full length sid4  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    Name:
    SHuffle T7 Express lysY Competent E coli
    Description:
    SHuffle T7 Express lysY Competent E coli 12x0 05 ml
    Catalog Number:
    c3030j
    Price:
    228
    Size:
    12x0 05 ml
    Category:
    Competent Bacteria
    Buy from Supplier


    Structured Review

    New England Biolabs full length sid4
    SHuffle T7 Express lysY Competent E coli
    SHuffle T7 Express lysY Competent E coli 12x0 05 ml
    https://www.bioz.com/result/full length sid4/product/New England Biolabs
    Average 91 stars, based on 385 article reviews
    Price from $9.99 to $1999.99
    full length sid4 - by Bioz Stars, 2020-09
    91/100 stars

    Images

    1) Product Images from "Dialogue between centrosomal entrance and exit scaffold pathways regulates mitotic commitment"

    Article Title: Dialogue between centrosomal entrance and exit scaffold pathways regulates mitotic commitment

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.201702172

    Blocking phosphorylation on T275 and S278 of Sid4 to block Chk2 Cds1 recruitment abolishes Chk2 Cds1 ’s ability of to evict Flp1.GFP from the SPB. (A and B) Representative fluorescence and brightfield (BF) images of flp1.GFP ppc89.tdTom cells that reveal how the eviction of Flp1.GFP from the SPB is abolished in the sid4.T275AS278A background that prevents Chk2 Cds1 recruitment to the SPB. (C) Quantification of the data in A and B. n = 3. For controls, see Fig. S4. (D) Frequency of monopolarity in the indicated strains as for Fig. 1 B . Error bars in C and D indicate SD for three independent experiments.
    Figure Legend Snippet: Blocking phosphorylation on T275 and S278 of Sid4 to block Chk2 Cds1 recruitment abolishes Chk2 Cds1 ’s ability of to evict Flp1.GFP from the SPB. (A and B) Representative fluorescence and brightfield (BF) images of flp1.GFP ppc89.tdTom cells that reveal how the eviction of Flp1.GFP from the SPB is abolished in the sid4.T275AS278A background that prevents Chk2 Cds1 recruitment to the SPB. (C) Quantification of the data in A and B. n = 3. For controls, see Fig. S4. (D) Frequency of monopolarity in the indicated strains as for Fig. 1 B . Error bars in C and D indicate SD for three independent experiments.

    Techniques Used: Blocking Assay, Fluorescence

    Model: Flp1 eviction by a Sid4-mediated NIMA Fin1 , CK1δ Hhp1 /CK1δ Hhp2 , Chk2 Cds1 relay to boost the impact of Cdk1–cyclin B activation at the SPB. Phosphorylation of T584 by NIMA Fin1 reduces Sid4 affinity for Ppc89 and supports binding to CK1δ Hhp1 /CK1δ Hhp2 . The CK1δ kinases then phosphorylate T275 and S278 to promote the recruitment of Chk2 Cds1 . As we see a BiFc signal between Chk2 Cds1 and Sid4 that is sensitive to competition from Dma1 on the SPB ( Fig. 7, C and D ; and Fig. S3 C), we assume that the loss of affinity for Ppc89 on the SPB (A) is rapidly followed by a dephosphorylation event after CK1δ kinases have phosphorylated T275 and S278 to create the docking site for Chk2 Cds1 . Alternatively, Sid4 anchorage to the SPB is retained while CK1δ kinases phosphorylate T275 and S278. This could be acheived by the phosphorylation of only one Sid4 molecule within a Sid4 dimer (B) or through more complex higher-order associations of Sid4 molecules that await characterization. The T584 phosphatase that would be an essential component in A could equally well operate in the scheme shown in B to remove phosphate from T584 while Chk2 Cds1 is anchored to Sid4 phosphorylated on T275 and S278. Sid4-anchored Chk2 Cds1 phosphorylates Flp1 phosphatase to reduce its affinity for the SPB, thereby lowering antagonism toward Cdk1–cyclin B phosphorylation events on the SPB. The consequence of this cascade is a reduction in the threshold of phosphorylation that must be passed in order to convert the SPB into a mitotic state. The SPB matures from an early G2 state with no potential to invoke mitosis (top; red SPB) to a state with all three kinases in cycles of activation on the SPB (middle; amber) to the mitotic commitment state of Flp1 expulsion from the SPB (bottom; green). We assume that the tipping of the balance between mid-G2 and commitment arises from alterations in the phosphatase activities that dephosphorylate T584, T275, and S278.
    Figure Legend Snippet: Model: Flp1 eviction by a Sid4-mediated NIMA Fin1 , CK1δ Hhp1 /CK1δ Hhp2 , Chk2 Cds1 relay to boost the impact of Cdk1–cyclin B activation at the SPB. Phosphorylation of T584 by NIMA Fin1 reduces Sid4 affinity for Ppc89 and supports binding to CK1δ Hhp1 /CK1δ Hhp2 . The CK1δ kinases then phosphorylate T275 and S278 to promote the recruitment of Chk2 Cds1 . As we see a BiFc signal between Chk2 Cds1 and Sid4 that is sensitive to competition from Dma1 on the SPB ( Fig. 7, C and D ; and Fig. S3 C), we assume that the loss of affinity for Ppc89 on the SPB (A) is rapidly followed by a dephosphorylation event after CK1δ kinases have phosphorylated T275 and S278 to create the docking site for Chk2 Cds1 . Alternatively, Sid4 anchorage to the SPB is retained while CK1δ kinases phosphorylate T275 and S278. This could be acheived by the phosphorylation of only one Sid4 molecule within a Sid4 dimer (B) or through more complex higher-order associations of Sid4 molecules that await characterization. The T584 phosphatase that would be an essential component in A could equally well operate in the scheme shown in B to remove phosphate from T584 while Chk2 Cds1 is anchored to Sid4 phosphorylated on T275 and S278. Sid4-anchored Chk2 Cds1 phosphorylates Flp1 phosphatase to reduce its affinity for the SPB, thereby lowering antagonism toward Cdk1–cyclin B phosphorylation events on the SPB. The consequence of this cascade is a reduction in the threshold of phosphorylation that must be passed in order to convert the SPB into a mitotic state. The SPB matures from an early G2 state with no potential to invoke mitosis (top; red SPB) to a state with all three kinases in cycles of activation on the SPB (middle; amber) to the mitotic commitment state of Flp1 expulsion from the SPB (bottom; green). We assume that the tipping of the balance between mid-G2 and commitment arises from alterations in the phosphatase activities that dephosphorylate T584, T275, and S278.

    Techniques Used: Activation Assay, Binding Assay, Bimolecular Fluorescence Complementation Assay, De-Phosphorylation Assay

    Mutagenic mimicry of phosphorylation at T584 imparts a sin − phenotype. (A) A scheme showing the configuration of sid4.T584E strains. (B) Representative images of tubulin immunofluorescence as in Fig. 1 A of sid4.T584E cells 3 h after an early log phase culture was shifted from 19°C to 36°C. The binucleated interphase cells, indicated by arrows, arise from cytokinesis/septation failure in the previous cell cycle because of abolition of SIN function. n = 3. See also Fig. S2 B. BF, brightfield. (C) Spot tests of the indicated strains after growth on minimal (EMM2, no thiamine sid4 + expressed), or rich (YES) medium (contains thiamine to repress sid4 + ) at the indicated temperatures. (D) Representative monopolar counts as in Fig. 1 (C and D) . See also Fig. S1 B. n = 3. (E–H) Western blots exploiting polyclonal antibodies that recognize Sid4 when phosphorylated on either T584 or simultaneously on both T275 and S278, all species of either Sid4 or Fin1, or the myc epitope tags on Pom1, as indicated. (E) Blots of Sid4 immunoprecipitates of denatured samples from cdc25.22 dma1.Δ cultures returned to 25°C 4.25 h after a shift to 36°C. As T584 phosphorylation peaks 40 min after release (not depicted), the impact of compromising kinase activities upon T584 phosphorylation was monitored at this time point in the figure. (F) Fin1 and Sid2 were isolated with polyclonal antibodies, whereas Pom1 was isolated with antibodies against the myc epitope, for kinase assays to identify which kinase could directly phosphorylate recombinant full-length Sid4 purified from E. coli . (G) Polyclonal antibodies precipitated Fin1 from asynchronous cultures of the indicated strains for in vitro kinase assays with recombinant Sid4. T584 phosphorylation was detected with the antibodies used in E.
    Figure Legend Snippet: Mutagenic mimicry of phosphorylation at T584 imparts a sin − phenotype. (A) A scheme showing the configuration of sid4.T584E strains. (B) Representative images of tubulin immunofluorescence as in Fig. 1 A of sid4.T584E cells 3 h after an early log phase culture was shifted from 19°C to 36°C. The binucleated interphase cells, indicated by arrows, arise from cytokinesis/septation failure in the previous cell cycle because of abolition of SIN function. n = 3. See also Fig. S2 B. BF, brightfield. (C) Spot tests of the indicated strains after growth on minimal (EMM2, no thiamine sid4 + expressed), or rich (YES) medium (contains thiamine to repress sid4 + ) at the indicated temperatures. (D) Representative monopolar counts as in Fig. 1 (C and D) . See also Fig. S1 B. n = 3. (E–H) Western blots exploiting polyclonal antibodies that recognize Sid4 when phosphorylated on either T584 or simultaneously on both T275 and S278, all species of either Sid4 or Fin1, or the myc epitope tags on Pom1, as indicated. (E) Blots of Sid4 immunoprecipitates of denatured samples from cdc25.22 dma1.Δ cultures returned to 25°C 4.25 h after a shift to 36°C. As T584 phosphorylation peaks 40 min after release (not depicted), the impact of compromising kinase activities upon T584 phosphorylation was monitored at this time point in the figure. (F) Fin1 and Sid2 were isolated with polyclonal antibodies, whereas Pom1 was isolated with antibodies against the myc epitope, for kinase assays to identify which kinase could directly phosphorylate recombinant full-length Sid4 purified from E. coli . (G) Polyclonal antibodies precipitated Fin1 from asynchronous cultures of the indicated strains for in vitro kinase assays with recombinant Sid4. T584 phosphorylation was detected with the antibodies used in E.

    Techniques Used: Immunofluorescence, Western Blot, Isolation, Recombinant, Purification, In Vitro

    Recruitment of Chk2 Cds1 to T275S278-phosphorylated Sid4 compensates for the SPB activation defect of c ut12.1 . (A and F) Representative plots of monopolar spindle counts as for Fig. 1 C . See also Fig. S3 A. In each case, n = 3. (B) Yeast two-hybrid comparisons of the indicated constructs. For full dilution series, see Fig. S3 B. Mrc1 is a validated Chk2 Cds1 partner ( Tanaka and Russell, 2001 ). SD-L-T, SD-Leu-Trp; SD-L-T-H, SD-Leu-Trp-His. (C and D) BiFc assays of fluorescence generated between Chk2 Cds1 .nYFP and Sid4.cYFP in the indicated strains. Each field shows cells from cultures of different strains as indicated. Cell walls of the strain named in red having been stained by transient suspension in red fluorescent lectin to identify it in the mixed field. The images are maximum projections of deconvoluted z stacks that span the diameter of the cell. See also Fig. S3 C. n = 3. Red arrows indicate signals at SPBs of wild-type sid4 + cells, and white arrows indicate signals at SPBs of sid4.T275A278AcYFP cells. BF, brightfield. (E) GFP-Trap precipitates from the indicated Chk2 Cds1 .GFP d ma1.Δ strains probed with Sid4 antibodies to detect coprecipitating Sid4. Coprecipitation was abolished by simultaneous phospho-blocking mutation at 275 and 278. n = 3. IP, immunoprecipitation. (F) A switch from 20 µM thiamine to the indicated concentrations 24 h before the temperature shift to 36 ° C de-repressed transcription of the Chk2 Cds1 .GFPn in a dose-dependent manner. n = 3.
    Figure Legend Snippet: Recruitment of Chk2 Cds1 to T275S278-phosphorylated Sid4 compensates for the SPB activation defect of c ut12.1 . (A and F) Representative plots of monopolar spindle counts as for Fig. 1 C . See also Fig. S3 A. In each case, n = 3. (B) Yeast two-hybrid comparisons of the indicated constructs. For full dilution series, see Fig. S3 B. Mrc1 is a validated Chk2 Cds1 partner ( Tanaka and Russell, 2001 ). SD-L-T, SD-Leu-Trp; SD-L-T-H, SD-Leu-Trp-His. (C and D) BiFc assays of fluorescence generated between Chk2 Cds1 .nYFP and Sid4.cYFP in the indicated strains. Each field shows cells from cultures of different strains as indicated. Cell walls of the strain named in red having been stained by transient suspension in red fluorescent lectin to identify it in the mixed field. The images are maximum projections of deconvoluted z stacks that span the diameter of the cell. See also Fig. S3 C. n = 3. Red arrows indicate signals at SPBs of wild-type sid4 + cells, and white arrows indicate signals at SPBs of sid4.T275A278AcYFP cells. BF, brightfield. (E) GFP-Trap precipitates from the indicated Chk2 Cds1 .GFP d ma1.Δ strains probed with Sid4 antibodies to detect coprecipitating Sid4. Coprecipitation was abolished by simultaneous phospho-blocking mutation at 275 and 278. n = 3. IP, immunoprecipitation. (F) A switch from 20 µM thiamine to the indicated concentrations 24 h before the temperature shift to 36 ° C de-repressed transcription of the Chk2 Cds1 .GFPn in a dose-dependent manner. n = 3.

    Techniques Used: Activation Assay, Construct, Bimolecular Fluorescence Complementation Assay, Fluorescence, Generated, Staining, Blocking Assay, Mutagenesis, Immunoprecipitation

    Recruitment of CK1δ Hhp1 /CK1δ Hhp2 to T584-phosphorylated Sid4 suppresses cut12.1 monopolarity. (A, B, D, and E) Representative monopolar spindle counts of the indicated strains as for Fig. 1 C . In each case, n = 3. See also Fig. S2. (C) The scheme for the anchorage of CK1δ Hhp1 and CK1δ Hhp2 .AS to the SPB to suppress the spindle activation defect of cut12.1 .
    Figure Legend Snippet: Recruitment of CK1δ Hhp1 /CK1δ Hhp2 to T584-phosphorylated Sid4 suppresses cut12.1 monopolarity. (A, B, D, and E) Representative monopolar spindle counts of the indicated strains as for Fig. 1 C . In each case, n = 3. See also Fig. S2. (C) The scheme for the anchorage of CK1δ Hhp1 and CK1δ Hhp2 .AS to the SPB to suppress the spindle activation defect of cut12.1 .

    Techniques Used: Activation Assay

    T584 phosphorylation switches Sid4 affinity for Ppc89 to affinity for CK1δ Hhp1 /CK1δ Hhp2 . (A) A scheme showing the configuration of strains expressing fusions between the carboxyl terminus of Sid4 and GFP to monitor affinity for the SPB in B. (B) Maximum projections of z stacks of GFP fluorescence that span the diameter of the cell. BF, brightfield. (C) Qualitative assessment of the impact of the indicated mutations upon the ability of the Sid4-GFP fusion protein to be recruited to the SPB. (D) GFP-Trap precipitation of the Sid4.GFP fusions used in A–C reveal association of wild-type and phospho-blocking T584V fusions with Ppc89.3Pk (detected with the 336 monoclonal antibody that recognizes the Pk epitope). IP, immunoprecipitation. (E) Yeast two-hybrid assays using the indicated baits and prey suggest that phosphorylation switches the affinity of unphosphorylated Sid4 for Ppc89 to an affinity for C K1δ Hhp1 /CK1δ Hhp2 . n = 3. For full dilution series, see Fig. S1 C. SD-L-T, SD-Leu-Trp; SD-L-T-H, SD-Leu-Trp-His.
    Figure Legend Snippet: T584 phosphorylation switches Sid4 affinity for Ppc89 to affinity for CK1δ Hhp1 /CK1δ Hhp2 . (A) A scheme showing the configuration of strains expressing fusions between the carboxyl terminus of Sid4 and GFP to monitor affinity for the SPB in B. (B) Maximum projections of z stacks of GFP fluorescence that span the diameter of the cell. BF, brightfield. (C) Qualitative assessment of the impact of the indicated mutations upon the ability of the Sid4-GFP fusion protein to be recruited to the SPB. (D) GFP-Trap precipitation of the Sid4.GFP fusions used in A–C reveal association of wild-type and phospho-blocking T584V fusions with Ppc89.3Pk (detected with the 336 monoclonal antibody that recognizes the Pk epitope). IP, immunoprecipitation. (E) Yeast two-hybrid assays using the indicated baits and prey suggest that phosphorylation switches the affinity of unphosphorylated Sid4 for Ppc89 to an affinity for C K1δ Hhp1 /CK1δ Hhp2 . n = 3. For full dilution series, see Fig. S1 C. SD-L-T, SD-Leu-Trp; SD-L-T-H, SD-Leu-Trp-His.

    Techniques Used: Expressing, Fluorescence, Blocking Assay, Immunoprecipitation

    sid4.T584E compromises anchorage of Sid4 and Cdc11 to the SPB. (A) Representative fluorescence images showing how the SPB affinity of the T584 phosphomimetic Sid4.T584EGFP fusion protein is reduced at 36°C. The cell walls of wild-type sid4.GFP cells were stained by resuspension in red lectin before being mixed with unstained sid4.T584EGFP cells and mounting the mixture for capture of a series of slices in the z axis that were merged to give the maximum projection shown. Red arrowheads indicate signals at SPBs of wild-type cells, and white arrows indicate signals at SPBs of sid4.T584E cells. n = 3. BF, brightfield. (B) Western blots of mid-log phase cultures of the indicated strains in which the transcription of an ectopic copy of sid4 + at the hph.171 locus was either repressed (Sid4 − ) by the inclusion of 20 µM thiamine or de-repressed by the removal of thiamine 24 h before sampling (Sid4 + ). n = 3. (C) Representative fluorescence images of Cdc11.GFP in the indicated strains at the temperatures shown. Both fields show a mixture of sid4 + cdc11.GFP and sid4.T584E cdc11.GFP cells. The sid4 + cdc11.GFP cells were stained by transient resuspension in red fluorescent lectin to identify them in the mixed field of view to highlight the reduction in fluorescence intensity arising from the sid4.T584E mutation. n = 3. (D) The scheme for the anchorage of Sid4.T584EGFP to the SPB for the spot tests in E that show that sid4.T584E sin − lethality arises from Sid4 departure from the SPB. (E) Spot tests in which serial dilution of the indicated strains were placed onto agar plates and incubated at 36 ° C.
    Figure Legend Snippet: sid4.T584E compromises anchorage of Sid4 and Cdc11 to the SPB. (A) Representative fluorescence images showing how the SPB affinity of the T584 phosphomimetic Sid4.T584EGFP fusion protein is reduced at 36°C. The cell walls of wild-type sid4.GFP cells were stained by resuspension in red lectin before being mixed with unstained sid4.T584EGFP cells and mounting the mixture for capture of a series of slices in the z axis that were merged to give the maximum projection shown. Red arrowheads indicate signals at SPBs of wild-type cells, and white arrows indicate signals at SPBs of sid4.T584E cells. n = 3. BF, brightfield. (B) Western blots of mid-log phase cultures of the indicated strains in which the transcription of an ectopic copy of sid4 + at the hph.171 locus was either repressed (Sid4 − ) by the inclusion of 20 µM thiamine or de-repressed by the removal of thiamine 24 h before sampling (Sid4 + ). n = 3. (C) Representative fluorescence images of Cdc11.GFP in the indicated strains at the temperatures shown. Both fields show a mixture of sid4 + cdc11.GFP and sid4.T584E cdc11.GFP cells. The sid4 + cdc11.GFP cells were stained by transient resuspension in red fluorescent lectin to identify them in the mixed field of view to highlight the reduction in fluorescence intensity arising from the sid4.T584E mutation. n = 3. (D) The scheme for the anchorage of Sid4.T584EGFP to the SPB for the spot tests in E that show that sid4.T584E sin − lethality arises from Sid4 departure from the SPB. (E) Spot tests in which serial dilution of the indicated strains were placed onto agar plates and incubated at 36 ° C.

    Techniques Used: Fluorescence, Staining, Western Blot, Sampling, Mutagenesis, Serial Dilution, Incubation

    C-terminal mutation of sid4 suppresses the cut12.1 SPB activation defect. (A) Representative images of immunofluorescence to reveal tubulin, the spindle pole marker Sad1, and chromatin 3 h after the temperature of an early log-phase culture was shifted from 25°C to 36°C in EMM2. n = 5. Arrows indicate the two SPBs. BF, brightfield. (B) A cartoon summarizing the SPB molecules upon which this study focuses. The representation is highly stylized because the mode of anchoring to the SPB core remains unclear for Ppc89 and Cut12, however. Cut12 is known to promote mitotic commitment (red arrows), whereas the anchorage of Sid4 to the SPB by Ppc89 enables Sid4 to anchor Cdc11 to the SPB. As Cdc11 recruits the SIN to the new SPB in anaphase, the recruitment of Cdc11 to Sid4 supports the events of mitotic exit such as septation and the formation of the equatorial microtubule-organizing center ( Heitz et al., 2001 ; Simanis, 2015 ). (C and D) Representative graphs indicating the frequency of spindle monopolarity in samples of the indicated strains 3 h after early log phase cultures were shifted from 25°C to 36°C. For each strain, 100 cells with spindle staining were scored as being either bipolar or monopolar. n = 3. Note that the SPB activation delay of cut12.1 means that monopolarity gives an underestimate of the incidence of SPB activation defects ( Tallada et al., 2009 ). See also Fig. S1 A. (E) A schematic of the characterized associations of the indicated SPB components. The core SPB and SIN are indicated in gray. It is not clear whether only one or both of the components of the Sid4 dimer binds to Cdc11 or Ppc89. The coiled-coil regions in Ppc89 have prompted us to show Ppc89 as a dimer; however, we note that homodimerization or higher levels of oligomerization are yet to be demonstrated. (F) The position of key mutations within an alignment of the sequences of the C termini of Sid4 from Schizosaccharomyces species and Pneumocystis murina .
    Figure Legend Snippet: C-terminal mutation of sid4 suppresses the cut12.1 SPB activation defect. (A) Representative images of immunofluorescence to reveal tubulin, the spindle pole marker Sad1, and chromatin 3 h after the temperature of an early log-phase culture was shifted from 25°C to 36°C in EMM2. n = 5. Arrows indicate the two SPBs. BF, brightfield. (B) A cartoon summarizing the SPB molecules upon which this study focuses. The representation is highly stylized because the mode of anchoring to the SPB core remains unclear for Ppc89 and Cut12, however. Cut12 is known to promote mitotic commitment (red arrows), whereas the anchorage of Sid4 to the SPB by Ppc89 enables Sid4 to anchor Cdc11 to the SPB. As Cdc11 recruits the SIN to the new SPB in anaphase, the recruitment of Cdc11 to Sid4 supports the events of mitotic exit such as septation and the formation of the equatorial microtubule-organizing center ( Heitz et al., 2001 ; Simanis, 2015 ). (C and D) Representative graphs indicating the frequency of spindle monopolarity in samples of the indicated strains 3 h after early log phase cultures were shifted from 25°C to 36°C. For each strain, 100 cells with spindle staining were scored as being either bipolar or monopolar. n = 3. Note that the SPB activation delay of cut12.1 means that monopolarity gives an underestimate of the incidence of SPB activation defects ( Tallada et al., 2009 ). See also Fig. S1 A. (E) A schematic of the characterized associations of the indicated SPB components. The core SPB and SIN are indicated in gray. It is not clear whether only one or both of the components of the Sid4 dimer binds to Cdc11 or Ppc89. The coiled-coil regions in Ppc89 have prompted us to show Ppc89 as a dimer; however, we note that homodimerization or higher levels of oligomerization are yet to be demonstrated. (F) The position of key mutations within an alignment of the sequences of the C termini of Sid4 from Schizosaccharomyces species and Pneumocystis murina .

    Techniques Used: Mutagenesis, Activation Assay, Immunofluorescence, Marker, Staining

    Phosphorylation on T584 promotes cell cycle–dependent phosphorylation of both T275 and S278. (A) Antibodies raised against a peptide corresponding with Sid4 simultaneously phosphorylated on T275 and S278 used to blot Sid4 preparations immunoprecipitated from denatured extracts of the indicated strains. Immunoprecipitates were incubated for 30 min at 30°C with λ phosphatase, its inhibitor, or buffer alone, as indicated. (B–D) Small G2 dma1.Δ (B), sid4.GFP ppc89.GBP dma1.Δ (C), or sid4.T584EGFP ppc89.GBP dma1.Δ (D) cells were isolated from mid-log phase cultures by centrifugal elutriation at t = 0, and aliquots were taken at the indicated intervals to monitor septation and new end take off (NETO) with calcofluor white or phosphorylation on both T275 and S278. Control samples 40 min after cdc25.22 dma1.Δ control cultures were released from 4.25 h arrest at 36 ° C as indicated.
    Figure Legend Snippet: Phosphorylation on T584 promotes cell cycle–dependent phosphorylation of both T275 and S278. (A) Antibodies raised against a peptide corresponding with Sid4 simultaneously phosphorylated on T275 and S278 used to blot Sid4 preparations immunoprecipitated from denatured extracts of the indicated strains. Immunoprecipitates were incubated for 30 min at 30°C with λ phosphatase, its inhibitor, or buffer alone, as indicated. (B–D) Small G2 dma1.Δ (B), sid4.GFP ppc89.GBP dma1.Δ (C), or sid4.T584EGFP ppc89.GBP dma1.Δ (D) cells were isolated from mid-log phase cultures by centrifugal elutriation at t = 0, and aliquots were taken at the indicated intervals to monitor septation and new end take off (NETO) with calcofluor white or phosphorylation on both T275 and S278. Control samples 40 min after cdc25.22 dma1.Δ control cultures were released from 4.25 h arrest at 36 ° C as indicated.

