c2566 complement cells  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    T7 Express Competent E coli High Efficiency
    Description:
    T7 Express Competent E coli High Efficiency 20x0 05 ml
    Catalog Number:
    c2566h
    Price:
    194
    Size:
    1 ml
    Category:
    Competent Bacteria
    Buy from Supplier


    Structured Review

    New England Biolabs c2566 complement cells
    T7 Express Competent E coli High Efficiency
    T7 Express Competent E coli High Efficiency 20x0 05 ml
    https://www.bioz.com/result/c2566 complement cells/product/New England Biolabs
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    c2566 complement cells - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Targeting the Wolbachia Cell Division Protein FtsZ as a New Approach for Antifilarial Therapy
    Article Snippet: Expression and purification of recombinant Wolbachia FtsZ proteins w Bm-ftsZ and E. coli ftsZ (Ec-ftsZ) were amplified using genomic DNA isolated from B. malayi and E. coli wild-type strain MG1655 respectively, and were then cloned into the pET28a plasmid to generate fusion proteins with a N-terminal His tag. .. Each protein was expressed in the Escherichia coli strain C2566 (New England Biolabs).

    Article Title: Prime-Boost Vaccination with SA-4-1BBL Costimulatory Molecule and Survivin Eradicates Lung Carcinoma in CD8+ T and NK Cell Dependent Manner
    Article Snippet: .. Cloning, expression, and purification of recombinant SVN Mouse SVN cDNA was subcloned into the pTWIN-1-6X-His bacterial expression vector and expressed in C2566 E. coli cells (New England Biolabs, Ipswich, MA). .. Briefly, IPTG treated cells were harvested 3 h after induction, pelleted, and resuspended in 100 ml of lysis buffer (20 mM Tris, pH 7.0, 500 mM NaCl, 5 mM imidazole, 5 mM β-ME, 10 µM ZnCl2 ).

    Article Title: Crystal structure of the modification-dependent SRA-HNH endonuclease TagI
    Article Snippet: Paragraph title: TagI gene cloning and purification ... The assembled DNA was transferred into Dcm− E. coli B strain C2566 by transformation (NEB).

    Article Title: Thioaptamers Targeting Dengue Virus Type-2 Envelope Protein Domain III
    Article Snippet: Paragraph title: Cloning, expression and purification of DENV-2 EDIII ... The ligated product was transfected into C2566 complement cells (New England Biolabs, Inc) using the manufacturer’s protocol.

    Article Title: Incorporation of tetanus-epitope into virus-like particles achieves vaccine responses even in older recipients in models of psoriasis, Alzheimer’s and cat allergy
    Article Snippet: Paragraph title: Isolation and cloning of a coat protein (CP) of cucumber mosaic virus (CMV) ... To obtain CMV VLPs, E. coli C2566 cells (New England Biolabs, Ipswich, USA) were transformed with the CMVTT CP gene-containing plasmid pET-CMVTT .

    Article Title: Molecular and biochemical characterization of a novel isoprene synthase from Metrosideros polymorpha
    Article Snippet: Paragraph title: Gene synthesis and cloning of MpIspS ... E. coli C2566 (New England Biolabs) and the pET-28a(+) plasmid (Novagen, Merck KGaA, Darmstadt, Germany) were used as host cells and expression vectors, respectively.

    Article Title: Characterization of Transcription Factors That Regulate the Type IV Secretion System and Riboflavin Biosynthesis in Wolbachia of Brugia malayi
    Article Snippet: 10 μl of the ribAp-lacZ insert and 1 μl of the pACYC184 backbone were then incubated with 1 μl of USER enzyme at room temperature for 15 min before being transformed into E. coli cloning strain C3019 (NEB) to generate the ribAp-lacZ -pACYC184 reporter plasmid. .. Both ribAp-lacZ -pACYC184 and wBmxR1- pET21a or wBmxR2 -pET21a were transformed into E. coli strain C2566 (NEB) for measuring β-galactosidase activity measurement.

    Article Title: ‘Shotgun DNA synthesis’ for the high-throughput construction of large DNA molecules
    Article Snippet: Gel-purified and barcoded DNA fragments were cloned into the TOPO vector using the TOP Cloner™ Blunt core kit (Enzynomics, Daejeon, Korea). .. Chemically competent Escherichia coli cells originally derived from C2566 (NEB, Ipswich, MA, USA) were then transformed with the TOPO vectors.

    Centrifugation:

    Article Title: Incorporation of tetanus-epitope into virus-like particles achieves vaccine responses even in older recipients in models of psoriasis, Alzheimer’s and cat allergy
    Article Snippet: To obtain CMV VLPs, E. coli C2566 cells (New England Biolabs, Ipswich, USA) were transformed with the CMVTT CP gene-containing plasmid pET-CMVTT . .. Incubation was continued on the rotary shaker at 20 o C for 18 h. The resulting biomass was collected by low-speed centrifugation and was frozen at -20 o C. After thawing on ice, the cells were suspended in the buffer containing 50 mM sodium citrate, 5 mM sodium borate, 5 mM EDTA, 5 mM mercapto-ethanol (pH 9.0, buffer A) and were disrupted by ultrasonic treatment.

    Amplification:

    Article Title: Targeting the Wolbachia Cell Division Protein FtsZ as a New Approach for Antifilarial Therapy
    Article Snippet: Expression and purification of recombinant Wolbachia FtsZ proteins w Bm-ftsZ and E. coli ftsZ (Ec-ftsZ) were amplified using genomic DNA isolated from B. malayi and E. coli wild-type strain MG1655 respectively, and were then cloned into the pET28a plasmid to generate fusion proteins with a N-terminal His tag. .. Each protein was expressed in the Escherichia coli strain C2566 (New England Biolabs).

    Article Title: Comprehensive computational design of mCreI homing endonuclease cleavage specificity for genome engineering
    Article Snippet: Amplified fragments were purified by agarose gel electrophoresis and silica DNA binding (Qiagen), then digested with NcoI and NotI prior to ligation into the T7 expression vector pET-15bHE. .. Plasmids were then transformed into expression-competent C2566 Escherichia coli cells (New England Biolabs), followed by growth on plates containing 100 μg/ml carbenicillin and 0.2% (w/v) glucose.

    Article Title: Thioaptamers Targeting Dengue Virus Type-2 Envelope Protein Domain III
    Article Snippet: A clone containing pET15b plasmid (kind gift from Dr. Alan Barrett, UTMB, Galveston) for expressing the DENV-2 EDIII (WT strain 11608, 103 amino acids, M292-K394, 11.9 kDa) was PCR amplified and cloned into the pET22b plasmid for incorporation of a C-terminal 6x his-tag. .. The ligated product was transfected into C2566 complement cells (New England Biolabs, Inc) using the manufacturer’s protocol.

    Article Title: Incorporation of tetanus-epitope into virus-like particles achieves vaccine responses even in older recipients in models of psoriasis, Alzheimer’s and cat allergy
    Article Snippet: For the first step amplification following primers were used for PCR: pET-220 (agcaccgccgccgcaaggaa –upstream from pET28a+ polylinker, the amplified region includes BglII site) and CMV-tt83-1R (ATTTGGAGTTGGCCTTAATATACT GGCCCATGGTATATCTCCTTCTTAAAGT). .. To obtain CMV VLPs, E. coli C2566 cells (New England Biolabs, Ipswich, USA) were transformed with the CMVTT CP gene-containing plasmid pET-CMVTT .

