competent escherichia coli  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher competent escherichia coli
    Competent Escherichia Coli, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 38 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/competent escherichia coli/product/Thermo Fisher
    Average 99 stars, based on 38 article reviews
    Price from $9.99 to $1999.99
    competent escherichia coli - by Bioz Stars, 2020-03
    99/100 stars

    Images

    Related Articles

    Transduction:

    Article Title: A high-throughput immune-oncology screen identifies EGFR inhibitors as potent enhancers of antigen-specific cytotoxic T-lymphocyte tumor cell killing
    Article Snippet: Plasmids were transformed into One Shot Stbl3 Chemically Competent E. coli according to the manufacturer’s protocol (cat# C737303 Thermo Fisher, Waltham, MA). .. ID8-Cas9 cells were transduced with pXPR-sgEGFR-GFP-Blast and placed under G418 selection for seven days.

    Clone Assay:

    Article Title: A Short Caspase-3 Isoform Inhibits Chemotherapy-Induced Apoptosis by Blocking Apoptosome Assembly
    Article Snippet: .. The inserts were cloned into pcDNA3.1/CT-GFP-TOPO or pcDNA3.1/CT-YFP-TOPO and amplified in One Shot® TOP10 Chemically Competent E. Coli with Fusion TOPO® TA Expression Kits (Invitrogen). .. The orientations of the caspase-3 or caspase-3s fragments were tested by PCR and automatic sequencing as described below.

    Article Title: Sleeping site ecology, but not sex, affect ecto- and hemoparasite risk, in sympatric, arboreal primates (Avahi occidentalis and Lepilemur edwardsi)
    Article Snippet: .. The amplified fragment was inserted into the pCR4™4-TOPO® vector and cloned into One Shot® TOP10 chemically competent E. coli using TOPO® TA cloning kit for sequencing (Invitrogen, Karlsruhe, Germany). .. Plasmid DNA was obtained using the NucleoSpin® Plasmid Kit (Macherey-Nagel, Dueren, Germany) following the manufacturer’s recommendations.

    Article Title: Diagnosing bovine parafilariosis: utility of the cytochrome c oxidase subunit 1 gene and internal transcribed spacer region for PCR detection of Parafilaria bovicola in skin biopsies and serohemorrhagic exudates of cattle
    Article Snippet: .. Afterwards, the amplicons were inserted into the pCR4™4-TOPO® vector and cloned into One Shot® TOP10 chemically competent E. coli using the TOPO® TA Cloning® Kit for Sequencing (Invitrogen, Schwerte, Germany). .. Plasmid DNA was obtained using the NucleoSpin® Plasmid Kit (Macherey-Nagel) following the manufacturer’s recommendations.

    Article Title: Does Wheat Genetically Modified for Disease Resistance Affect Root-Colonizing Pseudomonads and Arbuscular Mycorrhizal Fungi?
    Article Snippet: Paragraph title: Sequencing and cloning of DGGE bands ... The constructs were transformed into chemically competent Escherichia coli One Shot® TOP 10 cells (Invitrogen, Carlsbad, CA, USA), and transformants containing the pJET1.2_pqqC construct were selected for sequencing.

    Article Title: Sequence-Based Discovery Demonstrates That Fixed Light Chain Human Transgenic Rats Produce a Diverse Repertoire of Antigen-Specific Antibodies
    Article Snippet: We sequence validated the 2,560 individual heavy chain clones using Sanger sequencing on an ABI 3730xl DNA Analyzer platform to ensure they were the correct sequence and were cloned in frame with the leader peptide and Fc region. .. We individually transformed each expression vector into TOP10 chemically competent E. coli according to manufacturer’s protocols (Thermo Fisher catalog number C404003), grew them for 24 h in 2 mL of LB culture media and purified them in 96-well format using the Qiagen Plasmid Plus 96 Kit according to the manufacturer’s protocol (Qiagen catalog number: 16181).

    Article Title: Aptamer-functionalized lipid nanoparticles targeting osteoblasts as a novel RNA interference–based bone anabolic strategy
    Article Snippet: .. After multiple rounds of selection, the enriched ssDNA pool was cloned into TOP10 chemically competent Escherichia coli with the TA cloning kit (Invitrogen) and sequenced by Sangon, Shanghai, China. .. Binding assays of enriched ssDNA with the target cells and non-target cells were performed by a FACScan cytometer (BD Immunocytometry Systems).

    Article Title: Phenotype-Specific Bacterial Communities in the Cold-Water Coral Lophelia pertusa (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ †
    Article Snippet: .. Cloning was carried out using the Topo TA cloning kit for sequencing with One Shot TOP10 chemically competent Escherichia coli (Invitrogen). .. This kit was preferred for its high reliability, but it required DNA inserts with a 3′ adenosine overlap for ligation with the cloning vector.

    Amplification:

    Article Title: A Short Caspase-3 Isoform Inhibits Chemotherapy-Induced Apoptosis by Blocking Apoptosome Assembly
    Article Snippet: .. The inserts were cloned into pcDNA3.1/CT-GFP-TOPO or pcDNA3.1/CT-YFP-TOPO and amplified in One Shot® TOP10 Chemically Competent E. Coli with Fusion TOPO® TA Expression Kits (Invitrogen). .. The orientations of the caspase-3 or caspase-3s fragments were tested by PCR and automatic sequencing as described below.

    Article Title: Sleeping site ecology, but not sex, affect ecto- and hemoparasite risk, in sympatric, arboreal primates (Avahi occidentalis and Lepilemur edwardsi)
    Article Snippet: .. The amplified fragment was inserted into the pCR4™4-TOPO® vector and cloned into One Shot® TOP10 chemically competent E. coli using TOPO® TA cloning kit for sequencing (Invitrogen, Karlsruhe, Germany). .. Plasmid DNA was obtained using the NucleoSpin® Plasmid Kit (Macherey-Nagel, Dueren, Germany) following the manufacturer’s recommendations.

    Article Title: Expression and purification of recombinant human coagulation factor VII fused to a histidine tag using Gateway technology
    Article Snippet: The primer set for amplification of the full-length human FVII gene containing Kozak sequence site included the forward primer: 5’-CACCATGGTC TCC CAG GCCCTC AGG CTCC-3’ and reverse primer: 5’-T AGG GAA ATG GGG CTC GCA G-3’. .. The reaction was then placed on ice and the pENTR TOPO/D-FVII construct was transformed to competent E. coli according to the manufacturer’s protocol (Invitrogen, USA).

    Article Title: Aptamer-functionalized lipid nanoparticles targeting osteoblasts as a novel RNA interference–based bone anabolic strategy
    Article Snippet: Briefly, ssDNA library was incubated with 1–2 × 106 target cells at 37 °C for 0.5–1 h. After washing, the bound DNAs were eluted and then incubated with non-target cells at 37 °C for 1 h. The supernatant was desalted and amplified by PCR. .. After multiple rounds of selection, the enriched ssDNA pool was cloned into TOP10 chemically competent Escherichia coli with the TA cloning kit (Invitrogen) and sequenced by Sangon, Shanghai, China.

    Article Title: Phenotype-Specific Bacterial Communities in the Cold-Water Coral Lophelia pertusa (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ †
    Article Snippet: Cloning was carried out using the Topo TA cloning kit for sequencing with One Shot TOP10 chemically competent Escherichia coli (Invitrogen). .. Since the Phusion polymerase produces blunt-ended PCR products, a terminal deoxyadenosine had to be added to the 3′ ends of the amplified DNA prior to ligation.

    Synthesized:

    Article Title: A single amino acid switch converts the Sleeping Beauty transposase into an efficient unidirectional excisionase with utility in stem cell reprogramming
    Article Snippet: Primers were synthesized with a 5′-phosphate to enable a downstream intramolecular ligation reaction and were ordered from Eurofins (Eurofins/MWG, Luxembourg). .. The circularized PCR products were transformed into chemically competent E. coli (Invitrogen/Life Technologies, Carlsbad, CA, USA), grown in Luria-Bertani (LB) medium for 1 h, and selected for chloramphenicol resistance by plating on LB agar plates containing 25 μg/ml chloramphenicol.

    Article Title: CRISPR/Cas9 gene editing for the creation of an MGAT1-deficient CHO cell line to control HIV-1 vaccine glycosylation
    Article Snippet: Single-stranded DNA oligonucleotides and their complement strands were synthesized (Eurofins Genomics, Louisville, KY, US) with extra bases on the 3′ ends for ligation into a GeneArt CRISPR nuclease vector (Thermo Fisher, GeneArt, Waltham, MA, US). .. One Shot TOP10 Chemically Competent Escherichia coli were transformed and plated following the Invitrogen protocol (Thermo Fisher, Invitrogen, Carlsbad, CA, US).

    TA Cloning:

    Article Title: Sleeping site ecology, but not sex, affect ecto- and hemoparasite risk, in sympatric, arboreal primates (Avahi occidentalis and Lepilemur edwardsi)
    Article Snippet: .. The amplified fragment was inserted into the pCR4™4-TOPO® vector and cloned into One Shot® TOP10 chemically competent E. coli using TOPO® TA cloning kit for sequencing (Invitrogen, Karlsruhe, Germany). .. Plasmid DNA was obtained using the NucleoSpin® Plasmid Kit (Macherey-Nagel, Dueren, Germany) following the manufacturer’s recommendations.

    Article Title: Diagnosing bovine parafilariosis: utility of the cytochrome c oxidase subunit 1 gene and internal transcribed spacer region for PCR detection of Parafilaria bovicola in skin biopsies and serohemorrhagic exudates of cattle
    Article Snippet: .. Afterwards, the amplicons were inserted into the pCR4™4-TOPO® vector and cloned into One Shot® TOP10 chemically competent E. coli using the TOPO® TA Cloning® Kit for Sequencing (Invitrogen, Schwerte, Germany). .. Plasmid DNA was obtained using the NucleoSpin® Plasmid Kit (Macherey-Nagel) following the manufacturer’s recommendations.

    Article Title: Does Wheat Genetically Modified for Disease Resistance Affect Root-Colonizing Pseudomonads and Arbuscular Mycorrhizal Fungi?
    Article Snippet: Cloning was performed using the TA cloning vector pJET1.2 (CloneJet PCR cloning kit; Fermentas, Glen Burnie, MD, USA). .. The constructs were transformed into chemically competent Escherichia coli One Shot® TOP 10 cells (Invitrogen, Carlsbad, CA, USA), and transformants containing the pJET1.2_pqqC construct were selected for sequencing.

    Article Title: Aptamer-functionalized lipid nanoparticles targeting osteoblasts as a novel RNA interference–based bone anabolic strategy
    Article Snippet: .. After multiple rounds of selection, the enriched ssDNA pool was cloned into TOP10 chemically competent Escherichia coli with the TA cloning kit (Invitrogen) and sequenced by Sangon, Shanghai, China. .. Binding assays of enriched ssDNA with the target cells and non-target cells were performed by a FACScan cytometer (BD Immunocytometry Systems).

    Article Title: Phenotype-Specific Bacterial Communities in the Cold-Water Coral Lophelia pertusa (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ †
    Article Snippet: .. Cloning was carried out using the Topo TA cloning kit for sequencing with One Shot TOP10 chemically competent Escherichia coli (Invitrogen). .. This kit was preferred for its high reliability, but it required DNA inserts with a 3′ adenosine overlap for ligation with the cloning vector.

    Construct:

    Article Title: A high-throughput immune-oncology screen identifies EGFR inhibitors as potent enhancers of antigen-specific cytotoxic T-lymphocyte tumor cell killing
    Article Snippet: Paragraph title: sgEGFR constructs. ... Plasmids were transformed into One Shot Stbl3 Chemically Competent E. coli according to the manufacturer’s protocol (cat# C737303 Thermo Fisher, Waltham, MA).

