complementary dna cdna template  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Thermo Fisher complementary dna cdna template
    Complementary Dna Cdna Template, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/complementary dna cdna template/product/Thermo Fisher
    Average 92 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    complementary dna cdna template - by Bioz Stars, 2020-08
    92/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Skeletal Muscle Loss is Associated with TNF Mediated Insufficient Skeletal Myogenic Activation After Burn
    Article Snippet: .. One microgram (1 μg) of RNA sample was utilized for the first reverse transcription step to make complementary DNA (cDNA) template using High-capacity cDNA Reverse Transcription kits (Applied Biosystems, Foster city, CA). cDNA template was stored at -20°C for the real time PCR procedure. .. Real time quantitative PCR (qPCR) with SYBR® Green master mixes (Thermo Scientific Inc. Rockford, IL) was performed on IQ5 Multicolor real-time PCR system (Bio-Rad Laboratories, Herculus, CA).

    Article Title: Hydrogen peroxide functions as a secondary messenger for brassinosteroids-induced CO2 assimilation and carbohydrate metabolism in Cucumis sativus
    Article Snippet: .. The complementary DNA (cDNA) template for real time polymerase chain reaction (RT-PCR) was synthesized using a RevertAid™ first strand cDNA synthesis kit (Fermentas, Burlington, Canada) from 2 μg total RNA purified using RNeasy mini kit (Qiagen, Hilden, Germany). .. For quantitative RT-PCR (qRT-PCR) analysis, PCR products were amplified in triplicate using iQ SYBR Green SuperMix (Bio-Rad, Hercules, CA, USA) in 25 μl qRT-PCR reactions, an iCycler iQ 96-well RT-PCR detection system (Bio-Rad), iCycler software to calculate threshold cycle values and cucumber actin as an internal control.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Hydrogen peroxide functions as a secondary messenger for brassinosteroids-induced CO2 assimilation and carbohydrate metabolism in Cucumis sativus
    Article Snippet: .. The complementary DNA (cDNA) template for real time polymerase chain reaction (RT-PCR) was synthesized using a RevertAid™ first strand cDNA synthesis kit (Fermentas, Burlington, Canada) from 2 μg total RNA purified using RNeasy mini kit (Qiagen, Hilden, Germany). .. For quantitative RT-PCR (qRT-PCR) analysis, PCR products were amplified in triplicate using iQ SYBR Green SuperMix (Bio-Rad, Hercules, CA, USA) in 25 μl qRT-PCR reactions, an iCycler iQ 96-well RT-PCR detection system (Bio-Rad), iCycler software to calculate threshold cycle values and cucumber actin as an internal control.

    Amplification:

    Article Title: Tumor suppressor KIF1Bβ regulates mitochondrial apoptosis in collaboration with YME1L1, et al. Tumor suppressor KIF1Bβ regulates mitochondrial apoptosis in collaboration with YME1L1
    Article Snippet: .. Full‐length human YME1L1 was amplified using a complementary DNA (cDNA) template purchased from Invitrogen (No. 2961446; Carlsbad, CA). .. The YME1L1 fragment was cloned into the Kpn I and Nhe I restriction sites of pcDNA3.1/Myc‐His B (Invitrogen) using the following primers: (sense) 5′‐CTAGCTAGCTAGGCCATGTTTTCCTTGTCGAGC; (antisense) 5′‐GGGGTACCCTCACTTCCAACTTTTTC.

    Synthesized:

    Article Title: Hydrogen peroxide functions as a secondary messenger for brassinosteroids-induced CO2 assimilation and carbohydrate metabolism in Cucumis sativus
    Article Snippet: .. The complementary DNA (cDNA) template for real time polymerase chain reaction (RT-PCR) was synthesized using a RevertAid™ first strand cDNA synthesis kit (Fermentas, Burlington, Canada) from 2 μg total RNA purified using RNeasy mini kit (Qiagen, Hilden, Germany). .. For quantitative RT-PCR (qRT-PCR) analysis, PCR products were amplified in triplicate using iQ SYBR Green SuperMix (Bio-Rad, Hercules, CA, USA) in 25 μl qRT-PCR reactions, an iCycler iQ 96-well RT-PCR detection system (Bio-Rad), iCycler software to calculate threshold cycle values and cucumber actin as an internal control.

    Article Title: Autologous blood transfusion augments impaired wound healing in diabetic mice by enhancing lncRNA H19 expression via the HIF-1α signaling pathway
    Article Snippet: .. The complementary DNA (cDNA) template was synthesized according to the instructions of High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, USA). .. The RT-qPCR experiment was conducted using Power SYBR® Green Master mix (Applied Biosystems, Foster City, USA) and StepOne™ Real-Time PCR System (Applied Biosystems, Foster City, USA).

