complementary dna cdna synthesis kit  (Bio-Rad)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    iScript cDNA Synthesis Kit
    Description:
    100 x 20 µl reactions reverse transcription reagent kit includes 5x iScript reaction mix iScript reverse transcriptase nuclease free water education use only
    Catalog Number:
    1708891EDU
    Price:
    None
    Category:
    PCR Instrumentation
    Buy from Supplier


    Structured Review

    Bio-Rad complementary dna cdna synthesis kit
    iScript cDNA Synthesis Kit
    100 x 20 µl reactions reverse transcription reagent kit includes 5x iScript reaction mix iScript reverse transcriptase nuclease free water education use only
    https://www.bioz.com/result/complementary dna cdna synthesis kit/product/Bio-Rad
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    complementary dna cdna synthesis kit - by Bioz Stars, 2020-08
    99/100 stars

    Images

    Related Articles

    SYBR Green Assay:

    Article Title: Immunoprecipitation of Tri-methylated Capped RNA
    Article Snippet: .. RT-PCR of m3G-capped RNAs by using iScript™ cDNA Synthesis Kit and 2× SsoAdvanced™ SYBR® Green Supermix PCR according to manufacturer’s protocols: Note: Perform RT-PCR using un-processed RNA (input) and RNA extracted from supernatant to determine expression levels of RNA of interest (m3G-capped and uncapped). ..

    Article Title: Immunoprecipitation of Tri-methylated Capped RNA
    Article Snippet: .. Protein G Sepharose® 4 Fast Flow Beads (GE Healthcare, catalog number: 17061801) Normal rabbit serum (control, EMD Millipore, catalog number: NS01L-1ML) Sodium chloride (NaCl) (Fisher Scientific, catalog number: S671-3) NP-40 (Thermo Fisher Scientific, catalog number: 28324) Tris base (Fisher Scientific, catalog number: BP152-5) Hydrochloric acid (HCl) (VWR, catalog number: BDH7204-1) RNasin™ Plus RNase inhibitor (Promega, catalog number: N2611) NaOAc (AMRESCO, catalog number: 0602) Ethylenediaminetetraacetate acid (EDTA), pH 8 (Thermo Fisher Scientific, catalog number: AM9260G) Ethylenediaminetetraacetate acid (EDTA) (AMRESCO, catalog number: 0105) Sodium dodecyl sulfate (SDS) (Thermo Fisher Scientific, catalog number: AM9822) Phenol/Chloroform/Isoamyl Alcohol; 125:24:1 mixture, pH 4.5 (Thermo Fisher Scientific, catalog number: AM9720) Agarose LE (Denville Scientific, catalog number: CA3510-8) iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, catalog number: 1708891) Sso Advanced™ Universal SYBR® Green Supermix (Bio-Rad Laboratories, catalog number: 1725274) PARIS™ Kit (Thermo Fisher Scientific, catalog number: AM1921) Boric acid (Fisher Scientific, catalog number: A73-1) NET-2 Buffer (see Recipes) G-50 Buffer (see Recipes) 1× TBE (see Recipes) .. Micropipettes (Gilson, model: Pipetman® L, catalog number: F167370) Forma™ Steri-Cycle™ CO2 Incubator (Thermo Scientific, model: Forma™ Steri-Cycle™ CO2 Incubators, catalog number: 370) −80 °C freeze Sorvall™ Legend™ Micro 21R Microcentrifuge (Thermo Fisher Scientific, model: Sorvall™ Legend™ Micro 21R, catalog number: 75002490) Eppendorf™ Thermomixer™ R (Eppendorf, model: Thermomixer R, catalog number: 05-412-401) Labquake™ Tube Shaker/Rotator (Thermo Fisher Scientific, catalog number: C4152110Q) Sorvall™ ST 40R Centrifuge (Thermo Fisher Scientific, model: Sorvall™ ST 40R, catalog number: 75004525) NanoDrop™ 2000 Spectrophotometer (Thermo Fisher Scientific, model: NanoDrop™ 2000, catalog number: ND-2000) T100™ Thermal Cycler (Bio-Rad Laboratories, catalog number: 1861096) CFX Connect™ Real-Time PCR Detection System (Bio-Rad Laboratories, catalog number: 1855200) UV transilluminator