    Article Title: Molecular and biochemical characterization of a novel isoprene synthase from Metrosideros polymorpha
    Article Snippet: E. coli C2566 (New England Biolabs) and the pET-28a(+) plasmid (Novagen, Merck KGaA, Darmstadt, Germany) were used as host cells and expression vectors, respectively. .. The gene encoding MpIspS was amplified by PCR using the synthetic DNA as the template.

    Article Title: Characterization of Transcription Factors That Regulate the Type IV Secretion System and Riboflavin Biosynthesis in Wolbachia of Brugia malayi
    Article Snippet: The ribAp-lacZ fusion was amplified with primers acggagacaUCGCTCTGCCGGTGGTTACCA and agggaaagUAACCTATAAAAATAGGCGTATCACGAGG derived from the ribAp-lacZ -pNK1415 construct. .. Both ribAp-lacZ -pACYC184 and wBmxR1- pET21a or wBmxR2 -pET21a were transformed into E. coli strain C2566 (NEB) for measuring β-galactosidase activity measurement.

    Article Title: ‘Shotgun DNA synthesis’ for the high-throughput construction of large DNA molecules
    Article Snippet: These gel-purified products (10 µl) were diluted 100-fold using water (1 ml), and the diluted products were then used for a final PCR amplification step involving 454 DNA sequencing adaptor primers. .. Chemically competent Escherichia coli cells originally derived from C2566 (NEB, Ipswich, MA, USA) were then transformed with the TOPO vectors.

    Synthesized:

    Article Title: Molecular and biochemical characterization of a novel isoprene synthase from Metrosideros polymorpha
    Article Snippet: Gene synthesis and cloning of MpIspS The MpIspS (IspS from Metrosideros polymorpha ) gene identified from gene mining was codon-optimized for E. coli using the by IDT Codon Optimization Tool (Integrated DNA Technologies Inc., Coralville, IA, USA; http://sg.idtdna.com/CodonOpt ) and synthesized by Macrogen co. (Seoul, South Korea) (Additional file : Table S1). .. E. coli C2566 (New England Biolabs) and the pET-28a(+) plasmid (Novagen, Merck KGaA, Darmstadt, Germany) were used as host cells and expression vectors, respectively.

    Construct:

    Article Title: Characterization of Transcription Factors That Regulate the Type IV Secretion System and Riboflavin Biosynthesis in Wolbachia of Brugia malayi
    Article Snippet: The ribAp-lacZ fusion was amplified with primers acggagacaUCGCTCTGCCGGTGGTTACCA and agggaaagUAACCTATAAAAATAGGCGTATCACGAGG derived from the ribAp-lacZ -pNK1415 construct. .. Both ribAp-lacZ -pACYC184 and wBmxR1- pET21a or wBmxR2 -pET21a were transformed into E. coli strain C2566 (NEB) for measuring β-galactosidase activity measurement.

    Incubation:

    Article Title: Controlled Aggregation and Increased Stability of β-Glucuronidase by Cellulose Binding Domain Fusion
    Article Snippet: Microorganisms, plasmids, media, and culture conditions E . coli MG1655, E . coli C2566 (New England Biolabs, UK), and the pET-21a (+) plasmid (Novagen, Darmstadt, Germany) were used as the source of genomic DNA for GusA, as host cells for protein expression, and as the expression vector, respectively. .. When the optical density of the bacteria reached 0.6 at 600 nm, isopropyl-β-d -thiogalactopyranoside (IPTG) was added at a final concentration of 0.1 mM to induce expression of GusA or GusA-CBD enzymes, and the cultures were incubated with shaking at 150 rpm at 16°C for 16 h.

    Article Title: Incorporation of tetanus-epitope into virus-like particles achieves vaccine responses even in older recipients in models of psoriasis, Alzheimer’s and cat allergy
    Article Snippet: To obtain CMV VLPs, E. coli C2566 cells (New England Biolabs, Ipswich, USA) were transformed with the CMVTT CP gene-containing plasmid pET-CMVTT . .. Incubation was continued on the rotary shaker at 20 o C for 18 h. The resulting biomass was collected by low-speed centrifugation and was frozen at -20 o C. After thawing on ice, the cells were suspended in the buffer containing 50 mM sodium citrate, 5 mM sodium borate, 5 mM EDTA, 5 mM mercapto-ethanol (pH 9.0, buffer A) and were disrupted by ultrasonic treatment.

    Article Title: Characterization of Transcription Factors That Regulate the Type IV Secretion System and Riboflavin Biosynthesis in Wolbachia of Brugia malayi
    Article Snippet: 10 μl of the ribAp-lacZ insert and 1 μl of the pACYC184 backbone were then incubated with 1 μl of USER enzyme at room temperature for 15 min before being transformed into E. coli cloning strain C3019 (NEB) to generate the ribAp-lacZ -pACYC184 reporter plasmid. .. Both ribAp-lacZ -pACYC184 and wBmxR1- pET21a or wBmxR2 -pET21a were transformed into E. coli strain C2566 (NEB) for measuring β-galactosidase activity measurement.

    Activity Assay:

    Article Title: CRISPR-Cap: multiplexed double-stranded DNA enrichment based on the CRISPR system
    Article Snippet: The in vitro cleavage activity of the purified SpCas9 was previously confirmed ( ). .. We transformed C2566 BL21-based cells (New England BioLabs, USA) with the plasmid and cultured them in LB-kanamycin (30 μg/ml) media to an optical density at 600 nm (OD600 ) of 0.5.

    Article Title: Characterization of Transcription Factors That Regulate the Type IV Secretion System and Riboflavin Biosynthesis in Wolbachia of Brugia malayi
    Article Snippet: .. Both ribAp-lacZ -pACYC184 and wBmxR1- pET21a or wBmxR2 -pET21a were transformed into E. coli strain C2566 (NEB) for measuring β-galactosidase activity measurement. .. The pET21a vector alone was used as a negative control.

    Introduce:

    Article Title: Incorporation of tetanus-epitope into virus-like particles achieves vaccine responses even in older recipients in models of psoriasis, Alzheimer’s and cat allergy
    Article Snippet: To introduce the tetanus toxoid epitope coding sequence in CMVWT gene, two step PCR mutagenesis was necessary. .. To obtain CMV VLPs, E. coli C2566 cells (New England Biolabs, Ipswich, USA) were transformed with the CMVTT CP gene-containing plasmid pET-CMVTT .

    Expressing:

    Article Title: Targeting the Wolbachia Cell Division Protein FtsZ as a New Approach for Antifilarial Therapy
    Article Snippet: Paragraph title: Expression and purification of recombinant Wolbachia FtsZ proteins ... Each protein was expressed in the Escherichia coli strain C2566 (New England Biolabs).

