complementary dna cdna  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Millipore complementary dna cdna
    Complementary Dna Cdna, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/complementary dna cdna/product/Millipore
    Average 92 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    complementary dna cdna - by Bioz Stars, 2020-05
    92/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Novofumigatonin biosynthesis involves a non-heme iron-dependent endoperoxide isomerase for orthoester formation
    Article Snippet: .. To express nvfI , nvfE , and nvfF in E. coli , complementary DNA (cDNA) for each gene was introduced into the pET-28a(+) vector (Novagen), using an In-Fusion® HD Cloning Kit (Supplementary Data ). .. To obtain an intron-free nvfI gene, total RNA was extracted from an A. oryzae transformant expressing nvfI using ISOGEN (Nippon Gene Co., Ltd.), and cDNA was synthesized with SuperScript™ III Reverse Transcriptase (Invitrogen) from the extracted RNA.

    Transfection:

    Article Title: BIGH3 Promotes Osteolytic Lesions in Renal Cell Carcinoma Bone Metastasis by Inhibiting Osteoblast Differentiation
    Article Snippet: .. HEK293 cells were transfected with pcDNA3.1 vector containing complementary DNA (cDNA) encoding BIGH3 with a 7-histidine tag using polyethylenimine (Sigma Aldrich). .. The cell culture medium was collected 48 hours after transfection and concentrated using Amicon Ultra Centrifuge Filter device, and the BIGH3 protein was purified using Ni-NTA agarose (Qiagen) as described previously .

    Positron Emission Tomography:

    Article Title: Novofumigatonin biosynthesis involves a non-heme iron-dependent endoperoxide isomerase for orthoester formation
    Article Snippet: .. To express nvfI , nvfE , and nvfF in E. coli , complementary DNA (cDNA) for each gene was introduced into the pET-28a(+) vector (Novagen), using an In-Fusion® HD Cloning Kit (Supplementary Data ). .. To obtain an intron-free nvfI gene, total RNA was extracted from an A. oryzae transformant expressing nvfI using ISOGEN (Nippon Gene Co., Ltd.), and cDNA was synthesized with SuperScript™ III Reverse Transcriptase (Invitrogen) from the extracted RNA.

    Synthesized:

    Article Title: Expression of the Genes Encoding the Trk and Kdp Potassium Transport Systems of Mycobacterium tuberculosis during Growth In Vitro
    Article Snippet: .. 2.4.2. cDNA Synthesis The complementary DNA (cDNA) was synthesized following a two-step RT-PCR procedure described in the Sigma Enhanced Avian HS RT-PCR kit (Sigma-Aldrich). .. The annealing mixture for each gene consisting of 100 ng total RNA, 0.5 μ M deoxynucleotide triphosphate (dNTP) mixture (dATP, dTTP, dCTP, and dGTP), and 0.5 μ M gene-specific reverse primer, made to 10 μ L final volume, was incubated at 94°C for 90 s, followed by 65°C for 3 min and 62°C or 57°C for 3 min for the reference or target genes, respectively.

    Article Title: CD154 Induces Interleukin-6 Secretion by Kidney Tubular Epithelial Cells under Hypoxic Conditions: Inhibition by Chloroquine
    Article Snippet: .. Complementary DNA (cDNA) was synthesized using hexaprimers and oligo-dT from 1 μ g of total RNA in a final volume of 20 μ L, using the First-Strand cDNA Synthesis Kit for RT-PCR (Quantitect Reverse Transcription Kit (Sigma-Aldrich)), according to the manufacturer's instructions. .. The qPCR was performed in duplicate on a CFX 384 (Bio-Rad, Marnes-la-Coquette, France) using SYBR® Premix Ex Taq™ bulk (Takara, Ozyme).

    Article Title: Prophylactic intervention of probiotics (L.acidophilus, L.rhamnosus GG) and celecoxib modulate Bax-mediated apoptosis in 1,2-dimethylhydrazine-induced experimental colon carcinogenesis
    Article Snippet: .. Complementary DNA (cDNA) was synthesized from RNA isolated from the colonic tumors of animals belonging to all groups using commercially available kit (Sigma Aldrich, USA). .. RT-PCR is used to detect or quantify the expression of mRNA, from a small concentration of target RNA, PCR was performed using prepared cDNA.

