Structured Review

TaKaRa complementary dna cdna synthesis
Complementary Dna Cdna Synthesis, supplied by TaKaRa, used in various techniques. Bioz Stars score: 92/100, based on 47 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/complementary dna cdna synthesis/product/TaKaRa
Average 92 stars, based on 47 article reviews
Price from $9.99 to $1999.99
complementary dna cdna synthesis - by Bioz Stars, 2020-09
92/100 stars

Images

Related Articles

Synthesized:

Article Title: Acyclic Triterpenoid Isolated from Alpinia katsumadai Alleviates Formalin-Induced Chronic Mouse Paw Inflammation by Inhibiting the Phosphorylation of ERK and NF-κB
Article Snippet: .. The RNA concentration was measured by a microspectrophotometer (Allsheng, Hangzhou, Zhejiang, China), and complementary DNA (cDNA) synthesis was performed. cDNA was synthesized using a PrimeScript 1st strand cDNA synthesis kit (Takara Bio Inc., Shiga, Japan) from 1 μg/mL total RNA. .. Real-time PCR was performed by a StepOnePlus Real-Time PCR System using TaqMan probes and TaqMan Real-Time PCR master mix (Applied Biosystems, Foster City, CA, USA).

Quantitative RT-PCR:

Article Title: Genome-wide identification of the amino acid permease genes and molecular characterization of their transcriptional responses to various nutrient stresses in allotetraploid rapeseed
Article Snippet: .. Quantitative reverse-transcription PCR assays The quantitative reverse-transcription polymerase chain reaction (qRT-PCR) assays were used to determine the relative expression of BnaAAP s. After removing genomic DNA from the RNA samples with RNase-free DNase I, complementary DNA (cDNA) synthesis was performed using the PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa, Shiga, Japan) with total RNA as the templates. .. We performed the quantitative analysis of relative gene expression by using the SYBR® Premix Ex Taq ™ II (Tli RNaseH Plus) (TaKaRa, Shiga, Japan) kit in an Applied Biosystems StepOne™ Plus Real-time PCR System (Thermo Fisher Scientific, Waltham, MA, USA).

Article Title: Attenuation of Inflammation and Leptin Resistance by Pyrogallol-Phloroglucinol-6,6-Bieckol on in the Brain of Obese Animal Models
Article Snippet: .. Total RNA (1 μg) was used for complementary DNA (cDNA) synthesis using the PrimeScript 1st Strand cDNA Synthesis Kit (cat. 6110A; Takara, Otsu, Japan). qRT-PCR was performed in a C1000 Touch thermal cycler (Bio-Rad, Hercules, CA, USA). ..

Real-time Polymerase Chain Reaction:

Article Title: The m6A Methylation-Regulated AFF4 Promotes Self-Renewal of Bladder Cancer Stem Cells
Article Snippet: .. Complementary DNA (cDNA) synthesis was performed with the PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, RR047A) using 1 μg RNA per sample. qPCR reactions were performed using TB Green® Premix Ex Taq™ (Takara RR820A) to determine mRNA transcript levels. .. Primers for qRT-PCR are listed in Supplementary Table , siRNAs are used to knockdown METTL3, and AFF4 expression is listed in Supplementary Table .

Concentration Assay:

Article Title: Acyclic Triterpenoid Isolated from Alpinia katsumadai Alleviates Formalin-Induced Chronic Mouse Paw Inflammation by Inhibiting the Phosphorylation of ERK and NF-κB
Article Snippet: .. The RNA concentration was measured by a microspectrophotometer (Allsheng, Hangzhou, Zhejiang, China), and complementary DNA (cDNA) synthesis was performed. cDNA was synthesized using a PrimeScript 1st strand cDNA synthesis kit (Takara Bio Inc., Shiga, Japan) from 1 μg/mL total RNA. .. Real-time PCR was performed by a StepOnePlus Real-Time PCR System using TaqMan probes and TaqMan Real-Time PCR master mix (Applied Biosystems, Foster City, CA, USA).

Polymerase Chain Reaction:

Article Title: Genome-wide identification of the amino acid permease genes and molecular characterization of their transcriptional responses to various nutrient stresses in allotetraploid rapeseed
Article Snippet: .. Quantitative reverse-transcription PCR assays The quantitative reverse-transcription polymerase chain reaction (qRT-PCR) assays were used to determine the relative expression of BnaAAP s. After removing genomic DNA from the RNA samples with RNase-free DNase I, complementary DNA (cDNA) synthesis was performed using the PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa, Shiga, Japan) with total RNA as the templates. .. We performed the quantitative analysis of relative gene expression by using the SYBR® Premix Ex Taq ™ II (Tli RNaseH Plus) (TaKaRa, Shiga, Japan) kit in an Applied Biosystems StepOne™ Plus Real-time PCR System (Thermo Fisher Scientific, Waltham, MA, USA).