    Techniques Used: Immunoprecipitation, Incubation, Isolation

    2) Product Images from "hnRNPDL Phase Separation Is Regulated by Alternative Splicing and Disease-Causing Mutations Accelerate Its Aggregation"

    Article Title: hnRNPDL Phase Separation Is Regulated by Alternative Splicing and Disease-Causing Mutations Accelerate Its Aggregation

    Journal: Cell Reports

    doi: 10.1016/j.celrep.2019.12.080

    hnRNPDL Isoform 2 Disease-Causing Mutation Effects in Drosophila (A) Expression levels of DL2 and disease-causing mutations (DL2N and DL2H) in transgenic flies. Thoraxes of adult flies were processed for western blot analysis with an antibody against hnRNPDL. Actin was blotted as a loading control. (B) Adult flies were dissected to expose the dorsal longitudinal indirect fly muscle (DLM) and stained with Alexa Fluor 647-phalloidin (purple), hnRNPDL (red), and DAPI (blue). (C) Thoraxes of adult flies were dissected. Sequential extractions were performed to examine the solubility profile of hnRNPDL.
    Figure Legend Snippet: hnRNPDL Isoform 2 Disease-Causing Mutation Effects in Drosophila (A) Expression levels of DL2 and disease-causing mutations (DL2N and DL2H) in transgenic flies. Thoraxes of adult flies were processed for western blot analysis with an antibody against hnRNPDL. Actin was blotted as a loading control. (B) Adult flies were dissected to expose the dorsal longitudinal indirect fly muscle (DLM) and stained with Alexa Fluor 647-phalloidin (purple), hnRNPDL (red), and DAPI (blue). (C) Thoraxes of adult flies were dissected. Sequential extractions were performed to examine the solubility profile of hnRNPDL.

    Techniques Used: Mutagenesis, Expressing, Transgenic Assay, Western Blot, Staining, Solubility

    3) Product Images from "Evaluation of a Plasmodium-Specific Carrier Protein To Enhance Production of Recombinant Pfs25, a Leading Transmission-Blocking Vaccine Candidate"

    Article Title: Evaluation of a Plasmodium-Specific Carrier Protein To Enhance Production of Recombinant Pfs25, a Leading Transmission-Blocking Vaccine Candidate

    Journal: Infection and Immunity

    doi: 10.1128/IAI.00486-17

    Expression of chimeric r Pf s25/8(CΔS) and unfused r Pf s25. (A) Schematic depiction of expression constructs for the production of r Pf s25/8(CΔS) and r Pf s25. Expression plasmids for chimeric r Pf s25/8(CΔS) or unfused r Pf s25 were transformed into E. coli SHuffle T7 Express lysY cells. (B and C) r Pf s25/8(CΔS) lysates harvested before ( T 0 ) or 3 h after ( T 3 ) induction were separated by SDS-PAGE (10% gel) under reducing conditions, followed by Coomassie blue staining (B) or immunoblot analysis (C) using rabbit-anti-r Pf MSP8 IgG. The asterisk highlights r Pf s25/8(CΔS) at the predicted size. (D and E) The expression of unfused r Pf s25 was assessed as described above, on 12% polyacrylamide gels under reducing conditions, followed by Coomassie blue staining (D) or immunoblot analysis (E) using an anti-His MAb. The asterisk highlights r Pf s25 at the predicted size.
    Figure Legend Snippet: Expression of chimeric r Pf s25/8(CΔS) and unfused r Pf s25. (A) Schematic depiction of expression constructs for the production of r Pf s25/8(CΔS) and r Pf s25. Expression plasmids for chimeric r Pf s25/8(CΔS) or unfused r Pf s25 were transformed into E. coli SHuffle T7 Express lysY cells. (B and C) r Pf s25/8(CΔS) lysates harvested before ( T 0 ) or 3 h after ( T 3 ) induction were separated by SDS-PAGE (10% gel) under reducing conditions, followed by Coomassie blue staining (B) or immunoblot analysis (C) using rabbit-anti-r Pf MSP8 IgG. The asterisk highlights r Pf s25/8(CΔS) at the predicted size. (D and E) The expression of unfused r Pf s25 was assessed as described above, on 12% polyacrylamide gels under reducing conditions, followed by Coomassie blue staining (D) or immunoblot analysis (E) using an anti-His MAb. The asterisk highlights r Pf s25 at the predicted size.

    Techniques Used: Expressing, Construct, Transformation Assay, SDS Page, Staining

    4) Product Images from "A simple strategy for heritable chromosomal deletions in zebrafish via the combinatorial action of targeting nucleases"

    Article Title: A simple strategy for heritable chromosomal deletions in zebrafish via the combinatorial action of targeting nucleases

    Journal: Genome Biology

    doi: 10.1186/gb-2013-14-7-r69

    Targeted deletions in cyc and sqt by multiple TALEN and ZFN pairs . (a) Schematic representation of the cyc and sqt loci, with positions of the TALEN targeting sites and ZFN targeting sites indicated by black arrows. E1, E2 and E3 indicate cyc or sqt exons 1 to 3. Colored triangles in the both cyc and sqt panels indicate the position of primers used for genotyping. (b) Phenotype of cyc TALEN injected embryo at 24 hpf showing cyclopia. Scale bar, 100 μm. (c) Phenotype of representative sqt nuclease-injected embryo manifesting cyclopia and midline defects. (d) PCR with primers (yellow and black triangles in (a)) spanning the TALEN targeting sites (black arrows in (a)) shows the expected approximately 400 bp truncated cyc (white arrowhead), and 779 bp full-length cyc (black arrowhead) products in ten single embryos injected with cyc TALEN pairs, whereas the full-length product is observed in the un-injected control embryo. All embryos show faint intermediate sized products. No template control is indicated by -g. (e) PCR with primers (red and blue triangles in (a)) spanning the sqt locus show a 2.4 kb product (black arrowhead) for the intact sqt locus, whereas individual embryos with TALEN deletions show an approximately 220 bp complete locus deletion product (white arrowhead) and several other intermediate sized products. (f) PCR with primers spanning the sqt TSS site (red and green triangles in (a)) show a 478 bp full-length wild-type product (black arrowhead), and only one embryo (number 1) shows the expected approximately 300 bp deletion product (white arrowhead). (g) Alignment of wild-type (WT) cyc sequences with mutated PCR amplicons shows various deletions of approximately 400 bp between the targeting sites, accompanied by small insertions (red). (h) Alignment of wild type s qt sequences with mutated PCR amplicons shows various deletions of approximately 2.2 kb between the targeting sites, accompanied by small insertions (red).
    Figure Legend Snippet: Targeted deletions in cyc and sqt by multiple TALEN and ZFN pairs . (a) Schematic representation of the cyc and sqt loci, with positions of the TALEN targeting sites and ZFN targeting sites indicated by black arrows. E1, E2 and E3 indicate cyc or sqt exons 1 to 3. Colored triangles in the both cyc and sqt panels indicate the position of primers used for genotyping. (b) Phenotype of cyc TALEN injected embryo at 24 hpf showing cyclopia. Scale bar, 100 μm. (c) Phenotype of representative sqt nuclease-injected embryo manifesting cyclopia and midline defects. (d) PCR with primers (yellow and black triangles in (a)) spanning the TALEN targeting sites (black arrows in (a)) shows the expected approximately 400 bp truncated cyc (white arrowhead), and 779 bp full-length cyc (black arrowhead) products in ten single embryos injected with cyc TALEN pairs, whereas the full-length product is observed in the un-injected control embryo. All embryos show faint intermediate sized products. No template control is indicated by -g. (e) PCR with primers (red and blue triangles in (a)) spanning the sqt locus show a 2.4 kb product (black arrowhead) for the intact sqt locus, whereas individual embryos with TALEN deletions show an approximately 220 bp complete locus deletion product (white arrowhead) and several other intermediate sized products. (f) PCR with primers spanning the sqt TSS site (red and green triangles in (a)) show a 478 bp full-length wild-type product (black arrowhead), and only one embryo (number 1) shows the expected approximately 300 bp deletion product (white arrowhead). (g) Alignment of wild-type (WT) cyc sequences with mutated PCR amplicons shows various deletions of approximately 400 bp between the targeting sites, accompanied by small insertions (red). (h) Alignment of wild type s qt sequences with mutated PCR amplicons shows various deletions of approximately 2.2 kb between the targeting sites, accompanied by small insertions (red).

    Techniques Used: Injection, Polymerase Chain Reaction

    5) Product Images from "A simple strategy for heritable chromosomal deletions in zebrafish via the combinatorial action of targeting nucleases"

    Article Title: A simple strategy for heritable chromosomal deletions in zebrafish via the combinatorial action of targeting nucleases

    Journal: Genome Biology

    doi: 10.1186/gb-2013-14-7-r69

    Targeted deletions in cyc and sqt by multiple TALEN and ZFN pairs . (a) Schematic representation of the cyc and sqt loci, with positions of the TALEN targeting sites and ZFN targeting sites indicated by black arrows. E1, E2 and E3 indicate cyc or sqt exons 1 to 3. Colored triangles in the both cyc and sqt panels indicate the position of primers used for genotyping. (b) Phenotype of cyc TALEN injected embryo at 24 hpf showing cyclopia. Scale bar, 100 μm. (c) Phenotype of representative sqt nuclease-injected embryo manifesting cyclopia and midline defects. (d) PCR with primers (yellow and black triangles in (a)) spanning the TALEN targeting sites (black arrows in (a)) shows the expected approximately 400 bp truncated cyc (white arrowhead), and 779 bp full-length cyc (black arrowhead) products in ten single embryos injected with cyc TALEN pairs, whereas the full-length product is observed in the un-injected control embryo. All embryos show faint intermediate sized products. No template control is indicated by -g. (e) PCR with primers (red and blue triangles in (a)) spanning the sqt locus show a 2.4 kb product (black arrowhead) for the intact sqt locus, whereas individual embryos with TALEN deletions show an approximately 220 bp complete locus deletion product (white arrowhead) and several other intermediate sized products. (f) PCR with primers spanning the sqt TSS site (red and green triangles in (a)) show a 478 bp full-length wild-type product (black arrowhead), and only one embryo (number 1) shows the expected approximately 300 bp deletion product (white arrowhead). (g) Alignment of wild-type (WT) cyc sequences with mutated PCR amplicons shows various deletions of approximately 400 bp between the targeting sites, accompanied by small insertions (red). (h) Alignment of wild type s qt sequences with mutated PCR amplicons shows various deletions of approximately 2.2 kb between the targeting sites, accompanied by small insertions (red).
    Figure Legend Snippet: Targeted deletions in cyc and sqt by multiple TALEN and ZFN pairs . (a) Schematic representation of the cyc and sqt loci, with positions of the TALEN targeting sites and ZFN targeting sites indicated by black arrows. E1, E2 and E3 indicate cyc or sqt exons 1 to 3. Colored triangles in the both cyc and sqt panels indicate the position of primers used for genotyping. (b) Phenotype of cyc TALEN injected embryo at 24 hpf showing cyclopia. Scale bar, 100 μm. (c) Phenotype of representative sqt nuclease-injected embryo manifesting cyclopia and midline defects. (d) PCR with primers (yellow and black triangles in (a)) spanning the TALEN targeting sites (black arrows in (a)) shows the expected approximately 400 bp truncated cyc (white arrowhead), and 779 bp full-length cyc (black arrowhead) products in ten single embryos injected with cyc TALEN pairs, whereas the full-length product is observed in the un-injected control embryo. All embryos show faint intermediate sized products. No template control is indicated by -g. (e) PCR with primers (red and blue triangles in (a)) spanning the sqt locus show a 2.4 kb product (black arrowhead) for the intact sqt locus, whereas individual embryos with TALEN deletions show an approximately 220 bp complete locus deletion product (white arrowhead) and several other intermediate sized products. (f) PCR with primers spanning the sqt TSS site (red and green triangles in (a)) show a 478 bp full-length wild-type product (black arrowhead), and only one embryo (number 1) shows the expected approximately 300 bp deletion product (white arrowhead). (g) Alignment of wild-type (WT) cyc sequences with mutated PCR amplicons shows various deletions of approximately 400 bp between the targeting sites, accompanied by small insertions (red). (h) Alignment of wild type s qt sequences with mutated PCR amplicons shows various deletions of approximately 2.2 kb between the targeting sites, accompanied by small insertions (red).

    Techniques Used: Injection, Polymerase Chain Reaction

    6) Product Images from "Generation of an external guide sequence library for a reverse genetic screen in Caenorhabditis elegans"

    Article Title: Generation of an external guide sequence library for a reverse genetic screen in Caenorhabditis elegans

    Journal: BMC Biotechnology

    doi: 10.1186/1472-6750-9-47

    Construction of pET28a-LEGS . (A) Flow chart showing the construction of pET28a-LEGS. (B) The PCR product of pET28a-LEGSL (lane 1). The arrow indicates the 5-kb DNA band (lane M).
    Figure Legend Snippet: Construction of pET28a-LEGS . (A) Flow chart showing the construction of pET28a-LEGS. (B) The PCR product of pET28a-LEGSL (lane 1). The arrow indicates the 5-kb DNA band (lane M).

    Techniques Used: Flow Cytometry, Polymerase Chain Reaction

    7) Product Images from "Immunodominant IgM and IgG Epitopes Recognized by Antibodies Induced in Enterovirus A71-Associated Hand, Foot and Mouth Disease Patients"

    Article Title: Immunodominant IgM and IgG Epitopes Recognized by Antibodies Induced in Enterovirus A71-Associated Hand, Foot and Mouth Disease Patients

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0165659

    Amino acid sequence alignment of peptides with enteroviruses. The selected peptides (PEP12, PEP19, PEP21, PEP23, PEP25 and PEP27) were aligned to the corresponding sequences from 12 enterovirus prototype and consensus contemporary sequences (EV-A71, CV-A2 to CV-A8, CV-A10, CV-A12, CV-A14 and CV-A16). Conserved amino acids are indicated by a dash (–) and alignment gaps are shown in grey. The consensus sequences represent the current circulating strains while BrCr, Fleetwood, Olson, High Point, Swartz, Gdula, Parker, Donovan, Kowalik, Texas, G14 and G10 are the prototype virus strains.
    Figure Legend Snippet: Amino acid sequence alignment of peptides with enteroviruses. The selected peptides (PEP12, PEP19, PEP21, PEP23, PEP25 and PEP27) were aligned to the corresponding sequences from 12 enterovirus prototype and consensus contemporary sequences (EV-A71, CV-A2 to CV-A8, CV-A10, CV-A12, CV-A14 and CV-A16). Conserved amino acids are indicated by a dash (–) and alignment gaps are shown in grey. The consensus sequences represent the current circulating strains while BrCr, Fleetwood, Olson, High Point, Swartz, Gdula, Parker, Donovan, Kowalik, Texas, G14 and G10 are the prototype virus strains.

    Techniques Used: Sequencing

    EV-A71-specific IgM and IgG antibody determinants. (A) EV-A71-specific IgM antibody detection in sera (n = 44) at a dilution of 1:2000 was determined by peptide-based ELISA. Sera were categorized into EV-A71-infected patients (n = 22), non-EV-A71 enterovirus-infected patients (n = 12) and non-HFMD patients (n = 10). Red solid lines represent medians. (B) EV-A71-specific IgG antibody detection in sera (n = 38) at a dilution of 1:500 was determined by peptide-based ELISA. Sera were categorized into EV-A71-infected patients (n = 25), non-EV-A71 enterovirus-infected patients (n = 8) and healthy adults (n = 5). Red solid lines represent medians. One-way ANOVA with Kruskal-Wallis test was used for statistical analysis (* P
    Figure Legend Snippet: EV-A71-specific IgM and IgG antibody determinants. (A) EV-A71-specific IgM antibody detection in sera (n = 44) at a dilution of 1:2000 was determined by peptide-based ELISA. Sera were categorized into EV-A71-infected patients (n = 22), non-EV-A71 enterovirus-infected patients (n = 12) and non-HFMD patients (n = 10). Red solid lines represent medians. (B) EV-A71-specific IgG antibody detection in sera (n = 38) at a dilution of 1:500 was determined by peptide-based ELISA. Sera were categorized into EV-A71-infected patients (n = 25), non-EV-A71 enterovirus-infected patients (n = 8) and healthy adults (n = 5). Red solid lines represent medians. One-way ANOVA with Kruskal-Wallis test was used for statistical analysis (* P

    Techniques Used: Peptide ELISA, Infection

    Mapping of EV-A71 B-cell epitopes. Pooled human sera, at optimized dilutions of 1:2000 (IgM) and 1:500 (IgG), were subjected to peptide-based ELISA. (A) Acute infection with high neutralization sera (n = 5) were used for EV-A71-reactive IgM antibody detection. (B) Acute infection with high neutralization sera (n = 5), (C) convalescent sera (n = 3), and (D) adult sera (n = 5) were used for EV-A71-reactive IgG antibody detection. Non-HFMD children sera (n = 4) were used as negative controls. Data are presented as mean ± SD of 3 replicates. Values above the solid black line (S/CO≥2.1) were scored as weakly positive and values above the dotted line (S/CO≥5) were scored as strongly positive reactions. Grey bars represent weakly positive human anti-EV-A71 epitopes and black bars represent strongly positive human anti-EV-A71 epitopes.
    Figure Legend Snippet: Mapping of EV-A71 B-cell epitopes. Pooled human sera, at optimized dilutions of 1:2000 (IgM) and 1:500 (IgG), were subjected to peptide-based ELISA. (A) Acute infection with high neutralization sera (n = 5) were used for EV-A71-reactive IgM antibody detection. (B) Acute infection with high neutralization sera (n = 5), (C) convalescent sera (n = 3), and (D) adult sera (n = 5) were used for EV-A71-reactive IgG antibody detection. Non-HFMD children sera (n = 4) were used as negative controls. Data are presented as mean ± SD of 3 replicates. Values above the solid black line (S/CO≥2.1) were scored as weakly positive and values above the dotted line (S/CO≥5) were scored as strongly positive reactions. Grey bars represent weakly positive human anti-EV-A71 epitopes and black bars represent strongly positive human anti-EV-A71 epitopes.

    Techniques Used: Peptide ELISA, Infection, Neutralization

    Antigenic profiles of the human anti-EV-A71 antibodies. (A) Control cell lysates were loaded into SDS-PAGE gel electrophoresis. Recombinant EV-A71-EGFP cell lysates (structural and non-structural proteins) were probed with anti-GFP-HRP, while recombinant EV-A71 2A cell lysates were stained with Coomassie brilliant blue R-250. EV-A71 virion proteins were immunodetected with EV-A71-specific mAb 3323 (Millipore, USA) and mAb 979 (Millipore, USA), followed by secondary anti-mouse IgG-HRP. The expected band for each individual recombinant protein is indicated by red solid arrows and the protein sizes are shown. (B) Acute infection with no neutralization sera (n = 2) and (C) acute infection with high neutralization sera (n = 12) were used for EV-A71-specific IgM antibody detection. (D) Acute infection with high neutralization sera (n = 12) and (E) convalescent sera (n = 5) were used for EV-A71-specific IgG antibody detection. An estimated 20 μg of proteins was loaded for SDS-PAGE gel electrophoresis. The amount of EV-A71 structural and non-structural protein cell lysates was normalized with anti-GFP-HRP since the presence of inhibitory factors affected accurate quantitation of total proteins. The EV-A71 protein cell lysates and EV-A71 proteins were subjected to SDS-PAGE gel electrophoresis and probed with pooled human sera at a dilution of 1:300. The immunoblot was developed with Clarity Western ECL substrate and detected by chemiluminescence. Protein bands were determined using the Precision Plus Protein WesternC Standard (Bio-Rad, USA). The antigens recognized by EV-A71-infected patient sera are indicated by red solid arrows.
    Figure Legend Snippet: Antigenic profiles of the human anti-EV-A71 antibodies. (A) Control cell lysates were loaded into SDS-PAGE gel electrophoresis. Recombinant EV-A71-EGFP cell lysates (structural and non-structural proteins) were probed with anti-GFP-HRP, while recombinant EV-A71 2A cell lysates were stained with Coomassie brilliant blue R-250. EV-A71 virion proteins were immunodetected with EV-A71-specific mAb 3323 (Millipore, USA) and mAb 979 (Millipore, USA), followed by secondary anti-mouse IgG-HRP. The expected band for each individual recombinant protein is indicated by red solid arrows and the protein sizes are shown. (B) Acute infection with no neutralization sera (n = 2) and (C) acute infection with high neutralization sera (n = 12) were used for EV-A71-specific IgM antibody detection. (D) Acute infection with high neutralization sera (n = 12) and (E) convalescent sera (n = 5) were used for EV-A71-specific IgG antibody detection. An estimated 20 μg of proteins was loaded for SDS-PAGE gel electrophoresis. The amount of EV-A71 structural and non-structural protein cell lysates was normalized with anti-GFP-HRP since the presence of inhibitory factors affected accurate quantitation of total proteins. The EV-A71 protein cell lysates and EV-A71 proteins were subjected to SDS-PAGE gel electrophoresis and probed with pooled human sera at a dilution of 1:300. The immunoblot was developed with Clarity Western ECL substrate and detected by chemiluminescence. Protein bands were determined using the Precision Plus Protein WesternC Standard (Bio-Rad, USA). The antigens recognized by EV-A71-infected patient sera are indicated by red solid arrows.

    Techniques Used: SDS Page, Nucleic Acid Electrophoresis, Recombinant, Staining, Infection, Neutralization, Quantitation Assay, Western Blot

    Analysis of anti-EV-A71 antibodies recognizing linear B-cell epitopes. (A) IgM antibody determinants identified from acute infection with high neutralization sera. IgG antibody determinants identified from (B) acute infection with high neutralization sera, (C) convalescent sera, and (D) adult sera. Regions of amino acid sequences corresponding to the identified B-cell epitopes are indicated in the schematic diagrams of the EV-A71 genome. The percentage of antibody recognition contributed by each individual EV-A71 epitope is indicated in the pie charts, and was calculated according to the following equation: % antibody recognition = 100 x (OD values from individual peptide group/sum of the OD values from all peptide groups). In this calculation, the avidity and affinity of the peptides to the sera were assumed to be similar. Peptides are colour-coded according to the respective viral proteins.
    Figure Legend Snippet: Analysis of anti-EV-A71 antibodies recognizing linear B-cell epitopes. (A) IgM antibody determinants identified from acute infection with high neutralization sera. IgG antibody determinants identified from (B) acute infection with high neutralization sera, (C) convalescent sera, and (D) adult sera. Regions of amino acid sequences corresponding to the identified B-cell epitopes are indicated in the schematic diagrams of the EV-A71 genome. The percentage of antibody recognition contributed by each individual EV-A71 epitope is indicated in the pie charts, and was calculated according to the following equation: % antibody recognition = 100 x (OD values from individual peptide group/sum of the OD values from all peptide groups). In this calculation, the avidity and affinity of the peptides to the sera were assumed to be similar. Peptides are colour-coded according to the respective viral proteins.

    Techniques Used: Infection, Neutralization

    8) Product Images from "Phosphoregulated orthogonal signal transduction in mammalian cells"

    Article Title: Phosphoregulated orthogonal signal transduction in mammalian cells

    Journal: Nature Communications

    doi: 10.1038/s41467-020-16895-1

    EnvZ/OmpR and NarX/NarL POST. a Schematic of the engineered ORK/OGR proteins based on EnvZ/OmpR. In the ORK, short linkers consisting only of the two amino acids AS were used to reduce interdomain flexibility between the acV H H and the kinase domain and between the CA and DHp domains by replacing the native GQEMP linker. We hypothesize that this change results in inactive dimers. b Induction of EnvZ/OmpR POST with caffeine. The EnvZ mutant without acV H H (EnvZ 232–450;GQEMP:AS ) was included as a negative control. c Schematic of the engineered ORK/OGR proteins based on NarX/NarL. d Induction of NarX/NarL POST with caffeine. The NarX truncations without acV H H were included as negative controls. The bar charts show the mean ± s.d. of n = 3 biologically independent samples overlaid with a scatter dot plot of the original data points, measured at 24 h after induction, and the results are representative of three independent experiments. Source data are provided as a Source Data file.
    Figure Legend Snippet: EnvZ/OmpR and NarX/NarL POST. a Schematic of the engineered ORK/OGR proteins based on EnvZ/OmpR. In the ORK, short linkers consisting only of the two amino acids AS were used to reduce interdomain flexibility between the acV H H and the kinase domain and between the CA and DHp domains by replacing the native GQEMP linker. We hypothesize that this change results in inactive dimers. b Induction of EnvZ/OmpR POST with caffeine. The EnvZ mutant without acV H H (EnvZ 232–450;GQEMP:AS ) was included as a negative control. c Schematic of the engineered ORK/OGR proteins based on NarX/NarL. d Induction of NarX/NarL POST with caffeine. The NarX truncations without acV H H were included as negative controls. The bar charts show the mean ± s.d. of n = 3 biologically independent samples overlaid with a scatter dot plot of the original data points, measured at 24 h after induction, and the results are representative of three independent experiments. Source data are provided as a Source Data file.

    Techniques Used: Mutagenesis, Negative Control

    9) Product Images from "Bacteriophage DNA glucosylation impairs target DNA binding by type I and II but not by type V CRISPR–Cas effector complexes"

    Article Title: Bacteriophage DNA glucosylation impairs target DNA binding by type I and II but not by type V CRISPR–Cas effector complexes

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx1264

    Effect of T4 DNA modifications on type II-A CRISPR–Cas sgRNA mediated DNA targeting. ( A ) Schematic of DNA targeting by Cas9. Modified cytosine residues are indicated in red. Cleavage sites are indicated by black arrows. ( B ) Cleavage assay of Cas9 on 98 bp modified targets (indicated by black arrow). Cas9 is loaded with either targeting sgRNA (T sgRNA) or non-targeting sgRNA (NT sgRNA). Restriction products of Cas9 are 61 and 37 bp. ( C ) EMSA of dCas9 on target DNA containing C, 5-hmC or 5-ghmC (indicated by black arrow) at increasing protein concentrations [nM]. Fraction of bound target is indicated by white arrows.
    Figure Legend Snippet: Effect of T4 DNA modifications on type II-A CRISPR–Cas sgRNA mediated DNA targeting. ( A ) Schematic of DNA targeting by Cas9. Modified cytosine residues are indicated in red. Cleavage sites are indicated by black arrows. ( B ) Cleavage assay of Cas9 on 98 bp modified targets (indicated by black arrow). Cas9 is loaded with either targeting sgRNA (T sgRNA) or non-targeting sgRNA (NT sgRNA). Restriction products of Cas9 are 61 and 37 bp. ( C ) EMSA of dCas9 on target DNA containing C, 5-hmC or 5-ghmC (indicated by black arrow) at increasing protein concentrations [nM]. Fraction of bound target is indicated by white arrows.