    Isolation:

    Article Title: Prophylactic intervention of probiotics (L.acidophilus, L.rhamnosus GG) and celecoxib modulate Bax-mediated apoptosis in 1,2-dimethylhydrazine-induced experimental colon carcinogenesis
    Article Snippet: .. Complementary DNA (cDNA) was synthesized from RNA isolated from the colonic tumors of animals belonging to all groups using commercially available kit (Sigma Aldrich, USA). .. RT-PCR is used to detect or quantify the expression of mRNA, from a small concentration of target RNA, PCR was performed using prepared cDNA.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Expression of the Genes Encoding the Trk and Kdp Potassium Transport Systems of Mycobacterium tuberculosis during Growth In Vitro
    Article Snippet: .. 2.4.2. cDNA Synthesis The complementary DNA (cDNA) was synthesized following a two-step RT-PCR procedure described in the Sigma Enhanced Avian HS RT-PCR kit (Sigma-Aldrich). .. The annealing mixture for each gene consisting of 100 ng total RNA, 0.5 μ M deoxynucleotide triphosphate (dNTP) mixture (dATP, dTTP, dCTP, and dGTP), and 0.5 μ M gene-specific reverse primer, made to 10 μ L final volume, was incubated at 94°C for 90 s, followed by 65°C for 3 min and 62°C or 57°C for 3 min for the reference or target genes, respectively.

    Article Title: CD154 Induces Interleukin-6 Secretion by Kidney Tubular Epithelial Cells under Hypoxic Conditions: Inhibition by Chloroquine
    Article Snippet: .. Complementary DNA (cDNA) was synthesized using hexaprimers and oligo-dT from 1 μ g of total RNA in a final volume of 20 μ L, using the First-Strand cDNA Synthesis Kit for RT-PCR (Quantitect Reverse Transcription Kit (Sigma-Aldrich)), according to the manufacturer's instructions. .. The qPCR was performed in duplicate on a CFX 384 (Bio-Rad, Marnes-la-Coquette, France) using SYBR® Premix Ex Taq™ bulk (Takara, Ozyme).

    Plasmid Preparation:

    Article Title: Novofumigatonin biosynthesis involves a non-heme iron-dependent endoperoxide isomerase for orthoester formation
    Article Snippet: .. To express nvfI , nvfE , and nvfF in E. coli , complementary DNA (cDNA) for each gene was introduced into the pET-28a(+) vector (Novagen), using an In-Fusion® HD Cloning Kit (Supplementary Data ). .. To obtain an intron-free nvfI gene, total RNA was extracted from an A. oryzae transformant expressing nvfI using ISOGEN (Nippon Gene Co., Ltd.), and cDNA was synthesized with SuperScript™ III Reverse Transcriptase (Invitrogen) from the extracted RNA.

    Article Title: BIGH3 Promotes Osteolytic Lesions in Renal Cell Carcinoma Bone Metastasis by Inhibiting Osteoblast Differentiation
    Article Snippet: .. HEK293 cells were transfected with pcDNA3.1 vector containing complementary DNA (cDNA) encoding BIGH3 with a 7-histidine tag using polyethylenimine (Sigma Aldrich). .. The cell culture medium was collected 48 hours after transfection and concentrated using Amicon Ultra Centrifuge Filter device, and the BIGH3 protein was purified using Ni-NTA agarose (Qiagen) as described previously .

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Millipore j12 cdna
    Schematic presentation of pCAGJ12bsr. The expression vector pCAGJ12bsr contains the human CMV immediate-early (CMV-IE) enhancer, the chicken β-actin promoter (P β ) and intron derived from pCAGGS, the simian virus 40 (SV40) polyadenylation site (polyA) and t intron, and the BS resistance (bsr) gene derived from pEFBOSbsr. A JEV <t>cDNA</t> fragment, <t>J12,</t> encoding the viral signal peptide, prM, and E genes was inserted between the β-actin intron and the SV40 poly(A) site. A part of the JEV genome is represented schematically at the top of the figure with amino acid numbers, where 1 is the C protein initiation codon.
    J12 Cdna, supplied by Millipore, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/j12 cdna/product/Millipore
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    j12 cdna - by Bioz Stars, 2020-05
    85/100 stars
      Buy from Supplier