    Flow Cytometry:

    Article Title: Immunoprecipitation of Tri-methylated Capped RNA
    Article Snippet: .. Protein G Sepharose® 4 Fast Flow Beads (GE Healthcare, catalog number: 17061801) Normal rabbit serum (control, EMD Millipore, catalog number: NS01L-1ML) Sodium chloride (NaCl) (Fisher Scientific, catalog number: S671-3) NP-40 (Thermo Fisher Scientific, catalog number: 28324) Tris base (Fisher Scientific, catalog number: BP152-5) Hydrochloric acid (HCl) (VWR, catalog number: BDH7204-1) RNasin™ Plus RNase inhibitor (Promega, catalog number: N2611) NaOAc (AMRESCO, catalog number: 0602) Ethylenediaminetetraacetate acid (EDTA), pH 8 (Thermo Fisher Scientific, catalog number: AM9260G) Ethylenediaminetetraacetate acid (EDTA) (AMRESCO, catalog number: 0105) Sodium dodecyl sulfate (SDS) (Thermo Fisher Scientific, catalog number: AM9822) Phenol/Chloroform/Isoamyl Alcohol; 125:24:1 mixture, pH 4.5 (Thermo Fisher Scientific, catalog number: AM9720) Agarose LE (Denville Scientific, catalog number: CA3510-8) iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, catalog number: 1708891) Sso Advanced™ Universal SYBR® Green Supermix (Bio-Rad Laboratories, catalog number: 1725274) PARIS™ Kit (Thermo Fisher Scientific, catalog number: AM1921) Boric acid (Fisher Scientific, catalog number: A73-1) NET-2 Buffer (see Recipes) G-50 Buffer (see Recipes) 1× TBE (see Recipes) .. Micropipettes (Gilson, model: Pipetman® L, catalog number: F167370) Forma™ Steri-Cycle™ CO2 Incubator (Thermo Scientific, model: Forma™ Steri-Cycle™ CO2 Incubators, catalog number: 370) −80 °C freeze Sorvall™ Legend™ Micro 21R Microcentrifuge (Thermo Fisher Scientific, model: Sorvall™ Legend™ Micro 21R, catalog number: 75002490) Eppendorf™ Thermomixer™ R (Eppendorf, model: Thermomixer R, catalog number: 05-412-401) Labquake™ Tube Shaker/Rotator (Thermo Fisher Scientific, catalog number: C4152110Q) Sorvall™ ST 40R Centrifuge (Thermo Fisher Scientific, model: Sorvall™ ST 40R, catalog number: 75004525) NanoDrop™ 2000 Spectrophotometer (Thermo Fisher Scientific, model: NanoDrop™ 2000, catalog number: ND-2000) T100™ Thermal Cycler (Bio-Rad Laboratories, catalog number: 1861096) CFX Connect™ Real-Time PCR Detection System (Bio-Rad Laboratories, catalog number: 1855200) UV transilluminator

    Synthesized:

    Article Title: Effect of small interfering RNAs on matrix metalloproteinase 1 expression
    Article Snippet: .. First-strand cDNA was synthesized using 1 μg of total RNA by reverse-transcription using iScript™ cDNA synthesis kit (Bio-rad, California) as instructed by the manufacturer. .. For real-time PCR analysis of MMP1 and GAPDH gene expression was carried out using iQ™ SYBR® Green Supermix (Bio-rad, California), the primers used were: • MMP1 forward: AGTCAAGTTTGTGGCTTATGGA • MMP1 reverse: TTGTCACTGAAGCTGCTCTC • GAPDH forward: GTCGGAGTCAACGGATTT • GAPDH reverse: CAACAATATCCACTTTACCAGAG Briefly, the reaction mixture containing 2 μL cDNA, 1 μL forward primer (0.5 μM), 1 μL reverse primer (0.5 μM), 10 μL iQ SYBR Green Supermix, and 6 μL RNase-free water was prepared.