Expressing:

Article Title: Genome-wide identification of the amino acid permease genes and molecular characterization of their transcriptional responses to various nutrient stresses in allotetraploid rapeseed
Article Snippet: .. Quantitative reverse-transcription PCR assays The quantitative reverse-transcription polymerase chain reaction (qRT-PCR) assays were used to determine the relative expression of BnaAAP s. After removing genomic DNA from the RNA samples with RNase-free DNase I, complementary DNA (cDNA) synthesis was performed using the PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa, Shiga, Japan) with total RNA as the templates. .. We performed the quantitative analysis of relative gene expression by using the SYBR® Premix Ex Taq ™ II (Tli RNaseH Plus) (TaKaRa, Shiga, Japan) kit in an Applied Biosystems StepOne™ Plus Real-time PCR System (Thermo Fisher Scientific, Waltham, MA, USA).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Genome-wide identification of the amino acid permease genes and molecular characterization of their transcriptional responses to various nutrient stresses in allotetraploid rapeseed
Article Snippet: .. Quantitative reverse-transcription PCR assays The quantitative reverse-transcription polymerase chain reaction (qRT-PCR) assays were used to determine the relative expression of BnaAAP s. After removing genomic DNA from the RNA samples with RNase-free DNase I, complementary DNA (cDNA) synthesis was performed using the PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa, Shiga, Japan) with total RNA as the templates. .. We performed the quantitative analysis of relative gene expression by using the SYBR® Premix Ex Taq ™ II (Tli RNaseH Plus) (TaKaRa, Shiga, Japan) kit in an Applied Biosystems StepOne™ Plus Real-time PCR System (Thermo Fisher Scientific, Waltham, MA, USA).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    TaKaRa zbp2 cdna
    β -actin mRNA was coprecipitated with <t>ZBP2.</t> ZBP2 antibodies were used to immunoprecipitate a CEF extract. Primers to β-actin mRNA were used in an RT-PCK assay to detect the presence of β-actin mRNA in the pellets. (Lane 1) Negative PCR control no primers. (Lane 2) Preimmune rat serum. (Lane 3) ZBP2 antiserum. (Lane 4) Purified rat normal IgG. (Lane 5) affinity-purified ZBP2 IgG. (Lane 6) Positive PCR control using full-length <t>cDNA</t> of β-actin mRNA as template. M is the DNA molecular marker. The arrow denotes the PCR amplified DNA fragment of the 3′ UTR of β-actin mRNA.
    Zbp2 Cdna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/zbp2 cdna/product/TaKaRa
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    zbp2 cdna - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    95
    TaKaRa cdna ends
    Gene structure of rSAA4 . (A) Rat SAA4 mRNAs ( BC088188 , AY325132 , AY325161 ) from GenBank® ( http://www.ncbi.nlm.nih.gov/genbank/ ) are shown; thin grey squares ( ) represent untranslated regions, broad grey squares ( ) represent translated regions; intronic sequences are shown as thin black lines. Arrowheads indicate orientation of the gene. (B) Exon/intron structure of spliced ESTs published in the UCSC Genome Browser with the most extended 5′UTR (FQ107900) and 3′UTR region (EX492688) of rSAA4 are shown. (C) Schematic representation of results obtained by <t>RACE:</t> 3′RACE product extends the 5′UTR of EX492688 with 574 bases; that confirms the 5′UTR of BC088188 ; 5′RACE product extends the 3′-region of BC088188 and confirms the 3′UTR represented by the spliced EST FQ107900. (D) The predicted PCR-product for primers spanning from the first coding exon of rSAA4 reaching to a primer located 2 exons upstream of rSAA4 within a conserved exonic region of AY325132 . PCR-amplification of the 190 bp product was unsuccessful using rat Marathon <t>cDNA</t> as template and standard PCR programs. (E) Deduced full-length rSAA4 from RACE is shown: thin black squares ( ) represent untranslated regions, broad black squares (■) represent translated regions, intronic sequences are shown as thin black lines. The location of the GA-dinucleotide repeat (GA) n within the 5′UTR of rSAA4 is indicated below. (F) Partial 5′UTR of the SAA4 gene in different mammalian species (i.e. rSAA4 , mSAA4 , and hSAA4 ): note the GA-dinucleotide tandem repeat is only present in the rat genome. The UCSC Genome Browser [29] was used.
    Cdna Ends, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1045 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna ends/product/TaKaRa
    Average 95 stars, based on 1045 article reviews
    Price from $9.99 to $1999.99
    cdna ends - by Bioz Stars, 2020-09
    95/100 stars
      Buy from Supplier