    85
    Millipore vp2 cdna
    Generation of <t>VP2,</t> VP2 121-130 and 3D transgenic mice and tolerance determination. Expression constructs were designed using the human ubiquitin c promoter A. Constructs containing <t>cDNA</t> for the capsid protein VP2, immunodominant CD8 antigen VP2 121-130 , and the 3D polymerase from TMEV were generated. 3′ flanking sequences for 6XHisTag and bovine growth hormone polyA were included. PCR primers for screening are marked. The following primer sequences were used to identify VP2 [VP2-F1(5′tggtcgactctg tggttacg) and VP2-R1(5′gccggtcttgcaaagatagt)], VP2 121-130 [VP2 121 -F1(5′gccggctctcttcttgttt) and VP2 121 -R1(5′caagtggtgtccatggtgaa)] 3D [3D-F1(5′cgtagacatttccacaggatt) and 3D-R1(5′aa gacgttgtctttaccaa)] and any of the 3 [6XHis-F1(5′accggtcatcatcacc) and Bgh-R1(caccttc cagggtcaa)]. Restriction sites are identified as follows: B-BglII, P-PvuII and N-NspI. B. Relative transgene-specific expression in the brain of FVB VP2, FVB VP2 121-130 and FVB 3D. Primers specific for the VP2, VP2 121-130 and 3D transgenes were used to determine levels of mRNA transcript. C. Relative expression of transgenes in brain, thymus and mouse embryonic fibroblasts using primers specific for shared sequence motifs found in all transgenes. Primers used were 6XHis-F1 and Bgh-R1. Immune recognition of the self transgene was determined in FVB D b VP2 transgenic mice using lymphocyte proliferation and western blot. D. Splenocytes from FVB D b VP2+ mice failed to proliferate in response to VP2 antigen compared with FVB D b VP2- mice (*significant by t -test P
    Vp2 Cdna, supplied by Millipore, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vp2 cdna/product/Millipore
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    vp2 cdna - by Bioz Stars, 2020-05
    85/100 stars
      Buy from Supplier

    88
    Millipore nup153 cdna
    Phage display cloning to identify R -(-)-β- O -methylsynephrine binding proteins expressed by human <t>cDNA</t> libraries. (A) Chemical structures of R -(-)-β- O -methylsynephrine (OMe-Syn) and its biotinylated analog are shown. (B) Domain structure of nucleoporin 153 kDa <t>(NUP153)</t> and the phage coding region within the NUP153 RNA-binding domain (RBD) are shown. (C) The binding of NUP153-encoding phages to biotinylated OMe-Syn (biotinyl-OMe-Syn) is shown. Other candidates, including calmodulin-encoding phages (CaM) or mesencephalic astrocyte-derived neurotrophic factor precursor-encoding phages (ARMET) do not show significant binding to biotinyl-OMe-Syn. Data represent mean ± standard error from four independent experiments; ** p
    Nup153 Cdna, supplied by Millipore, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nup153 cdna/product/Millipore
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    nup153 cdna - by Bioz Stars, 2020-05
    88/100 stars
      Buy from Supplier

    88
    Millipore full length wild type cdna
    Effects of dominant negative mutant <t>RhoA</t> ( DNMRhoA ) and RhoA inhibitor on RhoA interaction with TRPC1 and Ca 2+ influx in stable IEC-TRPC1 cells. IEC-TRPC1 cells were infected with the recombinant adenoviral vector encoding human DNMRhoA <t>cDNA</t> (Ad DNMRhoA
    Full Length Wild Type Cdna, supplied by Millipore, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/full length wild type cdna/product/Millipore
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    full length wild type cdna - by Bioz Stars, 2020-05
    88/100 stars
      Buy from Supplier

    Image Search Results


    Schematic presentation of pCAGJ12bsr. The expression vector pCAGJ12bsr contains the human CMV immediate-early (CMV-IE) enhancer, the chicken β-actin promoter (P β ) and intron derived from pCAGGS, the simian virus 40 (SV40) polyadenylation site (polyA) and t intron, and the BS resistance (bsr) gene derived from pEFBOSbsr. A JEV cDNA fragment, J12, encoding the viral signal peptide, prM, and E genes was inserted between the β-actin intron and the SV40 poly(A) site. A part of the JEV genome is represented schematically at the top of the figure with amino acid numbers, where 1 is the C protein initiation codon.

    Journal: Journal of Virology

    Article Title: Stable High-Producer Cell Clone Expressing Virus-Like Particles of the Japanese Encephalitis Virus E Protein for a Second-Generation Subunit Vaccine

    doi: 10.1128/JVI.77.16.8745-8755.2003

    Figure Lengend Snippet: Schematic presentation of pCAGJ12bsr. The expression vector pCAGJ12bsr contains the human CMV immediate-early (CMV-IE) enhancer, the chicken β-actin promoter (P β ) and intron derived from pCAGGS, the simian virus 40 (SV40) polyadenylation site (polyA) and t intron, and the BS resistance (bsr) gene derived from pEFBOSbsr. A JEV cDNA fragment, J12, encoding the viral signal peptide, prM, and E genes was inserted between the β-actin intron and the SV40 poly(A) site. A part of the JEV genome is represented schematically at the top of the figure with amino acid numbers, where 1 is the C protein initiation codon.