    Article Title: PGE2 Augments Inflammasome Activation and M1 Polarization in Macrophages Infected With Salmonella Typhimurium and Yersinia enterocolitica
    Article Snippet: .. The cDNA was synthesized using a Bio-Rad iScript cDNA Synthesis Kit and expression of genes encoding EP1, EP2, EP3, and EP4 was measured as stated above on a Bio-Rad CFX96 Real-Time System. .. Fold change and statistical significance were determined , and the expression data were normalized to the expression of RPL37A.

    Purification:

    Article Title: dCas9-targeted locus-specific protein isolation method identifies histone gene regulators
    Article Snippet: .. Total RNA was extracted and purified using TRIzol reagent (Life Technologies) according to the manufacturer’s protocol. cDNA synthesis was performed with 1 μg of total RNA using the iScript cDNA Synthesis Kit (Bio-Rad) and was diluted 10-fold. .. Real-time PCR analysis was carried out with SYBR Select Master Mix for CFX (Life Technologies) using the CFX96 Touch Real-Time PCR Detection System (Bio-Rad).

    Real-time Polymerase Chain Reaction:

    Article Title: Plk1 Regulates the Repressor Function of FoxM1b by inhibiting its Interaction with the Retinoblastoma Protein
    Article Snippet: .. C-DNA synthesis kit and real-time PCR kit were from Bio Rad. .. The ECL detection kit was from Thermo Scientific.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Immunoprecipitation of Tri-methylated Capped RNA
    Article Snippet: .. RT-PCR of m3G-capped RNAs by using iScript™ cDNA Synthesis Kit and 2× SsoAdvanced™ SYBR® Green Supermix PCR according to manufacturer’s protocols: Note: Perform RT-PCR using un-processed RNA (input) and RNA extracted from supernatant to determine expression levels of RNA of interest (m3G-capped and uncapped). ..

    Generated:

    Article Title: Signal transducer and activator of transcription 5b: a new target of breast tumor kinase/protein tyrosine kinase 6
    Article Snippet: .. The cDNA was generated using iScript cDNA synthesis (Bio-Rad). .. The cDNA was amplified using primers for Brk or β-actin as described by Kasprzycka and colleagues [ ].

    Expressing:

    Article Title: Immunoprecipitation of Tri-methylated Capped RNA
    Article Snippet: .. RT-PCR of m3G-capped RNAs by using iScript™ cDNA Synthesis Kit and 2× SsoAdvanced™ SYBR® Green Supermix PCR according to manufacturer’s protocols: Note: Perform RT-PCR using un-processed RNA (input) and RNA extracted from supernatant to determine expression levels of RNA of interest (m3G-capped and uncapped). ..

    Article Title: PGE2 Augments Inflammasome Activation and M1 Polarization in Macrophages Infected With Salmonella Typhimurium and Yersinia enterocolitica
    Article Snippet: .. The cDNA was synthesized using a Bio-Rad iScript cDNA Synthesis Kit and expression of genes encoding EP1, EP2, EP3, and EP4 was measured as stated above on a Bio-Rad CFX96 Real-Time System. .. Fold change and statistical significance were determined , and the expression data were normalized to the expression of RPL37A.

    Polymerase Chain Reaction:

    Article Title: Immunoprecipitation of Tri-methylated Capped RNA
    Article Snippet: .. RT-PCR of m3G-capped RNAs by using iScript™ cDNA Synthesis Kit and 2× SsoAdvanced™ SYBR® Green Supermix PCR according to manufacturer’s protocols: Note: Perform RT-PCR using un-processed RNA (input) and RNA extracted from supernatant to determine expression levels of RNA of interest (m3G-capped and uncapped). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Bio-Rad iscript cdna synthesis kit
    RNA immunoprecipitation of (TMG)-capped primary miRNAs (Pri-miRNAs) in quiescent human foreskin fibroblasts (HFFs) RT-PCR data shows the RNA immunoprecipitation of Pri-miR-34a and Pri-miR-3188 in quiescent HFFs (as well as the positive control snRNA U7), but not Pri-miR-423 using an antibody against (TMG)-capped RNAs. Total RNA was extracted using TRIzol Reagent, and 10 μg of RNA was diluted in NET-2 buffer, precleared and incubated with Protein G Sepharose 4 Fast Flow beads loaded with 15 μl of control antibody (Normal Rabbit Serum, EMD-Millipore) or with antibody recognizing the (TMG)-cap (Anti-m3G-cap, rabbit polyclonal, Synaptic Systems). Beads were rinsed five times with NET-2 buffer and were resuspended in G-50 buffer. RNA was extracted from the beads by phenol-chloroform-isoamyl alcohol extraction and resuspended in 20 μl of nuclease-free water. Immunoprecipitated tri-methylated capped RNA was converted to <t>cDNA</t> using <t>iScript</t> cDNA synthesis kit (Bio-Rad), followed by RT-PCR, and visualized after gel electrophoresis.
    Iscript Cdna Synthesis Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 2820 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/iscript cdna synthesis kit/product/Bio-Rad
    Average 99 stars, based on 2820 article reviews
    Price from $9.99 to $1999.99
    iscript cdna synthesis kit - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    86
    Bio-Rad cdna superscript kit
    <t>SREBP</t> expression levels in BMDM of WT and SREBP-1aDF mice Total RNA was isolated from BMDM and equal amounts of RNA were used for the quantitative RT-PCR assay. RNA expression level for SREBP-1a (A), SREBP-1c (B), and SREBP-2 (C) are shown as the quantitative expression levels calculated by comparison to qPCR values obtained with a standard curve of serially diluted linear plasmid <t>cDNA.</t> The data are plotted as femtograms of RNA normalized to ribosomal L32 samples analyzed in parallel. Bars represent the standard deviations. (D) nuclear SREBP-1 protein level. Nuclear protein was prepared from BMDM of WT and SREBP-1aDF mice. Aliquots (30 µg) were analyzed by immunoblotting for SREBP-1. *, p = 0.0031, indicating a statistically significant difference between BMDM from the two lines of mice.
    Cdna Superscript Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 86/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna superscript kit/product/Bio-Rad
    Average 86 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    cdna superscript kit - by Bioz Stars, 2020-08
    86/100 stars
      Buy from Supplier

    Image Search Results


    RNA immunoprecipitation of (TMG)-capped primary miRNAs (Pri-miRNAs) in quiescent human foreskin fibroblasts (HFFs) RT-PCR data shows the RNA immunoprecipitation of Pri-miR-34a and Pri-miR-3188 in quiescent HFFs (as well as the positive control snRNA U7), but not Pri-miR-423 using an antibody against (TMG)-capped RNAs. Total RNA was extracted using TRIzol Reagent, and 10 μg of RNA was diluted in NET-2 buffer, precleared and incubated with Protein G Sepharose 4 Fast Flow beads loaded with 15 μl of control antibody (Normal Rabbit Serum, EMD-Millipore) or with antibody recognizing the (TMG)-cap (Anti-m3G-cap, rabbit polyclonal, Synaptic Systems). Beads were rinsed five times with NET-2 buffer and were resuspended in G-50 buffer. RNA was extracted from the beads by phenol-chloroform-isoamyl alcohol extraction and resuspended in 20 μl of nuclease-free water. Immunoprecipitated tri-methylated capped RNA was converted to cDNA using iScript cDNA synthesis kit (Bio-Rad), followed by RT-PCR, and visualized after gel electrophoresis.