    99
    TaKaRa smart pcr cdna synthesis kit
    The results of secondary <t>PCR</t> amplification: Lane 1: Subtracted A-N <t>cDNA</t> library; Lane 2: Unsubtracted A cDNA library; Lane 3: Subtracted T-A cDNA library; Lane 4: Unsubtracted T cDNA library; Lane 5: Subtracted T-N cDNA library; Lane 6: Control; A: Subtracted A-N cDNA library; B: Subtracted A-N cDNA library; C: Subtracted A-N cDNA library.
    Smart Pcr Cdna Synthesis Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 124 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/smart pcr cdna synthesis kit/product/TaKaRa
    Average 99 stars, based on 124 article reviews
    Price from $9.99 to $1999.99
    smart pcr cdna synthesis kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    β -actin mRNA was coprecipitated with ZBP2. ZBP2 antibodies were used to immunoprecipitate a CEF extract. Primers to β-actin mRNA were used in an RT-PCK assay to detect the presence of β-actin mRNA in the pellets. (Lane 1) Negative PCR control no primers. (Lane 2) Preimmune rat serum. (Lane 3) ZBP2 antiserum. (Lane 4) Purified rat normal IgG. (Lane 5) affinity-purified ZBP2 IgG. (Lane 6) Positive PCR control using full-length cDNA of β-actin mRNA as template. M is the DNA molecular marker. The arrow denotes the PCR amplified DNA fragment of the 3′ UTR of β-actin mRNA.

    Journal: The Journal of Cell Biology

    Article Title: A predominantly nuclear protein affecting cytoplasmic localization of ?-actin mRNA in fibroblasts and neurons

    doi: 10.1083/jcb.200105133

    Figure Lengend Snippet: β -actin mRNA was coprecipitated with ZBP2. ZBP2 antibodies were used to immunoprecipitate a CEF extract. Primers to β-actin mRNA were used in an RT-PCK assay to detect the presence of β-actin mRNA in the pellets. (Lane 1) Negative PCR control no primers. (Lane 2) Preimmune rat serum. (Lane 3) ZBP2 antiserum. (Lane 4) Purified rat normal IgG. (Lane 5) affinity-purified ZBP2 IgG. (Lane 6) Positive PCR control using full-length cDNA of β-actin mRNA as template. M is the DNA molecular marker. The arrow denotes the PCR amplified DNA fragment of the 3′ UTR of β-actin mRNA.

    Article Snippet: Isolation and cloning of ZBP2 cDNA Two primers, zbp2–1 and zbp2–2, were designed and synthesized according to the two peptide sequences (ZBP2 amino acids 621–627 and 685–709, respectively) and human KSRP cDNA sequence (zbp2–1 GCTTGGGAGGAGTACTACAA, zbp2–2 AGGACCTGGGGTCTGTCCGTA): A 200-bp DNA fragment was amplified from a chicken embryo brain library (CLONTECH Laboratories, Inc.) and verified by sequencing.

    Techniques: Polymerase Chain Reaction, Purification, Affinity Purification, Marker, Amplification

    Gene structure of rSAA4 . (A) Rat SAA4 mRNAs ( BC088188 , AY325132 , AY325161 ) from GenBank® ( http://www.ncbi.nlm.nih.gov/genbank/ ) are shown; thin grey squares ( ) represent untranslated regions, broad grey squares ( ) represent translated regions; intronic sequences are shown as thin black lines. Arrowheads indicate orientation of the gene. (B) Exon/intron structure of spliced ESTs published in the UCSC Genome Browser with the most extended 5′UTR (FQ107900) and 3′UTR region (EX492688) of rSAA4 are shown. (C) Schematic representation of results obtained by RACE: 3′RACE product extends the 5′UTR of EX492688 with 574 bases; that confirms the 5′UTR of BC088188 ; 5′RACE product extends the 3′-region of BC088188 and confirms the 3′UTR represented by the spliced EST FQ107900. (D) The predicted PCR-product for primers spanning from the first coding exon of rSAA4 reaching to a primer located 2 exons upstream of rSAA4 within a conserved exonic region of AY325132 . PCR-amplification of the 190 bp product was unsuccessful using rat Marathon cDNA as template and standard PCR programs. (E) Deduced full-length rSAA4 from RACE is shown: thin black squares ( ) represent untranslated regions, broad black squares (■) represent translated regions, intronic sequences are shown as thin black lines. The location of the GA-dinucleotide repeat (GA) n within the 5′UTR of rSAA4 is indicated below. (F) Partial 5′UTR of the SAA4 gene in different mammalian species (i.e. rSAA4 , mSAA4 , and hSAA4 ): note the GA-dinucleotide tandem repeat is only present in the rat genome. The UCSC Genome Browser [29] was used.