    Article Snippet: The fragment containing the CMV enhancer, the β-actin promoter and intron, and J12 cDNA was recovered from the pCAGJ12 plasmid and replaced with the regulatory region of a pEFBOSbsr plasmid (a kind gift from M. Tatsumi) to confer resistance to blasticidin S (BS) (Calbiochem, Inc., Darmstadt, Germany).

    Techniques: Expressing, Plasmid Preparation, Derivative Assay

    Generation of VP2, VP2 121-130 and 3D transgenic mice and tolerance determination. Expression constructs were designed using the human ubiquitin c promoter A. Constructs containing cDNA for the capsid protein VP2, immunodominant CD8 antigen VP2 121-130 , and the 3D polymerase from TMEV were generated. 3′ flanking sequences for 6XHisTag and bovine growth hormone polyA were included. PCR primers for screening are marked. The following primer sequences were used to identify VP2 [VP2-F1(5′tggtcgactctg tggttacg) and VP2-R1(5′gccggtcttgcaaagatagt)], VP2 121-130 [VP2 121 -F1(5′gccggctctcttcttgttt) and VP2 121 -R1(5′caagtggtgtccatggtgaa)] 3D [3D-F1(5′cgtagacatttccacaggatt) and 3D-R1(5′aa gacgttgtctttaccaa)] and any of the 3 [6XHis-F1(5′accggtcatcatcacc) and Bgh-R1(caccttc cagggtcaa)]. Restriction sites are identified as follows: B-BglII, P-PvuII and N-NspI. B. Relative transgene-specific expression in the brain of FVB VP2, FVB VP2 121-130 and FVB 3D. Primers specific for the VP2, VP2 121-130 and 3D transgenes were used to determine levels of mRNA transcript. C. Relative expression of transgenes in brain, thymus and mouse embryonic fibroblasts using primers specific for shared sequence motifs found in all transgenes. Primers used were 6XHis-F1 and Bgh-R1. Immune recognition of the self transgene was determined in FVB D b VP2 transgenic mice using lymphocyte proliferation and western blot. D. Splenocytes from FVB D b VP2+ mice failed to proliferate in response to VP2 antigen compared with FVB D b VP2- mice (*significant by t -test P

    Journal: Brain Pathology (Zurich, Switzerland)

    Article Title: Genetic Deletion of a Single Immunodominant T-cell Response Confers Susceptibility to Virus-induced Demyelination

    doi: 10.1111/j.1750-3639.2007.00062.x

    Figure Lengend Snippet: Generation of VP2, VP2 121-130 and 3D transgenic mice and tolerance determination. Expression constructs were designed using the human ubiquitin c promoter A. Constructs containing cDNA for the capsid protein VP2, immunodominant CD8 antigen VP2 121-130 , and the 3D polymerase from TMEV were generated. 3′ flanking sequences for 6XHisTag and bovine growth hormone polyA were included. PCR primers for screening are marked. The following primer sequences were used to identify VP2 [VP2-F1(5′tggtcgactctg tggttacg) and VP2-R1(5′gccggtcttgcaaagatagt)], VP2 121-130 [VP2 121 -F1(5′gccggctctcttcttgttt) and VP2 121 -R1(5′caagtggtgtccatggtgaa)] 3D [3D-F1(5′cgtagacatttccacaggatt) and 3D-R1(5′aa gacgttgtctttaccaa)] and any of the 3 [6XHis-F1(5′accggtcatcatcacc) and Bgh-R1(caccttc cagggtcaa)]. Restriction sites are identified as follows: B-BglII, P-PvuII and N-NspI. B. Relative transgene-specific expression in the brain of FVB VP2, FVB VP2 121-130 and FVB 3D. Primers specific for the VP2, VP2 121-130 and 3D transgenes were used to determine levels of mRNA transcript. C. Relative expression of transgenes in brain, thymus and mouse embryonic fibroblasts using primers specific for shared sequence motifs found in all transgenes. Primers used were 6XHis-F1 and Bgh-R1. Immune recognition of the self transgene was determined in FVB D b VP2 transgenic mice using lymphocyte proliferation and western blot. D. Splenocytes from FVB D b VP2+ mice failed to proliferate in response to VP2 antigen compared with FVB D b VP2- mice (*significant by t -test P

    Article Snippet: Briefly, VP2 cDNA was cloned into the pET30 vector (EMD Biosciences, Inc., San Diego, CA, USA).