    Techniques Used: CRISPR, Modification, Cleavage Assay

    Effect of T4 DNA modifications of PAM-complementary cytosines on type II-A CRISPR–Cas sgRNA mediated DNA targeting. Cleavage assay of Cas9 on target DNA containing 5-hmC (indicated in red). Cas9 is loaded with either targeting sgRNA (T sgRNA) or non-targeting sgRNA (NT sgRNA). Restriction products of Cas9 are 57 and 33 bp. The marker is indicated by white arrows.
    Figure Legend Snippet: Effect of T4 DNA modifications of PAM-complementary cytosines on type II-A CRISPR–Cas sgRNA mediated DNA targeting. Cleavage assay of Cas9 on target DNA containing 5-hmC (indicated in red). Cas9 is loaded with either targeting sgRNA (T sgRNA) or non-targeting sgRNA (NT sgRNA). Restriction products of Cas9 are 57 and 33 bp. The marker is indicated by white arrows.

    Techniques Used: CRISPR, Cleavage Assay, Marker

    Effect of T4 DNA modifications on type I-E CRISPR–Cas sgRNA mediated DNA targeting. ( A ) Schematic of DNA targeting and R-loop formation by Cascade. Modified cytosine residues are indicated in red. ( B ) Cleavage assay of Cas3 in conjunction with Cascade on 98 bp modified targets, indicated by black arrow. The marker is indicated by white arrows. Cascade effector complexes are loaded with either targeting crRNA (T crRNA) or non-targeting crRNA (NT crRNA). Restriction products of Cas3 are of undefined length. ( C ). Electrophoretic Mobility Shift Assay (EMSA) of Cascade on target DNA containing C, 5-hmC or 5-ghmC (indicated by black arrow) at increasing protein concentrations [nM]. Fraction of bound target is indicated by white arrows, dotted lines represent separate gels.
    Figure Legend Snippet: Effect of T4 DNA modifications on type I-E CRISPR–Cas sgRNA mediated DNA targeting. ( A ) Schematic of DNA targeting and R-loop formation by Cascade. Modified cytosine residues are indicated in red. ( B ) Cleavage assay of Cas3 in conjunction with Cascade on 98 bp modified targets, indicated by black arrow. The marker is indicated by white arrows. Cascade effector complexes are loaded with either targeting crRNA (T crRNA) or non-targeting crRNA (NT crRNA). Restriction products of Cas3 are of undefined length. ( C ). Electrophoretic Mobility Shift Assay (EMSA) of Cascade on target DNA containing C, 5-hmC or 5-ghmC (indicated by black arrow) at increasing protein concentrations [nM]. Fraction of bound target is indicated by white arrows, dotted lines represent separate gels.

    Techniques Used: CRISPR, Modification, Cleavage Assay, Marker, Electrophoretic Mobility Shift Assay

    Efficiency of plaquing (EOP) assays of T4 phages on E. coli cells expressing CRISPR–Cas systems targeting T4 genes 19 or 22. ( A ) Representation of the circular genome of bacteriophage T4. Positions of protospacer sequences and PAMs are shown (indicated by orange bars and purple bars respectively). Glucosyl-5-hydroxymethylcytosines are indicated in red and nucleotides that base pair with crRNA are indicated by black dots. ( B ) EOP of T4 phages on E. coli cells expressing targeting Cascade complexes normalized to EOP on non-targeting strains. ( C ) EOP of T4 phages on E. coli cells expressing targeting Cas9 proteins normalized to EOP on non-targeting strains.
    Figure Legend Snippet: Efficiency of plaquing (EOP) assays of T4 phages on E. coli cells expressing CRISPR–Cas systems targeting T4 genes 19 or 22. ( A ) Representation of the circular genome of bacteriophage T4. Positions of protospacer sequences and PAMs are shown (indicated by orange bars and purple bars respectively). Glucosyl-5-hydroxymethylcytosines are indicated in red and nucleotides that base pair with crRNA are indicated by black dots. ( B ) EOP of T4 phages on E. coli cells expressing targeting Cascade complexes normalized to EOP on non-targeting strains. ( C ) EOP of T4 phages on E. coli cells expressing targeting Cas9 proteins normalized to EOP on non-targeting strains.

    Techniques Used: Expressing, CRISPR

    Effect of T4 DNA modifications on type V-A CRISPR–Cas sgRNA mediated DNA targeting. ( A ) Schematic of DNA targeting by Cas12a. Modified cytosine residues are indicated in red. Cleavage sites are indicated by black arrows. ( B ) Cleavage assay of Cas12a on 98 bp modified targets (indicated by black arrow). Cas12a is loaded with either targeting crRNA (C crRNA) or non-targeting crRNA (NC crRNA). Cleavage products of Cas12a are 49 and 44 bp. The marker is indicated by white arrows. ( C ) Electrophoretic Mobility Shift Assay (EMSA) of Cas12a on target DNA containing C, 5-hmC or 5-ghmC (indicated by black arrow) at increasing protein concentrations [nM]. Fraction of bound target is indicated by white arrows.
    Figure Legend Snippet: Effect of T4 DNA modifications on type V-A CRISPR–Cas sgRNA mediated DNA targeting. ( A ) Schematic of DNA targeting by Cas12a. Modified cytosine residues are indicated in red. Cleavage sites are indicated by black arrows. ( B ) Cleavage assay of Cas12a on 98 bp modified targets (indicated by black arrow). Cas12a is loaded with either targeting crRNA (C crRNA) or non-targeting crRNA (NC crRNA). Cleavage products of Cas12a are 49 and 44 bp. The marker is indicated by white arrows. ( C ) Electrophoretic Mobility Shift Assay (EMSA) of Cas12a on target DNA containing C, 5-hmC or 5-ghmC (indicated by black arrow) at increasing protein concentrations [nM]. Fraction of bound target is indicated by white arrows.

    Techniques Used: CRISPR, Modification, Cleavage Assay, Marker, Electrophoretic Mobility Shift Assay

    10) Product Images from "Oxidation of SQSTM1/p62 mediates the link between redox state and protein homeostasis"

    Article Title: Oxidation of SQSTM1/p62 mediates the link between redox state and protein homeostasis

    Journal: Nature Communications

    doi: 10.1038/s41467-017-02746-z

    Two conserved cysteine residues located in a disordered region of p62 are required for formation of DLC and ubiquitylated aggregates. a Alignment showing cysteines 105 and 113 (highlighted) are conserved in vertebrates. Increasing conservation across species is shown by light-to-dark red. b p62 −/− MEFs stably expressing either wild type or C105A,C113A FLAG-p62 were treated with H 2 O 2 (3 mM, 1 min) or PR-619 (5 μM, 10 min) and immunoblotted in non-reducing conditions. c Formation of ubiquitylated, p62-positive aggregates in stable cells described in b following oxidative stress (1 mM H 2 O 2 or 5 μM PR-619 for 30 min). Cells were immunostained for ubiquitin and p62, analysed by confocal microscopy ( c ) and quantified ( d ). Error bars represent s.e.m., n = 3 , ** P
    Figure Legend Snippet: Two conserved cysteine residues located in a disordered region of p62 are required for formation of DLC and ubiquitylated aggregates. a Alignment showing cysteines 105 and 113 (highlighted) are conserved in vertebrates. Increasing conservation across species is shown by light-to-dark red. b p62 −/− MEFs stably expressing either wild type or C105A,C113A FLAG-p62 were treated with H 2 O 2 (3 mM, 1 min) or PR-619 (5 μM, 10 min) and immunoblotted in non-reducing conditions. c Formation of ubiquitylated, p62-positive aggregates in stable cells described in b following oxidative stress (1 mM H 2 O 2 or 5 μM PR-619 for 30 min). Cells were immunostained for ubiquitin and p62, analysed by confocal microscopy ( c ) and quantified ( d ). Error bars represent s.e.m., n = 3 , ** P

    Techniques Used: Stable Transfection, Expressing, Confocal Microscopy

    Oxidation-sensitive p62 is important for the oxidative stress resistance of flies and is perturbed in human age-related disease. a Whole-fly lysates were analysed in reducing (2.5% β-ME) and non-reducing conditions for p62 homologue, Ref(2)P. Asterisk indicates a non-specific band. b Diagram representing the introduction of an 18 amino acid fragment of human p62 containing C105 and C113 to produce a ‘humanised’ Ref(2)P (Ref(2)P ox ) in flies using CRISPR/Cas9. c Wild-type (WT) and Ref(2)P ox flies were treated with paraquat (PQ, 20 mM) for 12 h and whole-fly lysates were analysed by immunoblot for ubiquitin, Ref(2)P and tubulin and quantified. Error bars represent s.e.m., n = 3 (at least 10 flies per group per replicate); * P
    Figure Legend Snippet: Oxidation-sensitive p62 is important for the oxidative stress resistance of flies and is perturbed in human age-related disease. a Whole-fly lysates were analysed in reducing (2.5% β-ME) and non-reducing conditions for p62 homologue, Ref(2)P. Asterisk indicates a non-specific band. b Diagram representing the introduction of an 18 amino acid fragment of human p62 containing C105 and C113 to produce a ‘humanised’ Ref(2)P (Ref(2)P ox ) in flies using CRISPR/Cas9. c Wild-type (WT) and Ref(2)P ox flies were treated with paraquat (PQ, 20 mM) for 12 h and whole-fly lysates were analysed by immunoblot for ubiquitin, Ref(2)P and tubulin and quantified. Error bars represent s.e.m., n = 3 (at least 10 flies per group per replicate); * P

    Techniques Used: CRISPR

    Oxidation-sensitive p62 is required for pro-survival autophagy. a p62 −/− MEFs stably expressing FLAG-tagged wild type or C105A,C113A p62 were treated with cycloheximide (CHX, 50 μg/ml) and H 2 O 2 (1 mM), either in the absence ( a ) or presence ( b ) of bafilomycin A1 (Baf, 50 nM), lysed at the indicated time post treatment, immunoblotted for p62 and quantified. c Cells described in a plus one stably expressing K7A,D69A PB1-domain mutant of p62 were treated with H 2 O 2 (1 mM, 5 h), lysed and immunoblotted for ubiquitin, LC3, p62 and actin ( c ) and quantified ( d ). e , f Stable p62 cell lines in control conditions were fixed and stained for p62 and LC3 ( e ) and the % cells with > 20 autophagosomes was quantified ( f ). g , h Electron microscopy of stable p62 cell lines. White arrows: autophagosomes; black arrows: autolysosomes; blue arrow: endosome. Scale bar: 500 nm ( g ). Autophagosomes were quantified and graphs represent average number and % cells with three or more autophagosomes per field of view ( h ). i , j Stable p62 cell lines were treated as in c and % cell death was analysed by Ready Probes fluorescent dyes ( i ). j Stable p62 cell lines were treated as indicated and % cell death was analysed as in i . Error bars represent s.e.m., n = 3 , * P
    Figure Legend Snippet: Oxidation-sensitive p62 is required for pro-survival autophagy. a p62 −/− MEFs stably expressing FLAG-tagged wild type or C105A,C113A p62 were treated with cycloheximide (CHX, 50 μg/ml) and H 2 O 2 (1 mM), either in the absence ( a ) or presence ( b ) of bafilomycin A1 (Baf, 50 nM), lysed at the indicated time post treatment, immunoblotted for p62 and quantified. c Cells described in a plus one stably expressing K7A,D69A PB1-domain mutant of p62 were treated with H 2 O 2 (1 mM, 5 h), lysed and immunoblotted for ubiquitin, LC3, p62 and actin ( c ) and quantified ( d ). e , f Stable p62 cell lines in control conditions were fixed and stained for p62 and LC3 ( e ) and the % cells with > 20 autophagosomes was quantified ( f ). g , h Electron microscopy of stable p62 cell lines. White arrows: autophagosomes; black arrows: autolysosomes; blue arrow: endosome. Scale bar: 500 nm ( g ). Autophagosomes were quantified and graphs represent average number and % cells with three or more autophagosomes per field of view ( h ). i , j Stable p62 cell lines were treated as in c and % cell death was analysed by Ready Probes fluorescent dyes ( i ). j Stable p62 cell lines were treated as indicated and % cell death was analysed as in i . Error bars represent s.e.m., n = 3 , * P

    Techniques Used: Stable Transfection, Expressing, Mutagenesis, Staining, Electron Microscopy

    p62 forms oligomers and aggregates in response to oxidation. a Mouse brain tissue, young (3 months) and old (24 months) analysed by immunoblotting for p62, PRDX-SO 3 and actin as a loading control in reducing (2.5% β-ME) and non-reducing conditions. DLC disulphide-linked conjugates. Arrows indicate the positions of monomeric and oligomeric p62. b Representative images and quantification of p62 aggregates in old mouse Purkinje cells in the cerebellum. Green arrows and red arrowheads indicate Purkinje cells positive and negative for p62 aggregates, respectively. c Effect of autophagy inhibition (bafilomycin A1 (Baf, 400 nM, 4 h) and chloroquine (CQ, 50 μM, 4 h)) and oxidative stress (H 2 O 2 (3 mM, 10 min) and PR-619 (5 μM, 30 min)) on p62 DLC ( c ) and p62 aggregation ( d ) in HeLa cells. d Anti-p62 staining analysed by confocal microscopy. Error bars represent s.e.m., n = 3 , * P
    Figure Legend Snippet: p62 forms oligomers and aggregates in response to oxidation. a Mouse brain tissue, young (3 months) and old (24 months) analysed by immunoblotting for p62, PRDX-SO 3 and actin as a loading control in reducing (2.5% β-ME) and non-reducing conditions. DLC disulphide-linked conjugates. Arrows indicate the positions of monomeric and oligomeric p62. b Representative images and quantification of p62 aggregates in old mouse Purkinje cells in the cerebellum. Green arrows and red arrowheads indicate Purkinje cells positive and negative for p62 aggregates, respectively. c Effect of autophagy inhibition (bafilomycin A1 (Baf, 400 nM, 4 h) and chloroquine (CQ, 50 μM, 4 h)) and oxidative stress (H 2 O 2 (3 mM, 10 min) and PR-619 (5 μM, 30 min)) on p62 DLC ( c ) and p62 aggregation ( d ) in HeLa cells. d Anti-p62 staining analysed by confocal microscopy. Error bars represent s.e.m., n = 3 , * P

    Techniques Used: Inhibition, Staining, Confocal Microscopy

    11) Product Images from "Biosensor libraries harness large classes of binding domains for construction of allosteric transcriptional regulators"

    Article Title: Biosensor libraries harness large classes of binding domains for construction of allosteric transcriptional regulators

    Journal: Nature Communications

    doi: 10.1038/s41467-018-05525-6

    Schematic representation of enrichment process. Chemically competent E. coli (Ch-END)/(Ch-OD) cells (gray rectangles) carrying vectors pCKTRBS/pCKTRBS-OD expressing chimeric TFs were transformed with reporter plasmids pHC_DYO DBD -R as described in Methods. The resulting cells were grown in LB media in the presence of aTc. Under this culture conditions the chimeric TFs were expressed. Every TF contains one out of 15 DBD. In the cells where the DBD of the chimera (represented as yellow and purple rectangles) was able to recognize the operator boxes of the reporter promoter (bent arrows in yellow and purple) introduced in pHC_DYO DBD -R, and it retained its DNA-binding capabilities, the expression of GFP is repressed. On the other hand, GFP was highly transcribed in the cells where the TF was not able to interact with the reporter promoter. The cells showing the lowest levels of GFP expression were recovered using the FACS enrichment described in Methods in the so called Negative Sorting. The recovered cells were grown in the presence of the inducer molecule (benzoate). TFs carrying a functional LBD were able to recognize the inducer and transduce that information to the DBD triggering a conformational change strong enough to detach the DBD from the DNA. Under these conditions bacteria carrying functional TFs would resume the transcription of GFP from the reporter promoter. A FACS sorting allowed to obtain a population enriched in the functional chimeras (Positive Sorting). This enrichment process was iterated
    Figure Legend Snippet: Schematic representation of enrichment process. Chemically competent E. coli (Ch-END)/(Ch-OD) cells (gray rectangles) carrying vectors pCKTRBS/pCKTRBS-OD expressing chimeric TFs were transformed with reporter plasmids pHC_DYO DBD -R as described in Methods. The resulting cells were grown in LB media in the presence of aTc. Under this culture conditions the chimeric TFs were expressed. Every TF contains one out of 15 DBD. In the cells where the DBD of the chimera (represented as yellow and purple rectangles) was able to recognize the operator boxes of the reporter promoter (bent arrows in yellow and purple) introduced in pHC_DYO DBD -R, and it retained its DNA-binding capabilities, the expression of GFP is repressed. On the other hand, GFP was highly transcribed in the cells where the TF was not able to interact with the reporter promoter. The cells showing the lowest levels of GFP expression were recovered using the FACS enrichment described in Methods in the so called Negative Sorting. The recovered cells were grown in the presence of the inducer molecule (benzoate). TFs carrying a functional LBD were able to recognize the inducer and transduce that information to the DBD triggering a conformational change strong enough to detach the DBD from the DNA. Under these conditions bacteria carrying functional TFs would resume the transcription of GFP from the reporter promoter. A FACS sorting allowed to obtain a population enriched in the functional chimeras (Positive Sorting). This enrichment process was iterated

    Techniques Used: Expressing, Transformation Assay, Binding Assay, FACS, Functional Assay

    12) Product Images from "Biosensor libraries harness large classes of binding domains for construction of allosteric transcriptional regulators"

    Article Title: Biosensor libraries harness large classes of binding domains for construction of allosteric transcriptional regulators

    Journal: Nature Communications

    doi: 10.1038/s41467-018-05525-6

    Schematic representation of enrichment process. Chemically competent E. coli (Ch-END)/(Ch-OD) cells (gray rectangles) carrying vectors pCKTRBS/pCKTRBS-OD expressing chimeric TFs were transformed with reporter plasmids pHC_DYO DBD -R as described in Methods. The resulting cells were grown in LB media in the presence of aTc. Under this culture conditions the chimeric TFs were expressed. Every TF contains one out of 15 DBD. In the cells where the DBD of the chimera (represented as yellow and purple rectangles) was able to recognize the operator boxes of the reporter promoter (bent arrows in yellow and purple) introduced in pHC_DYO DBD -R, and it retained its DNA-binding capabilities, the expression of GFP is repressed. On the other hand, GFP was highly transcribed in the cells where the TF was not able to interact with the reporter promoter. The cells showing the lowest levels of GFP expression were recovered using the FACS enrichment described in Methods in the so called Negative Sorting. The recovered cells were grown in the presence of the inducer molecule (benzoate). TFs carrying a functional LBD were able to recognize the inducer and transduce that information to the DBD triggering a conformational change strong enough to detach the DBD from the DNA. Under these conditions bacteria carrying functional TFs would resume the transcription of GFP from the reporter promoter. A FACS sorting allowed to obtain a population enriched in the functional chimeras (Positive Sorting). This enrichment process was iterated
    Figure Legend Snippet: Schematic representation of enrichment process. Chemically competent E. coli (Ch-END)/(Ch-OD) cells (gray rectangles) carrying vectors pCKTRBS/pCKTRBS-OD expressing chimeric TFs were transformed with reporter plasmids pHC_DYO DBD -R as described in Methods. The resulting cells were grown in LB media in the presence of aTc. Under this culture conditions the chimeric TFs were expressed. Every TF contains one out of 15 DBD. In the cells where the DBD of the chimera (represented as yellow and purple rectangles) was able to recognize the operator boxes of the reporter promoter (bent arrows in yellow and purple) introduced in pHC_DYO DBD -R, and it retained its DNA-binding capabilities, the expression of GFP is repressed. On the other hand, GFP was highly transcribed in the cells where the TF was not able to interact with the reporter promoter. The cells showing the lowest levels of GFP expression were recovered using the FACS enrichment described in Methods in the so called Negative Sorting. The recovered cells were grown in the presence of the inducer molecule (benzoate). TFs carrying a functional LBD were able to recognize the inducer and transduce that information to the DBD triggering a conformational change strong enough to detach the DBD from the DNA. Under these conditions bacteria carrying functional TFs would resume the transcription of GFP from the reporter promoter. A FACS sorting allowed to obtain a population enriched in the functional chimeras (Positive Sorting). This enrichment process was iterated

    Techniques Used: Expressing, Transformation Assay, Binding Assay, FACS, Functional Assay

    13) Product Images from "DNA double-strand breaks induced by decay of 123I-labeled Hoechst 33342: Role of DNA topology"

    Article Title: DNA double-strand breaks induced by decay of 123I-labeled Hoechst 33342: Role of DNA topology

    Journal: International journal of radiation biology

    doi: 10.1080/09553000802512568

    Comparison of pUC19 L DNA exposed to the same number (~2 × 10 11 ) of 125 IEH and 123 IEH decays per μ g DNA: (−) and (+) indicate absence and presence of radioiodinated ligand, respectively.
    Figure Legend Snippet: Comparison of pUC19 L DNA exposed to the same number (~2 × 10 11 ) of 125 IEH and 123 IEH decays per μ g DNA: (−) and (+) indicate absence and presence of radioiodinated ligand, respectively.

    Techniques Used:

    Quantitative analysis of DNA strand breaks in supercoiled 3 H-pUC19 DNA
    Figure Legend Snippet: Quantitative analysis of DNA strand breaks in supercoiled 3 H-pUC19 DNA

    Techniques Used:

    Quantitative analysis of data from agarose gel electrophoresis assessing disappearance of SC 3 H-pUC19 plasmid DNA (A) and appearance of L DNA (B), indicator of DSB formation, as function of accumulated 123 I decays.
    Figure Legend Snippet: Quantitative analysis of data from agarose gel electrophoresis assessing disappearance of SC 3 H-pUC19 plasmid DNA (A) and appearance of L DNA (B), indicator of DSB formation, as function of accumulated 123 I decays.

    Techniques Used: Agarose Gel Electrophoresis, Plasmid Preparation

    Agarose gel analysis of L form of 3 H-pUC19 plasmid DNA incubated with 123 IEH at 4°C in PBS (pH 7.4): lane 1, control (no 123 IEH); lane 2, 4.6 × 10 12 decays/ml; lane 3, 8.1 × 10 12 decays/ml; lane 4, 11.5 × 10 12 decays/ml;
    Figure Legend Snippet: Agarose gel analysis of L form of 3 H-pUC19 plasmid DNA incubated with 123 IEH at 4°C in PBS (pH 7.4): lane 1, control (no 123 IEH); lane 2, 4.6 × 10 12 decays/ml; lane 3, 8.1 × 10 12 decays/ml; lane 4, 11.5 × 10 12 decays/ml;

    Techniques Used: Agarose Gel Electrophoresis, Plasmid Preparation, Incubation

    Quantitative analysis of data obtained from agarose gel electrophoresis indicating disappearance of L 3 H-pUC19 plasmid DNA after exposure to 123 IEH (●). Error bars are the standard deviation of the mean for three independent experiments. Dotted
    Figure Legend Snippet: Quantitative analysis of data obtained from agarose gel electrophoresis indicating disappearance of L 3 H-pUC19 plasmid DNA after exposure to 123 IEH (●). Error bars are the standard deviation of the mean for three independent experiments. Dotted

    Techniques Used: Agarose Gel Electrophoresis, Plasmid Preparation, Standard Deviation

    Agarose gel analysis of SC 3 H-pUC19 plasmid DNA incubated with 123 IEH at 4°C in PBS (pH 7.4): lane 1, control (no 123 IEH); lane 2 9.7 × 10 12 decays/ml; lane 3, 13.7 × 10 12 decays/ml; lane 4, 23.5 × 10 12 decays/ml; lane
    Figure Legend Snippet: Agarose gel analysis of SC 3 H-pUC19 plasmid DNA incubated with 123 IEH at 4°C in PBS (pH 7.4): lane 1, control (no 123 IEH); lane 2 9.7 × 10 12 decays/ml; lane 3, 13.7 × 10 12 decays/ml; lane 4, 23.5 × 10 12 decays/ml; lane

    Techniques Used: Agarose Gel Electrophoresis, Plasmid Preparation, Incubation

    14) Product Images from "Divergent roles of β‐ and γ‐actin isoforms during spread of vaccinia virus, et al. Divergent roles of β‐ and γ‐actin isoforms during spread of vaccinia virus"

    Article Title: Divergent roles of β‐ and γ‐actin isoforms during spread of vaccinia virus, et al. Divergent roles of β‐ and γ‐actin isoforms during spread of vaccinia virus

    Journal: Cytoskeleton (Hoboken, N.j.)

    doi: 10.1002/cm.21356

    GST pull‐down assays to determine binding preferences for β‐or γ‐CYA. Immunoblots of cell lysate bound to GST‐VCA or GST‐VCA RA/RA on glutathione‐containing Sepharose beads. Immunoblots were probed with either anti‐actin and anti‐GST antibodies (a) or antibodies specific to β‐CYA or γ‐CYA (b).
    Figure Legend Snippet: GST pull‐down assays to determine binding preferences for β‐or γ‐CYA. Immunoblots of cell lysate bound to GST‐VCA or GST‐VCA RA/RA on glutathione‐containing Sepharose beads. Immunoblots were probed with either anti‐actin and anti‐GST antibodies (a) or antibodies specific to β‐CYA or γ‐CYA (b).

    Techniques Used: Binding Assay, Western Blot

    15) Product Images from "Phosphoregulated orthogonal signal transduction in mammalian cells"

    Article Title: Phosphoregulated orthogonal signal transduction in mammalian cells

    Journal: Nature Communications

    doi: 10.1038/s41467-020-16895-1

    EnvZ/OmpR and NarX/NarL POST. a Schematic of the engineered ORK/OGR proteins based on EnvZ/OmpR. In the ORK, short linkers consisting only of the two amino acids AS were used to reduce interdomain flexibility between the acV H H and the kinase domain and between the CA and DHp domains by replacing the native GQEMP linker. We hypothesize that this change results in inactive dimers. b Induction of EnvZ/OmpR POST with caffeine. The EnvZ mutant without acV H H (EnvZ 232–450;GQEMP:AS ) was included as a negative control. c Schematic of the engineered ORK/OGR proteins based on NarX/NarL. d Induction of NarX/NarL POST with caffeine. The NarX truncations without acV H H were included as negative controls. The bar charts show the mean ± s.d. of n = 3 biologically independent samples overlaid with a scatter dot plot of the original data points, measured at 24 h after induction, and the results are representative of three independent experiments. Source data are provided as a Source Data file.
    Figure Legend Snippet: EnvZ/OmpR and NarX/NarL POST. a Schematic of the engineered ORK/OGR proteins based on EnvZ/OmpR. In the ORK, short linkers consisting only of the two amino acids AS were used to reduce interdomain flexibility between the acV H H and the kinase domain and between the CA and DHp domains by replacing the native GQEMP linker. We hypothesize that this change results in inactive dimers. b Induction of EnvZ/OmpR POST with caffeine. The EnvZ mutant without acV H H (EnvZ 232–450;GQEMP:AS ) was included as a negative control. c Schematic of the engineered ORK/OGR proteins based on NarX/NarL. d Induction of NarX/NarL POST with caffeine. The NarX truncations without acV H H were included as negative controls. The bar charts show the mean ± s.d. of n = 3 biologically independent samples overlaid with a scatter dot plot of the original data points, measured at 24 h after induction, and the results are representative of three independent experiments. Source data are provided as a Source Data file.