    Article Title: Does Wheat Genetically Modified for Disease Resistance Affect Root-Colonizing Pseudomonads and Arbuscular Mycorrhizal Fungi?
    Article Snippet: .. The constructs were transformed into chemically competent Escherichia coli One Shot® TOP 10 cells (Invitrogen, Carlsbad, CA, USA), and transformants containing the pJET1.2_pqqC construct were selected for sequencing. .. Phylogeny of DGGE bands A phylogenetic tree was inferred from the pqqC sequences (501 bp) of (i) the DGGE bands, (ii) a selection of 14 reference pseudomonas including 11 Pseudomonas strains listed in and three GenBank sequences (P. fluorescens SBW25, GenBank database accession number NC_012660.1; P. fluorescens Pf0-1, NC_007492.2; and P. syringae pv. syringae B728a, CP000075.1), (iii) 30 RW09-C isolates , and (iv) 76 RW09-NC clones obtained from wheat roots as described in Meyer et al. (Genbank database accession numbers JN397402 - 477).

    Article Title: Expression and purification of recombinant human coagulation factor VII fused to a histidine tag using Gateway technology
    Article Snippet: .. The reaction was then placed on ice and the pENTR TOPO/D-FVII construct was transformed to competent E. coli according to the manufacturer’s protocol (Invitrogen, USA). ..

    Enzyme-linked Immunosorbent Assay:

    Article Title: Sequence-Based Discovery Demonstrates That Fixed Light Chain Human Transgenic Rats Produce a Diverse Repertoire of Antigen-Specific Antibodies
    Article Snippet: Paragraph title: Recombinant Antibody Expression and ELISA Assays ... We individually transformed each expression vector into TOP10 chemically competent E. coli according to manufacturer’s protocols (Thermo Fisher catalog number C404003), grew them for 24 h in 2 mL of LB culture media and purified them in 96-well format using the Qiagen Plasmid Plus 96 Kit according to the manufacturer’s protocol (Qiagen catalog number: 16181).

    Incubation:

    Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
    Article Snippet: .. After incubation at 50 ˚C for 1 h, the product w as transformed into One Shot Stbl3 chemically competent Escherichia coli (Invitrogen). .. A fraction (150 μL) of cultures was spread on carbenicillin (50 μg/ml) LB plates and incubated overnight at 37 °C.

    Article Title: CRISPR/Cas9 gene editing for the creation of an MGAT1-deficient CHO cell line to control HIV-1 vaccine glycosylation
    Article Snippet: One Shot TOP10 Chemically Competent Escherichia coli were transformed and plated following the Invitrogen protocol (Thermo Fisher, Invitrogen, Carlsbad, CA, US). .. These were incubated in 5 mL LB broth at 37 °C in a shaking incubator at 225 rpm overnight.

    Article Title: Aptamer-functionalized lipid nanoparticles targeting osteoblasts as a novel RNA interference–based bone anabolic strategy
    Article Snippet: Briefly, ssDNA library was incubated with 1–2 × 106 target cells at 37 °C for 0.5–1 h. After washing, the bound DNAs were eluted and then incubated with non-target cells at 37 °C for 1 h. The supernatant was desalted and amplified by PCR. .. After multiple rounds of selection, the enriched ssDNA pool was cloned into TOP10 chemically competent Escherichia coli with the TA cloning kit (Invitrogen) and sequenced by Sangon, Shanghai, China.

    Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
    Article Snippet: .. After incubation at 50 ˚C for 1 h, the product was transformed into One Shot Stbl3 chemically competent Escherichia coli (Invitrogen). .. A fraction (150 μL) of cultures was spread on carbenicillin (50 μg/ml) LB plates and incubated overnight at 37 °C.

    Article Title: Phenotype-Specific Bacterial Communities in the Cold-Water Coral Lophelia pertusa (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ †
    Article Snippet: Cloning was carried out using the Topo TA cloning kit for sequencing with One Shot TOP10 chemically competent Escherichia coli (Invitrogen). .. For this purpose, the natural non-template-dependent terminal transferase activity of Taq polymerase was exploited: PCR products were incubated in 50 μl of 1× ThermoPol buffer (New England Biolabs) with 1 U of Taq DNA polymerase (New England Biolabs) and 200 μM dATP (Roche) for 30 min at 72°C.

    Gel Extraction:

    Article Title: A Short Caspase-3 Isoform Inhibits Chemotherapy-Induced Apoptosis by Blocking Apoptosome Assembly
    Article Snippet: The two transcripts were separated by a 3% agarose gel electrophoresis and purified by specific extraction with QIAquick Gel Extraction Kit (Qiagen, Courtaboeuf, France). .. The inserts were cloned into pcDNA3.1/CT-GFP-TOPO or pcDNA3.1/CT-YFP-TOPO and amplified in One Shot® TOP10 Chemically Competent E. Coli with Fusion TOPO® TA Expression Kits (Invitrogen).

    Article Title: Caulobacter crescentus as a Whole-Cell Uranium Biosensor ▿ as a Whole-Cell Uranium Biosensor ▿ †
    Article Snippet: OneShot Top10 chemically competent Escherichia coli and 0.1-cm electroporation cuvettes were purchased from Invitrogen (Carlsbad, CA). .. DNA miniprep and gel extraction kits were purchased from Qiagen (Valencia, CA).

    Activity Assay:

    Article Title: Phenotype-Specific Bacterial Communities in the Cold-Water Coral Lophelia pertusa (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ †
    Article Snippet: Cloning was carried out using the Topo TA cloning kit for sequencing with One Shot TOP10 chemically competent Escherichia coli (Invitrogen). .. For this purpose, the natural non-template-dependent terminal transferase activity of Taq polymerase was exploited: PCR products were incubated in 50 μl of 1× ThermoPol buffer (New England Biolabs) with 1 U of Taq DNA polymerase (New England Biolabs) and 200 μM dATP (Roche) for 30 min at 72°C.

    Spectrophotometry:

    Article Title: In vitro isolation of small-molecule-binding aptamers with intrinsic dye-displacement functionality
    Article Snippet: DNA concentrations were measured using a NanoDrop 2000 spectrophotometer (Thermo Scientific). .. Streptavidin-coated agarose resin (binding capacity: 1−3 mg biotinylated BSA/ml resin), One Shot Chemically Competent Escherichia coli , and SYBR Gold were purchased from Thermo Scientific.

    Expressing:

    Article Title: A Short Caspase-3 Isoform Inhibits Chemotherapy-Induced Apoptosis by Blocking Apoptosome Assembly
    Article Snippet: .. The inserts were cloned into pcDNA3.1/CT-GFP-TOPO or pcDNA3.1/CT-YFP-TOPO and amplified in One Shot® TOP10 Chemically Competent E. Coli with Fusion TOPO® TA Expression Kits (Invitrogen). .. The orientations of the caspase-3 or caspase-3s fragments were tested by PCR and automatic sequencing as described below.

    Article Title: A high-throughput immune-oncology screen identifies EGFR inhibitors as potent enhancers of antigen-specific cytotoxic T-lymphocyte tumor cell killing
    Article Snippet: The top four scoring sgRNA targeting EGFR (sequences listed in ) were ordered as oligos from IDT (Coralville, Iowa) and ligated into BsmBI site in pXPR-sgRNA-GFP-Blast expression vector (Addgene, Cambridge, MA) using Quick Ligation Kit according to manufacturer’s protocol (cat# M2200S New England Biolabs, Ipswich, MA). .. Plasmids were transformed into One Shot Stbl3 Chemically Competent E. coli according to the manufacturer’s protocol (cat# C737303 Thermo Fisher, Waltham, MA).

    Article Title: Sequence-Based Discovery Demonstrates That Fixed Light Chain Human Transgenic Rats Produce a Diverse Repertoire of Antigen-Specific Antibodies
    Article Snippet: .. We individually transformed each expression vector into TOP10 chemically competent E. coli according to manufacturer’s protocols (Thermo Fisher catalog number C404003), grew them for 24 h in 2 mL of LB culture media and purified them in 96-well format using the Qiagen Plasmid Plus 96 Kit according to the manufacturer’s protocol (Qiagen catalog number: 16181). .. We assessed the quantity and purity of the purified expression vectors by calculating the 260 and 280 nM absorbance ratio.

    Transformation Assay:

    Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
    Article Snippet: .. After incubation at 50 ˚C for 1 h, the product w as transformed into One Shot Stbl3 chemically competent Escherichia coli (Invitrogen). .. A fraction (150 μL) of cultures was spread on carbenicillin (50 μg/ml) LB plates and incubated overnight at 37 °C.

    Article Title: A single amino acid switch converts the Sleeping Beauty transposase into an efficient unidirectional excisionase with utility in stem cell reprogramming
    Article Snippet: .. The circularized PCR products were transformed into chemically competent E. coli (Invitrogen/Life Technologies, Carlsbad, CA, USA), grown in Luria-Bertani (LB) medium for 1 h, and selected for chloramphenicol resistance by plating on LB agar plates containing 25 μg/ml chloramphenicol. .. To confirm the presence of the desired mutations, DNAs from several single colonies were purified using the QIAprep spin miniprep kit (QIAGEN, Venlo, Holland) and were sequenced by GATC Biotech (Konstanz, Germany).

    Article Title: CRISPR/Cas9 gene editing for the creation of an MGAT1-deficient CHO cell line to control HIV-1 vaccine glycosylation
    Article Snippet: .. One Shot TOP10 Chemically Competent Escherichia coli were transformed and plated following the Invitrogen protocol (Thermo Fisher, Invitrogen, Carlsbad, CA, US). .. These were incubated in 5 mL LB broth at 37 °C in a shaking incubator at 225 rpm overnight.

    Article Title: A high-throughput immune-oncology screen identifies EGFR inhibitors as potent enhancers of antigen-specific cytotoxic T-lymphocyte tumor cell killing
    Article Snippet: .. Plasmids were transformed into One Shot Stbl3 Chemically Competent E. coli according to the manufacturer’s protocol (cat# C737303 Thermo Fisher, Waltham, MA). ..

    Article Title: Does Wheat Genetically Modified for Disease Resistance Affect Root-Colonizing Pseudomonads and Arbuscular Mycorrhizal Fungi?
    Article Snippet: .. The constructs were transformed into chemically competent Escherichia coli One Shot® TOP 10 cells (Invitrogen, Carlsbad, CA, USA), and transformants containing the pJET1.2_pqqC construct were selected for sequencing. .. Phylogeny of DGGE bands A phylogenetic tree was inferred from the pqqC sequences (501 bp) of (i) the DGGE bands, (ii) a selection of 14 reference pseudomonas including 11 Pseudomonas strains listed in and three GenBank sequences (P. fluorescens SBW25, GenBank database accession number NC_012660.1; P. fluorescens Pf0-1, NC_007492.2; and P. syringae pv. syringae B728a, CP000075.1), (iii) 30 RW09-C isolates , and (iv) 76 RW09-NC clones obtained from wheat roots as described in Meyer et al. (Genbank database accession numbers JN397402 - 477).

    Article Title: Expression and purification of recombinant human coagulation factor VII fused to a histidine tag using Gateway technology
    Article Snippet: .. The reaction was then placed on ice and the pENTR TOPO/D-FVII construct was transformed to competent E. coli according to the manufacturer’s protocol (Invitrogen, USA). ..

    Article Title: Sequence-Based Discovery Demonstrates That Fixed Light Chain Human Transgenic Rats Produce a Diverse Repertoire of Antigen-Specific Antibodies
    Article Snippet: .. We individually transformed each expression vector into TOP10 chemically competent E. coli according to manufacturer’s protocols (Thermo Fisher catalog number C404003), grew them for 24 h in 2 mL of LB culture media and purified them in 96-well format using the Qiagen Plasmid Plus 96 Kit according to the manufacturer’s protocol (Qiagen catalog number: 16181). .. We assessed the quantity and purity of the purified expression vectors by calculating the 260 and 280 nM absorbance ratio.

    Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
    Article Snippet: .. After incubation at 50 ˚C for 1 h, the product was transformed into One Shot Stbl3 chemically competent Escherichia coli (Invitrogen). .. A fraction (150 μL) of cultures was spread on carbenicillin (50 μg/ml) LB plates and incubated overnight at 37 °C.

    High Performance Liquid Chromatography:

    Article Title: In vitro isolation of small-molecule-binding aptamers with intrinsic dye-displacement functionality
    Article Snippet: Materials All oligonucleotides were ordered from Integrated DNA Technologies (IDT), purified with HPLC and dissolved in PCR quality water (Invitrogen). .. Streptavidin-coated agarose resin (binding capacity: 1−3 mg biotinylated BSA/ml resin), One Shot Chemically Competent Escherichia coli , and SYBR Gold were purchased from Thermo Scientific.

    Electroporation:

    Article Title: Caulobacter crescentus as a Whole-Cell Uranium Biosensor ▿ as a Whole-Cell Uranium Biosensor ▿ †
    Article Snippet: .. OneShot Top10 chemically competent Escherichia coli and 0.1-cm electroporation cuvettes were purchased from Invitrogen (Carlsbad, CA). ..

    Ligation:

    Article Title: A single amino acid switch converts the Sleeping Beauty transposase into an efficient unidirectional excisionase with utility in stem cell reprogramming
    Article Snippet: The PCR products were purified with QIAquick PCR Purification Kit (QIAGEN, Venlo, Holland), eluted in 30 μl elution buffer and digested with 2 μl Dpn I (NEB, Ipswich, MA, USA) for 2 h at 37°C, followed by 20 min heat-inactivation at 80°C.The linear, double-stranded PCR products were circularized by ligation with T4 DNA Ligase (NEB, Ipswich, MA, USA) overnight at room temperature. .. The circularized PCR products were transformed into chemically competent E. coli (Invitrogen/Life Technologies, Carlsbad, CA, USA), grown in Luria-Bertani (LB) medium for 1 h, and selected for chloramphenicol resistance by plating on LB agar plates containing 25 μg/ml chloramphenicol.

    Article Title: CRISPR/Cas9 gene editing for the creation of an MGAT1-deficient CHO cell line to control HIV-1 vaccine glycosylation
    Article Snippet: Single-stranded DNA oligonucleotides and their complement strands were synthesized (Eurofins Genomics, Louisville, KY, US) with extra bases on the 3′ ends for ligation into a GeneArt CRISPR nuclease vector (Thermo Fisher, GeneArt, Waltham, MA, US). .. One Shot TOP10 Chemically Competent Escherichia coli were transformed and plated following the Invitrogen protocol (Thermo Fisher, Invitrogen, Carlsbad, CA, US).

    Article Title: A high-throughput immune-oncology screen identifies EGFR inhibitors as potent enhancers of antigen-specific cytotoxic T-lymphocyte tumor cell killing
    Article Snippet: The top four scoring sgRNA targeting EGFR (sequences listed in ) were ordered as oligos from IDT (Coralville, Iowa) and ligated into BsmBI site in pXPR-sgRNA-GFP-Blast expression vector (Addgene, Cambridge, MA) using Quick Ligation Kit according to manufacturer’s protocol (cat# M2200S New England Biolabs, Ipswich, MA). .. Plasmids were transformed into One Shot Stbl3 Chemically Competent E. coli according to the manufacturer’s protocol (cat# C737303 Thermo Fisher, Waltham, MA).

    Article Title: Phenotype-Specific Bacterial Communities in the Cold-Water Coral Lophelia pertusa (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ †
    Article Snippet: Cloning was carried out using the Topo TA cloning kit for sequencing with One Shot TOP10 chemically competent Escherichia coli (Invitrogen). .. This kit was preferred for its high reliability, but it required DNA inserts with a 3′ adenosine overlap for ligation with the cloning vector.

    Transferring:

    Article Title: Does Wheat Genetically Modified for Disease Resistance Affect Root-Colonizing Pseudomonads and Arbuscular Mycorrhizal Fungi?
    Article Snippet: Briefly, the central part of DGGE bands was cut out using sterile pipette tips. .. The constructs were transformed into chemically competent Escherichia coli One Shot® TOP 10 cells (Invitrogen, Carlsbad, CA, USA), and transformants containing the pJET1.2_pqqC construct were selected for sequencing.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: A Short Caspase-3 Isoform Inhibits Chemotherapy-Induced Apoptosis by Blocking Apoptosome Assembly
    Article Snippet: Full-length cDNA synthesis and cloning The full-length of caspase-3 and caspase-3s coding sequences were obtained using SuperScript™ One-Step long templates RT-PCR (Invitrogen, Carlsbad, CA, USA) with 1.25 µg of total RNA from the UACC3199 cell line (Arizona Cancer Center Tissue Culture Shared Resource) containing high levels of the two transcripts. .. The inserts were cloned into pcDNA3.1/CT-GFP-TOPO or pcDNA3.1/CT-YFP-TOPO and amplified in One Shot® TOP10 Chemically Competent E. Coli with Fusion TOPO® TA Expression Kits (Invitrogen).

    Generated:

    Article Title: Diagnosing bovine parafilariosis: utility of the cytochrome c oxidase subunit 1 gene and internal transcribed spacer region for PCR detection of Parafilaria bovicola in skin biopsies and serohemorrhagic exudates of cattle
    Article Snippet: Afterwards, the amplicons were inserted into the pCR4™4-TOPO® vector and cloned into One Shot® TOP10 chemically competent E. coli using the TOPO® TA Cloning® Kit for Sequencing (Invitrogen, Schwerte, Germany). .. After removal of primer sequences, the newly generated sequences were deposited in the GenBank database under the accession numbers MG983750 and MG983751.

    DNA Sequencing:

    Article Title: CRISPR/Cas9 gene editing for the creation of an MGAT1-deficient CHO cell line to control HIV-1 vaccine glycosylation
    Article Snippet: One Shot TOP10 Chemically Competent Escherichia coli were transformed and plated following the Invitrogen protocol (Thermo Fisher, Invitrogen, Carlsbad, CA, US). .. Minipreps were performed according to manufactures instructions (Qiagen, Germantown, MD, US) and sent to UC Berkeley DNA Sequencing Facility (Berkeley, CA, US) with the U6 primers included in the GeneArt CRISPR kit to confirm successful integration of guide sequences.

    Sequencing:

    Article Title: A Short Caspase-3 Isoform Inhibits Chemotherapy-Induced Apoptosis by Blocking Apoptosome Assembly
    Article Snippet: The inserts were cloned into pcDNA3.1/CT-GFP-TOPO or pcDNA3.1/CT-YFP-TOPO and amplified in One Shot® TOP10 Chemically Competent E. Coli with Fusion TOPO® TA Expression Kits (Invitrogen). .. The orientations of the caspase-3 or caspase-3s fragments were tested by PCR and automatic sequencing as described below.

    Article Title: Sleeping site ecology, but not sex, affect ecto- and hemoparasite risk, in sympatric, arboreal primates (Avahi occidentalis and Lepilemur edwardsi)
    Article Snippet: .. The amplified fragment was inserted into the pCR4™4-TOPO® vector and cloned into One Shot® TOP10 chemically competent E. coli using TOPO® TA cloning kit for sequencing (Invitrogen, Karlsruhe, Germany). .. Plasmid DNA was obtained using the NucleoSpin® Plasmid Kit (Macherey-Nagel, Dueren, Germany) following the manufacturer’s recommendations.

    Article Title: Diagnosing bovine parafilariosis: utility of the cytochrome c oxidase subunit 1 gene and internal transcribed spacer region for PCR detection of Parafilaria bovicola in skin biopsies and serohemorrhagic exudates of cattle
    Article Snippet: .. Afterwards, the amplicons were inserted into the pCR4™4-TOPO® vector and cloned into One Shot® TOP10 chemically competent E. coli using the TOPO® TA Cloning® Kit for Sequencing (Invitrogen, Schwerte, Germany). .. Plasmid DNA was obtained using the NucleoSpin® Plasmid Kit (Macherey-Nagel) following the manufacturer’s recommendations.

    Article Title: CRISPR/Cas9 gene editing for the creation of an MGAT1-deficient CHO cell line to control HIV-1 vaccine glycosylation
    Article Snippet: Each sequence was run in NCBI’s BLAST tool for homologies with off-target sites in the CHO genome. .. One Shot TOP10 Chemically Competent Escherichia coli were transformed and plated following the Invitrogen protocol (Thermo Fisher, Invitrogen, Carlsbad, CA, US).

    Article Title: Does Wheat Genetically Modified for Disease Resistance Affect Root-Colonizing Pseudomonads and Arbuscular Mycorrhizal Fungi?
    Article Snippet: .. The constructs were transformed into chemically competent Escherichia coli One Shot® TOP 10 cells (Invitrogen, Carlsbad, CA, USA), and transformants containing the pJET1.2_pqqC construct were selected for sequencing. .. Phylogeny of DGGE bands A phylogenetic tree was inferred from the pqqC sequences (501 bp) of (i) the DGGE bands, (ii) a selection of 14 reference pseudomonas including 11 Pseudomonas strains listed in and three GenBank sequences (P. fluorescens SBW25, GenBank database accession number NC_012660.1; P. fluorescens Pf0-1, NC_007492.2; and P. syringae pv. syringae B728a, CP000075.1), (iii) 30 RW09-C isolates , and (iv) 76 RW09-NC clones obtained from wheat roots as described in Meyer et al. (Genbank database accession numbers JN397402 - 477).

    Article Title: Expression and purification of recombinant human coagulation factor VII fused to a histidine tag using Gateway technology
    Article Snippet: The primer set for amplification of the full-length human FVII gene containing Kozak sequence site included the forward primer: 5’-CACCATGGTC TCC CAG GCCCTC AGG CTCC-3’ and reverse primer: 5’-T AGG GAA ATG GGG CTC GCA G-3’. .. The reaction was then placed on ice and the pENTR TOPO/D-FVII construct was transformed to competent E. coli according to the manufacturer’s protocol (Invitrogen, USA).

    Article Title: Sequence-Based Discovery Demonstrates That Fixed Light Chain Human Transgenic Rats Produce a Diverse Repertoire of Antigen-Specific Antibodies
    Article Snippet: We also created and sequence validated a kappa light chain expression vector that contains the light chain variable region that corresponds to the germline sequence of the rearranged kappa light chain in the OmniFlic animal. .. We individually transformed each expression vector into TOP10 chemically competent E. coli according to manufacturer’s protocols (Thermo Fisher catalog number C404003), grew them for 24 h in 2 mL of LB culture media and purified them in 96-well format using the Qiagen Plasmid Plus 96 Kit according to the manufacturer’s protocol (Qiagen catalog number: 16181).

    Article Title: Phenotype-Specific Bacterial Communities in the Cold-Water Coral Lophelia pertusa (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ †
    Article Snippet: .. Cloning was carried out using the Topo TA cloning kit for sequencing with One Shot TOP10 chemically competent Escherichia coli (Invitrogen). .. This kit was preferred for its high reliability, but it required DNA inserts with a 3′ adenosine overlap for ligation with the cloning vector.

    Binding Assay:

    Article Title: In vitro isolation of small-molecule-binding aptamers with intrinsic dye-displacement functionality
    Article Snippet: .. Streptavidin-coated agarose resin (binding capacity: 1−3 mg biotinylated BSA/ml resin), One Shot Chemically Competent Escherichia coli , and SYBR Gold were purchased from Thermo Scientific. .. 500 μl micro-gravity columns were purchased from BioRad.