    Article Title: Comprehensive computational design of mCreI homing endonuclease cleavage specificity for genome engineering
    Article Snippet: .. Plasmids were then transformed into expression-competent C2566 Escherichia coli cells (New England Biolabs), followed by growth on plates containing 100 μg/ml carbenicillin and 0.2% (w/v) glucose. .. Protein expression was performed by inoculating individual colonies into 100 ml auto-induction medium [10 g/l tryptone, 5 g/l yeast extract, 0.5% glycerol, 0.05% glucose, 0.2% α-lactose, 0.5 M (NH4 )2 SO4 , 1 M KH2 PO4 , 1 M Na2 HPO4 , 1 mM MgS04 , 50 µM FeCl3 , 20 µM CaCl2 , 10 µM MnCl2 , 10 µM ZnSO4 , 2 µM CoCl2 , 2.0 µM CuCl2 , 2.0 µM NiCl2 , 2.0 µM Na2 MoO4 , 2.0 µM Na2 SeO3 , 2.0 µM H3 BO3 ], followed by growth for 8–12 h at 37°C and then a shift to 18°C for an additional 24 h when progressive glucose depletion from the growth medium lead to mCreI expression ( ).

    Article Title: Controlled Aggregation and Increased Stability of β-Glucuronidase by Cellulose Binding Domain Fusion
    Article Snippet: .. Microorganisms, plasmids, media, and culture conditions E . coli MG1655, E . coli C2566 (New England Biolabs, UK), and the pET-21a (+) plasmid (Novagen, Darmstadt, Germany) were used as the source of genomic DNA for GusA, as host cells for protein expression, and as the expression vector, respectively. .. The E . coli C2566 harboring GusA or GusA-CBD were cultivated in 500 ml of Luria–Bertani (LB) medium in a 2,000-ml flask containing 50 μg of ampicillin/ml at 37°C with shaking at 250 rpm.

    Article Title: Prime-Boost Vaccination with SA-4-1BBL Costimulatory Molecule and Survivin Eradicates Lung Carcinoma in CD8+ T and NK Cell Dependent Manner
    Article Snippet: .. Cloning, expression, and purification of recombinant SVN Mouse SVN cDNA was subcloned into the pTWIN-1-6X-His bacterial expression vector and expressed in C2566 E. coli cells (New England Biolabs, Ipswich, MA). .. Briefly, IPTG treated cells were harvested 3 h after induction, pelleted, and resuspended in 100 ml of lysis buffer (20 mM Tris, pH 7.0, 500 mM NaCl, 5 mM imidazole, 5 mM β-ME, 10 µM ZnCl2 ).

    Article Title: Thioaptamers Targeting Dengue Virus Type-2 Envelope Protein Domain III
    Article Snippet: Paragraph title: Cloning, expression and purification of DENV-2 EDIII ... The ligated product was transfected into C2566 complement cells (New England Biolabs, Inc) using the manufacturer’s protocol.

    Article Title: CRISPR-Cap: multiplexed double-stranded DNA enrichment based on the CRISPR system
    Article Snippet: SpCas9 protein purification Professor Hyongbum Kim's group donated the expression plasmid pET28a/Cas9-Cys, which has the SpCas9 protein-coding sequence appended with an N-terminal 6X -His tag and additional C-terminal cysteine for purification. .. We transformed C2566 BL21-based cells (New England BioLabs, USA) with the plasmid and cultured them in LB-kanamycin (30 μg/ml) media to an optical density at 600 nm (OD600 ) of 0.5.

    Article Title: Incorporation of tetanus-epitope into virus-like particles achieves vaccine responses even in older recipients in models of psoriasis, Alzheimer’s and cat allergy
    Article Snippet: To obtain CMV VLPs, E. coli C2566 cells (New England Biolabs, Ipswich, USA) were transformed with the CMVTT CP gene-containing plasmid pET-CMVTT . .. After selection of clones with the highest expression levels of target protein, E. coli cultures were grown in 2xTY medium containing kanamycin (25 mg/l) on a rotary shaker (200 rev/min; Infors, Bottmingen, Switzerland) at 30 o C to an OD600 of 0.8–1.0.

    Article Title: Molecular and biochemical characterization of a novel isoprene synthase from Metrosideros polymorpha
    Article Snippet: .. E. coli C2566 (New England Biolabs) and the pET-28a(+) plasmid (Novagen, Merck KGaA, Darmstadt, Germany) were used as host cells and expression vectors, respectively. .. The gene encoding MpIspS was amplified by PCR using the synthetic DNA as the template.

    Article Title: Differential Regulation of Duplicate Light-Dependent Protochlorophyllide Oxidoreductases in the Diatom Phaeodactylum tricornutum
    Article Snippet: .. POR1 and POR2 heterologous expression Protein expression in E . coli c2566 was found to be leaky and growth overnight at 30°C without IPTG induction produced copious quantities of POR1 and POR2 proteins ( ). .. Overnight cultures were centrifuged at 2000xg for 20min at 4°C, and re-suspended in 10% the original culture volume of lysis buffer [PBS (50mM sodium phosphate, 300mM sodium chloride, pH 7) containing 0.1% Triton-X and 5mM β - mercaptoethanol and cOmplete ULTRA EDTA-free protease inhibitors (1 tablet per 10mL; Roche, Nutley, NJ)].

    Transformation Assay:

    Article Title: Comprehensive computational design of mCreI homing endonuclease cleavage specificity for genome engineering
    Article Snippet: .. Plasmids were then transformed into expression-competent C2566 Escherichia coli cells (New England Biolabs), followed by growth on plates containing 100 μg/ml carbenicillin and 0.2% (w/v) glucose. .. Protein expression was performed by inoculating individual colonies into 100 ml auto-induction medium [10 g/l tryptone, 5 g/l yeast extract, 0.5% glycerol, 0.05% glucose, 0.2% α-lactose, 0.5 M (NH4 )2 SO4 , 1 M KH2 PO4 , 1 M Na2 HPO4 , 1 mM MgS04 , 50 µM FeCl3 , 20 µM CaCl2 , 10 µM MnCl2 , 10 µM ZnSO4 , 2 µM CoCl2 , 2.0 µM CuCl2 , 2.0 µM NiCl2 , 2.0 µM Na2 MoO4 , 2.0 µM Na2 SeO3 , 2.0 µM H3 BO3 ], followed by growth for 8–12 h at 37°C and then a shift to 18°C for an additional 24 h when progressive glucose depletion from the growth medium lead to mCreI expression ( ).

    Article Title: Crystal structure of the modification-dependent SRA-HNH endonuclease TagI
    Article Snippet: .. The assembled DNA was transferred into Dcm− E. coli B strain C2566 by transformation (NEB). .. The same tagIR gene (a PCR fragment) was also cloned into pET28b (Novagen) to generate a C-terminal 6xHis-tagged version.

    Article Title: CRISPR-Cap: multiplexed double-stranded DNA enrichment based on the CRISPR system
    Article Snippet: .. We transformed C2566 BL21-based cells (New England BioLabs, USA) with the plasmid and cultured them in LB-kanamycin (30 μg/ml) media to an optical density at 600 nm (OD600 ) of 0.5. .. We induced SpCas9 by treating the cultures with a 0.5 mM final concentration of isopropyl β-d -1-thiogalactopyranoside (IPTG) for 4 h at 30°C in a shaking incubator.

    Article Title: Incorporation of tetanus-epitope into virus-like particles achieves vaccine responses even in older recipients in models of psoriasis, Alzheimer’s and cat allergy
    Article Snippet: .. To obtain CMV VLPs, E. coli C2566 cells (New England Biolabs, Ipswich, USA) were transformed with the CMVTT CP gene-containing plasmid pET-CMVTT . .. After selection of clones with the highest expression levels of target protein, E. coli cultures were grown in 2xTY medium containing kanamycin (25 mg/l) on a rotary shaker (200 rev/min; Infors, Bottmingen, Switzerland) at 30 o C to an OD600 of 0.8–1.0.