    Purification:

    Article Title: Hydrogen peroxide functions as a secondary messenger for brassinosteroids-induced CO2 assimilation and carbohydrate metabolism in Cucumis sativus
    Article Snippet: .. The complementary DNA (cDNA) template for real time polymerase chain reaction (RT-PCR) was synthesized using a RevertAid™ first strand cDNA synthesis kit (Fermentas, Burlington, Canada) from 2 μg total RNA purified using RNeasy mini kit (Qiagen, Hilden, Germany). .. For quantitative RT-PCR (qRT-PCR) analysis, PCR products were amplified in triplicate using iQ SYBR Green SuperMix (Bio-Rad, Hercules, CA, USA) in 25 μl qRT-PCR reactions, an iCycler iQ 96-well RT-PCR detection system (Bio-Rad), iCycler software to calculate threshold cycle values and cucumber actin as an internal control.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Thermo Fisher template cdna
    Genome wide transcriptional analysis of differentiating mMEECs A. PCA analysis was used to show the relatedness of the different samples used in the study. B. The heatmap shows differentially expressed genes identified by Limma. Genes used in the analysis were > 2 fold differentially expressed. C , D. Gene ontogeny analysis of the most highly differentially expressed genes are displayd for day 0 vs original cells ( C) and Day 7 vs day 0 ( D ). E. End-point <t>RT-PCR</t> showing expression of Oaz1, Cdhr3, Spata18 and Dynlrb2 in <t>cDNA</t> from mMEC original cells isolated from the middle ear cavity, ALI day 0, 3 and 7 cells. Negative control samples contained no cDNA. F . Microarray derived data of relative expression of candidate OM associated genes in day 0 and day 7 cells. * P > 0.05; ** P > 0.01 using log transformed data. Human and mouse candidate genes are identified.
    Template Cdna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1316 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/template cdna/product/Thermo Fisher
    Average 94 stars, based on 1316 article reviews
    Price from $9.99 to $1999.99
    template cdna - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    94
    Thermo Fisher template sod wt yfp cdna
    Quantification of SOD1: <t>YFP</t> aggregation at 24 and 48 hours post-transfection. CHO cells were transiently transfected with expression vectors for the various SOD1: YFP constructs and images of the cells were captured at 24 and 48 hours (see S3 and S4 Figs). The effects of substitutions at Trp 32 on <t>SOD</t> aggregation were compared to constructs expressing either G85R or G93A-SOD1: YFP. The data for transfection with WT-, G85R-, and G93A-SOD1: YFP are averages from 6 independent experiments. All other data are from three independent transfections. For all experiments, random images were captured and examined by an observer blind to genotype. The number of total cells counted for each construct across the replications averaged between 60 and 213 cells per construct per experiment. A two-tailed type-2 t-test was used to determine whether the percentage of cells developing inclusions differed between cells expressing individual constructs in a pairwise fashion. *p
    Template Sod Wt Yfp Cdna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/template sod wt yfp cdna/product/Thermo Fisher
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    template sod wt yfp cdna - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    Image Search Results


    Genome wide transcriptional analysis of differentiating mMEECs A. PCA analysis was used to show the relatedness of the different samples used in the study. B. The heatmap shows differentially expressed genes identified by Limma. Genes used in the analysis were > 2 fold differentially expressed. C , D. Gene ontogeny analysis of the most highly differentially expressed genes are displayd for day 0 vs original cells ( C) and Day 7 vs day 0 ( D ). E. End-point RT-PCR showing expression of Oaz1, Cdhr3, Spata18 and Dynlrb2 in cDNA from mMEC original cells isolated from the middle ear cavity, ALI day 0, 3 and 7 cells. Negative control samples contained no cDNA. F . Microarray derived data of relative expression of candidate OM associated genes in day 0 and day 7 cells. * P > 0.05; ** P > 0.01 using log transformed data. Human and mouse candidate genes are identified.

    Journal: bioRxiv

    Article Title: The transcriptional landscape of the murine middle ear epithelium in vitro

    doi: 10.1101/800987

    Figure Lengend Snippet: Genome wide transcriptional analysis of differentiating mMEECs A. PCA analysis was used to show the relatedness of the different samples used in the study. B. The heatmap shows differentially expressed genes identified by Limma. Genes used in the analysis were > 2 fold differentially expressed. C , D. Gene ontogeny analysis of the most highly differentially expressed genes are displayd for day 0 vs original cells ( C) and Day 7 vs day 0 ( D ). E. End-point RT-PCR showing expression of Oaz1, Cdhr3, Spata18 and Dynlrb2 in cDNA from mMEC original cells isolated from the middle ear cavity, ALI day 0, 3 and 7 cells. Negative control samples contained no cDNA. F . Microarray derived data of relative expression of candidate OM associated genes in day 0 and day 7 cells. * P > 0.05; ** P > 0.01 using log transformed data. Human and mouse candidate genes are identified.

    Article Snippet: RT-PCR was performed with 1µl of template cDNA and Maxima Hot Start Green PCR Master Mix (ThermoFisher Scientific, Cat No-K1061).