    Article Title: Sequence-Based Discovery Demonstrates That Fixed Light Chain Human Transgenic Rats Produce a Diverse Repertoire of Antigen-Specific Antibodies
    Article Snippet: We chose a representative sampling of heavy chain variable sequences from the diversity of clonotypes identified in each animal to express and measure antigen binding by ELISA. .. We individually transformed each expression vector into TOP10 chemically competent E. coli according to manufacturer’s protocols (Thermo Fisher catalog number C404003), grew them for 24 h in 2 mL of LB culture media and purified them in 96-well format using the Qiagen Plasmid Plus 96 Kit according to the manufacturer’s protocol (Qiagen catalog number: 16181).

    Article Title: Aptamer-functionalized lipid nanoparticles targeting osteoblasts as a novel RNA interference–based bone anabolic strategy
    Article Snippet: After multiple rounds of selection, the enriched ssDNA pool was cloned into TOP10 chemically competent Escherichia coli with the TA cloning kit (Invitrogen) and sequenced by Sangon, Shanghai, China. .. Binding assays of enriched ssDNA with the target cells and non-target cells were performed by a FACScan cytometer (BD Immunocytometry Systems).

    DNA Extraction:

    Article Title: Sleeping site ecology, but not sex, affect ecto- and hemoparasite risk, in sympatric, arboreal primates (Avahi occidentalis and Lepilemur edwardsi)
    Article Snippet: Paragraph title: DNA extraction, PCRs and sequence analyses ... The amplified fragment was inserted into the pCR4™4-TOPO® vector and cloned into One Shot® TOP10 chemically competent E. coli using TOPO® TA cloning kit for sequencing (Invitrogen, Karlsruhe, Germany).

    Article Title: Diagnosing bovine parafilariosis: utility of the cytochrome c oxidase subunit 1 gene and internal transcribed spacer region for PCR detection of Parafilaria bovicola in skin biopsies and serohemorrhagic exudates of cattle
    Article Snippet: Paragraph title: DNA extraction and PCR of adult P. bovicola ... Afterwards, the amplicons were inserted into the pCR4™4-TOPO® vector and cloned into One Shot® TOP10 chemically competent E. coli using the TOPO® TA Cloning® Kit for Sequencing (Invitrogen, Schwerte, Germany).

    Nucleic Acid Electrophoresis:

    Article Title: Sleeping site ecology, but not sex, affect ecto- and hemoparasite risk, in sympatric, arboreal primates (Avahi occidentalis and Lepilemur edwardsi)
    Article Snippet: The PCR products were visualized by gel electrophoresis on 1% agarose gels. .. The amplified fragment was inserted into the pCR4™4-TOPO® vector and cloned into One Shot® TOP10 chemically competent E. coli using TOPO® TA cloning kit for sequencing (Invitrogen, Karlsruhe, Germany).

    Magnetic Beads:

    Article Title: Aptamer-functionalized lipid nanoparticles targeting osteoblasts as a novel RNA interference–based bone anabolic strategy
    Article Snippet: The desired ssDNA was separated by streptavidin-coated magnetic beads (Promega). .. After multiple rounds of selection, the enriched ssDNA pool was cloned into TOP10 chemically competent Escherichia coli with the TA cloning kit (Invitrogen) and sequenced by Sangon, Shanghai, China.

    Mutagenesis:

    Article Title: A single amino acid switch converts the Sleeping Beauty transposase into an efficient unidirectional excisionase with utility in stem cell reprogramming
    Article Snippet: Paragraph title: Site-directed mutagenesis of the SB100X transposase ... The circularized PCR products were transformed into chemically competent E. coli (Invitrogen/Life Technologies, Carlsbad, CA, USA), grown in Luria-Bertani (LB) medium for 1 h, and selected for chloramphenicol resistance by plating on LB agar plates containing 25 μg/ml chloramphenicol.

    Isolation:

    Article Title: Diagnosing bovine parafilariosis: utility of the cytochrome c oxidase subunit 1 gene and internal transcribed spacer region for PCR detection of Parafilaria bovicola in skin biopsies and serohemorrhagic exudates of cattle
    Article Snippet: DNA extraction and PCR of adult P. bovicola Genomic DNA was isolated from an approximately 10 mm piece of the adult worm using the NucleoSpin® Tissue Kit (Macherey-Nagel, Düren, Germany). .. Afterwards, the amplicons were inserted into the pCR4™4-TOPO® vector and cloned into One Shot® TOP10 chemically competent E. coli using the TOPO® TA Cloning® Kit for Sequencing (Invitrogen, Schwerte, Germany).

    Article Title: Expression and purification of recombinant human coagulation factor VII fused to a histidine tag using Gateway technology
    Article Snippet: Paragraph title: Isolation of FVII cDNA and plasmid construction ... The reaction was then placed on ice and the pENTR TOPO/D-FVII construct was transformed to competent E. coli according to the manufacturer’s protocol (Invitrogen, USA).

    Purification:

    Article Title: A Short Caspase-3 Isoform Inhibits Chemotherapy-Induced Apoptosis by Blocking Apoptosome Assembly
    Article Snippet: The two transcripts were separated by a 3% agarose gel electrophoresis and purified by specific extraction with QIAquick Gel Extraction Kit (Qiagen, Courtaboeuf, France). .. The inserts were cloned into pcDNA3.1/CT-GFP-TOPO or pcDNA3.1/CT-YFP-TOPO and amplified in One Shot® TOP10 Chemically Competent E. Coli with Fusion TOPO® TA Expression Kits (Invitrogen).

    Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
    Article Snippet: After digestion, the vector was purified using a QIAquick PCR Purification Kit (Qiagen). .. After incubation at 50 ˚C for 1 h, the product w as transformed into One Shot Stbl3 chemically competent Escherichia coli (Invitrogen).

    Article Title: A single amino acid switch converts the Sleeping Beauty transposase into an efficient unidirectional excisionase with utility in stem cell reprogramming
    Article Snippet: The PCR products were purified with QIAquick PCR Purification Kit (QIAGEN, Venlo, Holland), eluted in 30 μl elution buffer and digested with 2 μl Dpn I (NEB, Ipswich, MA, USA) for 2 h at 37°C, followed by 20 min heat-inactivation at 80°C.The linear, double-stranded PCR products were circularized by ligation with T4 DNA Ligase (NEB, Ipswich, MA, USA) overnight at room temperature. .. The circularized PCR products were transformed into chemically competent E. coli (Invitrogen/Life Technologies, Carlsbad, CA, USA), grown in Luria-Bertani (LB) medium for 1 h, and selected for chloramphenicol resistance by plating on LB agar plates containing 25 μg/ml chloramphenicol.

    Article Title: In vitro isolation of small-molecule-binding aptamers with intrinsic dye-displacement functionality
    Article Snippet: Materials All oligonucleotides were ordered from Integrated DNA Technologies (IDT), purified with HPLC and dissolved in PCR quality water (Invitrogen). .. Streptavidin-coated agarose resin (binding capacity: 1−3 mg biotinylated BSA/ml resin), One Shot Chemically Competent Escherichia coli , and SYBR Gold were purchased from Thermo Scientific.

    Article Title: Sequence-Based Discovery Demonstrates That Fixed Light Chain Human Transgenic Rats Produce a Diverse Repertoire of Antigen-Specific Antibodies
    Article Snippet: .. We individually transformed each expression vector into TOP10 chemically competent E. coli according to manufacturer’s protocols (Thermo Fisher catalog number C404003), grew them for 24 h in 2 mL of LB culture media and purified them in 96-well format using the Qiagen Plasmid Plus 96 Kit according to the manufacturer’s protocol (Qiagen catalog number: 16181). .. We assessed the quantity and purity of the purified expression vectors by calculating the 260 and 280 nM absorbance ratio.

    Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
    Article Snippet: After digestion, the vector was purified using a QIAquick PCR Purification Kit (Qiagen). .. After incubation at 50 ˚C for 1 h, the product was transformed into One Shot Stbl3 chemically competent Escherichia coli (Invitrogen).

    Article Title: Phenotype-Specific Bacterial Communities in the Cold-Water Coral Lophelia pertusa (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ †
    Article Snippet: PCR products were purified and precipitated as described above (see “Restriction digests”). .. Cloning was carried out using the Topo TA cloning kit for sequencing with One Shot TOP10 chemically competent Escherichia coli (Invitrogen).

    Cytometry:

    Article Title: Aptamer-functionalized lipid nanoparticles targeting osteoblasts as a novel RNA interference–based bone anabolic strategy
    Article Snippet: After multiple rounds of selection, the enriched ssDNA pool was cloned into TOP10 chemically competent Escherichia coli with the TA cloning kit (Invitrogen) and sequenced by Sangon, Shanghai, China. .. Binding assays of enriched ssDNA with the target cells and non-target cells were performed by a FACScan cytometer (BD Immunocytometry Systems).

    Polymerase Chain Reaction:

    Article Title: A Short Caspase-3 Isoform Inhibits Chemotherapy-Induced Apoptosis by Blocking Apoptosome Assembly
    Article Snippet: PCR program was performed by one cycle at 45°C for 30 min, 94°C for 2 min followed by 35 cycles of 15 s at 94°C, 30 s at 50°C, 1 min at 68°C, and one final cycle for 5 min at 72°C (Abi Prism 9700 thermocycler, Applied Biosystems, Foster City, CA, USA). .. The inserts were cloned into pcDNA3.1/CT-GFP-TOPO or pcDNA3.1/CT-YFP-TOPO and amplified in One Shot® TOP10 Chemically Competent E. Coli with Fusion TOPO® TA Expression Kits (Invitrogen).

    Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
    Article Snippet: After digestion, the vector was purified using a QIAquick PCR Purification Kit (Qiagen). .. After incubation at 50 ˚C for 1 h, the product w as transformed into One Shot Stbl3 chemically competent Escherichia coli (Invitrogen).

    Article Title: Sleeping site ecology, but not sex, affect ecto- and hemoparasite risk, in sympatric, arboreal primates (Avahi occidentalis and Lepilemur edwardsi)
    Article Snippet: The PCR products were visualized by gel electrophoresis on 1% agarose gels. .. The amplified fragment was inserted into the pCR4™4-TOPO® vector and cloned into One Shot® TOP10 chemically competent E. coli using TOPO® TA cloning kit for sequencing (Invitrogen, Karlsruhe, Germany).

    Article Title: A single amino acid switch converts the Sleeping Beauty transposase into an efficient unidirectional excisionase with utility in stem cell reprogramming
    Article Snippet: .. The circularized PCR products were transformed into chemically competent E. coli (Invitrogen/Life Technologies, Carlsbad, CA, USA), grown in Luria-Bertani (LB) medium for 1 h, and selected for chloramphenicol resistance by plating on LB agar plates containing 25 μg/ml chloramphenicol. .. To confirm the presence of the desired mutations, DNAs from several single colonies were purified using the QIAprep spin miniprep kit (QIAGEN, Venlo, Holland) and were sequenced by GATC Biotech (Konstanz, Germany).

    Article Title: Diagnosing bovine parafilariosis: utility of the cytochrome c oxidase subunit 1 gene and internal transcribed spacer region for PCR detection of Parafilaria bovicola in skin biopsies and serohemorrhagic exudates of cattle
    Article Snippet: Paragraph title: DNA extraction and PCR of adult P. bovicola ... Afterwards, the amplicons were inserted into the pCR4™4-TOPO® vector and cloned into One Shot® TOP10 chemically competent E. coli using the TOPO® TA Cloning® Kit for Sequencing (Invitrogen, Schwerte, Germany).

    Article Title: In vitro isolation of small-molecule-binding aptamers with intrinsic dye-displacement functionality
    Article Snippet: Materials All oligonucleotides were ordered from Integrated DNA Technologies (IDT), purified with HPLC and dissolved in PCR quality water (Invitrogen). .. Streptavidin-coated agarose resin (binding capacity: 1−3 mg biotinylated BSA/ml resin), One Shot Chemically Competent Escherichia coli , and SYBR Gold were purchased from Thermo Scientific.