    Techniques Used: Mutagenesis, Negative Control

    16) Product Images from "Crystal structure of human nucleosome core particle containing enzymatically introduced CpG methylation"

    Article Title: Crystal structure of human nucleosome core particle containing enzymatically introduced CpG methylation

    Journal: FEBS Open Bio

    doi: 10.1002/2211-5463.12064

    CpG methylation of nucleosomal DNA. (A) Scheme for the preparation of CpG‐methylated nucleosomal DNA. The 146‐bp human α‐satellite nucleosomal DNA 18 was mutated to contain four CpG dinucleotide‐containing CACGTG sequences, which are recognized by the methylation‐sensitive restriction enzyme Eco72 I. The DNA designated as CpG146 is biochemically methylated by M.Sss I, and then digested by Eco72 I, which is a CpG methylation‐sensitive restriction endonuclease for the CACGTG sequence. The full‐length 146‐bp nucleosomal DNA is methylated by M.Sss I, and a portion of the methylated DNA is examined by a digestion with Eco 72I before the NCP reconstitution. (B) Sequences of nucleosomal DNAs used for crystal structure analyses. NCP146, 146‐bp α‐satellite nucleosomal DNA 18 ; and CpG146, CpG dinucleotide sequence‐introduced 146‐bp nucleosomal DNA (this study). Four CpG dinucleotide‐containing Eco72 I recognition sequences, created by the site‐directed mutagenesis of NCP146, are shown in green. The positions of the CpG dinucleotides are underlined. Sat2R: the 145‐bp satellite 2 derivative right nucleosomal DNA 17 . Sat2L: the 146‐bp satellite 2 derivative left nucleosomal DNA 17 . The relative positions of DNA bases from the dyad axis (0) are indicated from −70 to +70 at the top. Minor groove‐inward facing regions, as reported by Chua et al . 31 , are boxed within blue squares. The major grooves of the boxed DNA sequences are outward‐facing, and CpG‐methyl reader and/or eraser proteins can access 5mC. (C) Eco72 I digestion patterns of double‐stranded CpG‐containing oligonucleotides. Oligonucleotides (a) and (b), or (c) and (d), which are both derived from the CpG146 sequence, were annealed to each other in the presence or absence of 5mC, at the indicated positions in bold letters. Lane 1, nondigested dsDNA; lanes 2–5, dsDNA digested with 1.8 units·pmol −1 Eco72 I for 16 h. Lane 2, nonmethylated dsDNA; lanes 3 and 4, hemimethylated dsDNAs; and lane 5, fully methylated dsDNA. The superscript m at the top indicates a 5mC‐containing oligonucleotide. The DNA bands at 21‐bp and 10‐bp in the left panel and the DNA band at 18‐bp in the right panel indicate Eco72 I‐digested DNA fragments.
    Figure Legend Snippet: CpG methylation of nucleosomal DNA. (A) Scheme for the preparation of CpG‐methylated nucleosomal DNA. The 146‐bp human α‐satellite nucleosomal DNA 18 was mutated to contain four CpG dinucleotide‐containing CACGTG sequences, which are recognized by the methylation‐sensitive restriction enzyme Eco72 I. The DNA designated as CpG146 is biochemically methylated by M.Sss I, and then digested by Eco72 I, which is a CpG methylation‐sensitive restriction endonuclease for the CACGTG sequence. The full‐length 146‐bp nucleosomal DNA is methylated by M.Sss I, and a portion of the methylated DNA is examined by a digestion with Eco 72I before the NCP reconstitution. (B) Sequences of nucleosomal DNAs used for crystal structure analyses. NCP146, 146‐bp α‐satellite nucleosomal DNA 18 ; and CpG146, CpG dinucleotide sequence‐introduced 146‐bp nucleosomal DNA (this study). Four CpG dinucleotide‐containing Eco72 I recognition sequences, created by the site‐directed mutagenesis of NCP146, are shown in green. The positions of the CpG dinucleotides are underlined. Sat2R: the 145‐bp satellite 2 derivative right nucleosomal DNA 17 . Sat2L: the 146‐bp satellite 2 derivative left nucleosomal DNA 17 . The relative positions of DNA bases from the dyad axis (0) are indicated from −70 to +70 at the top. Minor groove‐inward facing regions, as reported by Chua et al . 31 , are boxed within blue squares. The major grooves of the boxed DNA sequences are outward‐facing, and CpG‐methyl reader and/or eraser proteins can access 5mC. (C) Eco72 I digestion patterns of double‐stranded CpG‐containing oligonucleotides. Oligonucleotides (a) and (b), or (c) and (d), which are both derived from the CpG146 sequence, were annealed to each other in the presence or absence of 5mC, at the indicated positions in bold letters. Lane 1, nondigested dsDNA; lanes 2–5, dsDNA digested with 1.8 units·pmol −1 Eco72 I for 16 h. Lane 2, nonmethylated dsDNA; lanes 3 and 4, hemimethylated dsDNAs; and lane 5, fully methylated dsDNA. The superscript m at the top indicates a 5mC‐containing oligonucleotide. The DNA bands at 21‐bp and 10‐bp in the left panel and the DNA band at 18‐bp in the right panel indicate Eco72 I‐digested DNA fragments.

    Techniques Used: CpG Methylation Assay, Methylation, Sequencing, Mutagenesis, Derivative Assay

    Binding analysis between MBD2 and nucleosomal DNAs. (A) Scheme of the binding analysis. (B–D) Results of the MBD2‐binding analysis. The nucleosomal DNAs used in the assay are as follows: (B) M.Sss I‐treated146‐bp α‐satellite DNA (NCP146); (C) M.Sss I‐untreated 146‐bp α‐satellite‐based DNA containing four CpG sites (CpG146); and (D) M.Sss I‐treated CpG146 DNA. Lane 1, Input nucleosomal DNA (125 ng); lane 2, flow‐through fraction after the incubation of nucleosomal DNA with immobilized MBD2; lane 3, wash fraction of the first washing step; lane 4, wash fraction of the fourth washing step; lane 5, eluted fraction. In each panel, the position of the 100‐bp DNA is indicated on the right, and the position of the nucleosomal DNA is indicated by a red arrow.
    Figure Legend Snippet: Binding analysis between MBD2 and nucleosomal DNAs. (A) Scheme of the binding analysis. (B–D) Results of the MBD2‐binding analysis. The nucleosomal DNAs used in the assay are as follows: (B) M.Sss I‐treated146‐bp α‐satellite DNA (NCP146); (C) M.Sss I‐untreated 146‐bp α‐satellite‐based DNA containing four CpG sites (CpG146); and (D) M.Sss I‐treated CpG146 DNA. Lane 1, Input nucleosomal DNA (125 ng); lane 2, flow‐through fraction after the incubation of nucleosomal DNA with immobilized MBD2; lane 3, wash fraction of the first washing step; lane 4, wash fraction of the fourth washing step; lane 5, eluted fraction. In each panel, the position of the 100‐bp DNA is indicated on the right, and the position of the nucleosomal DNA is indicated by a red arrow.

    Techniques Used: Binding Assay, Flow Cytometry, Incubation

    Biochemical methylation of CpG dinucleotide‐containing nucleosomal DNA (CpG146). Lanes are as follows: M, 10‐bp DNA ladder (Thermo Fisher Scientific, Waltham, MA, USA; cat. 10821‐015); (+), presence; and (−), absence of the respective enzyme shown on the left. (A) Comparison of the CpG methyltransferase M.Sss I enzymatic activities. CpG146 DNA was methylated with M.Sss I enzymes as follows: lanes 3–5, M.Sss I purchased from New England Biolabs (NEB, cat. M0226M); and lanes 6–11, the M.Sss I protein purified in this study. In lanes 1 and 2, CpG146 DNAs were incubated in the methylation reaction buffer, in the absence of M.Sss I. Each DNA sample was methylated with an increasing amount of M.Sss I, and the DNA from each reaction was purified, digested with the methyl‐sensitive restriction endonuclease Eco72 I, and electrophoresed. The specific units of the NEB M.Sss I enzyme used in each reaction are as follows: lane 3, 2.0 units·μg −1 DNA; lane 4, 3.0 units·μg −1 DNA; and lane 5, 4.0 units·μg −1 DNA. The amount of the purified M.Sss I protein used in each reaction is as follows: lane 6, 0.032 μg·μg −1 DNA; lane 7, 0.063 μg·μg −1 DNA; lane 8, 0.13 μg·μg −1 DNA; lane 9, 0.25 μg·μg −1 DNA; lane 10, 0.50 μg·μg −1 DNA; and lane 11, 1.0 μg·μg −1 DNA. The positions of the 146‐bp CpG146 nucleosomal DNA, the half unit of CpG146, and the digested DNAs are shown by a red arrow, a black arrow, and a gray square bracket, respectively. (B) Confirmation of the CpG‐methylated CpG146 DNA by Eco72 I digestion. The digestion was performed with 20 units·μg −1 DNA (1.8 units·pmol −1 DNA). Lanes 1 and 3, unmodified CpG146 DNA; lanes 2 and 4, M.Sss I‐treated CpG146 DNA. In lanes 3 and 4, the nucleosomal DNA was subsequently incubated with the methylation‐sensitive restriction enzyme Eco72 I. (C) Confirmation of the CpG‐methylated CpG146 DNA by Msp JI digestion. The digestion was performed with 5 units·μg −1 DNA (0.45 units·pmol −1 DNA). Lanes 1 and 3, unmodified CpG146 DNA; lanes 2 and 4, M.Sss I‐treated CpG146 DNA. In lanes 3 and 4, the nucleosomal DNA was subsequently incubated with the methylation‐dependent restriction enzyme Msp JI.
    Figure Legend Snippet: Biochemical methylation of CpG dinucleotide‐containing nucleosomal DNA (CpG146). Lanes are as follows: M, 10‐bp DNA ladder (Thermo Fisher Scientific, Waltham, MA, USA; cat. 10821‐015); (+), presence; and (−), absence of the respective enzyme shown on the left. (A) Comparison of the CpG methyltransferase M.Sss I enzymatic activities. CpG146 DNA was methylated with M.Sss I enzymes as follows: lanes 3–5, M.Sss I purchased from New England Biolabs (NEB, cat. M0226M); and lanes 6–11, the M.Sss I protein purified in this study. In lanes 1 and 2, CpG146 DNAs were incubated in the methylation reaction buffer, in the absence of M.Sss I. Each DNA sample was methylated with an increasing amount of M.Sss I, and the DNA from each reaction was purified, digested with the methyl‐sensitive restriction endonuclease Eco72 I, and electrophoresed. The specific units of the NEB M.Sss I enzyme used in each reaction are as follows: lane 3, 2.0 units·μg −1 DNA; lane 4, 3.0 units·μg −1 DNA; and lane 5, 4.0 units·μg −1 DNA. The amount of the purified M.Sss I protein used in each reaction is as follows: lane 6, 0.032 μg·μg −1 DNA; lane 7, 0.063 μg·μg −1 DNA; lane 8, 0.13 μg·μg −1 DNA; lane 9, 0.25 μg·μg −1 DNA; lane 10, 0.50 μg·μg −1 DNA; and lane 11, 1.0 μg·μg −1 DNA. The positions of the 146‐bp CpG146 nucleosomal DNA, the half unit of CpG146, and the digested DNAs are shown by a red arrow, a black arrow, and a gray square bracket, respectively. (B) Confirmation of the CpG‐methylated CpG146 DNA by Eco72 I digestion. The digestion was performed with 20 units·μg −1 DNA (1.8 units·pmol −1 DNA). Lanes 1 and 3, unmodified CpG146 DNA; lanes 2 and 4, M.Sss I‐treated CpG146 DNA. In lanes 3 and 4, the nucleosomal DNA was subsequently incubated with the methylation‐sensitive restriction enzyme Eco72 I. (C) Confirmation of the CpG‐methylated CpG146 DNA by Msp JI digestion. The digestion was performed with 5 units·μg −1 DNA (0.45 units·pmol −1 DNA). Lanes 1 and 3, unmodified CpG146 DNA; lanes 2 and 4, M.Sss I‐treated CpG146 DNA. In lanes 3 and 4, the nucleosomal DNA was subsequently incubated with the methylation‐dependent restriction enzyme Msp JI.

    Techniques Used: Methylation, Purification, Incubation

    Native PAGE of the NCP samples used for crystallization. The positions of the NCPs and the free CpG146 DNAs are shown by red square brackets and a red arrow, respectively. (A) Ethidium bromide‐stained gel. (B) CBB‐stained gel. Lane M, 10‐bp DNA ladder (Thermo Fisher Scientific; cat. 10821‐015). Lanes 1–4, nucleosome core particles containing CpG146 DNA untreated with CpG methyltransferase M.Sss I. Lanes 5–8, nucleosome core particles containing CpG146 DNA treated with M.Sss I. Lanes 1 and 5, NCP samples after reconstitution and dialysis. Lanes 2 and 6, NCP samples after heat treatment. Lanes 3 and 7, supernatant fractions of MgCl 2 ‐treated NCP samples. Lanes 4 and 8, precipitated fractions of the MgCl 2 ‐treated NCP samples that were used for crystallization.
    Figure Legend Snippet: Native PAGE of the NCP samples used for crystallization. The positions of the NCPs and the free CpG146 DNAs are shown by red square brackets and a red arrow, respectively. (A) Ethidium bromide‐stained gel. (B) CBB‐stained gel. Lane M, 10‐bp DNA ladder (Thermo Fisher Scientific; cat. 10821‐015). Lanes 1–4, nucleosome core particles containing CpG146 DNA untreated with CpG methyltransferase M.Sss I. Lanes 5–8, nucleosome core particles containing CpG146 DNA treated with M.Sss I. Lanes 1 and 5, NCP samples after reconstitution and dialysis. Lanes 2 and 6, NCP samples after heat treatment. Lanes 3 and 7, supernatant fractions of MgCl 2 ‐treated NCP samples. Lanes 4 and 8, precipitated fractions of the MgCl 2 ‐treated NCP samples that were used for crystallization.

    Techniques Used: Clear Native PAGE, Crystallization Assay, Staining

    17) Product Images from "Oxidation of SQSTM1/p62 mediates the link between redox state and protein homeostasis"

    Article Title: Oxidation of SQSTM1/p62 mediates the link between redox state and protein homeostasis

    Journal: Nature Communications

    doi: 10.1038/s41467-017-02746-z

    Two conserved cysteine residues located in a disordered region of p62 are required for formation of DLC and ubiquitylated aggregates. a Alignment showing cysteines 105 and 113 (highlighted) are conserved in vertebrates. Increasing conservation across species is shown by light-to-dark red. b p62 −/− MEFs stably expressing either wild type or C105A,C113A FLAG-p62 were treated with H 2 O 2 (3 mM, 1 min) or PR-619 (5 μM, 10 min) and immunoblotted in non-reducing conditions. c Formation of ubiquitylated, p62-positive aggregates in stable cells described in b following oxidative stress (1 mM H 2 O 2 or 5 μM PR-619 for 30 min). Cells were immunostained for ubiquitin and p62, analysed by confocal microscopy ( c ) and quantified ( d ). Error bars represent s.e.m., n = 3 , ** P
    Figure Legend Snippet: Two conserved cysteine residues located in a disordered region of p62 are required for formation of DLC and ubiquitylated aggregates. a Alignment showing cysteines 105 and 113 (highlighted) are conserved in vertebrates. Increasing conservation across species is shown by light-to-dark red. b p62 −/− MEFs stably expressing either wild type or C105A,C113A FLAG-p62 were treated with H 2 O 2 (3 mM, 1 min) or PR-619 (5 μM, 10 min) and immunoblotted in non-reducing conditions. c Formation of ubiquitylated, p62-positive aggregates in stable cells described in b following oxidative stress (1 mM H 2 O 2 or 5 μM PR-619 for 30 min). Cells were immunostained for ubiquitin and p62, analysed by confocal microscopy ( c ) and quantified ( d ). Error bars represent s.e.m., n = 3 , ** P

    Techniques Used: Stable Transfection, Expressing, Confocal Microscopy

    Oxidation-sensitive p62 is required for pro-survival autophagy. a p62 −/− MEFs stably expressing FLAG-tagged wild type or C105A,C113A p62 were treated with cycloheximide (CHX, 50 μg/ml) and H 2 O 2 (1 mM), either in the absence ( a ) or presence ( b ) of bafilomycin A1 (Baf, 50 nM), lysed at the indicated time post treatment, immunoblotted for p62 and quantified. c Cells described in a plus one stably expressing K7A,D69A PB1-domain mutant of p62 were treated with H 2 O 2 (1 mM, 5 h), lysed and immunoblotted for ubiquitin, LC3, p62 and actin ( c ) and quantified ( d ). e , f Stable p62 cell lines in control conditions were fixed and stained for p62 and LC3 ( e ) and the % cells with > 20 autophagosomes was quantified ( f ). g , h Electron microscopy of stable p62 cell lines. White arrows: autophagosomes; black arrows: autolysosomes; blue arrow: endosome. Scale bar: 500 nm ( g ). Autophagosomes were quantified and graphs represent average number and % cells with three or more autophagosomes per field of view ( h ). i , j Stable p62 cell lines were treated as in c and % cell death was analysed by Ready Probes fluorescent dyes ( i ). j Stable p62 cell lines were treated as indicated and % cell death was analysed as in i . Error bars represent s.e.m., n = 3 , * P
    Figure Legend Snippet: Oxidation-sensitive p62 is required for pro-survival autophagy. a p62 −/− MEFs stably expressing FLAG-tagged wild type or C105A,C113A p62 were treated with cycloheximide (CHX, 50 μg/ml) and H 2 O 2 (1 mM), either in the absence ( a ) or presence ( b ) of bafilomycin A1 (Baf, 50 nM), lysed at the indicated time post treatment, immunoblotted for p62 and quantified. c Cells described in a plus one stably expressing K7A,D69A PB1-domain mutant of p62 were treated with H 2 O 2 (1 mM, 5 h), lysed and immunoblotted for ubiquitin, LC3, p62 and actin ( c ) and quantified ( d ). e , f Stable p62 cell lines in control conditions were fixed and stained for p62 and LC3 ( e ) and the % cells with > 20 autophagosomes was quantified ( f ). g , h Electron microscopy of stable p62 cell lines. White arrows: autophagosomes; black arrows: autolysosomes; blue arrow: endosome. Scale bar: 500 nm ( g ). Autophagosomes were quantified and graphs represent average number and % cells with three or more autophagosomes per field of view ( h ). i , j Stable p62 cell lines were treated as in c and % cell death was analysed by Ready Probes fluorescent dyes ( i ). j Stable p62 cell lines were treated as indicated and % cell death was analysed as in i . Error bars represent s.e.m., n = 3 , * P

    Techniques Used: Stable Transfection, Expressing, Mutagenesis, Staining, Electron Microscopy

    18) Product Images from "Loss of function mutation in glutamic pyruvate transaminase 2 (GPT2) causes developmental encephalopathy"

    Article Title: Loss of function mutation in glutamic pyruvate transaminase 2 (GPT2) causes developmental encephalopathy

    Journal: Journal of inherited metabolic disease

    doi: 10.1007/s10545-015-9824-x

    Family pedigree. Shaded symbols indicate affected individuals. Electropherograms show the GPT2 c.459C > G genotype
    Figure Legend Snippet: Family pedigree. Shaded symbols indicate affected individuals. Electropherograms show the GPT2 c.459C > G genotype

    Techniques Used:

    Location and conservation of S153R in ALT2 proteins. Conserved functional domains of human ALT2 ) against GenBank protein database. The mutation is indicated by the arrow. hALT2: human ALT2 (GenBank accession#:
    Figure Legend Snippet: Location and conservation of S153R in ALT2 proteins. Conserved functional domains of human ALT2 ) against GenBank protein database. The mutation is indicated by the arrow. hALT2: human ALT2 (GenBank accession#:

    Techniques Used: Functional Assay, Mutagenesis

    Expression and functional analyses of recombinant wild type and mutant ALT2 proteins a ) Upper panel: ALT activities were measured in lysates of bacteria transformed with vector expressing none (control), the 153S wild-type (WT) or 153R mutant (MUT) protein;
    Figure Legend Snippet: Expression and functional analyses of recombinant wild type and mutant ALT2 proteins a ) Upper panel: ALT activities were measured in lysates of bacteria transformed with vector expressing none (control), the 153S wild-type (WT) or 153R mutant (MUT) protein;

    Techniques Used: Expressing, Functional Assay, Recombinant, Mutagenesis, Transformation Assay, Plasmid Preparation

    19) Product Images from "Phosphoregulated orthogonal signal transduction in mammalian cells"

    Article Title: Phosphoregulated orthogonal signal transduction in mammalian cells

    Journal: Nature Communications

    doi: 10.1038/s41467-020-16895-1

    Design of the phosphoregulated orthogonal signal transduction (POST) system. a Mechanism of the native signal cascade activated by the bacterial histidine kinase DcuS. (1) Upon activation, (2) the homodimeric histidine kinase DcuS trans-autophosphorylates a histidine residue in its kinase domain, consisting of the dimerization and histidine-containing phosphotransfer (DHp) domain and the catalytic and ATP-binding (CA) domain. (3) This phosphohistidine is the substrate for the response regulator DcuR that catalyzes the autophosphorylation of an aspartate residue in its dimerization domain. (4) Phosphorylated DcuR dimerizes and (5) binds response elements in its operator site to control (6) gene expression. b Linear schematic depiction of the N-terminal truncation constructs. The constructs start with the amino acid number indicated to the left and end with amino acid number 543 (numbered according to UniProt ID: P0AEC8). c The camelid heavy chain nanoboy acV H H dimerizes in the presence of caffeine. d Schematic illustration of the POST system design. (1) Caffeine induces dimerization of acV H H domains in the engineered orthogonal receptor kinase (ORK), causing (2) kinase trans autophosphorylation and (3) phosphotransfer to an engineered effector protein, such as the orthogonal gene expression regulator (OGR). (4) The effector dimerizes upon phosphotransfer to perform its function, i.e., DNA binding (5), leading to (6) activation of gene expression. e Detailed design of ORK and OGR proteins. The regulatory domain catalyzes the transfer of the phosphoryl group from phosphohistidine to one of its own aspartate residues and subsequently dimerizes.
    Figure Legend Snippet: Design of the phosphoregulated orthogonal signal transduction (POST) system. a Mechanism of the native signal cascade activated by the bacterial histidine kinase DcuS. (1) Upon activation, (2) the homodimeric histidine kinase DcuS trans-autophosphorylates a histidine residue in its kinase domain, consisting of the dimerization and histidine-containing phosphotransfer (DHp) domain and the catalytic and ATP-binding (CA) domain. (3) This phosphohistidine is the substrate for the response regulator DcuR that catalyzes the autophosphorylation of an aspartate residue in its dimerization domain. (4) Phosphorylated DcuR dimerizes and (5) binds response elements in its operator site to control (6) gene expression. b Linear schematic depiction of the N-terminal truncation constructs. The constructs start with the amino acid number indicated to the left and end with amino acid number 543 (numbered according to UniProt ID: P0AEC8). c The camelid heavy chain nanoboy acV H H dimerizes in the presence of caffeine. d Schematic illustration of the POST system design. (1) Caffeine induces dimerization of acV H H domains in the engineered orthogonal receptor kinase (ORK), causing (2) kinase trans autophosphorylation and (3) phosphotransfer to an engineered effector protein, such as the orthogonal gene expression regulator (OGR). (4) The effector dimerizes upon phosphotransfer to perform its function, i.e., DNA binding (5), leading to (6) activation of gene expression. e Detailed design of ORK and OGR proteins. The regulatory domain catalyzes the transfer of the phosphoryl group from phosphohistidine to one of its own aspartate residues and subsequently dimerizes.

    Techniques Used: Transduction, Activation Assay, Binding Assay, Expressing, Construct

    Reducing DcuR autodimerization by generating truncation mutants. a Schematic of DcuS truncation mutants. b Reporter gene expression in response to expression of different DcuS N-terminal truncation variants together with DcuR-VP16. The bar chart shows the mean ± s.d. of n = 3 biologically independent samples overlaid with a scatter dot plot of the original data points, measured 24 h after transfection, and the results are representative of three independent experiments. Source data are provided as a Source Data file.
    Figure Legend Snippet: Reducing DcuR autodimerization by generating truncation mutants. a Schematic of DcuS truncation mutants. b Reporter gene expression in response to expression of different DcuS N-terminal truncation variants together with DcuR-VP16. The bar chart shows the mean ± s.d. of n = 3 biologically independent samples overlaid with a scatter dot plot of the original data points, measured 24 h after transfection, and the results are representative of three independent experiments. Source data are provided as a Source Data file.

    Techniques Used: Expressing, Transfection

    20) Product Images from "ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement"

    Article Title: ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement

    Journal: Scientific Reports

    doi: 10.1038/s41598-019-39768-0

    Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.
    Figure Legend Snippet: Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.

    Techniques Used: Clone Assay, Purification, Transformation Assay, Recombinant, Polymerase Chain Reaction

    Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.
    Figure Legend Snippet: Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.

    Techniques Used: Flow Cytometry, Derivative Assay, Recombinant, Plasmid Preparation, Expressing, Transformation Assay, Purification, Column Chromatography

    Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.
    Figure Legend Snippet: Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.

    Techniques Used: Purification, Lysis, Transformation Assay, Recombinant, Derivative Assay, Polymerase Chain Reaction

    The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.
    Figure Legend Snippet: The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.