    Article Title: Characterization of Transcription Factors That Regulate the Type IV Secretion System and Riboflavin Biosynthesis in Wolbachia of Brugia malayi
    Article Snippet: .. Both ribAp-lacZ -pACYC184 and wBmxR1- pET21a or wBmxR2 -pET21a were transformed into E. coli strain C2566 (NEB) for measuring β-galactosidase activity measurement. .. The pET21a vector alone was used as a negative control.

    Derivative Assay:

    Article Title: Characterization of Transcription Factors That Regulate the Type IV Secretion System and Riboflavin Biosynthesis in Wolbachia of Brugia malayi
    Article Snippet: The ribAp-lacZ fusion was amplified with primers acggagacaUCGCTCTGCCGGTGGTTACCA and agggaaagUAACCTATAAAAATAGGCGTATCACGAGG derived from the ribAp-lacZ -pNK1415 construct. .. Both ribAp-lacZ -pACYC184 and wBmxR1- pET21a or wBmxR2 -pET21a were transformed into E. coli strain C2566 (NEB) for measuring β-galactosidase activity measurement.

    Article Title: ‘Shotgun DNA synthesis’ for the high-throughput construction of large DNA molecules
    Article Snippet: .. Chemically competent Escherichia coli cells originally derived from C2566 (NEB, Ipswich, MA, USA) were then transformed with the TOPO vectors. .. After overnight growth on agar plates at 37°C, several colonies were chosen for colony PCR using M13 primer pairs (M13F-pUC and M13R-pUC primers; see Primer Set 4, Supplementary Sequence 4 ).

    Gel Purification:

    Article Title: ‘Shotgun DNA synthesis’ for the high-throughput construction of large DNA molecules
    Article Snippet: Eight replicate 50 µl PCR reactions containing 17.5 µl water, 25 µl Pfu DNA polymerase pre-mix, 2.5 µl of the 100-fold diluted gel purified products and 2.5 µl 454 DNA sequencing adaptor primers (Primer Set 3; see Supplementary Sequence 4 ; Macrogen, Seoul, Korea) were subjected to thermocycling using the following conditions: initial heating at 95°C for 3 min followed by 25 cycles of 95°C for 30 s, 71°C for 30 s, 72°C for 1 min and a final elongation at 72°C for 10 min. PCR products were electrophoresed through a 1.5% agarose gel and gel bands between 450 and 500 bp were excised and purified using an AccuPrep™ gel-purification kit with elution in 60 µl of water. .. Chemically competent Escherichia coli cells originally derived from C2566 (NEB, Ipswich, MA, USA) were then transformed with the TOPO vectors.

    Transfection:

    Article Title: Thioaptamers Targeting Dengue Virus Type-2 Envelope Protein Domain III
    Article Snippet: .. The ligated product was transfected into C2566 complement cells (New England Biolabs, Inc) using the manufacturer’s protocol. .. Uniformly 15 N, 13 C labeled EDIII protein was expressed as described previously with a few changes that are presented here [ – ] that greatly improved the yield.

    Ligation:

    Article Title: Comprehensive computational design of mCreI homing endonuclease cleavage specificity for genome engineering
    Article Snippet: Amplified fragments were purified by agarose gel electrophoresis and silica DNA binding (Qiagen), then digested with NcoI and NotI prior to ligation into the T7 expression vector pET-15bHE. .. Plasmids were then transformed into expression-competent C2566 Escherichia coli cells (New England Biolabs), followed by growth on plates containing 100 μg/ml carbenicillin and 0.2% (w/v) glucose.

    Low Copy Number:

    Article Title: Characterization of Transcription Factors That Regulate the Type IV Secretion System and Riboflavin Biosynthesis in Wolbachia of Brugia malayi
    Article Snippet: The USER cloning method (NEB) was then utilized to clone the ribAp-lacZ fusion into low copy number plasmid pACYC184 (NEB). .. Both ribAp-lacZ -pACYC184 and wBmxR1- pET21a or wBmxR2 -pET21a were transformed into E. coli strain C2566 (NEB) for measuring β-galactosidase activity measurement.

    Cell Culture:

    Article Title: CRISPR-Cap: multiplexed double-stranded DNA enrichment based on the CRISPR system
    Article Snippet: .. We transformed C2566 BL21-based cells (New England BioLabs, USA) with the plasmid and cultured them in LB-kanamycin (30 μg/ml) media to an optical density at 600 nm (OD600 ) of 0.5. .. We induced SpCas9 by treating the cultures with a 0.5 mM final concentration of isopropyl β-d -1-thiogalactopyranoside (IPTG) for 4 h at 30°C in a shaking incubator.

    DNA Sequencing:

    Article Title: ‘Shotgun DNA synthesis’ for the high-throughput construction of large DNA molecules
    Article Snippet: Eight replicate 50 µl PCR reactions containing 17.5 µl water, 25 µl Pfu DNA polymerase pre-mix, 2.5 µl of the 100-fold diluted gel purified products and 2.5 µl 454 DNA sequencing adaptor primers (Primer Set 3; see Supplementary Sequence 4 ; Macrogen, Seoul, Korea) were subjected to thermocycling using the following conditions: initial heating at 95°C for 3 min followed by 25 cycles of 95°C for 30 s, 71°C for 30 s, 72°C for 1 min and a final elongation at 72°C for 10 min. PCR products were electrophoresed through a 1.5% agarose gel and gel bands between 450 and 500 bp were excised and purified using an AccuPrep™ gel-purification kit with elution in 60 µl of water. .. Chemically competent Escherichia coli cells originally derived from C2566 (NEB, Ipswich, MA, USA) were then transformed with the TOPO vectors.

    Polymerase Chain Reaction:

    Article Title: Comprehensive computational design of mCreI homing endonuclease cleavage specificity for genome engineering
    Article Snippet: In brief, oligonucleotides encoding design amino acid substitutions were used to amplify the mCreI gene in PCR reactions that contained 200 µM dNTPs (New England Biolabs), 0.4 nM of each primer, ∼30–100 ng of the template mCreI gene in pET-15bHE, and 1 unit of Phusion thermophilic DNA polymerase in 1 × High Fidelity Phusion buffer (Finnzymes). .. Plasmids were then transformed into expression-competent C2566 Escherichia coli cells (New England Biolabs), followed by growth on plates containing 100 μg/ml carbenicillin and 0.2% (w/v) glucose.

    Article Title: Crystal structure of the modification-dependent SRA-HNH endonuclease TagI
    Article Snippet: The assembled DNA was transferred into Dcm− E. coli B strain C2566 by transformation (NEB). .. The same tagIR gene (a PCR fragment) was also cloned into pET28b (Novagen) to generate a C-terminal 6xHis-tagged version.

    Article Title: Thioaptamers Targeting Dengue Virus Type-2 Envelope Protein Domain III
    Article Snippet: A clone containing pET15b plasmid (kind gift from Dr. Alan Barrett, UTMB, Galveston) for expressing the DENV-2 EDIII (WT strain 11608, 103 amino acids, M292-K394, 11.9 kDa) was PCR amplified and cloned into the pET22b plasmid for incorporation of a C-terminal 6x his-tag. .. The ligated product was transfected into C2566 complement cells (New England Biolabs, Inc) using the manufacturer’s protocol.