    Article Title: Does Wheat Genetically Modified for Disease Resistance Affect Root-Colonizing Pseudomonads and Arbuscular Mycorrhizal Fungi?
    Article Snippet: Cloning was performed using the TA cloning vector pJET1.2 (CloneJet PCR cloning kit; Fermentas, Glen Burnie, MD, USA). .. The constructs were transformed into chemically competent Escherichia coli One Shot® TOP 10 cells (Invitrogen, Carlsbad, CA, USA), and transformants containing the pJET1.2_pqqC construct were selected for sequencing.

    Article Title: Expression and purification of recombinant human coagulation factor VII fused to a histidine tag using Gateway technology
    Article Snippet: The blunt-end PCR products were then TOPO-cloned into pENTR TOPO/D vector according to the manufacturer’s protocol (Invitrogen, USA). .. The reaction was then placed on ice and the pENTR TOPO/D-FVII construct was transformed to competent E. coli according to the manufacturer’s protocol (Invitrogen, USA).

    Article Title: Aptamer-functionalized lipid nanoparticles targeting osteoblasts as a novel RNA interference–based bone anabolic strategy
    Article Snippet: Briefly, ssDNA library was incubated with 1–2 × 106 target cells at 37 °C for 0.5–1 h. After washing, the bound DNAs were eluted and then incubated with non-target cells at 37 °C for 1 h. The supernatant was desalted and amplified by PCR. .. After multiple rounds of selection, the enriched ssDNA pool was cloned into TOP10 chemically competent Escherichia coli with the TA cloning kit (Invitrogen) and sequenced by Sangon, Shanghai, China.

    Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
    Article Snippet: After digestion, the vector was purified using a QIAquick PCR Purification Kit (Qiagen). .. After incubation at 50 ˚C for 1 h, the product was transformed into One Shot Stbl3 chemically competent Escherichia coli (Invitrogen).

    Article Title: Phenotype-Specific Bacterial Communities in the Cold-Water Coral Lophelia pertusa (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ †
    Article Snippet: PCR products were purified and precipitated as described above (see “Restriction digests”). .. Cloning was carried out using the Topo TA cloning kit for sequencing with One Shot TOP10 chemically competent Escherichia coli (Invitrogen).

    Selection:

    Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
    Article Snippet: Swapping the locations of the ORF and selection marker was avoided so that residues from 2A peptide cleavage were not added to the N-terminal of the overexpressed TF. .. After incubation at 50 ˚C for 1 h, the product w as transformed into One Shot Stbl3 chemically competent Escherichia coli (Invitrogen).

    Article Title: A high-throughput immune-oncology screen identifies EGFR inhibitors as potent enhancers of antigen-specific cytotoxic T-lymphocyte tumor cell killing
    Article Snippet: Plasmids were transformed into One Shot Stbl3 Chemically Competent E. coli according to the manufacturer’s protocol (cat# C737303 Thermo Fisher, Waltham, MA). .. ID8-Cas9 cells were transduced with pXPR-sgEGFR-GFP-Blast and placed under G418 selection for seven days.

    Article Title: Aptamer-functionalized lipid nanoparticles targeting osteoblasts as a novel RNA interference–based bone anabolic strategy
    Article Snippet: .. After multiple rounds of selection, the enriched ssDNA pool was cloned into TOP10 chemically competent Escherichia coli with the TA cloning kit (Invitrogen) and sequenced by Sangon, Shanghai, China. .. Binding assays of enriched ssDNA with the target cells and non-target cells were performed by a FACScan cytometer (BD Immunocytometry Systems).

    CRISPR:

    Article Title: CRISPR/Cas9 gene editing for the creation of an MGAT1-deficient CHO cell line to control HIV-1 vaccine glycosylation
    Article Snippet: Paragraph title: CRISPR/Cas9 target design and plasmid preparation ... One Shot TOP10 Chemically Competent Escherichia coli were transformed and plated following the Invitrogen protocol (Thermo Fisher, Invitrogen, Carlsbad, CA, US).

    Plasmid Preparation:

    Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
    Article Snippet: Each transcription factor vector was then individually assembled via Gibson assembly. .. After incubation at 50 ˚C for 1 h, the product w as transformed into One Shot Stbl3 chemically competent Escherichia coli (Invitrogen).

    Article Title: Sleeping site ecology, but not sex, affect ecto- and hemoparasite risk, in sympatric, arboreal primates (Avahi occidentalis and Lepilemur edwardsi)
    Article Snippet: .. The amplified fragment was inserted into the pCR4™4-TOPO® vector and cloned into One Shot® TOP10 chemically competent E. coli using TOPO® TA cloning kit for sequencing (Invitrogen, Karlsruhe, Germany). .. Plasmid DNA was obtained using the NucleoSpin® Plasmid Kit (Macherey-Nagel, Dueren, Germany) following the manufacturer’s recommendations.

    Article Title: Diagnosing bovine parafilariosis: utility of the cytochrome c oxidase subunit 1 gene and internal transcribed spacer region for PCR detection of Parafilaria bovicola in skin biopsies and serohemorrhagic exudates of cattle
    Article Snippet: .. Afterwards, the amplicons were inserted into the pCR4™4-TOPO® vector and cloned into One Shot® TOP10 chemically competent E. coli using the TOPO® TA Cloning® Kit for Sequencing (Invitrogen, Schwerte, Germany). .. Plasmid DNA was obtained using the NucleoSpin® Plasmid Kit (Macherey-Nagel) following the manufacturer’s recommendations.

    Article Title: CRISPR/Cas9 gene editing for the creation of an MGAT1-deficient CHO cell line to control HIV-1 vaccine glycosylation
    Article Snippet: Paragraph title: CRISPR/Cas9 target design and plasmid preparation ... One Shot TOP10 Chemically Competent Escherichia coli were transformed and plated following the Invitrogen protocol (Thermo Fisher, Invitrogen, Carlsbad, CA, US).

    Article Title: A high-throughput immune-oncology screen identifies EGFR inhibitors as potent enhancers of antigen-specific cytotoxic T-lymphocyte tumor cell killing
    Article Snippet: The top four scoring sgRNA targeting EGFR (sequences listed in ) were ordered as oligos from IDT (Coralville, Iowa) and ligated into BsmBI site in pXPR-sgRNA-GFP-Blast expression vector (Addgene, Cambridge, MA) using Quick Ligation Kit according to manufacturer’s protocol (cat# M2200S New England Biolabs, Ipswich, MA). .. Plasmids were transformed into One Shot Stbl3 Chemically Competent E. coli according to the manufacturer’s protocol (cat# C737303 Thermo Fisher, Waltham, MA).

    Article Title: Does Wheat Genetically Modified for Disease Resistance Affect Root-Colonizing Pseudomonads and Arbuscular Mycorrhizal Fungi?
    Article Snippet: Cloning was performed using the TA cloning vector pJET1.2 (CloneJet PCR cloning kit; Fermentas, Glen Burnie, MD, USA). .. The constructs were transformed into chemically competent Escherichia coli One Shot® TOP 10 cells (Invitrogen, Carlsbad, CA, USA), and transformants containing the pJET1.2_pqqC construct were selected for sequencing.

    Article Title: Expression and purification of recombinant human coagulation factor VII fused to a histidine tag using Gateway technology
    Article Snippet: Paragraph title: Isolation of FVII cDNA and plasmid construction ... The reaction was then placed on ice and the pENTR TOPO/D-FVII construct was transformed to competent E. coli according to the manufacturer’s protocol (Invitrogen, USA).

    Article Title: Sequence-Based Discovery Demonstrates That Fixed Light Chain Human Transgenic Rats Produce a Diverse Repertoire of Antigen-Specific Antibodies
    Article Snippet: .. We individually transformed each expression vector into TOP10 chemically competent E. coli according to manufacturer’s protocols (Thermo Fisher catalog number C404003), grew them for 24 h in 2 mL of LB culture media and purified them in 96-well format using the Qiagen Plasmid Plus 96 Kit according to the manufacturer’s protocol (Qiagen catalog number: 16181). .. We assessed the quantity and purity of the purified expression vectors by calculating the 260 and 280 nM absorbance ratio.

    Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
    Article Snippet: Each transcription factor vector was then individually assembled via Gibson assembly. .. After incubation at 50 ˚C for 1 h, the product was transformed into One Shot Stbl3 chemically competent Escherichia coli (Invitrogen).

    Article Title: Phenotype-Specific Bacterial Communities in the Cold-Water Coral Lophelia pertusa (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ (Scleractinia) and Their Implications for the Coral's Nutrition, Health, and Distribution ▿ †
    Article Snippet: Cloning was carried out using the Topo TA cloning kit for sequencing with One Shot TOP10 chemically competent Escherichia coli (Invitrogen). .. This kit was preferred for its high reliability, but it required DNA inserts with a 3′ adenosine overlap for ligation with the cloning vector.

    Software:

    Article Title: Sleeping site ecology, but not sex, affect ecto- and hemoparasite risk, in sympatric, arboreal primates (Avahi occidentalis and Lepilemur edwardsi)
    Article Snippet: The amplified fragment was inserted into the pCR4™4-TOPO® vector and cloned into One Shot® TOP10 chemically competent E. coli using TOPO® TA cloning kit for sequencing (Invitrogen, Karlsruhe, Germany). .. The obtained sequence was analysed using Clone Manager Professional Edition 9 (Sci-Ed Software, Denver, USA) and compared to publicly available sequences using BLAST [ ].

    Article Title: A single amino acid switch converts the Sleeping Beauty transposase into an efficient unidirectional excisionase with utility in stem cell reprogramming
    Article Snippet: The annealing temperatures of the mutagenic primers were calculated with the ‘NEB Tm calculator™’ software ( https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator ). .. The circularized PCR products were transformed into chemically competent E. coli (Invitrogen/Life Technologies, Carlsbad, CA, USA), grown in Luria-Bertani (LB) medium for 1 h, and selected for chloramphenicol resistance by plating on LB agar plates containing 25 μg/ml chloramphenicol.

    Article Title: Aptamer-functionalized lipid nanoparticles targeting osteoblasts as a novel RNA interference–based bone anabolic strategy
    Article Snippet: After multiple rounds of selection, the enriched ssDNA pool was cloned into TOP10 chemically competent Escherichia coli with the TA cloning kit (Invitrogen) and sequenced by Sangon, Shanghai, China. .. Secondary structures were predicted by RNAstructure 5.6 software.

    Denaturing Gradient Gel Electrophoresis:

    Article Title: Does Wheat Genetically Modified for Disease Resistance Affect Root-Colonizing Pseudomonads and Arbuscular Mycorrhizal Fungi?
    Article Snippet: Paragraph title: Sequencing and cloning of DGGE bands ... The constructs were transformed into chemically competent Escherichia coli One Shot® TOP 10 cells (Invitrogen, Carlsbad, CA, USA), and transformants containing the pJET1.2_pqqC construct were selected for sequencing.

    Agarose Gel Electrophoresis:

    Article Title: A Short Caspase-3 Isoform Inhibits Chemotherapy-Induced Apoptosis by Blocking Apoptosome Assembly
    Article Snippet: The two transcripts were separated by a 3% agarose gel electrophoresis and purified by specific extraction with QIAquick Gel Extraction Kit (Qiagen, Courtaboeuf, France). .. The inserts were cloned into pcDNA3.1/CT-GFP-TOPO or pcDNA3.1/CT-YFP-TOPO and amplified in One Shot® TOP10 Chemically Competent E. Coli with Fusion TOPO® TA Expression Kits (Invitrogen).