    Techniques Used: Generated, Plasmid Preparation, Chloramphenicol Acetyltransferase Assay, Clone Assay, Polymerase Chain Reaction, Expressing

    Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.
    Figure Legend Snippet: Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.

    Techniques Used: Purification, Plasmid Preparation, Sequencing, Clone Assay, Derivative Assay

    21) Product Images from "Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis"

    Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis

    Journal: Nature protocols

    doi: 10.1038/nprot.2010.131

    Ethidium bromide–stained agarose gel pattern showing digested pLD53SC2/A-box DNA from seven different genes. DNA was prepared from PCR-positive colonies, and then digested with AscI and XmaI. Samples were analyzed on a 1.5% agarose gel. The seven genes represented include Plekha2 (lane 1), Itgb5 (lane 2), Itga7 (lane 3), Tdo2 (lane 4), Trpc6 (lane 5), Slc39a6 (lane 6) and Sostdc1 (lane 7). The last sample is pLD53SC2 alone as a vector control (C). Fragment sizes were determined by comparison with a 2-log DNA ladder. The lower bands, which range from 395 to 515 bp, are inserts of each gene. The last sample is the vector that does not contain an insert. If the cloning does not work, the lane will contain a single 3,405-bp band representing the unmodified pLD53SC2.
    Figure Legend Snippet: Ethidium bromide–stained agarose gel pattern showing digested pLD53SC2/A-box DNA from seven different genes. DNA was prepared from PCR-positive colonies, and then digested with AscI and XmaI. Samples were analyzed on a 1.5% agarose gel. The seven genes represented include Plekha2 (lane 1), Itgb5 (lane 2), Itga7 (lane 3), Tdo2 (lane 4), Trpc6 (lane 5), Slc39a6 (lane 6) and Sostdc1 (lane 7). The last sample is pLD53SC2 alone as a vector control (C). Fragment sizes were determined by comparison with a 2-log DNA ladder. The lower bands, which range from 395 to 515 bp, are inserts of each gene. The last sample is the vector that does not contain an insert. If the cloning does not work, the lane will contain a single 3,405-bp band representing the unmodified pLD53SC2.

    Techniques Used: Staining, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Plasmid Preparation, Clone Assay

    22) Product Images from "A simple strategy for heritable chromosomal deletions in zebrafish via the combinatorial action of targeting nucleases"

    Article Title: A simple strategy for heritable chromosomal deletions in zebrafish via the combinatorial action of targeting nucleases

    Journal: Genome Biology

    doi: 10.1186/gb-2013-14-7-r69

    Targeted deletions in cyc and sqt by multiple TALEN and ZFN pairs . (a) Schematic representation of the cyc and sqt loci, with positions of the TALEN targeting sites and ZFN targeting sites indicated by black arrows. E1, E2 and E3 indicate cyc or sqt exons 1 to 3. Colored triangles in the both cyc and sqt panels indicate the position of primers used for genotyping. (b) Phenotype of cyc TALEN injected embryo at 24 hpf showing cyclopia. Scale bar, 100 μm. (c) Phenotype of representative sqt nuclease-injected embryo manifesting cyclopia and midline defects. (d) PCR with primers (yellow and black triangles in (a)) spanning the TALEN targeting sites (black arrows in (a)) shows the expected approximately 400 bp truncated cyc (white arrowhead), and 779 bp full-length cyc (black arrowhead) products in ten single embryos injected with cyc TALEN pairs, whereas the full-length product is observed in the un-injected control embryo. All embryos show faint intermediate sized products. No template control is indicated by -g. (e) PCR with primers (red and blue triangles in (a)) spanning the sqt locus show a 2.4 kb product (black arrowhead) for the intact sqt locus, whereas individual embryos with TALEN deletions show an approximately 220 bp complete locus deletion product (white arrowhead) and several other intermediate sized products. (f) PCR with primers spanning the sqt TSS site (red and green triangles in (a)) show a 478 bp full-length wild-type product (black arrowhead), and only one embryo (number 1) shows the expected approximately 300 bp deletion product (white arrowhead). (g) Alignment of wild-type (WT) cyc sequences with mutated PCR amplicons shows various deletions of approximately 400 bp between the targeting sites, accompanied by small insertions (red). (h) Alignment of wild type s qt sequences with mutated PCR amplicons shows various deletions of approximately 2.2 kb between the targeting sites, accompanied by small insertions (red).
    Figure Legend Snippet: Targeted deletions in cyc and sqt by multiple TALEN and ZFN pairs . (a) Schematic representation of the cyc and sqt loci, with positions of the TALEN targeting sites and ZFN targeting sites indicated by black arrows. E1, E2 and E3 indicate cyc or sqt exons 1 to 3. Colored triangles in the both cyc and sqt panels indicate the position of primers used for genotyping. (b) Phenotype of cyc TALEN injected embryo at 24 hpf showing cyclopia. Scale bar, 100 μm. (c) Phenotype of representative sqt nuclease-injected embryo manifesting cyclopia and midline defects. (d) PCR with primers (yellow and black triangles in (a)) spanning the TALEN targeting sites (black arrows in (a)) shows the expected approximately 400 bp truncated cyc (white arrowhead), and 779 bp full-length cyc (black arrowhead) products in ten single embryos injected with cyc TALEN pairs, whereas the full-length product is observed in the un-injected control embryo. All embryos show faint intermediate sized products. No template control is indicated by -g. (e) PCR with primers (red and blue triangles in (a)) spanning the sqt locus show a 2.4 kb product (black arrowhead) for the intact sqt locus, whereas individual embryos with TALEN deletions show an approximately 220 bp complete locus deletion product (white arrowhead) and several other intermediate sized products. (f) PCR with primers spanning the sqt TSS site (red and green triangles in (a)) show a 478 bp full-length wild-type product (black arrowhead), and only one embryo (number 1) shows the expected approximately 300 bp deletion product (white arrowhead). (g) Alignment of wild-type (WT) cyc sequences with mutated PCR amplicons shows various deletions of approximately 400 bp between the targeting sites, accompanied by small insertions (red). (h) Alignment of wild type s qt sequences with mutated PCR amplicons shows various deletions of approximately 2.2 kb between the targeting sites, accompanied by small insertions (red).

    Techniques Used: Injection, Polymerase Chain Reaction

    23) Product Images from "A simple strategy for heritable chromosomal deletions in zebrafish via the combinatorial action of targeting nucleases"

    Article Title: A simple strategy for heritable chromosomal deletions in zebrafish via the combinatorial action of targeting nucleases

    Journal: Genome Biology

    doi: 10.1186/gb-2013-14-7-r69

    Targeted deletions in cyc and sqt by multiple TALEN and ZFN pairs . (a) Schematic representation of the cyc and sqt loci, with positions of the TALEN targeting sites and ZFN targeting sites indicated by black arrows. E1, E2 and E3 indicate cyc or sqt exons 1 to 3. Colored triangles in the both cyc and sqt panels indicate the position of primers used for genotyping. (b) Phenotype of cyc TALEN injected embryo at 24 hpf showing cyclopia. Scale bar, 100 μm. (c) Phenotype of representative sqt nuclease-injected embryo manifesting cyclopia and midline defects. (d) PCR with primers (yellow and black triangles in (a)) spanning the TALEN targeting sites (black arrows in (a)) shows the expected approximately 400 bp truncated cyc (white arrowhead), and 779 bp full-length cyc (black arrowhead) products in ten single embryos injected with cyc TALEN pairs, whereas the full-length product is observed in the un-injected control embryo. All embryos show faint intermediate sized products. No template control is indicated by -g. (e) PCR with primers (red and blue triangles in (a)) spanning the sqt locus show a 2.4 kb product (black arrowhead) for the intact sqt locus, whereas individual embryos with TALEN deletions show an approximately 220 bp complete locus deletion product (white arrowhead) and several other intermediate sized products. (f) PCR with primers spanning the sqt TSS site (red and green triangles in (a)) show a 478 bp full-length wild-type product (black arrowhead), and only one embryo (number 1) shows the expected approximately 300 bp deletion product (white arrowhead). (g) Alignment of wild-type (WT) cyc sequences with mutated PCR amplicons shows various deletions of approximately 400 bp between the targeting sites, accompanied by small insertions (red). (h) Alignment of wild type s qt sequences with mutated PCR amplicons shows various deletions of approximately 2.2 kb between the targeting sites, accompanied by small insertions (red).
    Figure Legend Snippet: Targeted deletions in cyc and sqt by multiple TALEN and ZFN pairs . (a) Schematic representation of the cyc and sqt loci, with positions of the TALEN targeting sites and ZFN targeting sites indicated by black arrows. E1, E2 and E3 indicate cyc or sqt exons 1 to 3. Colored triangles in the both cyc and sqt panels indicate the position of primers used for genotyping. (b) Phenotype of cyc TALEN injected embryo at 24 hpf showing cyclopia. Scale bar, 100 μm. (c) Phenotype of representative sqt nuclease-injected embryo manifesting cyclopia and midline defects. (d) PCR with primers (yellow and black triangles in (a)) spanning the TALEN targeting sites (black arrows in (a)) shows the expected approximately 400 bp truncated cyc (white arrowhead), and 779 bp full-length cyc (black arrowhead) products in ten single embryos injected with cyc TALEN pairs, whereas the full-length product is observed in the un-injected control embryo. All embryos show faint intermediate sized products. No template control is indicated by -g. (e) PCR with primers (red and blue triangles in (a)) spanning the sqt locus show a 2.4 kb product (black arrowhead) for the intact sqt locus, whereas individual embryos with TALEN deletions show an approximately 220 bp complete locus deletion product (white arrowhead) and several other intermediate sized products. (f) PCR with primers spanning the sqt TSS site (red and green triangles in (a)) show a 478 bp full-length wild-type product (black arrowhead), and only one embryo (number 1) shows the expected approximately 300 bp deletion product (white arrowhead). (g) Alignment of wild-type (WT) cyc sequences with mutated PCR amplicons shows various deletions of approximately 400 bp between the targeting sites, accompanied by small insertions (red). (h) Alignment of wild type s qt sequences with mutated PCR amplicons shows various deletions of approximately 2.2 kb between the targeting sites, accompanied by small insertions (red).

    Techniques Used: Injection, Polymerase Chain Reaction

    24) Product Images from "Immunodominant IgM and IgG Epitopes Recognized by Antibodies Induced in Enterovirus A71-Associated Hand, Foot and Mouth Disease Patients"

    Article Title: Immunodominant IgM and IgG Epitopes Recognized by Antibodies Induced in Enterovirus A71-Associated Hand, Foot and Mouth Disease Patients

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0165659

    Amino acid sequence alignment of peptides with enteroviruses. The selected peptides (PEP12, PEP19, PEP21, PEP23, PEP25 and PEP27) were aligned to the corresponding sequences from 12 enterovirus prototype and consensus contemporary sequences (EV-A71, CV-A2 to CV-A8, CV-A10, CV-A12, CV-A14 and CV-A16). Conserved amino acids are indicated by a dash (–) and alignment gaps are shown in grey. The consensus sequences represent the current circulating strains while BrCr, Fleetwood, Olson, High Point, Swartz, Gdula, Parker, Donovan, Kowalik, Texas, G14 and G10 are the prototype virus strains.
    Figure Legend Snippet: Amino acid sequence alignment of peptides with enteroviruses. The selected peptides (PEP12, PEP19, PEP21, PEP23, PEP25 and PEP27) were aligned to the corresponding sequences from 12 enterovirus prototype and consensus contemporary sequences (EV-A71, CV-A2 to CV-A8, CV-A10, CV-A12, CV-A14 and CV-A16). Conserved amino acids are indicated by a dash (–) and alignment gaps are shown in grey. The consensus sequences represent the current circulating strains while BrCr, Fleetwood, Olson, High Point, Swartz, Gdula, Parker, Donovan, Kowalik, Texas, G14 and G10 are the prototype virus strains.

    Techniques Used: Sequencing

    EV-A71-specific IgM and IgG antibody determinants. (A) EV-A71-specific IgM antibody detection in sera (n = 44) at a dilution of 1:2000 was determined by peptide-based ELISA. Sera were categorized into EV-A71-infected patients (n = 22), non-EV-A71 enterovirus-infected patients (n = 12) and non-HFMD patients (n = 10). Red solid lines represent medians. (B) EV-A71-specific IgG antibody detection in sera (n = 38) at a dilution of 1:500 was determined by peptide-based ELISA. Sera were categorized into EV-A71-infected patients (n = 25), non-EV-A71 enterovirus-infected patients (n = 8) and healthy adults (n = 5). Red solid lines represent medians. One-way ANOVA with Kruskal-Wallis test was used for statistical analysis (* P
    Figure Legend Snippet: EV-A71-specific IgM and IgG antibody determinants. (A) EV-A71-specific IgM antibody detection in sera (n = 44) at a dilution of 1:2000 was determined by peptide-based ELISA. Sera were categorized into EV-A71-infected patients (n = 22), non-EV-A71 enterovirus-infected patients (n = 12) and non-HFMD patients (n = 10). Red solid lines represent medians. (B) EV-A71-specific IgG antibody detection in sera (n = 38) at a dilution of 1:500 was determined by peptide-based ELISA. Sera were categorized into EV-A71-infected patients (n = 25), non-EV-A71 enterovirus-infected patients (n = 8) and healthy adults (n = 5). Red solid lines represent medians. One-way ANOVA with Kruskal-Wallis test was used for statistical analysis (* P

    Techniques Used: Peptide ELISA, Infection

    Mapping of EV-A71 B-cell epitopes. Pooled human sera, at optimized dilutions of 1:2000 (IgM) and 1:500 (IgG), were subjected to peptide-based ELISA. (A) Acute infection with high neutralization sera (n = 5) were used for EV-A71-reactive IgM antibody detection. (B) Acute infection with high neutralization sera (n = 5), (C) convalescent sera (n = 3), and (D) adult sera (n = 5) were used for EV-A71-reactive IgG antibody detection. Non-HFMD children sera (n = 4) were used as negative controls. Data are presented as mean ± SD of 3 replicates. Values above the solid black line (S/CO≥2.1) were scored as weakly positive and values above the dotted line (S/CO≥5) were scored as strongly positive reactions. Grey bars represent weakly positive human anti-EV-A71 epitopes and black bars represent strongly positive human anti-EV-A71 epitopes.
    Figure Legend Snippet: Mapping of EV-A71 B-cell epitopes. Pooled human sera, at optimized dilutions of 1:2000 (IgM) and 1:500 (IgG), were subjected to peptide-based ELISA. (A) Acute infection with high neutralization sera (n = 5) were used for EV-A71-reactive IgM antibody detection. (B) Acute infection with high neutralization sera (n = 5), (C) convalescent sera (n = 3), and (D) adult sera (n = 5) were used for EV-A71-reactive IgG antibody detection. Non-HFMD children sera (n = 4) were used as negative controls. Data are presented as mean ± SD of 3 replicates. Values above the solid black line (S/CO≥2.1) were scored as weakly positive and values above the dotted line (S/CO≥5) were scored as strongly positive reactions. Grey bars represent weakly positive human anti-EV-A71 epitopes and black bars represent strongly positive human anti-EV-A71 epitopes.

    Techniques Used: Peptide ELISA, Infection, Neutralization

    Antigenic profiles of the human anti-EV-A71 antibodies. (A) Control cell lysates were loaded into SDS-PAGE gel electrophoresis. Recombinant EV-A71-EGFP cell lysates (structural and non-structural proteins) were probed with anti-GFP-HRP, while recombinant EV-A71 2A cell lysates were stained with Coomassie brilliant blue R-250. EV-A71 virion proteins were immunodetected with EV-A71-specific mAb 3323 (Millipore, USA) and mAb 979 (Millipore, USA), followed by secondary anti-mouse IgG-HRP. The expected band for each individual recombinant protein is indicated by red solid arrows and the protein sizes are shown. (B) Acute infection with no neutralization sera (n = 2) and (C) acute infection with high neutralization sera (n = 12) were used for EV-A71-specific IgM antibody detection. (D) Acute infection with high neutralization sera (n = 12) and (E) convalescent sera (n = 5) were used for EV-A71-specific IgG antibody detection. An estimated 20 μg of proteins was loaded for SDS-PAGE gel electrophoresis. The amount of EV-A71 structural and non-structural protein cell lysates was normalized with anti-GFP-HRP since the presence of inhibitory factors affected accurate quantitation of total proteins. The EV-A71 protein cell lysates and EV-A71 proteins were subjected to SDS-PAGE gel electrophoresis and probed with pooled human sera at a dilution of 1:300. The immunoblot was developed with Clarity Western ECL substrate and detected by chemiluminescence. Protein bands were determined using the Precision Plus Protein WesternC Standard (Bio-Rad, USA). The antigens recognized by EV-A71-infected patient sera are indicated by red solid arrows.
    Figure Legend Snippet: Antigenic profiles of the human anti-EV-A71 antibodies. (A) Control cell lysates were loaded into SDS-PAGE gel electrophoresis. Recombinant EV-A71-EGFP cell lysates (structural and non-structural proteins) were probed with anti-GFP-HRP, while recombinant EV-A71 2A cell lysates were stained with Coomassie brilliant blue R-250. EV-A71 virion proteins were immunodetected with EV-A71-specific mAb 3323 (Millipore, USA) and mAb 979 (Millipore, USA), followed by secondary anti-mouse IgG-HRP. The expected band for each individual recombinant protein is indicated by red solid arrows and the protein sizes are shown. (B) Acute infection with no neutralization sera (n = 2) and (C) acute infection with high neutralization sera (n = 12) were used for EV-A71-specific IgM antibody detection. (D) Acute infection with high neutralization sera (n = 12) and (E) convalescent sera (n = 5) were used for EV-A71-specific IgG antibody detection. An estimated 20 μg of proteins was loaded for SDS-PAGE gel electrophoresis. The amount of EV-A71 structural and non-structural protein cell lysates was normalized with anti-GFP-HRP since the presence of inhibitory factors affected accurate quantitation of total proteins. The EV-A71 protein cell lysates and EV-A71 proteins were subjected to SDS-PAGE gel electrophoresis and probed with pooled human sera at a dilution of 1:300. The immunoblot was developed with Clarity Western ECL substrate and detected by chemiluminescence. Protein bands were determined using the Precision Plus Protein WesternC Standard (Bio-Rad, USA). The antigens recognized by EV-A71-infected patient sera are indicated by red solid arrows.

    Techniques Used: SDS Page, Nucleic Acid Electrophoresis, Recombinant, Staining, Infection, Neutralization, Quantitation Assay, Western Blot

    Analysis of anti-EV-A71 antibodies recognizing linear B-cell epitopes. (A) IgM antibody determinants identified from acute infection with high neutralization sera. IgG antibody determinants identified from (B) acute infection with high neutralization sera, (C) convalescent sera, and (D) adult sera. Regions of amino acid sequences corresponding to the identified B-cell epitopes are indicated in the schematic diagrams of the EV-A71 genome. The percentage of antibody recognition contributed by each individual EV-A71 epitope is indicated in the pie charts, and was calculated according to the following equation: % antibody recognition = 100 x (OD values from individual peptide group/sum of the OD values from all peptide groups). In this calculation, the avidity and affinity of the peptides to the sera were assumed to be similar. Peptides are colour-coded according to the respective viral proteins.
    Figure Legend Snippet: Analysis of anti-EV-A71 antibodies recognizing linear B-cell epitopes. (A) IgM antibody determinants identified from acute infection with high neutralization sera. IgG antibody determinants identified from (B) acute infection with high neutralization sera, (C) convalescent sera, and (D) adult sera. Regions of amino acid sequences corresponding to the identified B-cell epitopes are indicated in the schematic diagrams of the EV-A71 genome. The percentage of antibody recognition contributed by each individual EV-A71 epitope is indicated in the pie charts, and was calculated according to the following equation: % antibody recognition = 100 x (OD values from individual peptide group/sum of the OD values from all peptide groups). In this calculation, the avidity and affinity of the peptides to the sera were assumed to be similar. Peptides are colour-coded according to the respective viral proteins.

    Techniques Used: Infection, Neutralization

    25) Product Images from "Arabidopsis thaliana DGAT3 is a [2Fe-2S] protein involved in TAG biosynthesis"

    Article Title: Arabidopsis thaliana DGAT3 is a [2Fe-2S] protein involved in TAG biosynthesis

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-35545-7

    AtDGAT3 UV-visible spectroscopy. ( A ) Freshly purified Δ46AtDGAT3 UV-visible spectrum was registered in aerobic conditions with 16,5 μM of protein on a Shimadzu UV-1800 spectrophotometer. The UV-Vis spectrum presents a typical oxidized [2Fe-2S] 2+ cluster with sulfur to iron charge transfer absorption bands observed here at 335 nm, 425 nm, and 550 nm. ( B ) Δ46AtDGAT3 UV-visible spectrum of a freshly purified protein at 337 µM was recorded before (spectrum 1) and after addition of sodium dithionite at 2 mM (spectrum 2: 1 minute; spectrum 3: 30 min), or 100 mM (spectrum 4: 20 min).
    Figure Legend Snippet: AtDGAT3 UV-visible spectroscopy. ( A ) Freshly purified Δ46AtDGAT3 UV-visible spectrum was registered in aerobic conditions with 16,5 μM of protein on a Shimadzu UV-1800 spectrophotometer. The UV-Vis spectrum presents a typical oxidized [2Fe-2S] 2+ cluster with sulfur to iron charge transfer absorption bands observed here at 335 nm, 425 nm, and 550 nm. ( B ) Δ46AtDGAT3 UV-visible spectrum of a freshly purified protein at 337 µM was recorded before (spectrum 1) and after addition of sodium dithionite at 2 mM (spectrum 2: 1 minute; spectrum 3: 30 min), or 100 mM (spectrum 4: 20 min).

    Techniques Used: Spectroscopy, Purification, Spectrophotometry

    Immunodetection of AtDGAT3 in A. thaliana in germinating seeds. A. thaliana seeds (from the Col-0 accession) were stratified on humid Whatman discs at 4 °C in the dark for 72 hours and then transferred in a growth cabinet (25 °C, constant light) to trigger germination. Proteins were extracted from 10 seeds or seedlings during the germination process (0, 24, 48, or 72 h after the first exposure to the light), separated by SDS-PAGE, transferred and immunodetected using polyclonal antibodies raised in rat against Δ75AtDGAT3. The arrow indicates the localization of the protein (calculated MW = 39.2 kDa). Separations indicate delineation of the figure.
    Figure Legend Snippet: Immunodetection of AtDGAT3 in A. thaliana in germinating seeds. A. thaliana seeds (from the Col-0 accession) were stratified on humid Whatman discs at 4 °C in the dark for 72 hours and then transferred in a growth cabinet (25 °C, constant light) to trigger germination. Proteins were extracted from 10 seeds or seedlings during the germination process (0, 24, 48, or 72 h after the first exposure to the light), separated by SDS-PAGE, transferred and immunodetected using polyclonal antibodies raised in rat against Δ75AtDGAT3. The arrow indicates the localization of the protein (calculated MW = 39.2 kDa). Separations indicate delineation of the figure.

    Techniques Used: Immunodetection, SDS Page

    SDS-PAGE and Western-blot analyses of recombinant AtDGAT3 proteins after purification by affinity chromatography. The full-length (40.2 kDa), Δ46 (35.4 kDa) and Δ75 (31.9 kDa) protein variants of recombinant His-tagged AtDGAT3 were purified on a nickel chelating resin from the 12 000 x g supernatant of the lysate of an E. coli culture and further purified using size exclusion chromatography (Δ46). Protein concentration was determined by the Bio-Rad assay and 7.5 to 10 µg were separated by SDS-PAGE. Each variant protein is indicated by a black arrow. The identity of the band corresponding to the full-length protein was validated by Western blot and by mass spectrometry. The band (highlighted with a black asterisk) of the SDS-PAGE was cut, digested and analysed by LC-MS/MS. Vertical lines indicate delineation of the figure. Original gels and blot are displayed in Supplementary Fig. S2A–C .
    Figure Legend Snippet: SDS-PAGE and Western-blot analyses of recombinant AtDGAT3 proteins after purification by affinity chromatography. The full-length (40.2 kDa), Δ46 (35.4 kDa) and Δ75 (31.9 kDa) protein variants of recombinant His-tagged AtDGAT3 were purified on a nickel chelating resin from the 12 000 x g supernatant of the lysate of an E. coli culture and further purified using size exclusion chromatography (Δ46). Protein concentration was determined by the Bio-Rad assay and 7.5 to 10 µg were separated by SDS-PAGE. Each variant protein is indicated by a black arrow. The identity of the band corresponding to the full-length protein was validated by Western blot and by mass spectrometry. The band (highlighted with a black asterisk) of the SDS-PAGE was cut, digested and analysed by LC-MS/MS. Vertical lines indicate delineation of the figure. Original gels and blot are displayed in Supplementary Fig. S2A–C .

    Techniques Used: SDS Page, Western Blot, Recombinant, Purification, Affinity Chromatography, Size-exclusion Chromatography, Protein Concentration, Variant Assay, Mass Spectrometry, Liquid Chromatography with Mass Spectroscopy

    EPR Spectrum of the [2Fe-2S] + cluster of Δ46AtDGAT3. The EPR spectrum of an AtDGAT3 solution (concentration: 250 μM) was recorded at 50 K under non-saturating conditions. The spectrum indicates a rhombic symmetry with 3 distinct principal g-values (g z = 2.002, g y = 1.948, g x = 1.919).
    Figure Legend Snippet: EPR Spectrum of the [2Fe-2S] + cluster of Δ46AtDGAT3. The EPR spectrum of an AtDGAT3 solution (concentration: 250 μM) was recorded at 50 K under non-saturating conditions. The spectrum indicates a rhombic symmetry with 3 distinct principal g-values (g z = 2.002, g y = 1.948, g x = 1.919).