    Article Title: Incorporation of tetanus-epitope into virus-like particles achieves vaccine responses even in older recipients in models of psoriasis, Alzheimer’s and cat allergy
    Article Snippet: For the second round the PCR product from the first round was diluted 1:50 and re-amplified with primers pET-220 (SEQ ID NO: 11) and CMV-tt83Sal-R2 (GACGTCGACGCTCGGTAATCCCGATAAATTTGGAGTTG GCCTTAATATACTG). .. To obtain CMV VLPs, E. coli C2566 cells (New England Biolabs, Ipswich, USA) were transformed with the CMVTT CP gene-containing plasmid pET-CMVTT .

    Article Title: Molecular and biochemical characterization of a novel isoprene synthase from Metrosideros polymorpha
    Article Snippet: E. coli C2566 (New England Biolabs) and the pET-28a(+) plasmid (Novagen, Merck KGaA, Darmstadt, Germany) were used as host cells and expression vectors, respectively. .. The gene encoding MpIspS was amplified by PCR using the synthetic DNA as the template.

    Article Title: ‘Shotgun DNA synthesis’ for the high-throughput construction of large DNA molecules
    Article Snippet: Eight replicate 50 µl PCR reactions containing 17.5 µl water, 25 µl Pfu DNA polymerase pre-mix, 2.5 µl of the 100-fold diluted gel purified products and 2.5 µl 454 DNA sequencing adaptor primers (Primer Set 3; see Supplementary Sequence 4 ; Macrogen, Seoul, Korea) were subjected to thermocycling using the following conditions: initial heating at 95°C for 3 min followed by 25 cycles of 95°C for 30 s, 71°C for 30 s, 72°C for 1 min and a final elongation at 72°C for 10 min. PCR products were electrophoresed through a 1.5% agarose gel and gel bands between 450 and 500 bp were excised and purified using an AccuPrep™ gel-purification kit with elution in 60 µl of water. .. Chemically competent Escherichia coli cells originally derived from C2566 (NEB, Ipswich, MA, USA) were then transformed with the TOPO vectors.

    Binding Assay:

    Article Title: Comprehensive computational design of mCreI homing endonuclease cleavage specificity for genome engineering
    Article Snippet: Amplified fragments were purified by agarose gel electrophoresis and silica DNA binding (Qiagen), then digested with NcoI and NotI prior to ligation into the T7 expression vector pET-15bHE. .. Plasmids were then transformed into expression-competent C2566 Escherichia coli cells (New England Biolabs), followed by growth on plates containing 100 μg/ml carbenicillin and 0.2% (w/v) glucose.

    Mutagenesis:

    Article Title: Comprehensive computational design of mCreI homing endonuclease cleavage specificity for genome engineering
    Article Snippet: Thus we used site-directed mutagenesis to generate the open reading frames for all ‘minus’ half site design variants. .. Plasmids were then transformed into expression-competent C2566 Escherichia coli cells (New England Biolabs), followed by growth on plates containing 100 μg/ml carbenicillin and 0.2% (w/v) glucose.

    Article Title: Incorporation of tetanus-epitope into virus-like particles achieves vaccine responses even in older recipients in models of psoriasis, Alzheimer’s and cat allergy
    Article Snippet: To introduce the tetanus toxoid epitope coding sequence in CMVWT gene, two step PCR mutagenesis was necessary. .. To obtain CMV VLPs, E. coli C2566 cells (New England Biolabs, Ipswich, USA) were transformed with the CMVTT CP gene-containing plasmid pET-CMVTT .

    Isolation:

    Article Title: Targeting the Wolbachia Cell Division Protein FtsZ as a New Approach for Antifilarial Therapy
    Article Snippet: Expression and purification of recombinant Wolbachia FtsZ proteins w Bm-ftsZ and E. coli ftsZ (Ec-ftsZ) were amplified using genomic DNA isolated from B. malayi and E. coli wild-type strain MG1655 respectively, and were then cloned into the pET28a plasmid to generate fusion proteins with a N-terminal His tag. .. Each protein was expressed in the Escherichia coli strain C2566 (New England Biolabs).

    Article Title: Incorporation of tetanus-epitope into virus-like particles achieves vaccine responses even in older recipients in models of psoriasis, Alzheimer’s and cat allergy
    Article Snippet: Paragraph title: Isolation and cloning of a coat protein (CP) of cucumber mosaic virus (CMV) ... To obtain CMV VLPs, E. coli C2566 cells (New England Biolabs, Ipswich, USA) were transformed with the CMVTT CP gene-containing plasmid pET-CMVTT .

    Size-exclusion Chromatography:

    Article Title: Thioaptamers Targeting Dengue Virus Type-2 Envelope Protein Domain III
    Article Snippet: The ligated product was transfected into C2566 complement cells (New England Biolabs, Inc) using the manufacturer’s protocol. .. The denatured protein in the supernatant was purified under partially denaturing conditions (2 M guanidine hydrochloride) by size-exclusion chromatography (SEC) using a Superdex G-75 column fitted to an AKTA Purifier FPLC system.

    Labeling:

    Article Title: Thioaptamers Targeting Dengue Virus Type-2 Envelope Protein Domain III
    Article Snippet: The ligated product was transfected into C2566 complement cells (New England Biolabs, Inc) using the manufacturer’s protocol. .. Uniformly 15 N, 13 C labeled EDIII protein was expressed as described previously with a few changes that are presented here [ – ] that greatly improved the yield.

    Purification:

    Article Title: Targeting the Wolbachia Cell Division Protein FtsZ as a New Approach for Antifilarial Therapy
    Article Snippet: Paragraph title: Expression and purification of recombinant Wolbachia FtsZ proteins ... Each protein was expressed in the Escherichia coli strain C2566 (New England Biolabs).

    Article Title: Comprehensive computational design of mCreI homing endonuclease cleavage specificity for genome engineering
    Article Snippet: Amplified fragments were purified by agarose gel electrophoresis and silica DNA binding (Qiagen), then digested with NcoI and NotI prior to ligation into the T7 expression vector pET-15bHE. .. Plasmids were then transformed into expression-competent C2566 Escherichia coli cells (New England Biolabs), followed by growth on plates containing 100 μg/ml carbenicillin and 0.2% (w/v) glucose.

    Article Title: Prime-Boost Vaccination with SA-4-1BBL Costimulatory Molecule and Survivin Eradicates Lung Carcinoma in CD8+ T and NK Cell Dependent Manner
    Article Snippet: .. Cloning, expression, and purification of recombinant SVN Mouse SVN cDNA was subcloned into the pTWIN-1-6X-His bacterial expression vector and expressed in C2566 E. coli cells (New England Biolabs, Ipswich, MA). .. Briefly, IPTG treated cells were harvested 3 h after induction, pelleted, and resuspended in 100 ml of lysis buffer (20 mM Tris, pH 7.0, 500 mM NaCl, 5 mM imidazole, 5 mM β-ME, 10 µM ZnCl2 ).

    Article Title: Crystal structure of the modification-dependent SRA-HNH endonuclease TagI
    Article Snippet: Paragraph title: TagI gene cloning and purification ... The assembled DNA was transferred into Dcm− E. coli B strain C2566 by transformation (NEB).