    Journal: Bio-protocol

    Article Title: Immunoprecipitation of Tri-methylated Capped RNA

    doi: 10.21769/BioProtoc.2717

    Figure Lengend Snippet: RNA immunoprecipitation of (TMG)-capped primary miRNAs (Pri-miRNAs) in quiescent human foreskin fibroblasts (HFFs) RT-PCR data shows the RNA immunoprecipitation of Pri-miR-34a and Pri-miR-3188 in quiescent HFFs (as well as the positive control snRNA U7), but not Pri-miR-423 using an antibody against (TMG)-capped RNAs. Total RNA was extracted using TRIzol Reagent, and 10 μg of RNA was diluted in NET-2 buffer, precleared and incubated with Protein G Sepharose 4 Fast Flow beads loaded with 15 μl of control antibody (Normal Rabbit Serum, EMD-Millipore) or with antibody recognizing the (TMG)-cap (Anti-m3G-cap, rabbit polyclonal, Synaptic Systems). Beads were rinsed five times with NET-2 buffer and were resuspended in G-50 buffer. RNA was extracted from the beads by phenol-chloroform-isoamyl alcohol extraction and resuspended in 20 μl of nuclease-free water. Immunoprecipitated tri-methylated capped RNA was converted to cDNA using iScript cDNA synthesis kit (Bio-Rad), followed by RT-PCR, and visualized after gel electrophoresis.

    Article Snippet: Protein G Sepharose® 4 Fast Flow Beads (GE Healthcare, catalog number: 17061801) Normal rabbit serum (control, EMD Millipore, catalog number: NS01L-1ML) Sodium chloride (NaCl) (Fisher Scientific, catalog number: S671-3) NP-40 (Thermo Fisher Scientific, catalog number: 28324) Tris base (Fisher Scientific, catalog number: BP152-5) Hydrochloric acid (HCl) (VWR, catalog number: BDH7204-1) RNasin™ Plus RNase inhibitor (Promega, catalog number: N2611) NaOAc (AMRESCO, catalog number: 0602) Ethylenediaminetetraacetate acid (EDTA), pH 8 (Thermo Fisher Scientific, catalog number: AM9260G) Ethylenediaminetetraacetate acid (EDTA) (AMRESCO, catalog number: 0105) Sodium dodecyl sulfate (SDS) (Thermo Fisher Scientific, catalog number: AM9822) Phenol/Chloroform/Isoamyl Alcohol; 125:24:1 mixture, pH 4.5 (Thermo Fisher Scientific, catalog number: AM9720) Agarose LE (Denville Scientific, catalog number: CA3510-8) iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, catalog number: 1708891) Sso Advanced™ Universal SYBR® Green Supermix (Bio-Rad Laboratories, catalog number: 1725274) PARIS™ Kit (Thermo Fisher Scientific, catalog number: AM1921) Boric acid (Fisher Scientific, catalog number: A73-1) NET-2 Buffer (see Recipes) G-50 Buffer (see Recipes) 1× TBE (see Recipes)

    Techniques: Immunoprecipitation, Reverse Transcription Polymerase Chain Reaction, Positive Control, Incubation, Flow Cytometry, Methylation, Nucleic Acid Electrophoresis

    Induction of autophagic genes expression following 4 weeks of nitrite therapy in CHF mice. cDNA was prepared from RNA obtained from mouse heart tissues followed by analysis of mRNA of autophagic markers beclin‐1 (A), ATG ‐5 (B), and ATG ‐7 (C). The number in the circle inside the bar denotes the number of animals used. Differences in data between the groups were compared using Prism 6 (GraphPad Software, La Jolla, CA) with nonparametric test (Wilcoxon rank sum test). ATG indicates autophagy related gene; CHF, chronic heart failure.

    Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

    Article Title: Nitrite Therapy Ameliorates Myocardial Dysfunction via H2S and Nuclear Factor‐Erythroid 2‐Related Factor 2 (Nrf2)‐Dependent Signaling in Chronic Heart Failure

    doi: 10.1161/JAHA.116.003551

    Figure Lengend Snippet: Induction of autophagic genes expression following 4 weeks of nitrite therapy in CHF mice. cDNA was prepared from RNA obtained from mouse heart tissues followed by analysis of mRNA of autophagic markers beclin‐1 (A), ATG ‐5 (B), and ATG ‐7 (C). The number in the circle inside the bar denotes the number of animals used. Differences in data between the groups were compared using Prism 6 (GraphPad Software, La Jolla, CA) with nonparametric test (Wilcoxon rank sum test). ATG indicates autophagy related gene; CHF, chronic heart failure.