    Techniques Used: Electron Paramagnetic Resonance, Concentration Assay

    Comparison of AtDGAT3 sequence with that of other DGAT3s. The AtDGAT3 amino acid sequence (GenBank accession number AEE32272) was aligned, using Clustal Omega with ( A ) five plant DGAT3 protein sequences [ Theobroma cacao (EOX95446), Arachis hypogaea (AAX62735 and AGT57760), Ricinus communis (EEF43203), Vernicia fordii (AGL81309)] and with ( B ) homologues to the thioredoxin-like [2Fe-2S] ferredoxin class: a ferredoxin from Bacillus megaterium (CbiW, CAA04306), a NADH-ubiquinone oxidoreductase subunit from Paracoccus denitrificans (NuoE or NQO2, AAA25588), the [FeFe]-hydrogenase gamma subunit from Thermotoga maritima (Tma or HydC, AAC02684)]. Multiple sequence alignments were edited using the BioEdit program and the BLOSUM62 similarity matrix for shading with a threshold of 75%. Identical residues are highlighted in black and homologous residues are shaded in grey. Conserved motifs are boxed: the two polylysine motifs in blue, a polyserine-rich region in purple and the thioredoxin-like ferredoxin domain in red with its conserved cysteine residues in yellow and highlighted with red asterisks. Putative catalytic motifs identified in A. hypogea DGAT3s by homology with motifs found in GPATs or DGAT1s are boxed in green. The putative catalytic histidine from the first GPAT-like motif, absent in the truncated forms of AtDGAT3, is yellow.
    Figure Legend Snippet: Comparison of AtDGAT3 sequence with that of other DGAT3s. The AtDGAT3 amino acid sequence (GenBank accession number AEE32272) was aligned, using Clustal Omega with ( A ) five plant DGAT3 protein sequences [ Theobroma cacao (EOX95446), Arachis hypogaea (AAX62735 and AGT57760), Ricinus communis (EEF43203), Vernicia fordii (AGL81309)] and with ( B ) homologues to the thioredoxin-like [2Fe-2S] ferredoxin class: a ferredoxin from Bacillus megaterium (CbiW, CAA04306), a NADH-ubiquinone oxidoreductase subunit from Paracoccus denitrificans (NuoE or NQO2, AAA25588), the [FeFe]-hydrogenase gamma subunit from Thermotoga maritima (Tma or HydC, AAC02684)]. Multiple sequence alignments were edited using the BioEdit program and the BLOSUM62 similarity matrix for shading with a threshold of 75%. Identical residues are highlighted in black and homologous residues are shaded in grey. Conserved motifs are boxed: the two polylysine motifs in blue, a polyserine-rich region in purple and the thioredoxin-like ferredoxin domain in red with its conserved cysteine residues in yellow and highlighted with red asterisks. Putative catalytic motifs identified in A. hypogea DGAT3s by homology with motifs found in GPATs or DGAT1s are boxed in green. The putative catalytic histidine from the first GPAT-like motif, absent in the truncated forms of AtDGAT3, is yellow.

    Techniques Used: Sequencing

    AtDGAT3 catalyses the synthesis of triacylglycerols. HPTLC plate showing the result of DGAT assay using an unlabelled DAG acceptor (1,2-dioleoyl- sn -glycerol) and an acyl donor (Lauroyl Coenzyme A). Assays contained 60 µg proteins and were performed during 20 h at 30 °C under mild shaking. Reaction products were extracted and separated on HPTLC plates. Lipid identification was based upon migration obtained for lipid standards. + or − indicate the presence or absence of the different compounds in the reaction mixtures. Vertical lines indicate delineation of the figure. Original HPTLC is displayed in Supplementary Figure S4 .
    Figure Legend Snippet: AtDGAT3 catalyses the synthesis of triacylglycerols. HPTLC plate showing the result of DGAT assay using an unlabelled DAG acceptor (1,2-dioleoyl- sn -glycerol) and an acyl donor (Lauroyl Coenzyme A). Assays contained 60 µg proteins and were performed during 20 h at 30 °C under mild shaking. Reaction products were extracted and separated on HPTLC plates. Lipid identification was based upon migration obtained for lipid standards. + or − indicate the presence or absence of the different compounds in the reaction mixtures. Vertical lines indicate delineation of the figure. Original HPTLC is displayed in Supplementary Figure S4 .

    Techniques Used: High Performance Thin Layer Chromatography, Migration

    26) Product Images from "ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement"

    Article Title: ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement

    Journal: Scientific Reports

    doi: 10.1038/s41598-019-39768-0

    Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.
    Figure Legend Snippet: Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.

    Techniques Used: Clone Assay, Purification, Transformation Assay, Recombinant, Polymerase Chain Reaction

    Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.
    Figure Legend Snippet: Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.

    Techniques Used: Flow Cytometry, Derivative Assay, Recombinant, Plasmid Preparation, Expressing, Transformation Assay, Purification, Column Chromatography

    Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.
    Figure Legend Snippet: Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.

    Techniques Used: Purification, Lysis, Transformation Assay, Recombinant, Derivative Assay, Polymerase Chain Reaction

    The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.
    Figure Legend Snippet: The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.

    Techniques Used: Generated, Plasmid Preparation, Chloramphenicol Acetyltransferase Assay, Clone Assay, Polymerase Chain Reaction, Expressing

    Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.
    Figure Legend Snippet: Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.

    Techniques Used: Purification, Plasmid Preparation, Sequencing, Clone Assay, Derivative Assay

    27) Product Images from "Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis"

    Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis

    Journal: Nature protocols

    doi: 10.1038/nprot.2010.131

    Diagrammatic representation of an A-homology (A-box) arm. The example chosen is the gene Chat (encoding choline acetyltransferase). The 5′ primer used in the amplification of the Chat A-box was 5′ GGCGCGCC AAGGTGCTCTAGTGCTCTGATCCCAG 3′. The first eight nucleotides in this sequence do not correspond to the genomic sequence of Chat but represent an added Asc I recognition site sequence 5′-GGCGCGCC-3′. A key step in designing the 5′ primer is the addition of an AscI or MluI enzyme site at the front of the primer. It serves in a later step when the A-homology arm is ligated into an AscI and SwaI-digested pLD53.SC2 vector at its AscI or SwaI cloning sites. If an internal AscI recognition sequence is present within the homology sequence (can be checked with the DNASTAR program), a MluI recognition site, 5′-ACGCGT-3′, should be added to the end of the primer instead. The enzyme MluI is then used in the digestion step. The 3′ primer used for Cha t in the homology amplification step was 5′ CCTAGCGATTCTTAATCCAGAGTAGC 3′. This is the reverse-complement of the 3′ sequence highlighted in the figure.
    Figure Legend Snippet: Diagrammatic representation of an A-homology (A-box) arm. The example chosen is the gene Chat (encoding choline acetyltransferase). The 5′ primer used in the amplification of the Chat A-box was 5′ GGCGCGCC AAGGTGCTCTAGTGCTCTGATCCCAG 3′. The first eight nucleotides in this sequence do not correspond to the genomic sequence of Chat but represent an added Asc I recognition site sequence 5′-GGCGCGCC-3′. A key step in designing the 5′ primer is the addition of an AscI or MluI enzyme site at the front of the primer. It serves in a later step when the A-homology arm is ligated into an AscI and SwaI-digested pLD53.SC2 vector at its AscI or SwaI cloning sites. If an internal AscI recognition sequence is present within the homology sequence (can be checked with the DNASTAR program), a MluI recognition site, 5′-ACGCGT-3′, should be added to the end of the primer instead. The enzyme MluI is then used in the digestion step. The 3′ primer used for Cha t in the homology amplification step was 5′ CCTAGCGATTCTTAATCCAGAGTAGC 3′. This is the reverse-complement of the 3′ sequence highlighted in the figure.

    Techniques Used: Amplification, Sequencing, Plasmid Preparation, Clone Assay

    28) Product Images from "A simple strategy for heritable chromosomal deletions in zebrafish via the combinatorial action of targeting nucleases"

    Article Title: A simple strategy for heritable chromosomal deletions in zebrafish via the combinatorial action of targeting nucleases

    Journal: Genome Biology

    doi: 10.1186/gb-2013-14-7-r69

    Targeted deletions in cyc and sqt by multiple TALEN and ZFN pairs . (a) Schematic representation of the cyc and sqt loci, with positions of the TALEN targeting sites and ZFN targeting sites indicated by black arrows. E1, E2 and E3 indicate cyc or sqt exons 1 to 3. Colored triangles in the both cyc and sqt panels indicate the position of primers used for genotyping. (b) Phenotype of cyc TALEN injected embryo at 24 hpf showing cyclopia. Scale bar, 100 μm. (c) Phenotype of representative sqt nuclease-injected embryo manifesting cyclopia and midline defects. (d) PCR with primers (yellow and black triangles in (a)) spanning the TALEN targeting sites (black arrows in (a)) shows the expected approximately 400 bp truncated cyc (white arrowhead), and 779 bp full-length cyc (black arrowhead) products in ten single embryos injected with cyc TALEN pairs, whereas the full-length product is observed in the un-injected control embryo. All embryos show faint intermediate sized products. No template control is indicated by -g. (e) PCR with primers (red and blue triangles in (a)) spanning the sqt locus show a 2.4 kb product (black arrowhead) for the intact sqt locus, whereas individual embryos with TALEN deletions show an approximately 220 bp complete locus deletion product (white arrowhead) and several other intermediate sized products. (f) PCR with primers spanning the sqt TSS site (red and green triangles in (a)) show a 478 bp full-length wild-type product (black arrowhead), and only one embryo (number 1) shows the expected approximately 300 bp deletion product (white arrowhead). (g) Alignment of wild-type (WT) cyc sequences with mutated PCR amplicons shows various deletions of approximately 400 bp between the targeting sites, accompanied by small insertions (red). (h) Alignment of wild type s qt sequences with mutated PCR amplicons shows various deletions of approximately 2.2 kb between the targeting sites, accompanied by small insertions (red).
    Figure Legend Snippet: Targeted deletions in cyc and sqt by multiple TALEN and ZFN pairs . (a) Schematic representation of the cyc and sqt loci, with positions of the TALEN targeting sites and ZFN targeting sites indicated by black arrows. E1, E2 and E3 indicate cyc or sqt exons 1 to 3. Colored triangles in the both cyc and sqt panels indicate the position of primers used for genotyping. (b) Phenotype of cyc TALEN injected embryo at 24 hpf showing cyclopia. Scale bar, 100 μm. (c) Phenotype of representative sqt nuclease-injected embryo manifesting cyclopia and midline defects. (d) PCR with primers (yellow and black triangles in (a)) spanning the TALEN targeting sites (black arrows in (a)) shows the expected approximately 400 bp truncated cyc (white arrowhead), and 779 bp full-length cyc (black arrowhead) products in ten single embryos injected with cyc TALEN pairs, whereas the full-length product is observed in the un-injected control embryo. All embryos show faint intermediate sized products. No template control is indicated by -g. (e) PCR with primers (red and blue triangles in (a)) spanning the sqt locus show a 2.4 kb product (black arrowhead) for the intact sqt locus, whereas individual embryos with TALEN deletions show an approximately 220 bp complete locus deletion product (white arrowhead) and several other intermediate sized products. (f) PCR with primers spanning the sqt TSS site (red and green triangles in (a)) show a 478 bp full-length wild-type product (black arrowhead), and only one embryo (number 1) shows the expected approximately 300 bp deletion product (white arrowhead). (g) Alignment of wild-type (WT) cyc sequences with mutated PCR amplicons shows various deletions of approximately 400 bp between the targeting sites, accompanied by small insertions (red). (h) Alignment of wild type s qt sequences with mutated PCR amplicons shows various deletions of approximately 2.2 kb between the targeting sites, accompanied by small insertions (red).

    Techniques Used: Injection, Polymerase Chain Reaction

    Heritable deletions in the sqt locus that result in RNA-null alleles . (a) PCR on single wild-type or sqt deletion mutant embryos (using primers indicated in Figure 2a) shows a 220 bp fragment in a s qt sg32 locus-deletion embryo, and a 380 bp fragment in TSS deleted sqt sg27 mutant embryo. Sometimes a larger approximately 500 bp fragment is observed in sqt sg27 /+ heterozygous embryos, but the sequence is identical to the 478 bp product. (b) Percentage of embryos with sqt mutant phenotypes in sqt cz35/+ , sqt sg27/+ , sqt sg32/+ and sqt sg7/+ in-crosses and mating of sqt cz35/+ with sqt sg27/+ , sqt sg32/+ and sqt sg7/+ . The cz35 allele is an approximately 1.9 kb insertion in sqt exon 1; the sg27 allele is a 98 bp deletion of sqt TSS sequences; sg32 allele is a whole locus deletion of sqt ; the sg7 ZFN allele harbors a GGCC insertion in sqt exon 2. (c-j) DIC images of 24 h wild-type (c), sqt cz35/cz35 (d), sqt sg27/cz35 (e), sqt sg32/cz35 (f), sqt sg7/cz35 (g), sqt sg27/sg27 (h), sqt sg32/sg32 (i), and sqt sg7/sg7 (j) embryos; scale bar in (c), 100 μm. (k) UCSC genome browser view of the sqt locus and neighboring genomic region. (l,m) RT-PCR with primers to detect expression of sqt RNA and transcripts of neighboring genes, eif4ebp1 , rnf180 , and htr1ab , shows lack of sqt RNA expression in sqt sg27/sg27 (l) and sqt sg32/sg32 (m) embryos whereas all neighboring gene transcripts are expressed at wild-type levels. Actin ( act ) expression was used as control. In contrast, both un-spliced and spliced sqt RNA is detected in wild-type and heterozygous embryos.
    Figure Legend Snippet: Heritable deletions in the sqt locus that result in RNA-null alleles . (a) PCR on single wild-type or sqt deletion mutant embryos (using primers indicated in Figure 2a) shows a 220 bp fragment in a s qt sg32 locus-deletion embryo, and a 380 bp fragment in TSS deleted sqt sg27 mutant embryo. Sometimes a larger approximately 500 bp fragment is observed in sqt sg27 /+ heterozygous embryos, but the sequence is identical to the 478 bp product. (b) Percentage of embryos with sqt mutant phenotypes in sqt cz35/+ , sqt sg27/+ , sqt sg32/+ and sqt sg7/+ in-crosses and mating of sqt cz35/+ with sqt sg27/+ , sqt sg32/+ and sqt sg7/+ . The cz35 allele is an approximately 1.9 kb insertion in sqt exon 1; the sg27 allele is a 98 bp deletion of sqt TSS sequences; sg32 allele is a whole locus deletion of sqt ; the sg7 ZFN allele harbors a GGCC insertion in sqt exon 2. (c-j) DIC images of 24 h wild-type (c), sqt cz35/cz35 (d), sqt sg27/cz35 (e), sqt sg32/cz35 (f), sqt sg7/cz35 (g), sqt sg27/sg27 (h), sqt sg32/sg32 (i), and sqt sg7/sg7 (j) embryos; scale bar in (c), 100 μm. (k) UCSC genome browser view of the sqt locus and neighboring genomic region. (l,m) RT-PCR with primers to detect expression of sqt RNA and transcripts of neighboring genes, eif4ebp1 , rnf180 , and htr1ab , shows lack of sqt RNA expression in sqt sg27/sg27 (l) and sqt sg32/sg32 (m) embryos whereas all neighboring gene transcripts are expressed at wild-type levels. Actin ( act ) expression was used as control. In contrast, both un-spliced and spliced sqt RNA is detected in wild-type and heterozygous embryos.

    Techniques Used: Polymerase Chain Reaction, Mutagenesis, Sequencing, Reverse Transcription Polymerase Chain Reaction, Expressing, RNA Expression, Activated Clotting Time Assay

    29) Product Images from "Spy Go purification of SpyTag-proteins using pseudo-SpyCatcher to access an oligomerization toolbox"

    Article Title: Spy Go purification of SpyTag-proteins using pseudo-SpyCatcher to access an oligomerization toolbox

    Journal: Nature Communications

    doi: 10.1038/s41467-019-09678-w

    Spy Go from bacterial expression. a SpyTag-MBP was purified from E. coli clarified lysate by Spy Go. Protein: input SpyTag-MBP protein. T: total pooled elutions. Purity of T was determined by densitometry (right); gray represents background lane intensity (mean ± 1 s.d., n = 3). b Ni-NTA purification of SpyTag-MBP from the same lysate via its His-tag. c Spy Go purification of scPvuII-SpyTag (SpyTag at an internal loop, shown schematically) from bacterial lysate. d Spy Go purification of the nanobody αDR5-SpyTag (C-terminal fusion) from bacterial lysate. All fractions were analyzed by SDS-PAGE with Coomassie staining
    Figure Legend Snippet: Spy Go from bacterial expression. a SpyTag-MBP was purified from E. coli clarified lysate by Spy Go. Protein: input SpyTag-MBP protein. T: total pooled elutions. Purity of T was determined by densitometry (right); gray represents background lane intensity (mean ± 1 s.d., n = 3). b Ni-NTA purification of SpyTag-MBP from the same lysate via its His-tag. c Spy Go purification of scPvuII-SpyTag (SpyTag at an internal loop, shown schematically) from bacterial lysate. d Spy Go purification of the nanobody αDR5-SpyTag (C-terminal fusion) from bacterial lysate. All fractions were analyzed by SDS-PAGE with Coomassie staining

    Techniques Used: Expressing, Purification, SDS Page, Staining

    30) Product Images from "Phosphoregulated orthogonal signal transduction in mammalian cells"

    Article Title: Phosphoregulated orthogonal signal transduction in mammalian cells

    Journal: Nature Communications

    doi: 10.1038/s41467-020-16895-1

    EnvZ/OmpR and NarX/NarL POST. a Schematic of the engineered ORK/OGR proteins based on EnvZ/OmpR. In the ORK, short linkers consisting only of the two amino acids AS were used to reduce interdomain flexibility between the acV H H and the kinase domain and between the CA and DHp domains by replacing the native GQEMP linker. We hypothesize that this change results in inactive dimers. b Induction of EnvZ/OmpR POST with caffeine. The EnvZ mutant without acV H H (EnvZ 232–450;GQEMP:AS ) was included as a negative control. c Schematic of the engineered ORK/OGR proteins based on NarX/NarL. d Induction of NarX/NarL POST with caffeine. The NarX truncations without acV H H were included as negative controls. The bar charts show the mean ± s.d. of n = 3 biologically independent samples overlaid with a scatter dot plot of the original data points, measured at 24 h after induction, and the results are representative of three independent experiments. Source data are provided as a Source Data file.
    Figure Legend Snippet: EnvZ/OmpR and NarX/NarL POST. a Schematic of the engineered ORK/OGR proteins based on EnvZ/OmpR. In the ORK, short linkers consisting only of the two amino acids AS were used to reduce interdomain flexibility between the acV H H and the kinase domain and between the CA and DHp domains by replacing the native GQEMP linker. We hypothesize that this change results in inactive dimers. b Induction of EnvZ/OmpR POST with caffeine. The EnvZ mutant without acV H H (EnvZ 232–450;GQEMP:AS ) was included as a negative control. c Schematic of the engineered ORK/OGR proteins based on NarX/NarL. d Induction of NarX/NarL POST with caffeine. The NarX truncations without acV H H were included as negative controls. The bar charts show the mean ± s.d. of n = 3 biologically independent samples overlaid with a scatter dot plot of the original data points, measured at 24 h after induction, and the results are representative of three independent experiments. Source data are provided as a Source Data file.

    Techniques Used: Mutagenesis, Negative Control

    31) Product Images from "Probing the Acceptor Active Site Organization of the Human Recombinant β1,4-Galactosyltransferase 7 and Design of Xyloside-based Inhibitors *"

    Article Title: Probing the Acceptor Active Site Organization of the Human Recombinant β1,4-Galactosyltransferase 7 and Design of Xyloside-based Inhibitors *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M114.628123

    Effect of wild-type and mutated hβ4GalT7 expression on GAG chains primed from 4-MUX in CHOpgsB-618 cells. Cells were transiently transfected with wild-type (WT) or mutated hβ4GalT7 cDNA or with empty vector ( pcDNA ), and GAG chains synthesis was quantified by scintillation counting following Na 2 [ 35 SO 4 2− ] incorporation, using 0 ( white bars ), 5 ( gray bars ), and 10 μ m ( black bars ) 4-MUX. Immunoblot analyses of the protein expression level in CHOpgsB-618 cells transfected with the vector coding for the wild-type or mutated hβ4GalT7 are shown as the inset . The enzyme was identified at the band of ∼35 kDa, whereas the upper band corresponding to ∼39 kDa band could be attributed to the N -glycosylated enzyme as demonstrated by its disappearance upon addition of peptide N -glycosidase F ( PNGase F ) ( left panel ). Both bands intensities were used to quantify the total protein expression level (ImageJ software). The immunoblot analysis indicates that the mutated enzymes were all expressed at a comparable level to that of the wild-type hβ4GalT7 ( right panel ). Data are mean ± S.E. of three independent experiments performed in triplicate. Statistical analysis was carried out by the Student's t test with *, p
    Figure Legend Snippet: Effect of wild-type and mutated hβ4GalT7 expression on GAG chains primed from 4-MUX in CHOpgsB-618 cells. Cells were transiently transfected with wild-type (WT) or mutated hβ4GalT7 cDNA or with empty vector ( pcDNA ), and GAG chains synthesis was quantified by scintillation counting following Na 2 [ 35 SO 4 2− ] incorporation, using 0 ( white bars ), 5 ( gray bars ), and 10 μ m ( black bars ) 4-MUX. Immunoblot analyses of the protein expression level in CHOpgsB-618 cells transfected with the vector coding for the wild-type or mutated hβ4GalT7 are shown as the inset . The enzyme was identified at the band of ∼35 kDa, whereas the upper band corresponding to ∼39 kDa band could be attributed to the N -glycosylated enzyme as demonstrated by its disappearance upon addition of peptide N -glycosidase F ( PNGase F ) ( left panel ). Both bands intensities were used to quantify the total protein expression level (ImageJ software). The immunoblot analysis indicates that the mutated enzymes were all expressed at a comparable level to that of the wild-type hβ4GalT7 ( right panel ). Data are mean ± S.E. of three independent experiments performed in triplicate. Statistical analysis was carried out by the Student's t test with *, p

    Techniques Used: Expressing, Transfection, Plasmid Preparation, Software

    32) Product Images from "Purification and Characterization of RhoPDE, a Retinylidene/Phosphodiesterase Fusion Protein and Potential Optogenetic Tool from the Choanoflagellate Salpingoeca rosetta"

    Article Title: Purification and Characterization of RhoPDE, a Retinylidene/Phosphodiesterase Fusion Protein and Potential Optogenetic Tool from the Choanoflagellate Salpingoeca rosetta

    Journal: Biochemistry

    doi: 10.1021/acs.biochem.7b00519

    Phosphodiesterase activity of the isolated PDE domain purified from transformed E. coli T7 Express cells. (A) Coomassie-stained SDS–PAGE gel showing fractions from purification of the isolated PDE domain from transformed E. coli T7 Express cells using a six-His tag with a Ni affinity column: lane M, molecular mass markers in kilodaltons; lane P, pellet from the cell extract; lane S, soluble fraction from the cell extract; lane FT, flow-through, nonbound fraction from the Ni affinity column; lane W, last wash before elution with an imidazole gradient; and lanes E1–E3, three representative fractions from the imidazole gradient eluate. (B) AKTA FPLC profile for size exclusion chromatography of the isolated PDE domain on a Superdex-200 10/300 GL column. Molecular mass standards: (1) blue dextran, 2000 kDa, 8.5 mL (void volume); (2) aldolase, 158 kDa, 13.15 mL; (3) albumin, 67 kDa, 14.57 mL; (4) ovalbumin, 43 kDa, 15.41 mL; and (5) chymotrypsinogen, 25 kDa, 17.35 mL. The isolated PDE domain elutes at 14.5 mL, giving a mass of 74 kDa, consistent with a homodimer. (C) HPLC assay of the cGMP phosphodiesterase activity of the isolated PDE domain. The concentration of PDE in this assay was 100 nM, which gives an apparent k cat of 3.13 ± 0.12 s −1 .
    Figure Legend Snippet: Phosphodiesterase activity of the isolated PDE domain purified from transformed E. coli T7 Express cells. (A) Coomassie-stained SDS–PAGE gel showing fractions from purification of the isolated PDE domain from transformed E. coli T7 Express cells using a six-His tag with a Ni affinity column: lane M, molecular mass markers in kilodaltons; lane P, pellet from the cell extract; lane S, soluble fraction from the cell extract; lane FT, flow-through, nonbound fraction from the Ni affinity column; lane W, last wash before elution with an imidazole gradient; and lanes E1–E3, three representative fractions from the imidazole gradient eluate. (B) AKTA FPLC profile for size exclusion chromatography of the isolated PDE domain on a Superdex-200 10/300 GL column. Molecular mass standards: (1) blue dextran, 2000 kDa, 8.5 mL (void volume); (2) aldolase, 158 kDa, 13.15 mL; (3) albumin, 67 kDa, 14.57 mL; (4) ovalbumin, 43 kDa, 15.41 mL; and (5) chymotrypsinogen, 25 kDa, 17.35 mL. The isolated PDE domain elutes at 14.5 mL, giving a mass of 74 kDa, consistent with a homodimer. (C) HPLC assay of the cGMP phosphodiesterase activity of the isolated PDE domain. The concentration of PDE in this assay was 100 nM, which gives an apparent k cat of 3.13 ± 0.12 s −1 .