    Techniques: Genome Wide, Reverse Transcription Polymerase Chain Reaction, Expressing, Isolation, Negative Control, Microarray, Derivative Assay, Transformation Assay

    Effect of Co 2+ and TLR4 activation on ICAM1 expression A. HMEC-1 and B. MonoMac 6 cells were stimulated with 1μg/ml CLI-095 for 6h prior to 24h stimulation with 0.75mM Co 2+ or 100ng/ml LPS. RNA was isolated and cDNA synthesised by reverse transcription. ICAM1 expression was quantified by qRT-PCR. Data is representative of three independent experiments.

    Journal: Oncotarget

    Article Title: Effect of cobalt-mediated Toll-like receptor 4 activation on inflammatory responses in endothelial cells

    doi: 10.18632/oncotarget.13260

    Figure Lengend Snippet: Effect of Co 2+ and TLR4 activation on ICAM1 expression A. HMEC-1 and B. MonoMac 6 cells were stimulated with 1μg/ml CLI-095 for 6h prior to 24h stimulation with 0.75mM Co 2+ or 100ng/ml LPS. RNA was isolated and cDNA synthesised by reverse transcription. ICAM1 expression was quantified by qRT-PCR. Data is representative of three independent experiments.

    Article Snippet: Each qRT-PCR reaction contained 5μl TaqMan Gene Expression Mastermix (ThermoFisher Scientific), 2μl diluted cDNA template, 2.5μl nuclease-free H2 O and 0.5μl TaqMan Gene Expression Assay (ThermoFisher Scientific).

    Techniques: Activation Assay, Expressing, Isolation, Quantitative RT-PCR

    Agarose gel electrophoresis of HTNV cDNA and cRNA. ( A ) cDNA with a length of 516 bp was synthesized by reverse-transcription and subsequently amplified by PCR. Marker: 50 bp DNA ladder. ( B ) HTNV cRNA with a length of 499 bp was synthesized using the cDNA as template by in vitro transcription. Marker: DNA ladder DL2000.

    Journal: PLoS ONE

    Article Title: Quantification of Hantaan Virus with a SYBR Green I-Based One-Step qRT-PCR Assay

    doi: 10.1371/journal.pone.0081525

    Figure Lengend Snippet: Agarose gel electrophoresis of HTNV cDNA and cRNA. ( A ) cDNA with a length of 516 bp was synthesized by reverse-transcription and subsequently amplified by PCR. Marker: 50 bp DNA ladder. ( B ) HTNV cRNA with a length of 499 bp was synthesized using the cDNA as template by in vitro transcription. Marker: DNA ladder DL2000.

    Article Snippet: Amplification of cDNA template by conventional RT-PCR The eluted HTNV RNA was reverse transcribed into cDNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA).

    Techniques: Agarose Gel Electrophoresis, Synthesized, Amplification, Polymerase Chain Reaction, Marker, In Vitro

    Quantification of SOD1: YFP aggregation at 24 and 48 hours post-transfection. CHO cells were transiently transfected with expression vectors for the various SOD1: YFP constructs and images of the cells were captured at 24 and 48 hours (see S3 and S4 Figs). The effects of substitutions at Trp 32 on SOD aggregation were compared to constructs expressing either G85R or G93A-SOD1: YFP. The data for transfection with WT-, G85R-, and G93A-SOD1: YFP are averages from 6 independent experiments. All other data are from three independent transfections. For all experiments, random images were captured and examined by an observer blind to genotype. The number of total cells counted for each construct across the replications averaged between 60 and 213 cells per construct per experiment. A two-tailed type-2 t-test was used to determine whether the percentage of cells developing inclusions differed between cells expressing individual constructs in a pairwise fashion. *p

    Journal: PLoS ONE

    Article Title: Tryptophan residue 32 in human Cu-Zn superoxide dismutase modulates prion-like propagation and strain selection

    doi: 10.1371/journal.pone.0227655

    Figure Lengend Snippet: Quantification of SOD1: YFP aggregation at 24 and 48 hours post-transfection. CHO cells were transiently transfected with expression vectors for the various SOD1: YFP constructs and images of the cells were captured at 24 and 48 hours (see S3 and S4 Figs). The effects of substitutions at Trp 32 on SOD aggregation were compared to constructs expressing either G85R or G93A-SOD1: YFP. The data for transfection with WT-, G85R-, and G93A-SOD1: YFP are averages from 6 independent experiments. All other data are from three independent transfections. For all experiments, random images were captured and examined by an observer blind to genotype. The number of total cells counted for each construct across the replications averaged between 60 and 213 cells per construct per experiment. A two-tailed type-2 t-test was used to determine whether the percentage of cells developing inclusions differed between cells expressing individual constructs in a pairwise fashion. *p

    Article Snippet: Cell transfections with YFP-tagged SOD1 Mutant SOD1-YFP fusion plasmids were constructed by inducing point mutations on template SOD-WT-YFP cDNA with the Quick-Change mutagenesis kit (Cat. No. 200523, Thermo/Fisher, Waltham, MA, purchased 2014).

    Techniques: Transfection, Expressing, Construct, Two Tailed Test