    Article Snippet: One microgram of RNA was transcribed using an I‐script cDNA synthesis kit from Bio‐Rad.

    Techniques: Expressing, Mouse Assay, Software

    Effects of nitrite therapy on hypertrophic gene expression in ischemia‐induced CHF mice. Nitrite (100 mg/L) was given in the drinking water during reperfusion. cDNA was prepared from RNA obtained from mouse heart tissues followed by analysis of mRNA of ANP (A), BNP (B), and Myh7 (C) using TaqMan PCR assay system. The number inside the bar denotes the number of animals used per experiment. Differences in data between the groups were compared using Prism 6 (GraphPad Software, La Jolla, CA) with nonparametric test (Wilcoxon rank sum test). ANP indicates atrial natriuretic peptide; BNP, brain natriuretic peptide; Myh7, myosin heavy chain beta; PCR, polymerase chain reaction.

    Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

    Article Title: Nitrite Therapy Ameliorates Myocardial Dysfunction via H2S and Nuclear Factor‐Erythroid 2‐Related Factor 2 (Nrf2)‐Dependent Signaling in Chronic Heart Failure

    doi: 10.1161/JAHA.116.003551

    Figure Lengend Snippet: Effects of nitrite therapy on hypertrophic gene expression in ischemia‐induced CHF mice. Nitrite (100 mg/L) was given in the drinking water during reperfusion. cDNA was prepared from RNA obtained from mouse heart tissues followed by analysis of mRNA of ANP (A), BNP (B), and Myh7 (C) using TaqMan PCR assay system. The number inside the bar denotes the number of animals used per experiment. Differences in data between the groups were compared using Prism 6 (GraphPad Software, La Jolla, CA) with nonparametric test (Wilcoxon rank sum test). ANP indicates atrial natriuretic peptide; BNP, brain natriuretic peptide; Myh7, myosin heavy chain beta; PCR, polymerase chain reaction.

    Article Snippet: One microgram of RNA was transcribed using an I‐script cDNA synthesis kit from Bio‐Rad.

    Techniques: Expressing, Mouse Assay, Aqueous Normal-phase Chromatography, Polymerase Chain Reaction, Software

    Effects of nitrite on cardiac antioxidant gene and protein levels in CHF mice. cDNA was prepared from RNA obtained from mouse heart tissues followed by analysis of mRNA of SOD 1 (A), catalase (B), and GPX (C) using TaqMan PCR assay system. (D) represents proteins levels of SOD 1, catalase, and GPX , and (E), (F), and (G) represent the quantitation of the blots in (D). The number in the circle inside the bar denotes the number of animals used. Differences in data between the groups were compared using Prism 6 (GraphPad Software, La Jolla, CA) with nonparametric test (Wilcoxon rank sum test). CHF indicates chronic heart failure; GPX, glutathione peroxidase; PCR, polymerase chain reaction; SOD1, superoxide dismutase 1.

    Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

    Article Title: Nitrite Therapy Ameliorates Myocardial Dysfunction via H2S and Nuclear Factor‐Erythroid 2‐Related Factor 2 (Nrf2)‐Dependent Signaling in Chronic Heart Failure

    doi: 10.1161/JAHA.116.003551

    Figure Lengend Snippet: Effects of nitrite on cardiac antioxidant gene and protein levels in CHF mice. cDNA was prepared from RNA obtained from mouse heart tissues followed by analysis of mRNA of SOD 1 (A), catalase (B), and GPX (C) using TaqMan PCR assay system. (D) represents proteins levels of SOD 1, catalase, and GPX , and (E), (F), and (G) represent the quantitation of the blots in (D). The number in the circle inside the bar denotes the number of animals used. Differences in data between the groups were compared using Prism 6 (GraphPad Software, La Jolla, CA) with nonparametric test (Wilcoxon rank sum test). CHF indicates chronic heart failure; GPX, glutathione peroxidase; PCR, polymerase chain reaction; SOD1, superoxide dismutase 1.