    Article Title: Thioaptamers Targeting Dengue Virus Type-2 Envelope Protein Domain III
    Article Snippet: Paragraph title: Cloning, expression and purification of DENV-2 EDIII ... The ligated product was transfected into C2566 complement cells (New England Biolabs, Inc) using the manufacturer’s protocol.

    Article Title: CRISPR-Cap: multiplexed double-stranded DNA enrichment based on the CRISPR system
    Article Snippet: The in vitro cleavage activity of the purified SpCas9 was previously confirmed ( ). .. We transformed C2566 BL21-based cells (New England BioLabs, USA) with the plasmid and cultured them in LB-kanamycin (30 μg/ml) media to an optical density at 600 nm (OD600 ) of 0.5.

    Article Title: ‘Shotgun DNA synthesis’ for the high-throughput construction of large DNA molecules
    Article Snippet: Eight replicate 50 µl PCR reactions containing 17.5 µl water, 25 µl Pfu DNA polymerase pre-mix, 2.5 µl of the 100-fold diluted gel purified products and 2.5 µl 454 DNA sequencing adaptor primers (Primer Set 3; see Supplementary Sequence 4 ; Macrogen, Seoul, Korea) were subjected to thermocycling using the following conditions: initial heating at 95°C for 3 min followed by 25 cycles of 95°C for 30 s, 71°C for 30 s, 72°C for 1 min and a final elongation at 72°C for 10 min. PCR products were electrophoresed through a 1.5% agarose gel and gel bands between 450 and 500 bp were excised and purified using an AccuPrep™ gel-purification kit with elution in 60 µl of water. .. Chemically competent Escherichia coli cells originally derived from C2566 (NEB, Ipswich, MA, USA) were then transformed with the TOPO vectors.

    Protein Purification:

    Article Title: Comprehensive computational design of mCreI homing endonuclease cleavage specificity for genome engineering
    Article Snippet: Paragraph title: Recombinant protein purification ... Plasmids were then transformed into expression-competent C2566 Escherichia coli cells (New England Biolabs), followed by growth on plates containing 100 μg/ml carbenicillin and 0.2% (w/v) glucose.

    Article Title: CRISPR-Cap: multiplexed double-stranded DNA enrichment based on the CRISPR system
    Article Snippet: Paragraph title: SpCas9 protein purification ... We transformed C2566 BL21-based cells (New England BioLabs, USA) with the plasmid and cultured them in LB-kanamycin (30 μg/ml) media to an optical density at 600 nm (OD600 ) of 0.5.

    Sequencing:

    Article Title: CRISPR-Cap: multiplexed double-stranded DNA enrichment based on the CRISPR system
    Article Snippet: SpCas9 protein purification Professor Hyongbum Kim's group donated the expression plasmid pET28a/Cas9-Cys, which has the SpCas9 protein-coding sequence appended with an N-terminal 6X -His tag and additional C-terminal cysteine for purification. .. We transformed C2566 BL21-based cells (New England BioLabs, USA) with the plasmid and cultured them in LB-kanamycin (30 μg/ml) media to an optical density at 600 nm (OD600 ) of 0.5.

    Article Title: Incorporation of tetanus-epitope into virus-like particles achieves vaccine responses even in older recipients in models of psoriasis, Alzheimer’s and cat allergy
    Article Snippet: To introduce the tetanus toxoid epitope coding sequence in CMVWT gene, two step PCR mutagenesis was necessary. .. To obtain CMV VLPs, E. coli C2566 cells (New England Biolabs, Ipswich, USA) were transformed with the CMVTT CP gene-containing plasmid pET-CMVTT .

    Article Title: ‘Shotgun DNA synthesis’ for the high-throughput construction of large DNA molecules
    Article Snippet: Prior to 454 sequencing, we performed TOPO cloning of the barcoded shotgun synthesis fragments, and several colonies were submitted for Sanger sequencing evaluation. .. Chemically competent Escherichia coli cells originally derived from C2566 (NEB, Ipswich, MA, USA) were then transformed with the TOPO vectors.

    Positron Emission Tomography:

    Article Title: Comprehensive computational design of mCreI homing endonuclease cleavage specificity for genome engineering
    Article Snippet: Amplified fragments were purified by agarose gel electrophoresis and silica DNA binding (Qiagen), then digested with NcoI and NotI prior to ligation into the T7 expression vector pET-15bHE. .. Plasmids were then transformed into expression-competent C2566 Escherichia coli cells (New England Biolabs), followed by growth on plates containing 100 μg/ml carbenicillin and 0.2% (w/v) glucose.

    Article Title: Controlled Aggregation and Increased Stability of β-Glucuronidase by Cellulose Binding Domain Fusion
    Article Snippet: .. Microorganisms, plasmids, media, and culture conditions E . coli MG1655, E . coli C2566 (New England Biolabs, UK), and the pET-21a (+) plasmid (Novagen, Darmstadt, Germany) were used as the source of genomic DNA for GusA, as host cells for protein expression, and as the expression vector, respectively. .. The E . coli C2566 harboring GusA or GusA-CBD were cultivated in 500 ml of Luria–Bertani (LB) medium in a 2,000-ml flask containing 50 μg of ampicillin/ml at 37°C with shaking at 250 rpm.

    Article Title: Incorporation of tetanus-epitope into virus-like particles achieves vaccine responses even in older recipients in models of psoriasis, Alzheimer’s and cat allergy
    Article Snippet: .. To obtain CMV VLPs, E. coli C2566 cells (New England Biolabs, Ipswich, USA) were transformed with the CMVTT CP gene-containing plasmid pET-CMVTT . .. After selection of clones with the highest expression levels of target protein, E. coli cultures were grown in 2xTY medium containing kanamycin (25 mg/l) on a rotary shaker (200 rev/min; Infors, Bottmingen, Switzerland) at 30 o C to an OD600 of 0.8–1.0.

    Article Title: Molecular and biochemical characterization of a novel isoprene synthase from Metrosideros polymorpha
    Article Snippet: .. E. coli C2566 (New England Biolabs) and the pET-28a(+) plasmid (Novagen, Merck KGaA, Darmstadt, Germany) were used as host cells and expression vectors, respectively. .. The gene encoding MpIspS was amplified by PCR using the synthetic DNA as the template.

    Fast Protein Liquid Chromatography:

    Article Title: Thioaptamers Targeting Dengue Virus Type-2 Envelope Protein Domain III
    Article Snippet: The ligated product was transfected into C2566 complement cells (New England Biolabs, Inc) using the manufacturer’s protocol. .. The denatured protein in the supernatant was purified under partially denaturing conditions (2 M guanidine hydrochloride) by size-exclusion chromatography (SEC) using a Superdex G-75 column fitted to an AKTA Purifier FPLC system.

    Lysis:

    Article Title: Prime-Boost Vaccination with SA-4-1BBL Costimulatory Molecule and Survivin Eradicates Lung Carcinoma in CD8+ T and NK Cell Dependent Manner
    Article Snippet: Cloning, expression, and purification of recombinant SVN Mouse SVN cDNA was subcloned into the pTWIN-1-6X-His bacterial expression vector and expressed in C2566 E. coli cells (New England Biolabs, Ipswich, MA). .. Briefly, IPTG treated cells were harvested 3 h after induction, pelleted, and resuspended in 100 ml of lysis buffer (20 mM Tris, pH 7.0, 500 mM NaCl, 5 mM imidazole, 5 mM β-ME, 10 µM ZnCl2 ).