    Knock-Out:

    Article Title: CRISPR/Cas9 gene editing for the creation of an MGAT1-deficient CHO cell line to control HIV-1 vaccine glycosylation
    Article Snippet: Three target sequences to knock out the CHO-S MGAT1 gene were designed using an online CRISPR RNA Configurator tool (GE Dharmacon, Lafayette, CO, US): Target 1: CCCTGGAACTTGCGGTGGTC; Target 2: GGGCATTCCAGCCCACAAAG; Target 3: GGCGGAACACCTCACGGGTG. .. One Shot TOP10 Chemically Competent Escherichia coli were transformed and plated following the Invitrogen protocol (Thermo Fisher, Invitrogen, Carlsbad, CA, US).

    Sampling:

    Article Title: Sequence-Based Discovery Demonstrates That Fixed Light Chain Human Transgenic Rats Produce a Diverse Repertoire of Antigen-Specific Antibodies
    Article Snippet: We chose a representative sampling of heavy chain variable sequences from the diversity of clonotypes identified in each animal to express and measure antigen binding by ELISA. .. We individually transformed each expression vector into TOP10 chemically competent E. coli according to manufacturer’s protocols (Thermo Fisher catalog number C404003), grew them for 24 h in 2 mL of LB culture media and purified them in 96-well format using the Qiagen Plasmid Plus 96 Kit according to the manufacturer’s protocol (Qiagen catalog number: 16181).

    Concentration Assay:

    Article Title: Sequence-Based Discovery Demonstrates That Fixed Light Chain Human Transgenic Rats Produce a Diverse Repertoire of Antigen-Specific Antibodies
    Article Snippet: We individually transformed each expression vector into TOP10 chemically competent E. coli according to manufacturer’s protocols (Thermo Fisher catalog number C404003), grew them for 24 h in 2 mL of LB culture media and purified them in 96-well format using the Qiagen Plasmid Plus 96 Kit according to the manufacturer’s protocol (Qiagen catalog number: 16181). .. After purification and spectroscopic analysis, we then normalized the concentration of each vector.

    Marker:

    Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
    Article Snippet: Swapping the locations of the ORF and selection marker was avoided so that residues from 2A peptide cleavage were not added to the N-terminal of the overexpressed TF. .. After incubation at 50 ˚C for 1 h, the product w as transformed into One Shot Stbl3 chemically competent Escherichia coli (Invitrogen).

    Recombinant:

    Article Title: Sequence-Based Discovery Demonstrates That Fixed Light Chain Human Transgenic Rats Produce a Diverse Repertoire of Antigen-Specific Antibodies
    Article Snippet: Paragraph title: Recombinant Antibody Expression and ELISA Assays ... We individually transformed each expression vector into TOP10 chemically competent E. coli according to manufacturer’s protocols (Thermo Fisher catalog number C404003), grew them for 24 h in 2 mL of LB culture media and purified them in 96-well format using the Qiagen Plasmid Plus 96 Kit according to the manufacturer’s protocol (Qiagen catalog number: 16181).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 80
    Thermo Fisher e coli cells expressing eif4a wt
    RocA clamps <t>eIF4A</t> on polypurine motif even after ATP hydrolysis (a, b) Direct measurement of the eIF4A/RNA affinity by fluorescence polarization for eIF4A and 5′ FAM-labeled RNAs in the presence or absence of RocA. Data represent mean and S.D. (n = 3). (c) Motif enrichments along entire 4-mer motifs in Bind-n-Seq with ADP + Pi and highest-scoring elements (inset). (d) Competition assay with unlabeled RNA. Data represent mean (n = 3). (e) Ribosome toeprinting assay performed in RRL in the presence of GMP-PNP in the presence or absence of 3 μM RocA treatment. (f) Relative RNase I cleavage protected by eIF4A/RocA complex on mRNA containg one AGAGAG at the middle in footprinting assay. See the original data in Extended Data Figure 9f .
    E Coli Cells Expressing Eif4a Wt, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 80/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli cells expressing eif4a wt/product/Thermo Fisher
    Average 80 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    e coli cells expressing eif4a wt - by Bioz Stars, 2020-03
    80/100 stars
      Buy from Supplier

    89
    Thermo Fisher functional complementation assays
    RocA clamps <t>eIF4A</t> on polypurine motif even after ATP hydrolysis (a, b) Direct measurement of the eIF4A/RNA affinity by fluorescence polarization for eIF4A and 5′ FAM-labeled RNAs in the presence or absence of RocA. Data represent mean and S.D. (n = 3). (c) Motif enrichments along entire 4-mer motifs in Bind-n-Seq with ADP + Pi and highest-scoring elements (inset). (d) Competition assay with unlabeled RNA. Data represent mean (n = 3). (e) Ribosome toeprinting assay performed in RRL in the presence of GMP-PNP in the presence or absence of 3 μM RocA treatment. (f) Relative RNase I cleavage protected by eIF4A/RocA complex on mRNA containg one AGAGAG at the middle in footprinting assay. See the original data in Extended Data Figure 9f .
    Functional Complementation Assays, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/functional complementation assays/product/Thermo Fisher
    Average 89 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    functional complementation assays - by Bioz Stars, 2020-03
    89/100 stars
      Buy from Supplier

    79
    Thermo Fisher csga gene
    RocA clamps <t>eIF4A</t> on polypurine motif even after ATP hydrolysis (a, b) Direct measurement of the eIF4A/RNA affinity by fluorescence polarization for eIF4A and 5′ FAM-labeled RNAs in the presence or absence of RocA. Data represent mean and S.D. (n = 3). (c) Motif enrichments along entire 4-mer motifs in Bind-n-Seq with ADP + Pi and highest-scoring elements (inset). (d) Competition assay with unlabeled RNA. Data represent mean (n = 3). (e) Ribosome toeprinting assay performed in RRL in the presence of GMP-PNP in the presence or absence of 3 μM RocA treatment. (f) Relative RNase I cleavage protected by eIF4A/RocA complex on mRNA containg one AGAGAG at the middle in footprinting assay. See the original data in Extended Data Figure 9f .
    Csga Gene, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/csga gene/product/Thermo Fisher
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    csga gene - by Bioz Stars, 2020-03
    79/100 stars
      Buy from Supplier

    Image Search Results


    RocA clamps eIF4A on polypurine motif even after ATP hydrolysis (a, b) Direct measurement of the eIF4A/RNA affinity by fluorescence polarization for eIF4A and 5′ FAM-labeled RNAs in the presence or absence of RocA. Data represent mean and S.D. (n = 3). (c) Motif enrichments along entire 4-mer motifs in Bind-n-Seq with ADP + Pi and highest-scoring elements (inset). (d) Competition assay with unlabeled RNA. Data represent mean (n = 3). (e) Ribosome toeprinting assay performed in RRL in the presence of GMP-PNP in the presence or absence of 3 μM RocA treatment. (f) Relative RNase I cleavage protected by eIF4A/RocA complex on mRNA containg one AGAGAG at the middle in footprinting assay. See the original data in Extended Data Figure 9f .

    Journal: Nature

    Article Title: Rocaglates convert DEAD-box protein eIF4A into a sequence-selective translational repressor

    doi: 10.1038/nature17978

    Figure Lengend Snippet: RocA clamps eIF4A on polypurine motif even after ATP hydrolysis (a, b) Direct measurement of the eIF4A/RNA affinity by fluorescence polarization for eIF4A and 5′ FAM-labeled RNAs in the presence or absence of RocA. Data represent mean and S.D. (n = 3). (c) Motif enrichments along entire 4-mer motifs in Bind-n-Seq with ADP + Pi and highest-scoring elements (inset). (d) Competition assay with unlabeled RNA. Data represent mean (n = 3). (e) Ribosome toeprinting assay performed in RRL in the presence of GMP-PNP in the presence or absence of 3 μM RocA treatment. (f) Relative RNase I cleavage protected by eIF4A/RocA complex on mRNA containg one AGAGAG at the middle in footprinting assay. See the original data in Extended Data Figure 9f .

    Article Snippet: Pulldown assay The lysate of E. coli cells expressing eIF4A WT or eIF4A D296A-T298K proteins from 1 ml culture was prepared as described in “Purification of recombinant eIF4A proteins“ and incubated with 10 μl of HisPur Ni-NTA Magnetic Beads (Thermo Scientific) at 4 °C for 30 min.

    Techniques: Fluorescence, Labeling, Competitive Binding Assay, Toeprinting Assay, Footprinting

    Purification of SBP-tagged eIF4A and co-purified RNA from HEK 293 cells (a) Western blot of exogenous SBP-eIF4A and endogenous eIF4A in tetracycline-inducible stable cell line. Expression of physiological levels of the tagged allele attenuated endogenous eIF4A expression but preserved overall eIF4A levels, likely reflecting the same feedback loop previously reported between eIF4AI and eIF4AII 31 . (b) CBB staining of purified SBP-eIF4A and SYBR Gold staining of purified RNA bound to SBP-eIF4A with or without Micrococcal Nuclease (MNase). (c) Correlation of sum of the mRNA fragment reads of each transcript between biological replicates of RIP-seq. r is Pearson’s correlation coefficient. P value is calculated by Student′s t-test. (d) Histogram of the number of transcripts along RNA/eIF4A interaction -fold change by RIP-Seq when cells are treated with 0.03 or 0.3 µM RocA normalized to spiked-in RNA. Data present the same mRNAs analyzed in Figure 1a . Median -fold change is shown. Bin width is 0.1. (e) Correlation of RIP -fold change between different concentration of RocA treatments. ρ: Spearman’s rank correlation coefficient. (f) Correlation of translation -fold change to RIP -fold change with the same concentration of RocA treatment. ρ: Spearman’s rank correlation.

    Journal: Nature

    Article Title: Rocaglates convert DEAD-box protein eIF4A into a sequence-selective translational repressor

    doi: 10.1038/nature17978

    Figure Lengend Snippet: Purification of SBP-tagged eIF4A and co-purified RNA from HEK 293 cells (a) Western blot of exogenous SBP-eIF4A and endogenous eIF4A in tetracycline-inducible stable cell line. Expression of physiological levels of the tagged allele attenuated endogenous eIF4A expression but preserved overall eIF4A levels, likely reflecting the same feedback loop previously reported between eIF4AI and eIF4AII 31 . (b) CBB staining of purified SBP-eIF4A and SYBR Gold staining of purified RNA bound to SBP-eIF4A with or without Micrococcal Nuclease (MNase). (c) Correlation of sum of the mRNA fragment reads of each transcript between biological replicates of RIP-seq. r is Pearson’s correlation coefficient. P value is calculated by Student′s t-test. (d) Histogram of the number of transcripts along RNA/eIF4A interaction -fold change by RIP-Seq when cells are treated with 0.03 or 0.3 µM RocA normalized to spiked-in RNA. Data present the same mRNAs analyzed in Figure 1a . Median -fold change is shown. Bin width is 0.1. (e) Correlation of RIP -fold change between different concentration of RocA treatments. ρ: Spearman’s rank correlation coefficient. (f) Correlation of translation -fold change to RIP -fold change with the same concentration of RocA treatment. ρ: Spearman’s rank correlation.

    Article Snippet: Pulldown assay The lysate of E. coli cells expressing eIF4A WT or eIF4A D296A-T298K proteins from 1 ml culture was prepared as described in “Purification of recombinant eIF4A proteins“ and incubated with 10 μl of HisPur Ni-NTA Magnetic Beads (Thermo Scientific) at 4 °C for 30 min.

    Techniques: Purification, Western Blot, Stable Transfection, Expressing, Staining, Concentration Assay

    eIF4A/RNA affinity measured by fluorescence polarization (a) CBB staining of recombinant proteins used in this study. (b) Summary of K d between RNA and eIF4A among the conditions assayed. (c, e-g, i) Direct measurement of the eIF4A/RNA affinity by fluorescence polarization for eIF4A WT, eIF4A (VX 4 GKT), or eIF4A (D296A-T298K) and 5′ FAM-labeled RNAs in the presence or absence of RocA. Data represent mean and S.D. (n = 3). (d) ATP crosslinking assay with eIF4A WT and eIF4A (VX 4 GKT). (h) Pulldown assay with His-MBP-eIF4A expressed in E. coli and eIF4E/G in RRL.