    Techniques Used: Activity Assay, Isolation, Purification, Transformation Assay, Staining, SDS Page, Affinity Column, Flow Cytometry, Fast Protein Liquid Chromatography, Size-exclusion Chromatography, High Performance Liquid Chromatography, Concentration Assay

    33) Product Images from "FICD acts bi-functionally to AMPylate and de-AMPylate the endoplasmic reticulum chaperone BiP"

    Article Title: FICD acts bi-functionally to AMPylate and de-AMPylate the endoplasmic reticulum chaperone BiP

    Journal: bioRxiv

    doi: 10.1101/071332

    Wildtype and FICD-deficient (-/-) cells respond indistinguishably to unfolded protein stress in the ER. (A) Flow cytometry analysis of wildtype and FICD-deficient (-/-) CHO-K1 CHOP::GFP UPR reporter cells treated with the UPR-inducing compounds, tunicamycin (2.5 µg/ml) or thapsigargin (0.5 µM), for 16 hours before analysis. Note the equal accumulation of CHOP::GFP-positive cells in tunicamycin- or thapsigargin-treated wildtype and FICD −/− cells. (B) Plot of the median values ± SD of the GFP fluorescent signal of the samples described in “A” from three independent experiments (fold change relative to untreated wildtype cells; n = 3). (C) Flow cytometry analysis of wildtype and FICD-deficient (-/-) CHO-K1 CHOP::GFP UPR reporter cells transiently transfected with plasmids encoding the Cas9 nuclease and single guide RNAs targeting hamster BiP. Note the similar levels of UPR signaling in wildtype and FICD −/− cells. D) Plot of the median values ± SD of the CHOP::GFP fluorescent signal in the transfected subpopulation of the cells shown in “C” from three independent experiments. Transfected cells were identified by co-expression of a mCherry marker (not shown) carried by the Cas9 plasmid (fold change relative to wildtype cells transfected with plasmid DNA encoding Cas9 and mCherry only; n = 3).
    Figure Legend Snippet: Wildtype and FICD-deficient (-/-) cells respond indistinguishably to unfolded protein stress in the ER. (A) Flow cytometry analysis of wildtype and FICD-deficient (-/-) CHO-K1 CHOP::GFP UPR reporter cells treated with the UPR-inducing compounds, tunicamycin (2.5 µg/ml) or thapsigargin (0.5 µM), for 16 hours before analysis. Note the equal accumulation of CHOP::GFP-positive cells in tunicamycin- or thapsigargin-treated wildtype and FICD −/− cells. (B) Plot of the median values ± SD of the GFP fluorescent signal of the samples described in “A” from three independent experiments (fold change relative to untreated wildtype cells; n = 3). (C) Flow cytometry analysis of wildtype and FICD-deficient (-/-) CHO-K1 CHOP::GFP UPR reporter cells transiently transfected with plasmids encoding the Cas9 nuclease and single guide RNAs targeting hamster BiP. Note the similar levels of UPR signaling in wildtype and FICD −/− cells. D) Plot of the median values ± SD of the CHOP::GFP fluorescent signal in the transfected subpopulation of the cells shown in “C” from three independent experiments. Transfected cells were identified by co-expression of a mCherry marker (not shown) carried by the Cas9 plasmid (fold change relative to wildtype cells transfected with plasmid DNA encoding Cas9 and mCherry only; n = 3).

    Techniques Used: Flow Cytometry, Transfection, Expressing, Marker, Plasmid Preparation

    FICD counteracts BiP AMPylation in cells ( A ) Immunoblot of endogenous BiP from CHO-K1 cells resolved by native-PAGE. The cells were transfected with the indicated amount of plasmid DNA encoding wildtype FICD and exposed to cycloheximide (CHX; 100 µg/mL, 3 hours) to promote AMPylated BiP. The AMPylated ‘B’ form of BiP is indicated (as are the other major species, see Figure 1 legend). Immunoblots of the same samples resolved by SDS-PAGE report on FICD, total BiP and total eIF2α (which also serves as a loading control). Data representative of three independent experiments are shown ( n = 3). ( B ) Activity of an integrated CHOP::GFP UPR reporter in isogenic wildtype and FICD-deficient CHO-K1 cells following transfection with plasmids encoding the indicated FICD derivatives (marked by an mCherry transgene). Shown are the median values ± SD of the GFP fluorescent signal of the mCherry-positive cells from three independent experiments (fold change relative to wildtype cells transfected with control plasmid DNA encoding mCherry only; n = 3). ( C ) As in “B”, but cells were co-transfected with the indicated pairs of plasmids. Data from three independent experiments are shown ( n = 3). ( D ) Bar diagram comparing outgrowth of puromycin-resistant colonies of wildtype and FICD-deficient CHO-K1 cells transduced with retrovirus (with a puromycin resistance maker) expressing a catalytically inactive FICD E234G-H363A or de-AMPylation defective/AMPylation active FICD E234G . Shown are the mean values ± SD of the number of colonies per plate from three replicates ( n = 3). Below is a photograph of the crystal violet stained colonies from the samples described above.
    Figure Legend Snippet: FICD counteracts BiP AMPylation in cells ( A ) Immunoblot of endogenous BiP from CHO-K1 cells resolved by native-PAGE. The cells were transfected with the indicated amount of plasmid DNA encoding wildtype FICD and exposed to cycloheximide (CHX; 100 µg/mL, 3 hours) to promote AMPylated BiP. The AMPylated ‘B’ form of BiP is indicated (as are the other major species, see Figure 1 legend). Immunoblots of the same samples resolved by SDS-PAGE report on FICD, total BiP and total eIF2α (which also serves as a loading control). Data representative of three independent experiments are shown ( n = 3). ( B ) Activity of an integrated CHOP::GFP UPR reporter in isogenic wildtype and FICD-deficient CHO-K1 cells following transfection with plasmids encoding the indicated FICD derivatives (marked by an mCherry transgene). Shown are the median values ± SD of the GFP fluorescent signal of the mCherry-positive cells from three independent experiments (fold change relative to wildtype cells transfected with control plasmid DNA encoding mCherry only; n = 3). ( C ) As in “B”, but cells were co-transfected with the indicated pairs of plasmids. Data from three independent experiments are shown ( n = 3). ( D ) Bar diagram comparing outgrowth of puromycin-resistant colonies of wildtype and FICD-deficient CHO-K1 cells transduced with retrovirus (with a puromycin resistance maker) expressing a catalytically inactive FICD E234G-H363A or de-AMPylation defective/AMPylation active FICD E234G . Shown are the mean values ± SD of the number of colonies per plate from three replicates ( n = 3). Below is a photograph of the crystal violet stained colonies from the samples described above.

    Techniques Used: Clear Native PAGE, Transfection, Plasmid Preparation, Western Blot, SDS Page, Activity Assay, Transduction, Expressing, Staining

    34) Product Images from "ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement"

    Article Title: ZeBRα a universal, multi-fragment DNA-assembly-system with minimal hands-on time requirement

    Journal: Scientific Reports

    doi: 10.1038/s41598-019-39768-0

    Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.
    Figure Legend Snippet: Three or four fragments can efficiently be assembled with PPY-cell extracts, while iVEC/“transformation-cloning” with three fragments is markedly less efficient. ( a ) The assembly of four fragments in a single reaction reduces the number of successful assemblies by a factor of two to ten as compared to the three-fragment-assembly. Cell-extracts were prepared from autoinduced PPY cells and the assemblies were purified prior transformation. ( b ) Assembly of three fragments by iVEC/“transformation-cloning” with NEB 5-alpha resulted in roughly 250 recombinant colonies/µg transformed DNA. A significant number of colonies harboring plasmids with defective inserts (grey bar) and PCR-template carry-over (dotted bar) were present on the plates.

    Techniques Used: Clone Assay, Purification, Transformation Assay, Recombinant, Polymerase Chain Reaction

    Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.
    Figure Legend Snippet: Strategy for SLiCE optimization and evaluation. ( a ) Flow chart of the optimization process for generating a recombinogenic E. coli lysate. The PPY strain is a DH10B-derivative used to prepare the recombinogenic cell lysate and expresses the coding sequences for Redαβγ. The extracts, derived from arabinose autoinduced PPY-cells, were compared to extracts made from non-induced PPY-cells. ( b ) Structure of the examined non-ionic detergents used to prepare the recombinogenic PPY-extracts, CHAPS, Sulfo-Betain (SB-12), n-Octyl-β-D-thioglucopyranosid (OTG), n-Octyl-β-D-glucopyranosid (OG) Dodecyl-β-D-maltosid (DDM). ( c ) PPY-extracts were tested for their recombination capacity by assembling three DNA fragments with overlapping ends, to generate a recombinant plasmid constitutively expressing a blue chromoprotein. To examine the effects detergents had on the transformation, samples were split after the assembly reaction. One part was transformed into NEB 5-alpha unpurified; the other fraction was purified by silica-column chromatography prior to transformation.

    Techniques Used: Flow Cytometry, Derivative Assay, Recombinant, Plasmid Preparation, Expressing, Transformation Assay, Purification, Column Chromatography

    Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.
    Figure Legend Snippet: Comparison of the influence of detergent, autoinduction, post-assembly purification and competency of used bacteria on DNA assembling efficiency. ( a ) In four of the five PPY lysis conditions induction of Redα had moderate effects. Five different detergents were tested on PPY-cells grown with either lactose (Redα un-induced) or arabinose (Redα induced). All assemblies were column-purified before transformation into NEB 5-alpha. Bars indicate standard error of three independent replicates of an assembly reaction in all following graphs. PPY recombinogenic capacity was assessed in three-fragment assemblies. ( b ) Column-purification of the three-fragment-assembly reactions led to markedly increased number of recombinant colonies for all tested detergents. In the case of CHAPS and SB-12, unpurified samples resulted in no colonies. The OTG derived PPY-extract resulted in the highest number of recombinant colonies without purification. All assemblies were arabinose-induced. ( c ) Chemical competency has profound influence on recombination efficiency. OTG prepared PPY-lysate was used in a three-fragment-assembly and transformed into commercial NEB 5-alpha competent E. coli (1 × 10 9 cfu/µg pUC DNA) or the same strain prepared by the Inoue-method 21 (2.3 × 10 6 cfu/µg DNA). ( d ) For convenient readout of the potency of the PPY-extracts PCR-fragments used for the three- and four-way assembly reactions consisted of a blue chromoprotein coding ORF, a kanamycin resistance gene an origin-of-replication (on one fragment for the three-fragment assembly) and a bacterial basal-promoter-fragment. Only successful recombinants could produce blue colonies on kanamycin plates. The PCR-fragments to be assembled had overlapping bases that summed up to about 15 bp overlapping ends.

    Techniques Used: Purification, Lysis, Transformation Assay, Recombinant, Derivative Assay, Polymerase Chain Reaction

    The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.
    Figure Legend Snippet: The recombinogenic capacity of OTG extracts from autoinduced PPY and NEB 5-alpha extracts are equivalent or better than PPY-extracts generated by the original protocol. ( a ) Plasmid map of pT7- Hin dIII- ccdB used to assess three-fragment ZeBRα assemblies. Two Hin dIII and two Bsa I sites flank the toxic-placeholder- ccdB , allowing linearization and removal of ccdB . Unique sites are available on either side of ccdB . Chloramphenicol-acetyl-transferase coding gene ( CmR ), is part of the placeholder cassette and prevents ccdB -loss during plasmid propagation. The hatched region encompasses the fragment removed during cloning. ( b ) Map of the vector pT7-GFP antisense resulting from the three-fragment test-assembly of the pT7- Hin dIII- ccdB as recipient for a GFP-ORF and a bacterial promoter containing PCR-fragment, to evaluate the efficacy of the ZeBRα-procedure. Criss-cross lines mark the fusion-sites of the assembled fragments. ( c ) Comparison of the recombination capacity of extracts prepared with OTG or CelLyticB TM from manually induced and autoinduced (denoted as “auto” in the column) PPY-cells and NEB 5-alpha. The iVEC/“transformation-cloning” of the respective fragments is shown as last column. ( d ) Green fluorescent NEB 5-alpha colonies harboring the constitutively GFP-expressing vector pT7-GFP antisense.

    Techniques Used: Generated, Plasmid Preparation, Chloramphenicol Acetyltransferase Assay, Clone Assay, Polymerase Chain Reaction, Expressing

    Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.
    Figure Legend Snippet: Rendering the CcdB in the placeholder non-toxic increases the number of GFP – background colonies markedly, showing that ccdB is an essential element if working with non-gel purified vector. ( a ) The pT7- Hin dIII-dead- ccdB differs by a four base-pair deletion in the ccdB -coding sequence from it’s predecessor pT7- Hin dIII- ccdB . The dotted lines encompass the region removed during cloning. ( b ) Sequence alignment of the region encompassing the small deletion in the ccdB -ORF, in pT7- Hin dIII-dead- ccdB compared to the region in pT7- Hin dIII- ccdB and the resulting frameshift rendering the ΔCcdB non-toxic for E. coli NEB 5-alpha. The numbers denote bases in the vector. ( c ) The three-fragment assembly as shown in Fig. 6c uses the pT7-HindIII-dead- ccdB vector and OTG-derived PPY-extract to assemble pT7-GFP antisense analogous to the assemblies shown in Fig. 5 . The percentage of GFP + colonies drops from nearly 100% for pT7- Hin dIII- ccdB to 57% for pT7- Hin dIII-dead- ccdB . ( d ) Image of the mixture of GFP + and GFP − resulting from the assembly (100 µl outgrowth medium spread). The red arrow points at a cluster of GFP − colonies representing un-digested vector that would have to be screened for in a non-model assembly.

    Techniques Used: Purification, Plasmid Preparation, Sequencing, Clone Assay, Derivative Assay

    35) Product Images from "Facile Method for the Site-Specific, Covalent Attachment of full-length IgG onto Nanoparticles"

    Article Title: Facile Method for the Site-Specific, Covalent Attachment of full-length IgG onto Nanoparticles

    Journal: Small (Weinheim an der Bergstrasse, Germany)

    doi: 10.1002/smll.201303629

    SDS-PAGE with Coomassie staining confirming the in vivo incorporation of BPA into expressed Protein Z T7 competent E. coli were co-transformed with the pEVOL-pBpf plasmid containing the amber suppressor tRNA/aminoacyl transferase pair and the pTXB1 plasmid, which codes for Protein Z with an amber codon mutation (ProZ F13BPA). Following induction of protein expression, cell lysates, with or without BPA in the media, were evaluated by SDS-PAGE stained with Coomassie (lanes 1 and 2, respectively). Analogous studies were performed with E. coli that express wild-type Protein Z (lane 3) and unmodified T7 competent cells (lane 4).
    Figure Legend Snippet: SDS-PAGE with Coomassie staining confirming the in vivo incorporation of BPA into expressed Protein Z T7 competent E. coli were co-transformed with the pEVOL-pBpf plasmid containing the amber suppressor tRNA/aminoacyl transferase pair and the pTXB1 plasmid, which codes for Protein Z with an amber codon mutation (ProZ F13BPA). Following induction of protein expression, cell lysates, with or without BPA in the media, were evaluated by SDS-PAGE stained with Coomassie (lanes 1 and 2, respectively). Analogous studies were performed with E. coli that express wild-type Protein Z (lane 3) and unmodified T7 competent cells (lane 4).

    Techniques Used: SDS Page, Staining, In Vivo, Transformation Assay, Plasmid Preparation, Mutagenesis, Expressing

    36) Product Images from "Paternal age effects on sperm FOXK1 and KCNA7 methylation and transmission into the next generation"

    Article Title: Paternal age effects on sperm FOXK1 and KCNA7 methylation and transmission into the next generation

    Journal: Human Molecular Genetics

    doi: 10.1093/hmg/ddw328

    Distribution of single sperm (allele) methylation of FOXK1 (left diagram) and KCNA7 (right). Red dots represent sperm samples of older (40–55 years) and blue dots of younger (25–35 years) donors. The FOXK1 assay targets 5 and the KCNA7 assay 12 CpG sites. The Y axis indicates the percentage of reads (individual sperm) with 0, 1, 2, 3, 4 or 5 methylated CpGs for FOXK1 and 0–12 methylated CpGs for KCNA7 , respectively. Methylation measurements were performed using deep bisulfite sequencing. Average methylation values for the measured CpG sites are provided in Supplementary Material, Table S10 .
    Figure Legend Snippet: Distribution of single sperm (allele) methylation of FOXK1 (left diagram) and KCNA7 (right). Red dots represent sperm samples of older (40–55 years) and blue dots of younger (25–35 years) donors. The FOXK1 assay targets 5 and the KCNA7 assay 12 CpG sites. The Y axis indicates the percentage of reads (individual sperm) with 0, 1, 2, 3, 4 or 5 methylated CpGs for FOXK1 and 0–12 methylated CpGs for KCNA7 , respectively. Methylation measurements were performed using deep bisulfite sequencing. Average methylation values for the measured CpG sites are provided in Supplementary Material, Table S10 .

    Techniques Used: Methylation, Methylation Sequencing

    Luciferase activity of pCpGL vector containing either methylated or unmethylated FOXK1 promoter, normalized to activity of an internal control vector (Firefly/Renilla ratio). pCpGL and control vector were co-transfected in a 500:1 ratio in three different cell lines, SH-SY5Y, U2OS, and HELA. Empty vector and non-transfected cells served as negative controls. All measurements were done in duplicates.
    Figure Legend Snippet: Luciferase activity of pCpGL vector containing either methylated or unmethylated FOXK1 promoter, normalized to activity of an internal control vector (Firefly/Renilla ratio). pCpGL and control vector were co-transfected in a 500:1 ratio in three different cell lines, SH-SY5Y, U2OS, and HELA. Empty vector and non-transfected cells served as negative controls. All measurements were done in duplicates.

    Techniques Used: Luciferase, Activity Assay, Plasmid Preparation, Methylation, Transfection

    Correlation between DMPK , FOXK1 , KCNA7 , and NCOR2 methylation and paternal age in sperm cohort 1 (upper panel) and cord blood (lower panel). Each dot represents average methylation of several target CpGs in an individual sperm or cord blood sample, measured by bisulfite pyrosequencing. Regression lines suggest a negative correlation with paternal age.
    Figure Legend Snippet: Correlation between DMPK , FOXK1 , KCNA7 , and NCOR2 methylation and paternal age in sperm cohort 1 (upper panel) and cord blood (lower panel). Each dot represents average methylation of several target CpGs in an individual sperm or cord blood sample, measured by bisulfite pyrosequencing. Regression lines suggest a negative correlation with paternal age.

    Techniques Used: Methylation

    Boxplots showing the distribution of FOXK1 methylation in 74 male ASD patients (red boxes) and 41 age and sex-matched controls (blue boxes) in three different age groups (2–5, 5–10, and 10–20 years). The median is represented by a horizontal black line. The bottom of the box indicates the 25th, the top the 75th percentile. Outliers are shown as open circles.
    Figure Legend Snippet: Boxplots showing the distribution of FOXK1 methylation in 74 male ASD patients (red boxes) and 41 age and sex-matched controls (blue boxes) in three different age groups (2–5, 5–10, and 10–20 years). The median is represented by a horizontal black line. The bottom of the box indicates the 25th, the top the 75th percentile. Outliers are shown as open circles.

    Techniques Used: Methylation

    37) Product Images from "Evaluation of a Plasmodium-Specific Carrier Protein To Enhance Production of Recombinant Pfs25, a Leading Transmission-Blocking Vaccine Candidate"

    Article Title: Evaluation of a Plasmodium-Specific Carrier Protein To Enhance Production of Recombinant Pfs25, a Leading Transmission-Blocking Vaccine Candidate

    Journal: Infection and Immunity

    doi: 10.1128/IAI.00486-17

    Pf MSP8 is expressed during P. falciparum gametocyte development but is absent on the surface of activated macrogametes. (A) Detection of Pf MSP8 expression in fixed and permeabilized P. falciparum gametocytes (stages II to V) by an immunofluorescence assay with rabbit anti-r Pf MSP8 IgG or control IgG followed by FITC-conjugated secondary antibodies. DAPI was used to stain parasite DNA. (B) Analysis of Pf MSP8 expression on activated, live P. falciparum macrogametes by an immunofluorescence assay, as described above, with rabbit anti-r Pf MSP8 IgG. Samples were costained with MAb 4B7, which is specific for Pf s25 (MAb 4B7), followed by TRITC-conjugated secondary IgG. DIC, differential interference contrast.
    Figure Legend Snippet: Pf MSP8 is expressed during P. falciparum gametocyte development but is absent on the surface of activated macrogametes. (A) Detection of Pf MSP8 expression in fixed and permeabilized P. falciparum gametocytes (stages II to V) by an immunofluorescence assay with rabbit anti-r Pf MSP8 IgG or control IgG followed by FITC-conjugated secondary antibodies. DAPI was used to stain parasite DNA. (B) Analysis of Pf MSP8 expression on activated, live P. falciparum macrogametes by an immunofluorescence assay, as described above, with rabbit anti-r Pf MSP8 IgG. Samples were costained with MAb 4B7, which is specific for Pf s25 (MAb 4B7), followed by TRITC-conjugated secondary IgG. DIC, differential interference contrast.

    Techniques Used: Expressing, Immunofluorescence, Staining

    Purification of the r Pf s25-based vaccine. (A and B) Purified r Pf s25 was analyzed by SDS-PAGE (12% gel) under both reducing (R) and nonreducing (NR) conditions, followed by Coomassie blue staining (3 μg/lane) (A) or immunoblot analysis (0.2 μg/lane) (B) using anti- Pf s25 MAb 4B7. (C to E) Purified r Pfs 25/8(CΔS) was analyzed by SDS-PAGE (10% gel) under both reducing and nonreducing conditions, followed by Coomassie blue staining (3 μg/lane) (C) or immunoblot analysis (0.4 μg/lane) using anti- Pf s25 MAb 4B7 (D) or rabbit anti- Pf MSP8 (E).
    Figure Legend Snippet: Purification of the r Pf s25-based vaccine. (A and B) Purified r Pf s25 was analyzed by SDS-PAGE (12% gel) under both reducing (R) and nonreducing (NR) conditions, followed by Coomassie blue staining (3 μg/lane) (A) or immunoblot analysis (0.2 μg/lane) (B) using anti- Pf s25 MAb 4B7. (C to E) Purified r Pfs 25/8(CΔS) was analyzed by SDS-PAGE (10% gel) under both reducing and nonreducing conditions, followed by Coomassie blue staining (3 μg/lane) (C) or immunoblot analysis (0.4 μg/lane) using anti- Pf s25 MAb 4B7 (D) or rabbit anti- Pf MSP8 (E).

    Techniques Used: Purification, SDS Page, Staining

    Immunization with r Pf s25 or r Pf s25/8(CΔS) elicits high titers of Pf s25-specific antibodies. New Zealand White rabbits were immunized three times with r Pf s25 ( n = 4) (black bars), r Pf s25/8(CΔS) ( n = 4) (white bars), antigens formulated with Alhydrogel as an adjuvant, or the adjuvant alone. Sera collected 2 weeks following each immunization were analyzed for antigen-specific IgG titers (means ± standard deviations) by an ELISA using plates coated with r Pf s25, r Pf s25/8(CΔS), or r Pf MSP8 antigens. The signal using adjuvant control sera was subtracted as the background. ns, nonsignificant ( P > 0.05).
    Figure Legend Snippet: Immunization with r Pf s25 or r Pf s25/8(CΔS) elicits high titers of Pf s25-specific antibodies. New Zealand White rabbits were immunized three times with r Pf s25 ( n = 4) (black bars), r Pf s25/8(CΔS) ( n = 4) (white bars), antigens formulated with Alhydrogel as an adjuvant, or the adjuvant alone. Sera collected 2 weeks following each immunization were analyzed for antigen-specific IgG titers (means ± standard deviations) by an ELISA using plates coated with r Pf s25, r Pf s25/8(CΔS), or r Pf MSP8 antigens. The signal using adjuvant control sera was subtracted as the background. ns, nonsignificant ( P > 0.05).

    Techniques Used: Enzyme-linked Immunosorbent Assay

    Expression of chimeric r Pf s25/8(CΔS) and unfused r Pf s25. (A) Schematic depiction of expression constructs for the production of r Pf s25/8(CΔS) and r Pf s25. Expression plasmids for chimeric r Pf s25/8(CΔS) or unfused r Pf s25 were transformed into E. coli SHuffle T7 Express lysY cells. (B and C) r Pf s25/8(CΔS) lysates harvested before ( T 0 ) or 3 h after ( T 3 ) induction were separated by SDS-PAGE (10% gel) under reducing conditions, followed by Coomassie blue staining (B) or immunoblot analysis (C) using rabbit-anti-r Pf MSP8 IgG. The asterisk highlights r Pf s25/8(CΔS) at the predicted size. (D and E) The expression of unfused r Pf s25 was assessed as described above, on 12% polyacrylamide gels under reducing conditions, followed by Coomassie blue staining (D) or immunoblot analysis (E) using an anti-His MAb. The asterisk highlights r Pf s25 at the predicted size.
    Figure Legend Snippet: Expression of chimeric r Pf s25/8(CΔS) and unfused r Pf s25. (A) Schematic depiction of expression constructs for the production of r Pf s25/8(CΔS) and r Pf s25. Expression plasmids for chimeric r Pf s25/8(CΔS) or unfused r Pf s25 were transformed into E. coli SHuffle T7 Express lysY cells. (B and C) r Pf s25/8(CΔS) lysates harvested before ( T 0 ) or 3 h after ( T 3 ) induction were separated by SDS-PAGE (10% gel) under reducing conditions, followed by Coomassie blue staining (B) or immunoblot analysis (C) using rabbit-anti-r Pf MSP8 IgG. The asterisk highlights r Pf s25/8(CΔS) at the predicted size. (D and E) The expression of unfused r Pf s25 was assessed as described above, on 12% polyacrylamide gels under reducing conditions, followed by Coomassie blue staining (D) or immunoblot analysis (E) using an anti-His MAb. The asterisk highlights r Pf s25 at the predicted size.

    Techniques Used: Expressing, Construct, Transformation Assay, SDS Page, Staining

    38) Product Images from "Divergent roles of β‐ and γ‐actin isoforms during spread of vaccinia virus, et al. Divergent roles of β‐ and γ‐actin isoforms during spread of vaccinia virus"

    Article Title: Divergent roles of β‐ and γ‐actin isoforms during spread of vaccinia virus, et al. Divergent roles of β‐ and γ‐actin isoforms during spread of vaccinia virus

    Journal: Cytoskeleton (Hoboken, N.j.)

    doi: 10.1002/cm.21356

    GST pull‐down assays to determine binding preferences for β‐or γ‐CYA. Immunoblots of cell lysate bound to GST‐VCA or GST‐VCA RA/RA on glutathione‐containing Sepharose beads. Immunoblots were probed with either anti‐actin and anti‐GST antibodies (a) or antibodies specific to β‐CYA or γ‐CYA (b).
    Figure Legend Snippet: GST pull‐down assays to determine binding preferences for β‐or γ‐CYA. Immunoblots of cell lysate bound to GST‐VCA or GST‐VCA RA/RA on glutathione‐containing Sepharose beads. Immunoblots were probed with either anti‐actin and anti‐GST antibodies (a) or antibodies specific to β‐CYA or γ‐CYA (b).