    Article Title: CRISPR-Cap: multiplexed double-stranded DNA enrichment based on the CRISPR system
    Article Snippet: We transformed C2566 BL21-based cells (New England BioLabs, USA) with the plasmid and cultured them in LB-kanamycin (30 μg/ml) media to an optical density at 600 nm (OD600 ) of 0.5. .. The lysis buffer was 20 mM Tris–HCl pH 8.0, 300 mM NaCl; 40 mL buffer/1 l cultured cells.

    IA:

    Article Title: Molecular and biochemical characterization of a novel isoprene synthase from Metrosideros polymorpha
    Article Snippet: Gene synthesis and cloning of MpIspS The MpIspS (IspS from Metrosideros polymorpha ) gene identified from gene mining was codon-optimized for E. coli using the by IDT Codon Optimization Tool (Integrated DNA Technologies Inc., Coralville, IA, USA; http://sg.idtdna.com/CodonOpt ) and synthesized by Macrogen co. (Seoul, South Korea) (Additional file : Table S1). .. E. coli C2566 (New England Biolabs) and the pET-28a(+) plasmid (Novagen, Merck KGaA, Darmstadt, Germany) were used as host cells and expression vectors, respectively.

    SDS Page:

    Article Title: Thioaptamers Targeting Dengue Virus Type-2 Envelope Protein Domain III
    Article Snippet: The ligated product was transfected into C2566 complement cells (New England Biolabs, Inc) using the manufacturer’s protocol. .. Pure fractions (determined by SDS-PAGE) were pooled together.

    Plasmid Preparation:

    Article Title: Targeting the Wolbachia Cell Division Protein FtsZ as a New Approach for Antifilarial Therapy
    Article Snippet: Expression and purification of recombinant Wolbachia FtsZ proteins w Bm-ftsZ and E. coli ftsZ (Ec-ftsZ) were amplified using genomic DNA isolated from B. malayi and E. coli wild-type strain MG1655 respectively, and were then cloned into the pET28a plasmid to generate fusion proteins with a N-terminal His tag. .. Each protein was expressed in the Escherichia coli strain C2566 (New England Biolabs).

    Article Title: Comprehensive computational design of mCreI homing endonuclease cleavage specificity for genome engineering
    Article Snippet: Amplified fragments were purified by agarose gel electrophoresis and silica DNA binding (Qiagen), then digested with NcoI and NotI prior to ligation into the T7 expression vector pET-15bHE. .. Plasmids were then transformed into expression-competent C2566 Escherichia coli cells (New England Biolabs), followed by growth on plates containing 100 μg/ml carbenicillin and 0.2% (w/v) glucose.

    Article Title: Controlled Aggregation and Increased Stability of β-Glucuronidase by Cellulose Binding Domain Fusion
    Article Snippet: .. Microorganisms, plasmids, media, and culture conditions E . coli MG1655, E . coli C2566 (New England Biolabs, UK), and the pET-21a (+) plasmid (Novagen, Darmstadt, Germany) were used as the source of genomic DNA for GusA, as host cells for protein expression, and as the expression vector, respectively. .. The E . coli C2566 harboring GusA or GusA-CBD were cultivated in 500 ml of Luria–Bertani (LB) medium in a 2,000-ml flask containing 50 μg of ampicillin/ml at 37°C with shaking at 250 rpm.

    Article Title: Prime-Boost Vaccination with SA-4-1BBL Costimulatory Molecule and Survivin Eradicates Lung Carcinoma in CD8+ T and NK Cell Dependent Manner
    Article Snippet: .. Cloning, expression, and purification of recombinant SVN Mouse SVN cDNA was subcloned into the pTWIN-1-6X-His bacterial expression vector and expressed in C2566 E. coli cells (New England Biolabs, Ipswich, MA). .. Briefly, IPTG treated cells were harvested 3 h after induction, pelleted, and resuspended in 100 ml of lysis buffer (20 mM Tris, pH 7.0, 500 mM NaCl, 5 mM imidazole, 5 mM β-ME, 10 µM ZnCl2 ).

    Article Title: Thioaptamers Targeting Dengue Virus Type-2 Envelope Protein Domain III
    Article Snippet: A clone containing pET15b plasmid (kind gift from Dr. Alan Barrett, UTMB, Galveston) for expressing the DENV-2 EDIII (WT strain 11608, 103 amino acids, M292-K394, 11.9 kDa) was PCR amplified and cloned into the pET22b plasmid for incorporation of a C-terminal 6x his-tag. .. The ligated product was transfected into C2566 complement cells (New England Biolabs, Inc) using the manufacturer’s protocol.

    Article Title: CRISPR-Cap: multiplexed double-stranded DNA enrichment based on the CRISPR system
    Article Snippet: .. We transformed C2566 BL21-based cells (New England BioLabs, USA) with the plasmid and cultured them in LB-kanamycin (30 μg/ml) media to an optical density at 600 nm (OD600 ) of 0.5. .. We induced SpCas9 by treating the cultures with a 0.5 mM final concentration of isopropyl β-d -1-thiogalactopyranoside (IPTG) for 4 h at 30°C in a shaking incubator.

    Article Title: Construction of a Chimeric Biosynthetic Pathway for the de novo Biosynthesis of Rosmarinic Acid in Escherichia coli
    Article Snippet: .. E. coli C2566 (New England Biolabs, Ipswich, MA, USA) was used for plasmid manipulation and propagation and was cultivated in Luria-Bertani (LB) medium at 37 °C. .. L. delbrueckii subsp . bulgaricus (DSM-20081) was cultivated anaerobically in MRS broth (DSMZ Medium 11) at 37 °C.

    Article Title: Incorporation of tetanus-epitope into virus-like particles achieves vaccine responses even in older recipients in models of psoriasis, Alzheimer’s and cat allergy
    Article Snippet: .. To obtain CMV VLPs, E. coli C2566 cells (New England Biolabs, Ipswich, USA) were transformed with the CMVTT CP gene-containing plasmid pET-CMVTT . .. After selection of clones with the highest expression levels of target protein, E. coli cultures were grown in 2xTY medium containing kanamycin (25 mg/l) on a rotary shaker (200 rev/min; Infors, Bottmingen, Switzerland) at 30 o C to an OD600 of 0.8–1.0.

    Article Title: Molecular and biochemical characterization of a novel isoprene synthase from Metrosideros polymorpha
    Article Snippet: .. E. coli C2566 (New England Biolabs) and the pET-28a(+) plasmid (Novagen, Merck KGaA, Darmstadt, Germany) were used as host cells and expression vectors, respectively. .. The gene encoding MpIspS was amplified by PCR using the synthetic DNA as the template.

    Article Title: Characterization of Transcription Factors That Regulate the Type IV Secretion System and Riboflavin Biosynthesis in Wolbachia of Brugia malayi
    Article Snippet: 10 μl of the ribAp-lacZ insert and 1 μl of the pACYC184 backbone were then incubated with 1 μl of USER enzyme at room temperature for 15 min before being transformed into E. coli cloning strain C3019 (NEB) to generate the ribAp-lacZ -pACYC184 reporter plasmid. .. Both ribAp-lacZ -pACYC184 and wBmxR1- pET21a or wBmxR2 -pET21a were transformed into E. coli strain C2566 (NEB) for measuring β-galactosidase activity measurement.