    Journal: Biochemical and Biophysical Research Communications

    Article Title: Characterization of rat serum amyloid A4 (SAA4): A novel member of the SAA superfamily

    doi: 10.1016/j.bbrc.2014.07.054

    Figure Lengend Snippet: Gene structure of rSAA4 . (A) Rat SAA4 mRNAs ( BC088188 , AY325132 , AY325161 ) from GenBank® ( http://www.ncbi.nlm.nih.gov/genbank/ ) are shown; thin grey squares ( ) represent untranslated regions, broad grey squares ( ) represent translated regions; intronic sequences are shown as thin black lines. Arrowheads indicate orientation of the gene. (B) Exon/intron structure of spliced ESTs published in the UCSC Genome Browser with the most extended 5′UTR (FQ107900) and 3′UTR region (EX492688) of rSAA4 are shown. (C) Schematic representation of results obtained by RACE: 3′RACE product extends the 5′UTR of EX492688 with 574 bases; that confirms the 5′UTR of BC088188 ; 5′RACE product extends the 3′-region of BC088188 and confirms the 3′UTR represented by the spliced EST FQ107900. (D) The predicted PCR-product for primers spanning from the first coding exon of rSAA4 reaching to a primer located 2 exons upstream of rSAA4 within a conserved exonic region of AY325132 . PCR-amplification of the 190 bp product was unsuccessful using rat Marathon cDNA as template and standard PCR programs. (E) Deduced full-length rSAA4 from RACE is shown: thin black squares ( ) represent untranslated regions, broad black squares (■) represent translated regions, intronic sequences are shown as thin black lines. The location of the GA-dinucleotide repeat (GA) n within the 5′UTR of rSAA4 is indicated below. (F) Partial 5′UTR of the SAA4 gene in different mammalian species (i.e. rSAA4 , mSAA4 , and hSAA4 ): note the GA-dinucleotide tandem repeat is only present in the rat genome. The UCSC Genome Browser [29] was used.

    Article Snippet: 2.1 Rapid amplification of cDNA ends (RACE) Rat brain Marathon-Ready cDNA (Clontech Laboratories, Takara Bio Company, Mountain View, CA) was used as template to amplify full-length rSAA4 cDNA ( ).

    Techniques: Polymerase Chain Reaction, Amplification

    The results of secondary PCR amplification: Lane 1: Subtracted A-N cDNA library; Lane 2: Unsubtracted A cDNA library; Lane 3: Subtracted T-A cDNA library; Lane 4: Unsubtracted T cDNA library; Lane 5: Subtracted T-N cDNA library; Lane 6: Control; A: Subtracted A-N cDNA library; B: Subtracted A-N cDNA library; C: Subtracted A-N cDNA library.

    Journal: World Journal of Gastroenterology

    Article Title: Identification of differentially expressed genes in normal mucosa, adenoma and adenocarcinoma of colon by SSH

    doi: 10.3748/wjg.v7.i5.726

    Figure Lengend Snippet: The results of secondary PCR amplification: Lane 1: Subtracted A-N cDNA library; Lane 2: Unsubtracted A cDNA library; Lane 3: Subtracted T-A cDNA library; Lane 4: Unsubtracted T cDNA library; Lane 5: Subtracted T-N cDNA library; Lane 6: Control; A: Subtracted A-N cDNA library; B: Subtracted A-N cDNA library; C: Subtracted A-N cDNA library.

    Article Snippet: High yields of full-length cDNAs were generated from 1 μg total RNA of normal mucosa, adenoma and adenocarcinoma using SMART PCR cDNA Synthesis kit (Clontech, USA).

    Techniques: Polymerase Chain Reaction, Amplification, cDNA Library Assay

    Analysis of differentially expressed cDNA with nest PCR

    Journal: Journal of Zhejiang University. Science. B

    Article Title: Construction of a hepatic stellate cells subtracted cDNA library of differentially expressed genes in normal mice and mice with Schistosomiasis japonica *

    doi: 10.1631/jzus.2005.B0280

    Figure Lengend Snippet: Analysis of differentially expressed cDNA with nest PCR

    Article Snippet: High yields of full-length cDNAs were generated from 1 μg total RNA of normal and fibrosis HSCs using SMART PCR cDNA synthesis kit (Clontech, USA). cDNAs (0.2 μg) were electrophosed on a 1.0% agarose gel, transferred onto Hybond N+ Membrane (Roch, Germany) and hybridized with DIG-labelled clone probes.

    Techniques: Polymerase Chain Reaction