    Techniques: Transgenic Assay, Mouse Assay, Expressing, Construct, Generated, Polymerase Chain Reaction, Sequencing, Western Blot

    Phage display cloning to identify R -(-)-β- O -methylsynephrine binding proteins expressed by human cDNA libraries. (A) Chemical structures of R -(-)-β- O -methylsynephrine (OMe-Syn) and its biotinylated analog are shown. (B) Domain structure of nucleoporin 153 kDa (NUP153) and the phage coding region within the NUP153 RNA-binding domain (RBD) are shown. (C) The binding of NUP153-encoding phages to biotinylated OMe-Syn (biotinyl-OMe-Syn) is shown. Other candidates, including calmodulin-encoding phages (CaM) or mesencephalic astrocyte-derived neurotrophic factor precursor-encoding phages (ARMET) do not show significant binding to biotinyl-OMe-Syn. Data represent mean ± standard error from four independent experiments; ** p

    Journal: International Journal of Biological Sciences

    Article Title: The Small Molecule R-(-)-β-O-Methylsynephrine Binds to Nucleoporin 153 kDa and Inhibits Angiogenesis

    doi: 10.7150/ijbs.10603

    Figure Lengend Snippet: Phage display cloning to identify R -(-)-β- O -methylsynephrine binding proteins expressed by human cDNA libraries. (A) Chemical structures of R -(-)-β- O -methylsynephrine (OMe-Syn) and its biotinylated analog are shown. (B) Domain structure of nucleoporin 153 kDa (NUP153) and the phage coding region within the NUP153 RNA-binding domain (RBD) are shown. (C) The binding of NUP153-encoding phages to biotinylated OMe-Syn (biotinyl-OMe-Syn) is shown. Other candidates, including calmodulin-encoding phages (CaM) or mesencephalic astrocyte-derived neurotrophic factor precursor-encoding phages (ARMET) do not show significant binding to biotinyl-OMe-Syn. Data represent mean ± standard error from four independent experiments; ** p

    Article Snippet: Cloning and purification of the RNA-binding domain of NUP153 A PCR-amplified N-terminal (amino acids [aa] 235-326) fragment of NUP153 cDNA (NM_005124) was cloned into the Eco RI/Sal I site of the pET-28a expression vector (Millipore).

    Techniques: Clone Assay, Binding Assay, RNA Binding Assay, Chick Chorioallantoic Membrane Assay, Derivative Assay

    Effects of dominant negative mutant RhoA ( DNMRhoA ) and RhoA inhibitor on RhoA interaction with TRPC1 and Ca 2+ influx in stable IEC-TRPC1 cells. IEC-TRPC1 cells were infected with the recombinant adenoviral vector encoding human DNMRhoA cDNA (Ad DNMRhoA

    Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

    Article Title: RhoA enhances store-operated Ca2+ entry and intestinal epithelial restitution by interacting with TRPC1 after wounding

    doi: 10.1152/ajpgi.00185.2015

    Figure Lengend Snippet: Effects of dominant negative mutant RhoA ( DNMRhoA ) and RhoA inhibitor on RhoA interaction with TRPC1 and Ca 2+ influx in stable IEC-TRPC1 cells. IEC-TRPC1 cells were infected with the recombinant adenoviral vector encoding human DNMRhoA cDNA (Ad DNMRhoA

    Article Snippet: The transfection grade eukaryotic expression vector pUSEamp(+), containing the full-length wild type cDNA of human RhoA gene, was purchased from Millipore.

    Techniques: Dominant Negative Mutation, Infection, Recombinant, Plasmid Preparation

    Effects of ectopic overexpression of wild-type (WT)-RhoA on RhoA/TRPC1 association and Ca 2+ influx. The complete open reading frame of WT-RhoA cDNA was subcloned into the expression vector pcDNA3.1(+) under control of cytomegalovirus immediate-early promoter

    Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

    Article Title: RhoA enhances store-operated Ca2+ entry and intestinal epithelial restitution by interacting with TRPC1 after wounding

    doi: 10.1152/ajpgi.00185.2015

    Figure Lengend Snippet: Effects of ectopic overexpression of wild-type (WT)-RhoA on RhoA/TRPC1 association and Ca 2+ influx. The complete open reading frame of WT-RhoA cDNA was subcloned into the expression vector pcDNA3.1(+) under control of cytomegalovirus immediate-early promoter

    Article Snippet: The transfection grade eukaryotic expression vector pUSEamp(+), containing the full-length wild type cDNA of human RhoA gene, was purchased from Millipore.

    Techniques: Over Expression, Expressing, Plasmid Preparation