    Article Snippet: One microgram of RNA was transcribed using an I‐script cDNA synthesis kit from Bio‐Rad.

    Techniques: Mouse Assay, Polymerase Chain Reaction, Quantitation Assay, Software

    Effect of silencing Schistosoma mansoni CYP450 in cultured larval worms. Freshly prepared schistosomula (300–400) were placed in each well containing 1 ml Basch’s Media in a 24-well plate and overnight in a 37°C with 5% CO2. The following day schistosomula were treated with 10 or 30 μg/ml S . mansoni CYP450 dsRNA or 30 μg/ml negative control dsRNA. Over several days worms were observed for dead (dark, granular appearance) or alive (translucent). (A) mRNA expression patterns in schistosomula treated with S . mansoni CYP450 specific dsRNA or negative control dsRNA control after 3 days of treatment (Experiments 1 and 2) or 2 days treatment (Experiment 3). The control gene for cDNA input is S . mansoni glyceraldehyde 3-phosphate dehydrogenase (GAPDH). C, schistosomula treated with 30 μg/mL irrelevant dsRNA; 10, schistosomula treated with 10 μg/mL Sm CYP450 dsRNA; 30, schistosomula treated with 30 μg/mL Sm CYP450 dsRNA. (B) Effect of S . mansoni CYP450 dsRNA on schistosomula survival in cultures with 30 μg/mL negative control dsRNA (black square), 10 μg/mL S . mansoni CYP450-specific ds RNA (open triangle), and 30 μg/mL S . mansoni CYP450-specific ds RNA (black triangle). Treatments were done in triplicate and repeated 3 times. Error bars indicate standard error of the mean; *, p

    Journal: PLoS Neglected Tropical Diseases

    Article Title: The Schistosoma mansoni Cytochrome P450 (CYP3050A1) Is Essential for Worm Survival and Egg Development

    doi: 10.1371/journal.pntd.0004279

    Figure Lengend Snippet: Effect of silencing Schistosoma mansoni CYP450 in cultured larval worms. Freshly prepared schistosomula (300–400) were placed in each well containing 1 ml Basch’s Media in a 24-well plate and overnight in a 37°C with 5% CO2. The following day schistosomula were treated with 10 or 30 μg/ml S . mansoni CYP450 dsRNA or 30 μg/ml negative control dsRNA. Over several days worms were observed for dead (dark, granular appearance) or alive (translucent). (A) mRNA expression patterns in schistosomula treated with S . mansoni CYP450 specific dsRNA or negative control dsRNA control after 3 days of treatment (Experiments 1 and 2) or 2 days treatment (Experiment 3). The control gene for cDNA input is S . mansoni glyceraldehyde 3-phosphate dehydrogenase (GAPDH). C, schistosomula treated with 30 μg/mL irrelevant dsRNA; 10, schistosomula treated with 10 μg/mL Sm CYP450 dsRNA; 30, schistosomula treated with 30 μg/mL Sm CYP450 dsRNA. (B) Effect of S . mansoni CYP450 dsRNA on schistosomula survival in cultures with 30 μg/mL negative control dsRNA (black square), 10 μg/mL S . mansoni CYP450-specific ds RNA (open triangle), and 30 μg/mL S . mansoni CYP450-specific ds RNA (black triangle). Treatments were done in triplicate and repeated 3 times. Error bars indicate standard error of the mean; *, p

    Article Snippet: Total RNA was used for cDNA synthesis (iScript, BIO-RAD) per the manufacturer’s recommendation.