    Journal: Nature

    Article Title: Rocaglates convert DEAD-box protein eIF4A into a sequence-selective translational repressor

    doi: 10.1038/nature17978

    Figure Lengend Snippet: eIF4A/RNA affinity measured by fluorescence polarization (a) CBB staining of recombinant proteins used in this study. (b) Summary of K d between RNA and eIF4A among the conditions assayed. (c, e-g, i) Direct measurement of the eIF4A/RNA affinity by fluorescence polarization for eIF4A WT, eIF4A (VX 4 GKT), or eIF4A (D296A-T298K) and 5′ FAM-labeled RNAs in the presence or absence of RocA. Data represent mean and S.D. (n = 3). (d) ATP crosslinking assay with eIF4A WT and eIF4A (VX 4 GKT). (h) Pulldown assay with His-MBP-eIF4A expressed in E. coli and eIF4E/G in RRL.

    Article Snippet: Pulldown assay The lysate of E. coli cells expressing eIF4A WT or eIF4A D296A-T298K proteins from 1 ml culture was prepared as described in “Purification of recombinant eIF4A proteins“ and incubated with 10 μl of HisPur Ni-NTA Magnetic Beads (Thermo Scientific) at 4 °C for 30 min.

    Techniques: Fluorescence, Staining, Recombinant, Labeling

    RNA Bind-n-Seq and iCLIP reveal that RocA preferentially increases the affinity between eIF4A and polypurine motif (a) Correlations between 4-mer motif enrichment in Bind-n-Seq by 0.03 µM RocA treatment and motif prediction of 0.03 µM RocA effect in RIP-Seq. ρ: Spearman’s rank correlation. (b) Highest-scoring elements in Bind-n-Seq and RIP-Seq. (c) The change in mRNA binding for mRNAs with or without the enriched 4-mer motif (b) in their 5′ UTRs is shown as the RIP -fold change by RocA normalized to spike-in RNA. Significance is calculated by Mann-Whitney U test. (d) Enrichment of 4-mer motifs (b) in iCLIP by RocA treatment relative to control DMSO treatment. (e) The frequency of the 4-mer motif (b) in the 5′ UTR predicts whether a mRNA is high- or low-sensitivity, based on the difference in cumulative distributions of motifs in the 5′ UTR. Significance is calculated by Mann-Whitney U test. (f) Reporter assay in HEK 293 cells with a CAA-repeat 5′ UTR containing seven polypurine motif (AGAGAG) insertions ( Extended Data Figure 9a ). Data represent mean and S.D. (n = 3).

    Journal: Nature

    Article Title: Rocaglates convert DEAD-box protein eIF4A into a sequence-selective translational repressor

    doi: 10.1038/nature17978

    Figure Lengend Snippet: RNA Bind-n-Seq and iCLIP reveal that RocA preferentially increases the affinity between eIF4A and polypurine motif (a) Correlations between 4-mer motif enrichment in Bind-n-Seq by 0.03 µM RocA treatment and motif prediction of 0.03 µM RocA effect in RIP-Seq. ρ: Spearman’s rank correlation. (b) Highest-scoring elements in Bind-n-Seq and RIP-Seq. (c) The change in mRNA binding for mRNAs with or without the enriched 4-mer motif (b) in their 5′ UTRs is shown as the RIP -fold change by RocA normalized to spike-in RNA. Significance is calculated by Mann-Whitney U test. (d) Enrichment of 4-mer motifs (b) in iCLIP by RocA treatment relative to control DMSO treatment. (e) The frequency of the 4-mer motif (b) in the 5′ UTR predicts whether a mRNA is high- or low-sensitivity, based on the difference in cumulative distributions of motifs in the 5′ UTR. Significance is calculated by Mann-Whitney U test. (f) Reporter assay in HEK 293 cells with a CAA-repeat 5′ UTR containing seven polypurine motif (AGAGAG) insertions ( Extended Data Figure 9a ). Data represent mean and S.D. (n = 3).

    Article Snippet: Pulldown assay The lysate of E. coli cells expressing eIF4A WT or eIF4A D296A-T298K proteins from 1 ml culture was prepared as described in “Purification of recombinant eIF4A proteins“ and incubated with 10 μl of HisPur Ni-NTA Magnetic Beads (Thermo Scientific) at 4 °C for 30 min.

    Techniques: Binding Assay, MANN-WHITNEY, Reporter Assay, Cellular Antioxidant Activity Assay

    Characterization of toeprinting assay (a) Diagram of the reporters used in this study. (b, and c) In vitro translation in RRL with mRNAs containing seven polypurine motif (AGAGAG) insertions (b) and qPCR from the samples (c). (d) Dideoxy terminated sequencing of RNA by reverse transcription verified the toeprinting product length terminated by 48S ribosomes. (e) Ribosome toeprinting assay performed in RRL in the presence of m7-GTP in the presence or absence of 3 μM RocA treatment. (f) Toeprinting assay using 10 μM recombinant eIF4A in the presence or absence of 10 μM RocA treatment. (g) Toeprinting assay (top) and RNase I footprinting assay (bottom) using 10 μM recombinant eIF4A with mRNA containing one AGAGAG motif at the middle in the presence or absence of 10 μM RocA treatment. (h and i) Toeprinting assay using 10 μM recombinant eIF4A (VX 4 GKT) or (D296A-T298K) with mRNA containing seven AGAGAG motifs in the presence or absence of 10 μM RocA treatment. (j) Pre-formation of the complex with RocA and eIF4A (VX 4 GKT) or (D296A-T298K) on the mRNA bearing seven polypurine motifs represses the translation from the mRNA in RRL. (k) Basal translation level from mRNA containing seven AGAGAG with the supplementation of recombinant eIF4A. (l) In vitro translation in RRL with mRNAs with single polypurine motif (AGAGAG) insertion at the different positions in 5′ UTR (m) Basal translation level from mRNAs bearing PV IRES and PV IRES with three AGAGAG. In b-c and h-j, data represent mean and S.D. (n = 3).

    Journal: Nature

    Article Title: Rocaglates convert DEAD-box protein eIF4A into a sequence-selective translational repressor

    doi: 10.1038/nature17978

    Figure Lengend Snippet: Characterization of toeprinting assay (a) Diagram of the reporters used in this study. (b, and c) In vitro translation in RRL with mRNAs containing seven polypurine motif (AGAGAG) insertions (b) and qPCR from the samples (c). (d) Dideoxy terminated sequencing of RNA by reverse transcription verified the toeprinting product length terminated by 48S ribosomes. (e) Ribosome toeprinting assay performed in RRL in the presence of m7-GTP in the presence or absence of 3 μM RocA treatment. (f) Toeprinting assay using 10 μM recombinant eIF4A in the presence or absence of 10 μM RocA treatment. (g) Toeprinting assay (top) and RNase I footprinting assay (bottom) using 10 μM recombinant eIF4A with mRNA containing one AGAGAG motif at the middle in the presence or absence of 10 μM RocA treatment. (h and i) Toeprinting assay using 10 μM recombinant eIF4A (VX 4 GKT) or (D296A-T298K) with mRNA containing seven AGAGAG motifs in the presence or absence of 10 μM RocA treatment. (j) Pre-formation of the complex with RocA and eIF4A (VX 4 GKT) or (D296A-T298K) on the mRNA bearing seven polypurine motifs represses the translation from the mRNA in RRL. (k) Basal translation level from mRNA containing seven AGAGAG with the supplementation of recombinant eIF4A. (l) In vitro translation in RRL with mRNAs with single polypurine motif (AGAGAG) insertion at the different positions in 5′ UTR (m) Basal translation level from mRNAs bearing PV IRES and PV IRES with three AGAGAG. In b-c and h-j, data represent mean and S.D. (n = 3).

    Article Snippet: Pulldown assay The lysate of E. coli cells expressing eIF4A WT or eIF4A D296A-T298K proteins from 1 ml culture was prepared as described in “Purification of recombinant eIF4A proteins“ and incubated with 10 μl of HisPur Ni-NTA Magnetic Beads (Thermo Scientific) at 4 °C for 30 min.

    Techniques: Toeprinting Assay, In Vitro, Real-time Polymerase Chain Reaction, Sequencing, Recombinant, Footprinting

    eIF4A/RocA complexes on polypurine motifs block scanning of pre-initiation complex, inducing uORF translation (a) Pre-formation of the complex with RocA and eIF4A on the mRNA bearing seven polypurine motifs represses the translation from the mRNA in RRL. (b) The supplementation of recombinant eIF4A protein to RRL in vitro transaltion reaction with 10 μM Hipp or 3 μM RocA. (c) In vitro translation in RRL with mRNAs with native PV IRES and that with three polypurine motifs ( Extended Data Figure 9a ). (d) Meta-gene analysis of high-sensitivity transcripts to RocA. Reads are normalized to the sum of mitochondrial footprints reads. Histogram of the position of the first polypurine motif (6-mer) after uORF initiation codon (inset). P value is calculated by Fisher’s exact test. Bin width is 12 nt. (e) Western blot of SBP translated from uORF and downstream major ORF in RRL with 0.03 μM RocA treatment. Quantification of bands normalized to long form with DMSO treatment is shown. For gel source data, see Supplementary Fig. 1 . (f) Schematic representation of RocA-mediated translation control. RocA clamps eIF4A onto mRNA by selective affinity enhancement for a polypurine motif in eIF4F-, cap-, and ATP-independent manners, which then blocks scanning of pre-initiation complex, introducing premature translation from uORF and inhibiting downstream ORF translation. In b and c, data represent mean and S.D. (n = 3).

    Journal: Nature

    Article Title: Rocaglates convert DEAD-box protein eIF4A into a sequence-selective translational repressor

    doi: 10.1038/nature17978

    Figure Lengend Snippet: eIF4A/RocA complexes on polypurine motifs block scanning of pre-initiation complex, inducing uORF translation (a) Pre-formation of the complex with RocA and eIF4A on the mRNA bearing seven polypurine motifs represses the translation from the mRNA in RRL. (b) The supplementation of recombinant eIF4A protein to RRL in vitro transaltion reaction with 10 μM Hipp or 3 μM RocA. (c) In vitro translation in RRL with mRNAs with native PV IRES and that with three polypurine motifs ( Extended Data Figure 9a ). (d) Meta-gene analysis of high-sensitivity transcripts to RocA. Reads are normalized to the sum of mitochondrial footprints reads. Histogram of the position of the first polypurine motif (6-mer) after uORF initiation codon (inset). P value is calculated by Fisher’s exact test. Bin width is 12 nt. (e) Western blot of SBP translated from uORF and downstream major ORF in RRL with 0.03 μM RocA treatment. Quantification of bands normalized to long form with DMSO treatment is shown. For gel source data, see Supplementary Fig. 1 . (f) Schematic representation of RocA-mediated translation control. RocA clamps eIF4A onto mRNA by selective affinity enhancement for a polypurine motif in eIF4F-, cap-, and ATP-independent manners, which then blocks scanning of pre-initiation complex, introducing premature translation from uORF and inhibiting downstream ORF translation. In b and c, data represent mean and S.D. (n = 3).

    Article Snippet: Pulldown assay The lysate of E. coli cells expressing eIF4A WT or eIF4A D296A-T298K proteins from 1 ml culture was prepared as described in “Purification of recombinant eIF4A proteins“ and incubated with 10 μl of HisPur Ni-NTA Magnetic Beads (Thermo Scientific) at 4 °C for 30 min.

