to generate pCMV/+1. In pATXN8OS/−114 and/−481, 114 and 481-bp ATXN8OS promoter fragments was used to replace the CMV promoter in pCMV/+1. (B) Real-time PCR quantification of ORF-EGFP RNA level relative to endogenous HPRT1 RNA. To normalize, expression level in pATXN8OS/−481 transfected cells is set as 1.0. (C) FACS analysis of EGFP fluorescence. Levels of EGFP were expressed as percentages of pIRES2-EGFP, which was set at 100%. Each value is the mean ± SD of three independent experiments each performed in duplicate.

    Article Snippet: The ATXN8OS cDNA were then cloned into the Eco RI site of pEGFP-N1 (Clontech).

    Techniques: Expressing, Construct, Real-time Polymerase Chain Reaction, Transfection, FACS, Fluorescence