    Techniques: Cell Culture, Negative Control, Expressing

    CYP450 messenger RNA abundance during the lifecycle of Schistosoma mansoni . Whole RNA was extracted from different stages of S . mansoni (cercariae, 1-day old schistosomula; juvenile liver worms (23 days post infection), adult males (49 days post infection), adult females (49 days post infection) and eggs) using TRIzol reagent and chloroform/ethanol extraction protocol. cDNA was synthesized from whole RNA and used for qRT-PCR, with reactions done in triplicate. Adult males (= 1) were used as calibrator stage and mRNA abundance was normalized to α-tubulin. Error bars indicate standard error of the mean with n ≥ 3 biological replicates. Numbers indicate fold change relative to adult males and all values are significantly different from adult males; p

    Journal: PLoS Neglected Tropical Diseases

    Article Title: The Schistosoma mansoni Cytochrome P450 (CYP3050A1) Is Essential for Worm Survival and Egg Development

    doi: 10.1371/journal.pntd.0004279

    Figure Lengend Snippet: CYP450 messenger RNA abundance during the lifecycle of Schistosoma mansoni . Whole RNA was extracted from different stages of S . mansoni (cercariae, 1-day old schistosomula; juvenile liver worms (23 days post infection), adult males (49 days post infection), adult females (49 days post infection) and eggs) using TRIzol reagent and chloroform/ethanol extraction protocol. cDNA was synthesized from whole RNA and used for qRT-PCR, with reactions done in triplicate. Adult males (= 1) were used as calibrator stage and mRNA abundance was normalized to α-tubulin. Error bars indicate standard error of the mean with n ≥ 3 biological replicates. Numbers indicate fold change relative to adult males and all values are significantly different from adult males; p

    Article Snippet: Total RNA was used for cDNA synthesis (iScript, BIO-RAD) per the manufacturer’s recommendation.

    Techniques: Infection, Synthesized, Quantitative RT-PCR

    SREBP expression levels in BMDM of WT and SREBP-1aDF mice Total RNA was isolated from BMDM and equal amounts of RNA were used for the quantitative RT-PCR assay. RNA expression level for SREBP-1a (A), SREBP-1c (B), and SREBP-2 (C) are shown as the quantitative expression levels calculated by comparison to qPCR values obtained with a standard curve of serially diluted linear plasmid cDNA. The data are plotted as femtograms of RNA normalized to ribosomal L32 samples analyzed in parallel. Bars represent the standard deviations. (D) nuclear SREBP-1 protein level. Nuclear protein was prepared from BMDM of WT and SREBP-1aDF mice. Aliquots (30 µg) were analyzed by immunoblotting for SREBP-1. *, p = 0.0031, indicating a statistically significant difference between BMDM from the two lines of mice.

    Journal: Cell metabolism

    Article Title: Linking Lipid Metabolism to the Innate Immune Response in Macrophages through Sterol Regulatory Element Binding Protein -1a

    doi: 10.1016/j.cmet.2011.04.001

    Figure Lengend Snippet: SREBP expression levels in BMDM of WT and SREBP-1aDF mice Total RNA was isolated from BMDM and equal amounts of RNA were used for the quantitative RT-PCR assay. RNA expression level for SREBP-1a (A), SREBP-1c (B), and SREBP-2 (C) are shown as the quantitative expression levels calculated by comparison to qPCR values obtained with a standard curve of serially diluted linear plasmid cDNA. The data are plotted as femtograms of RNA normalized to ribosomal L32 samples analyzed in parallel. Bars represent the standard deviations. (D) nuclear SREBP-1 protein level. Nuclear protein was prepared from BMDM of WT and SREBP-1aDF mice. Aliquots (30 µg) were analyzed by immunoblotting for SREBP-1. *, p = 0.0031, indicating a statistically significant difference between BMDM from the two lines of mice.

    Article Snippet: Total RNA was isolated from macrophages of WT and SREBP-1aDF mice using the Trizol method (Invitrogen). cDNA was synthesized by cDNA superscript kit (Bio-Rad) and used for qPCR with Real-Time PCR Detection (Bio-Rad). mRNA levels were normalized for expression of ribosomal protein L32 mRNA as control and calculated by the comparative threshold cycle method.

    Techniques: Expressing, Mouse Assay, Isolation, Quantitative RT-PCR, RNA Expression, Real-time Polymerase Chain Reaction, Plasmid Preparation