    Techniques: Blocking Assay, Recombinant, In Vitro, Western Blot

    Characterization of iCLIP data (a) CBB staining of purified SBP-eIF4A protein in iCLIP procedure. (b) Visualization of RNA-crosslinked with SBP-eIF4A and unknown proteins by 32 P labeling of RNA. We avoided the contamination of RNAs cross-linked to the additional, co-purifying, unknown proteins. (c) Distribution of read length in iCLIP libraries. Avoidance of contaminating RNAs restricted us to short RNAs, which likely correspond to the region of RNA physically protected by eIF4A binding, or footprint (d) Nucleotide bias along the reads in iCLIP libraries. The crosslinking bias for U may underestimate the preference for polypurine motifs. (e) Correlations of iCLIP motif enrichment (4-mer) by different RocA concentrations. (f) Correlations of iCLIP motif enrichment (4-mer) by 3 μM RocA and motif prediction of 0.03 μM RocA effect in RIP-Seq. The motifs shown in Figure 3b are highlighted. ρ: Spearman’s rank correlation.

    Journal: Nature

    Article Title: Rocaglates convert DEAD-box protein eIF4A into a sequence-selective translational repressor

    doi: 10.1038/nature17978

    Figure Lengend Snippet: Characterization of iCLIP data (a) CBB staining of purified SBP-eIF4A protein in iCLIP procedure. (b) Visualization of RNA-crosslinked with SBP-eIF4A and unknown proteins by 32 P labeling of RNA. We avoided the contamination of RNAs cross-linked to the additional, co-purifying, unknown proteins. (c) Distribution of read length in iCLIP libraries. Avoidance of contaminating RNAs restricted us to short RNAs, which likely correspond to the region of RNA physically protected by eIF4A binding, or footprint (d) Nucleotide bias along the reads in iCLIP libraries. The crosslinking bias for U may underestimate the preference for polypurine motifs. (e) Correlations of iCLIP motif enrichment (4-mer) by different RocA concentrations. (f) Correlations of iCLIP motif enrichment (4-mer) by 3 μM RocA and motif prediction of 0.03 μM RocA effect in RIP-Seq. The motifs shown in Figure 3b are highlighted. ρ: Spearman’s rank correlation.

    Article Snippet: Pulldown assay The lysate of E. coli cells expressing eIF4A WT or eIF4A D296A-T298K proteins from 1 ml culture was prepared as described in “Purification of recombinant eIF4A proteins“ and incubated with 10 μl of HisPur Ni-NTA Magnetic Beads (Thermo Scientific) at 4 °C for 30 min.

    Techniques: Staining, Purification, Labeling, Binding Assay

    RocA represses translation, targeting to eIF4A (a) Polysome profiling experiments with RocA and PP242 treatments. RocA disrupts polysomes dose-dependently. (b) Western blot of phospho-eIF2α and phospho-4EBP shows that effect of RocA is independent of known translation control targeting to eIFs. Phosphorylation of eIF2α and dephosphorylation of 4EBP were induced by Thapsigargin and PP242, respectively. (c and d) Luciferase reporter assay possessing PTGES3 5′ UTR ( Figure 1c ) with exogenous expression of WT or RocA resistant eIF4A mutants (c) and western blot of endogenous and exogenous eIF4A (d). eIF4A is the main molecular target of RocA. Data represent mean and S.D. (n = 3). (e and f) Correlation of sum of the footprint reads to 13 mitochondrial mRNAs among different conditions (e) and correlation of sum of the footprint reads from cytoplasmic ribosomes to each transcript between biological replicates (f). r is Pearson’s correlation. P value is calculated by Student′s t-test. (g and h) Tile plot of codon periodicity along length of mitochondria footprints (g, left) and mitochondria footprint length distribution (g, right) and codon periodicities of 31 nt mitochondrial footprints among different conditions (h). Footprints with 31-nt length showed most homogenous codon periodicity and this periodicity was retained with RocA treatment, showing that mitochondrial ribosome translates even in high doses of RocA.

    Journal: Nature

    Article Title: Rocaglates convert DEAD-box protein eIF4A into a sequence-selective translational repressor

    doi: 10.1038/nature17978

    Figure Lengend Snippet: RocA represses translation, targeting to eIF4A (a) Polysome profiling experiments with RocA and PP242 treatments. RocA disrupts polysomes dose-dependently. (b) Western blot of phospho-eIF2α and phospho-4EBP shows that effect of RocA is independent of known translation control targeting to eIFs. Phosphorylation of eIF2α and dephosphorylation of 4EBP were induced by Thapsigargin and PP242, respectively. (c and d) Luciferase reporter assay possessing PTGES3 5′ UTR ( Figure 1c ) with exogenous expression of WT or RocA resistant eIF4A mutants (c) and western blot of endogenous and exogenous eIF4A (d). eIF4A is the main molecular target of RocA. Data represent mean and S.D. (n = 3). (e and f) Correlation of sum of the footprint reads to 13 mitochondrial mRNAs among different conditions (e) and correlation of sum of the footprint reads from cytoplasmic ribosomes to each transcript between biological replicates (f). r is Pearson’s correlation. P value is calculated by Student′s t-test. (g and h) Tile plot of codon periodicity along length of mitochondria footprints (g, left) and mitochondria footprint length distribution (g, right) and codon periodicities of 31 nt mitochondrial footprints among different conditions (h). Footprints with 31-nt length showed most homogenous codon periodicity and this periodicity was retained with RocA treatment, showing that mitochondrial ribosome translates even in high doses of RocA.

    Article Snippet: Pulldown assay The lysate of E. coli cells expressing eIF4A WT or eIF4A D296A-T298K proteins from 1 ml culture was prepared as described in “Purification of recombinant eIF4A proteins“ and incubated with 10 μl of HisPur Ni-NTA Magnetic Beads (Thermo Scientific) at 4 °C for 30 min.

    Techniques: Western Blot, De-Phosphorylation Assay, Luciferase, Reporter Assay, Expressing

    RNA sequence selectivity is imparted upon eIF4A by RocA causing selective translation repression (a) Histogram of the number of transcripts along translation -fold change by ribosome profiling when cells are treated with 0.03, 0.3, or 3 μM RocA, normalized to the number of mitochondrial footprints. Median -fold change is shown. Bin width is 0.1. (b) MA plot of mean footprint reads between 3 μM RocA treatment and non-treatment normalized to library sizes versus translation -fold change by 3 μM RocA treatment, highlighting high-sensitivity and low-sensitivity mRNAs. (c) The 5′ UTRs of indicated genes were fused to Renilla luciferase and these reporter mRNAs were transfected prior to treatment with RocA as indicated. Data represent mean and standard deviation (S.D.) (n = 3). (d) Correlation of translation -fold change to RIP -fold change with RocA treatment. ρ: Spearman’s rank correlation.

    Journal: Nature

    Article Title: Rocaglates convert DEAD-box protein eIF4A into a sequence-selective translational repressor

    doi: 10.1038/nature17978

    Figure Lengend Snippet: RNA sequence selectivity is imparted upon eIF4A by RocA causing selective translation repression (a) Histogram of the number of transcripts along translation -fold change by ribosome profiling when cells are treated with 0.03, 0.3, or 3 μM RocA, normalized to the number of mitochondrial footprints. Median -fold change is shown. Bin width is 0.1. (b) MA plot of mean footprint reads between 3 μM RocA treatment and non-treatment normalized to library sizes versus translation -fold change by 3 μM RocA treatment, highlighting high-sensitivity and low-sensitivity mRNAs. (c) The 5′ UTRs of indicated genes were fused to Renilla luciferase and these reporter mRNAs were transfected prior to treatment with RocA as indicated. Data represent mean and standard deviation (S.D.) (n = 3). (d) Correlation of translation -fold change to RIP -fold change with RocA treatment. ρ: Spearman’s rank correlation.

    Article Snippet: Pulldown assay The lysate of E. coli cells expressing eIF4A WT or eIF4A D296A-T298K proteins from 1 ml culture was prepared as described in “Purification of recombinant eIF4A proteins“ and incubated with 10 μl of HisPur Ni-NTA Magnetic Beads (Thermo Scientific) at 4 °C for 30 min.

    Techniques: Sequencing, Luciferase, Transfection, Standard Deviation

    Motif enrichment by Bind-n-Seq (a) Nucleotide composition in each length of reads in input RNAs for Bind-n-Seq. Input RNAs are random in entire read length. (b) Length distribution of reads from Bind-n-Seq. RNAs bound to eIF4A showed longer length distribution, indicating that eIF4A has preference for longer RNAs. (c) Correlations of 4-mer motif enrichment in Bind-n-Seq by 0.03 μM RocA treatment to that by 0.3 μM RocA treatment. (d) Correlations between 5-mer and 6-mer motif enrichment in Bind-n-Seq by 0.03 μM RocA treatment and motif prediction of 0.03 μM RocA effect in RIP-Seq. ρ: Spearman’s rank correlation. (e) Highest-scoring 5-mer and 6-mer motifs in Bind-n-Seq and RIP-Seq. (f) Cumulative fractions along number of 4-mer motifs ( Figure 2b ) in 5′ UTR are plotted to total, RocA high-sensitivity, and RocA low-sensitivity mRNAs. Significance is calculated by Mann-Whitney U test. (g) Correlations of Bind-n-Seq motif enrichment (5-mer) by eIF4A to that by 0.03 μM RocA treatment. The motifs appeared in RNAs used in Extended Data figure 8 are highlighted. (h) Correlation of Bind-n-Seq motif enrichment (5-mer) by eIF4A to motif prediction of Hipp effect in translation change, which is define as Spearman’s correlation of motif number in 5′ UTR to translation -fold change by Hipp. mRNAs with high affinity motif to eIF4A in 5′ UTR are resistant to Hipp treatment. (i) The correlation between enriched motifs of replicates in Bind-n-Seq with ADP + Pi. ρ: Spearman’s rank correlation.

    Journal: Nature

    Article Title: Rocaglates convert DEAD-box protein eIF4A into a sequence-selective translational repressor

    doi: 10.1038/nature17978

    Figure Lengend Snippet: Motif enrichment by Bind-n-Seq (a) Nucleotide composition in each length of reads in input RNAs for Bind-n-Seq. Input RNAs are random in entire read length. (b) Length distribution of reads from Bind-n-Seq. RNAs bound to eIF4A showed longer length distribution, indicating that eIF4A has preference for longer RNAs. (c) Correlations of 4-mer motif enrichment in Bind-n-Seq by 0.03 μM RocA treatment to that by 0.3 μM RocA treatment. (d) Correlations between 5-mer and 6-mer motif enrichment in Bind-n-Seq by 0.03 μM RocA treatment and motif prediction of 0.03 μM RocA effect in RIP-Seq. ρ: Spearman’s rank correlation. (e) Highest-scoring 5-mer and 6-mer motifs in Bind-n-Seq and RIP-Seq. (f) Cumulative fractions along number of 4-mer motifs ( Figure 2b ) in 5′ UTR are plotted to total, RocA high-sensitivity, and RocA low-sensitivity mRNAs. Significance is calculated by Mann-Whitney U test. (g) Correlations of Bind-n-Seq motif enrichment (5-mer) by eIF4A to that by 0.03 μM RocA treatment. The motifs appeared in RNAs used in Extended Data figure 8 are highlighted. (h) Correlation of Bind-n-Seq motif enrichment (5-mer) by eIF4A to motif prediction of Hipp effect in translation change, which is define as Spearman’s correlation of motif number in 5′ UTR to translation -fold change by Hipp. mRNAs with high affinity motif to eIF4A in 5′ UTR are resistant to Hipp treatment. (i) The correlation between enriched motifs of replicates in Bind-n-Seq with ADP + Pi. ρ: Spearman’s rank correlation.

    Article Snippet: Pulldown assay The lysate of E. coli cells expressing eIF4A WT or eIF4A D296A-T298K proteins from 1 ml culture was prepared as described in “Purification of recombinant eIF4A proteins“ and incubated with 10 μl of HisPur Ni-NTA Magnetic Beads (Thermo Scientific) at 4 °C for 30 min.

    Techniques: MANN-WHITNEY