    Article Title: ‘Shotgun DNA synthesis’ for the high-throughput construction of large DNA molecules
    Article Snippet: Gel-purified and barcoded DNA fragments were cloned into the TOPO vector using the TOP Cloner™ Blunt core kit (Enzynomics, Daejeon, Korea). .. Chemically competent Escherichia coli cells originally derived from C2566 (NEB, Ipswich, MA, USA) were then transformed with the TOPO vectors.

    Negative Control:

    Article Title: Characterization of Transcription Factors That Regulate the Type IV Secretion System and Riboflavin Biosynthesis in Wolbachia of Brugia malayi
    Article Snippet: Both ribAp-lacZ -pACYC184 and wBmxR1- pET21a or wBmxR2 -pET21a were transformed into E. coli strain C2566 (NEB) for measuring β-galactosidase activity measurement. .. The pET21a vector alone was used as a negative control.

    Selection:

    Article Title: Incorporation of tetanus-epitope into virus-like particles achieves vaccine responses even in older recipients in models of psoriasis, Alzheimer’s and cat allergy
    Article Snippet: To obtain CMV VLPs, E. coli C2566 cells (New England Biolabs, Ipswich, USA) were transformed with the CMVTT CP gene-containing plasmid pET-CMVTT . .. After selection of clones with the highest expression levels of target protein, E. coli cultures were grown in 2xTY medium containing kanamycin (25 mg/l) on a rotary shaker (200 rev/min; Infors, Bottmingen, Switzerland) at 30 o C to an OD600 of 0.8–1.0.

    Agarose Gel Electrophoresis:

    Article Title: Comprehensive computational design of mCreI homing endonuclease cleavage specificity for genome engineering
    Article Snippet: Amplified fragments were purified by agarose gel electrophoresis and silica DNA binding (Qiagen), then digested with NcoI and NotI prior to ligation into the T7 expression vector pET-15bHE. .. Plasmids were then transformed into expression-competent C2566 Escherichia coli cells (New England Biolabs), followed by growth on plates containing 100 μg/ml carbenicillin and 0.2% (w/v) glucose.

    Article Title: ‘Shotgun DNA synthesis’ for the high-throughput construction of large DNA molecules
    Article Snippet: Eight replicate 50 µl PCR reactions containing 17.5 µl water, 25 µl Pfu DNA polymerase pre-mix, 2.5 µl of the 100-fold diluted gel purified products and 2.5 µl 454 DNA sequencing adaptor primers (Primer Set 3; see Supplementary Sequence 4 ; Macrogen, Seoul, Korea) were subjected to thermocycling using the following conditions: initial heating at 95°C for 3 min followed by 25 cycles of 95°C for 30 s, 71°C for 30 s, 72°C for 1 min and a final elongation at 72°C for 10 min. PCR products were electrophoresed through a 1.5% agarose gel and gel bands between 450 and 500 bp were excised and purified using an AccuPrep™ gel-purification kit with elution in 60 µl of water. .. Chemically competent Escherichia coli cells originally derived from C2566 (NEB, Ipswich, MA, USA) were then transformed with the TOPO vectors.

    In Vitro:

    Article Title: CRISPR-Cap: multiplexed double-stranded DNA enrichment based on the CRISPR system
    Article Snippet: The in vitro cleavage activity of the purified SpCas9 was previously confirmed ( ). .. We transformed C2566 BL21-based cells (New England BioLabs, USA) with the plasmid and cultured them in LB-kanamycin (30 μg/ml) media to an optical density at 600 nm (OD600 ) of 0.5.

    Produced:

    Article Title: Differential Regulation of Duplicate Light-Dependent Protochlorophyllide Oxidoreductases in the Diatom Phaeodactylum tricornutum
    Article Snippet: .. POR1 and POR2 heterologous expression Protein expression in E . coli c2566 was found to be leaky and growth overnight at 30°C without IPTG induction produced copious quantities of POR1 and POR2 proteins ( ). .. Overnight cultures were centrifuged at 2000xg for 20min at 4°C, and re-suspended in 10% the original culture volume of lysis buffer [PBS (50mM sodium phosphate, 300mM sodium chloride, pH 7) containing 0.1% Triton-X and 5mM β - mercaptoethanol and cOmplete ULTRA EDTA-free protease inhibitors (1 tablet per 10mL; Roche, Nutley, NJ)].

    Concentration Assay:

    Article Title: Controlled Aggregation and Increased Stability of β-Glucuronidase by Cellulose Binding Domain Fusion
    Article Snippet: Microorganisms, plasmids, media, and culture conditions E . coli MG1655, E . coli C2566 (New England Biolabs, UK), and the pET-21a (+) plasmid (Novagen, Darmstadt, Germany) were used as the source of genomic DNA for GusA, as host cells for protein expression, and as the expression vector, respectively. .. When the optical density of the bacteria reached 0.6 at 600 nm, isopropyl-β-d -thiogalactopyranoside (IPTG) was added at a final concentration of 0.1 mM to induce expression of GusA or GusA-CBD enzymes, and the cultures were incubated with shaking at 150 rpm at 16°C for 16 h.

    Article Title: CRISPR-Cap: multiplexed double-stranded DNA enrichment based on the CRISPR system
    Article Snippet: We transformed C2566 BL21-based cells (New England BioLabs, USA) with the plasmid and cultured them in LB-kanamycin (30 μg/ml) media to an optical density at 600 nm (OD600 ) of 0.5. .. We induced SpCas9 by treating the cultures with a 0.5 mM final concentration of isopropyl β-d -1-thiogalactopyranoside (IPTG) for 4 h at 30°C in a shaking incubator.

    Recombinant:

    Article Title: Targeting the Wolbachia Cell Division Protein FtsZ as a New Approach for Antifilarial Therapy
    Article Snippet: Paragraph title: Expression and purification of recombinant Wolbachia FtsZ proteins ... Each protein was expressed in the Escherichia coli strain C2566 (New England Biolabs).

    Article Title: Comprehensive computational design of mCreI homing endonuclease cleavage specificity for genome engineering
    Article Snippet: Paragraph title: Recombinant protein purification ... Plasmids were then transformed into expression-competent C2566 Escherichia coli cells (New England Biolabs), followed by growth on plates containing 100 μg/ml carbenicillin and 0.2% (w/v) glucose.

    Article Title: Prime-Boost Vaccination with SA-4-1BBL Costimulatory Molecule and Survivin Eradicates Lung Carcinoma in CD8+ T and NK Cell Dependent Manner
    Article Snippet: .. Cloning, expression, and purification of recombinant SVN Mouse SVN cDNA was subcloned into the pTWIN-1-6X-His bacterial expression vector and expressed in C2566 E. coli cells (New England Biolabs, Ipswich, MA). .. Briefly, IPTG treated cells were harvested 3 h after induction, pelleted, and resuspended in 100 ml of lysis buffer (20 mM Tris, pH 7.0, 500 mM NaCl, 5 mM imidazole, 5 mM β-ME, 10 µM ZnCl2 ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs c2566 complement cells
    C2566 Complement Cells, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c2566 complement cells/product/New England Biolabs
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    c2566 complement cells - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results