    Techniques Used: Binding Assay, Western Blot

    39) Product Images from "Drosophila PATJ supports adherens junction stability by modulating Myosin light chain activity"

    Article Title: Drosophila PATJ supports adherens junction stability by modulating Myosin light chain activity

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.201206064

    PATJ enhances Myosin phosphorylation by inhibiting Myosin phosphatase. (A) Endogenous MBS coimmunoprecipitates with endogenous PATJ from embryonic lysates. The figure represents blots from different gels with 5% (PATJ blot) and 95% of the immunoprecipitation (IP) loaded. (B) MBS-myc coimmunoprecipitates with PATJ-GFP from lysates of transfected S2R+ cells. (C) PATJ binds directly to MBS. GST-PATJ and MBP-MBS were expressed in E. coli and purified. GST alone served as negative control. Inputs are shown on Coomassie-stained gel. (D and E) Localization of endogenous MBS during cellularization (D) and in mature epithelial cells of the epidermis (E; junctional MBS is marked by arrows). (F) Overexpression of PATJ-HA in stripes using an engrailed::GAL4 driver line stabilizes/recruits Sqh-GFP in the embryonic epidermis. Sqh-GFP was expressed under its endogenous promoter ( Royou et al., 2002 ). Here, we used an insertion on the third chromosome, resulting in a rather low protein expression. Similar results were obtained using a ubiquitous promoter (polyubiquitin; not depicted). (G) Segmental overexpression of PATJ-HA results in an increased phosphorylation of Sqh in embryos heterozygous for mbs T541 . (H) Follicle cell clones for PATJ Δ1 showing decreased phosphorylation of Sqh at the apical junction (arrows). PATJ mutant clones are marked by the absence of GFP. UAS, upstream activation sequence. Bars: (D–F) 5 µm; (G and H) 10 µm.
    Figure Legend Snippet: PATJ enhances Myosin phosphorylation by inhibiting Myosin phosphatase. (A) Endogenous MBS coimmunoprecipitates with endogenous PATJ from embryonic lysates. The figure represents blots from different gels with 5% (PATJ blot) and 95% of the immunoprecipitation (IP) loaded. (B) MBS-myc coimmunoprecipitates with PATJ-GFP from lysates of transfected S2R+ cells. (C) PATJ binds directly to MBS. GST-PATJ and MBP-MBS were expressed in E. coli and purified. GST alone served as negative control. Inputs are shown on Coomassie-stained gel. (D and E) Localization of endogenous MBS during cellularization (D) and in mature epithelial cells of the epidermis (E; junctional MBS is marked by arrows). (F) Overexpression of PATJ-HA in stripes using an engrailed::GAL4 driver line stabilizes/recruits Sqh-GFP in the embryonic epidermis. Sqh-GFP was expressed under its endogenous promoter ( Royou et al., 2002 ). Here, we used an insertion on the third chromosome, resulting in a rather low protein expression. Similar results were obtained using a ubiquitous promoter (polyubiquitin; not depicted). (G) Segmental overexpression of PATJ-HA results in an increased phosphorylation of Sqh in embryos heterozygous for mbs T541 . (H) Follicle cell clones for PATJ Δ1 showing decreased phosphorylation of Sqh at the apical junction (arrows). PATJ mutant clones are marked by the absence of GFP. UAS, upstream activation sequence. Bars: (D–F) 5 µm; (G and H) 10 µm.

    Techniques Used: Immunoprecipitation, Transfection, Purification, Negative Control, Staining, Over Expression, Expressing, Clone Assay, Mutagenesis, Activation Assay, Sequencing

    PATJ associates with Myosin in vitro and in vivo. (A) Segmental overexpression of PATJ-HA stabilizes a Sqh protein, which cannot be phosphorylated, at the AJ (SqhAA-GFP). (B) Endogenous Zip can be copurified together with PATJ from embryonic lysates. Both blots are from the same gel. (C) Coimmunoprecipitation of PATJ-GFP and Sqh-myc from transfected S2R+ cells. (D) GST-PATJ directly associates with MBP-Sqh in a MBP pull-down assay. (E) Overexpression of wild-type Sqh but not of a phosphorylation-deficient version (SqhAA) can partly rescue PATJ mutant embryonic lethality. Lethality data were averaged from three different experiments with 100 embryos each. IP, immunoprecipitation; UAS, upstream activation sequence. Error bars show SDs. Bar, 10 µm.
    Figure Legend Snippet: PATJ associates with Myosin in vitro and in vivo. (A) Segmental overexpression of PATJ-HA stabilizes a Sqh protein, which cannot be phosphorylated, at the AJ (SqhAA-GFP). (B) Endogenous Zip can be copurified together with PATJ from embryonic lysates. Both blots are from the same gel. (C) Coimmunoprecipitation of PATJ-GFP and Sqh-myc from transfected S2R+ cells. (D) GST-PATJ directly associates with MBP-Sqh in a MBP pull-down assay. (E) Overexpression of wild-type Sqh but not of a phosphorylation-deficient version (SqhAA) can partly rescue PATJ mutant embryonic lethality. Lethality data were averaged from three different experiments with 100 embryos each. IP, immunoprecipitation; UAS, upstream activation sequence. Error bars show SDs. Bar, 10 µm.

    Techniques Used: In Vitro, In Vivo, Over Expression, Transfection, Pull Down Assay, Mutagenesis, Immunoprecipitation, Activation Assay, Sequencing

    40) Product Images from "Overexpression of AtBMI1C, a Polycomb Group Protein Gene, Accelerates Flowering in Arabidopsis"

    Article Title: Overexpression of AtBMI1C, a Polycomb Group Protein Gene, Accelerates Flowering in Arabidopsis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0021364

    ChIP analysis of H3K4me3 and H3K27me3 at FLC chromatin. (A) H3K4 trimethylation levels at FLC chromatin between wild type and an ATBMI1C -overexpressing line harboring p35S::AtBMI1C-YFP . (B) H3K27 trimethylation levels at FLC chromatin between wild type and AtBMI1C -overexpressing lines harboring p35S::AtBMI1C-YFP . Anti-H3K4me3 or -H3K27me3 antibodies were used for the assay. The locations of the primer pairs used to amplify FLC fragments across the region are indicated in (C). The values are the mean ± SD of three independent experiments.
    Figure Legend Snippet: ChIP analysis of H3K4me3 and H3K27me3 at FLC chromatin. (A) H3K4 trimethylation levels at FLC chromatin between wild type and an ATBMI1C -overexpressing line harboring p35S::AtBMI1C-YFP . (B) H3K27 trimethylation levels at FLC chromatin between wild type and AtBMI1C -overexpressing lines harboring p35S::AtBMI1C-YFP . Anti-H3K4me3 or -H3K27me3 antibodies were used for the assay. The locations of the primer pairs used to amplify FLC fragments across the region are indicated in (C). The values are the mean ± SD of three independent experiments.

    Techniques Used: Chromatin Immunoprecipitation

    Nuclear localization and expression pattern of AtBMI1C . (A) Images of roots from transgenic seedlings harboring YFP driven by the CaMV35S promoter. (B) Images of roots from transgenic seedlings harboring YFP-tagged AtBMI1C driven by the CaMV35S promoter. Scale bar (red), 100 µm. (C) Images of petals from transgenic plants harboring YFP-tagged AtBMI1C driven by the CaMV35S promoter. Scale bar (red), 50 µm. (D) The expression pattern of AtBMI1C in seedlings and different organs was analyzed by semiquantitative RT-PCR.
    Figure Legend Snippet: Nuclear localization and expression pattern of AtBMI1C . (A) Images of roots from transgenic seedlings harboring YFP driven by the CaMV35S promoter. (B) Images of roots from transgenic seedlings harboring YFP-tagged AtBMI1C driven by the CaMV35S promoter. Scale bar (red), 100 µm. (C) Images of petals from transgenic plants harboring YFP-tagged AtBMI1C driven by the CaMV35S promoter. Scale bar (red), 50 µm. (D) The expression pattern of AtBMI1C in seedlings and different organs was analyzed by semiquantitative RT-PCR.

    Techniques Used: Expressing, Transgenic Assay, Reverse Transcription Polymerase Chain Reaction

    Expression of FLC and FT in AtBMI1C -overexpressing lines. (A) Expression of FLC in AtBMI1C -overexpressing lines harboring p35S::ATBMI1C-YFP as determined by quantitative real-time RT-PCR. (B) FT expression in AtBMI1C -overexpressing lines harboring p35S::AtBMI1C-YFP as determined by quantitative real-time RT-PCR. (C) FLC expression in transgenic lines harboring pAP1::AtBMI1C-GFP as determined by quantitative real-time RT-PCR. (D) FT expression in transgenic lines harboring pAP1::AtBMI1C-GFP as determined by quantitative RT-PCR. Total RNA was isolated from ten-day-old transgenic or wild-type seedlings. FLC or FT expression was measured by quantitative real-time RT-PCR using ACTIN2/7 as an endogenous control. The values are the mean ± SD of three independent experiments.
    Figure Legend Snippet: Expression of FLC and FT in AtBMI1C -overexpressing lines. (A) Expression of FLC in AtBMI1C -overexpressing lines harboring p35S::ATBMI1C-YFP as determined by quantitative real-time RT-PCR. (B) FT expression in AtBMI1C -overexpressing lines harboring p35S::AtBMI1C-YFP as determined by quantitative real-time RT-PCR. (C) FLC expression in transgenic lines harboring pAP1::AtBMI1C-GFP as determined by quantitative real-time RT-PCR. (D) FT expression in transgenic lines harboring pAP1::AtBMI1C-GFP as determined by quantitative RT-PCR. Total RNA was isolated from ten-day-old transgenic or wild-type seedlings. FLC or FT expression was measured by quantitative real-time RT-PCR using ACTIN2/7 as an endogenous control. The values are the mean ± SD of three independent experiments.

    Techniques Used: Expressing, Quantitative RT-PCR, Transgenic Assay, Isolation

    AtBMI1C overexpression driven by the 35S promoter accelerates flowering in Arabidopsis . (A) Morphology of AtBMI1C -overexpressing plants carrying p35S::AtBMI1C-YFP grown under LD conditions for 27 days. The plants flowered earlier than wild type. A total of 30 out of 198 independent T1 lines showed an early flowering phenotype and elevated AtBMI1C expression. A number of independent transgenic lines were chosen for the following investigation. Scale bar, 2 cm. (B) AtBMI1C expression in transgenic lines carrying p35S::AtBMI1C-YFP . AtBMI1C expression was measured by semiquantitative RT-PCR. ACTIN2/7 was used as an internal control. (C) and (D) Determination of flowering time in AtBMI1C -overexpressing plants containing p35S::AtBMI1C-YFP grown under LD and SD conditions using two AtBMI1C overexpressor lines as representatives. The number of rosette leaves was determined after bolting. (E) Vegetative phase transition in AtBMI1C -overexpressing plants containing p35S::AtBMI1C-YFP grown under LD conditions. Juvenile, adult, rosette, and cauline leaves were counted after flowering. Juvenile and adult leaves were distinguished based on the presence of trichomes on their abaxial surface.
    Figure Legend Snippet: AtBMI1C overexpression driven by the 35S promoter accelerates flowering in Arabidopsis . (A) Morphology of AtBMI1C -overexpressing plants carrying p35S::AtBMI1C-YFP grown under LD conditions for 27 days. The plants flowered earlier than wild type. A total of 30 out of 198 independent T1 lines showed an early flowering phenotype and elevated AtBMI1C expression. A number of independent transgenic lines were chosen for the following investigation. Scale bar, 2 cm. (B) AtBMI1C expression in transgenic lines carrying p35S::AtBMI1C-YFP . AtBMI1C expression was measured by semiquantitative RT-PCR. ACTIN2/7 was used as an internal control. (C) and (D) Determination of flowering time in AtBMI1C -overexpressing plants containing p35S::AtBMI1C-YFP grown under LD and SD conditions using two AtBMI1C overexpressor lines as representatives. The number of rosette leaves was determined after bolting. (E) Vegetative phase transition in AtBMI1C -overexpressing plants containing p35S::AtBMI1C-YFP grown under LD conditions. Juvenile, adult, rosette, and cauline leaves were counted after flowering. Juvenile and adult leaves were distinguished based on the presence of trichomes on their abaxial surface.

    Techniques Used: Over Expression, Expressing, Transgenic Assay, Reverse Transcription Polymerase Chain Reaction, Sublimation

    Phylogenetic relationship and conservation of AtBMI1s. (A) Phylogenetic tree based on the full-length sequence of AtBMI1 from Arabidopsis and its human and fly homologs. (B) Tree showing the phylogenetic relationships among RING domain-containing AtBMI1s from Arabidopsis and their human and fly homologs. (C) Primary sequence alignment of the RING domain from AtBMI1 and its human and fly homologs. The GenBank accessions of the sequences are: NM_128610 (At2g30580) for AtBMI1A, NM_202046 (At1g06770) for AtBMI1B, AY099845 (At3g23060) for AtBMI1C from Arabidopsis thaliana , NM_002931 for hRING1, NM_007212 for hRING2 from Homo sapiens , and NM_079001 for Psc from Drosophila melanogaster (dPsc).
    Figure Legend Snippet: Phylogenetic relationship and conservation of AtBMI1s. (A) Phylogenetic tree based on the full-length sequence of AtBMI1 from Arabidopsis and its human and fly homologs. (B) Tree showing the phylogenetic relationships among RING domain-containing AtBMI1s from Arabidopsis and their human and fly homologs. (C) Primary sequence alignment of the RING domain from AtBMI1 and its human and fly homologs. The GenBank accessions of the sequences are: NM_128610 (At2g30580) for AtBMI1A, NM_202046 (At1g06770) for AtBMI1B, AY099845 (At3g23060) for AtBMI1C from Arabidopsis thaliana , NM_002931 for hRING1, NM_007212 for hRING2 from Homo sapiens , and NM_079001 for Psc from Drosophila melanogaster (dPsc).

    Techniques Used: Sequencing

    Tissue-specific AtBMI1C overexpression promotes flowering in Arabidopsis . (A) Morphology of transgenic plants carrying pAP1::AtBMI1C-GFP grown under LD conditions for 28 days. The plants showed an early flowering phenotype compared with wild type. A total of 18 out of 72 independent T1 lines showed an early flowering phenotype. A few lines were chosen for the following experiments. (B) and (C) Determination of flowering time in transgenic plants containing pAP1::AtBMI1C-GFP grown under LD and SD conditions using three AtBMI1C transgenic lines as representatives. The number of rosette leaves was determined after bolting. (D) Vegetative phase transition in transgenic plants containing pAP1::AtBMI1C-GFP grown under LD conditions. Juvenile, adult, rosette, and cauline leaves were counted after flowering. Juvenile and adult leaves were distinguished based on the presence of trichomes on their abaxial surface. (E) AtBMI1C expression in transgenic lines carrying pAP1::AtBMI1C-YFP . Total RNA was extracted from leaves of pAP1::AtBMI1C-GFP and wild-type plants. AtBMI1C expression was measured by semiquantitative RT-PCR using ACTIN2/7 as an internal control. (F) Morphology of transgenic plants carrying pKNAT1::AtBMI1C-GFP grown under LD conditions for 28 days. The plants showed an early flowering phenotype compared with wild type. A total of 20 out of 108 independent T1 lines showed an early flowering phenotype. (G) Determination of flowering time in transgenic plants containing pKNAT1::AtBMI1C-GFP grown under LD conditions. The number of rosette leaves was determined after bolting. (H) Morphology of transgenic plants carrying pSUC2::AtBMI1C-GFP grown under LD conditions for 28 days. The plants showed an early flowering phenotype compared with wild type. A total of 24 out of 108 independent T1 lines showed an early flowering phenotype. (I) Determination of flowering time in transgenic plants containing pSUC2::AtBMI1C-GFP grown under LD conditions. The number of rosette leaves was determined after bolting.
    Figure Legend Snippet: Tissue-specific AtBMI1C overexpression promotes flowering in Arabidopsis . (A) Morphology of transgenic plants carrying pAP1::AtBMI1C-GFP grown under LD conditions for 28 days. The plants showed an early flowering phenotype compared with wild type. A total of 18 out of 72 independent T1 lines showed an early flowering phenotype. A few lines were chosen for the following experiments. (B) and (C) Determination of flowering time in transgenic plants containing pAP1::AtBMI1C-GFP grown under LD and SD conditions using three AtBMI1C transgenic lines as representatives. The number of rosette leaves was determined after bolting. (D) Vegetative phase transition in transgenic plants containing pAP1::AtBMI1C-GFP grown under LD conditions. Juvenile, adult, rosette, and cauline leaves were counted after flowering. Juvenile and adult leaves were distinguished based on the presence of trichomes on their abaxial surface. (E) AtBMI1C expression in transgenic lines carrying pAP1::AtBMI1C-YFP . Total RNA was extracted from leaves of pAP1::AtBMI1C-GFP and wild-type plants. AtBMI1C expression was measured by semiquantitative RT-PCR using ACTIN2/7 as an internal control. (F) Morphology of transgenic plants carrying pKNAT1::AtBMI1C-GFP grown under LD conditions for 28 days. The plants showed an early flowering phenotype compared with wild type. A total of 20 out of 108 independent T1 lines showed an early flowering phenotype. (G) Determination of flowering time in transgenic plants containing pKNAT1::AtBMI1C-GFP grown under LD conditions. The number of rosette leaves was determined after bolting. (H) Morphology of transgenic plants carrying pSUC2::AtBMI1C-GFP grown under LD conditions for 28 days. The plants showed an early flowering phenotype compared with wild type. A total of 24 out of 108 independent T1 lines showed an early flowering phenotype. (I) Determination of flowering time in transgenic plants containing pSUC2::AtBMI1C-GFP grown under LD conditions. The number of rosette leaves was determined after bolting.

    Techniques Used: Over Expression, Transgenic Assay, Sublimation, Expressing, Reverse Transcription Polymerase Chain Reaction

    Physical interactions between AtBMI1C and AtRING1A/B, and the detection of H2A monoubiquitination activity. (A) Yeast two-hybrid assay. Positive control: pGADT7-T + pGBKT7-53 (encoding fusions between the GAL4 DNA-BD and AD and murine p53 and SV40 large T-antigen, respectively). Negative control: pGADT7-T + pGBKT7-Lam (encoding a fusion of the DNA-BD with human lamin C; control for interactions between an unrelated protein and either the pGADT7-T control or AD/library plasmid). The indicated combinations of plasmids were co-transformed into the yeast reporter strain, and the interactions of AtBMI1C with AtRINGs were assessed by growth on plates lacking Leu, Trp, His, and adenine. (B) The interactions between AtBMI1C and AtRING1A/B were quantitatively evaluated based on the level of β-galactosidase activity. (C) Pull-down assay. Total protein was extracted from 2 g of eleven-day-old Myc- RING1A/ring1 or Myc- RING1B/ring1 plants, respectively. Each protein extract was divided in half and incubated with MBP- or MBP-GST-coated beads. The pulled down fractions were analyzed by Western blotting. (D) Western blot analysis of histone extracts of WT and 35S::BMI3-YFP using anti-ubiquitin and -H3 antibodies, respectively. Molecular weight (MW) markers (in kDa), monoubiquitinated H2B (uH2B), and monoubiquitinated H2A (uH2A) are indicated. Asterisks indicate cross-reacting bands.
    Figure Legend Snippet: Physical interactions between AtBMI1C and AtRING1A/B, and the detection of H2A monoubiquitination activity. (A) Yeast two-hybrid assay. Positive control: pGADT7-T + pGBKT7-53 (encoding fusions between the GAL4 DNA-BD and AD and murine p53 and SV40 large T-antigen, respectively). Negative control: pGADT7-T + pGBKT7-Lam (encoding a fusion of the DNA-BD with human lamin C; control for interactions between an unrelated protein and either the pGADT7-T control or AD/library plasmid). The indicated combinations of plasmids were co-transformed into the yeast reporter strain, and the interactions of AtBMI1C with AtRINGs were assessed by growth on plates lacking Leu, Trp, His, and adenine. (B) The interactions between AtBMI1C and AtRING1A/B were quantitatively evaluated based on the level of β-galactosidase activity. (C) Pull-down assay. Total protein was extracted from 2 g of eleven-day-old Myc- RING1A/ring1 or Myc- RING1B/ring1 plants, respectively. Each protein extract was divided in half and incubated with MBP- or MBP-GST-coated beads. The pulled down fractions were analyzed by Western blotting. (D) Western blot analysis of histone extracts of WT and 35S::BMI3-YFP using anti-ubiquitin and -H3 antibodies, respectively. Molecular weight (MW) markers (in kDa), monoubiquitinated H2B (uH2B), and monoubiquitinated H2A (uH2A) are indicated. Asterisks indicate cross-reacting bands.

    Techniques Used: Activity Assay, Y2H Assay, Positive Control, Negative Control, Laser Capture Microdissection, Plasmid Preparation, Transformation Assay, Pull Down Assay, Incubation, Western Blot, Molecular Weight

    Identification of the AtBMI1C mutant and characterization of artificial microRNAi lines. (A) Genomic architecture of AtBMI1C and position of the mutation in atbmi1c-1 . The 5′ or 3′ UTR is represented by a gray bar. Exons are represented by black bars. Introns are represented by black lines. The T-DNA insertion in atbmi1c-1 (SALK_148143) is located in the 5′ UTR of AtBMI1C . Scale bar, 500 bp. (B) Detection of AtBMI1C mRNA in a homozygous atbmi1c-1 T-DNA insertion line by semiquantitative RT-PCR. Total RNA was extracted from the inflorescences of homozygous atbmi1c and wild-type plants. Semiquantitative RT-PCR was performed to amplify the full-length transcript using ACTIN2/7 as an endogenous control. (C) Characterization of AtBMI1C mRNA abundance in AtBMI1C-Rs. Total RNA was extracted from the inflorescences of AtBMI1C-Rs and wild-type plants. Semiquantitative RT-PCR was conducted to amplify the full-length transcript using ACTIN2/7 as an endogenous control. (D) Morphology of the AtBMI1C-Rs, in which AtBMI1C was down-regulated, compared to wild type and AtBMI1C-R12, an amiRNAi line in which the expression of AtBMI1C was almost the same as in wild type. (E) Flowering time in the AtBMI1C-Rs was the same as in wild type. Plants were grown under LD conditions. The number of rosette leaves was determined after bolting.
    Figure Legend Snippet: Identification of the AtBMI1C mutant and characterization of artificial microRNAi lines. (A) Genomic architecture of AtBMI1C and position of the mutation in atbmi1c-1 . The 5′ or 3′ UTR is represented by a gray bar. Exons are represented by black bars. Introns are represented by black lines. The T-DNA insertion in atbmi1c-1 (SALK_148143) is located in the 5′ UTR of AtBMI1C . Scale bar, 500 bp. (B) Detection of AtBMI1C mRNA in a homozygous atbmi1c-1 T-DNA insertion line by semiquantitative RT-PCR. Total RNA was extracted from the inflorescences of homozygous atbmi1c and wild-type plants. Semiquantitative RT-PCR was performed to amplify the full-length transcript using ACTIN2/7 as an endogenous control. (C) Characterization of AtBMI1C mRNA abundance in AtBMI1C-Rs. Total RNA was extracted from the inflorescences of AtBMI1C-Rs and wild-type plants. Semiquantitative RT-PCR was conducted to amplify the full-length transcript using ACTIN2/7 as an endogenous control. (D) Morphology of the AtBMI1C-Rs, in which AtBMI1C was down-regulated, compared to wild type and AtBMI1C-R12, an amiRNAi line in which the expression of AtBMI1C was almost the same as in wild type. (E) Flowering time in the AtBMI1C-Rs was the same as in wild type. Plants were grown under LD conditions. The number of rosette leaves was determined after bolting.

    Techniques Used: Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Expressing

    Related Articles

    Clone Assay:

    Article Title: Comparison of periplasmic and intracellular expression of Arabidopsis thionin proproteins in E. coli
    Article Snippet: .. We therefore cloned the expression plasmids for all four fusion proteins into the SHuffle strain C3030 (New England Biolabs) in which the lethal phenotype of lacking the gor and trxB reductases is suppressed by a mutation in the peroxidase ahpC (Faulkner et al. ) thus providing an oxidising environment in the cytoplasm. .. Additionally, expression of periplasmic disulfide bond isomerase (DsbC) in the cytoplasm of these strains is supposed to enhance proper disulfide bond formation (Maskos et al. ).

    Selection:

    Article Title: The crystal structure of SnTox3 from the necrotrophic fungus Parastagonospora nodorum reveals a unique effector fold and insights into Kex2 protease processing of fungal effectors
    Article Snippet: .. For recombinant expression, SHuffle® T7 Express lysY competent E. coli (NEB, C3030J) were cultured at 30°C in Terrific Broth media with appropriate antibiotics for plasmid selection. .. Vector construction The five effectors used in this study, SnTox3 and SnToxA from P. nodorum , and SIX1, SIX4 and SIX6 from Fusarium oxysporum f. sp. lycopersici , including their putative pro-domains, were codon-optimised for expression in E. coli (SnTox321-230 , SnToxA17-178 , FolSIX122-284 , FolSIX418-242 and FolSIX617-225 ) and were introduced into either the pET His6 Sumo TEV LIC cloning vector (2S-T; Addgene #29711) or the modified, Golden Gate-compatible, pOPIN expression vector.

    Mutagenesis:

    Article Title: Comparison of periplasmic and intracellular expression of Arabidopsis thionin proproteins in E. coli
    Article Snippet: .. We therefore cloned the expression plasmids for all four fusion proteins into the SHuffle strain C3030 (New England Biolabs) in which the lethal phenotype of lacking the gor and trxB reductases is suppressed by a mutation in the peroxidase ahpC (Faulkner et al. ) thus providing an oxidising environment in the cytoplasm. .. Additionally, expression of periplasmic disulfide bond isomerase (DsbC) in the cytoplasm of these strains is supposed to enhance proper disulfide bond formation (Maskos et al. ).

    Construct:

    Article Title: Evaluation of a Plasmodium-Specific Carrier Protein To Enhance Production of Recombinant Pfs25, a Leading Transmission-Blocking Vaccine Candidate
    Article Snippet: .. The resulting construct, pET28a- Pf MSP1/8(CΔS), was sequence verified and transformed into competent Escherichia coli SHuffle T7 Express lysY cells (New England BioLabs, Ipswich, MA). .. The expression and purification of r Pf MSP1/8(CΔS) were performed according to protocols reported previously for unmodified r Pf MSP1/8, at a 5-liter scale, using a BioFlo115 benchtop bioreactor (New Brunswick Scientific, Edison, NJ) with nickel chelate affinity chromatography conducted under nondenaturing conditions ( ).

    Article Title: Evaluation of a Plasmodium-Specific Carrier Protein To Enhance Production of Recombinant Pfs25, a Leading Transmission-Blocking Vaccine Candidate
    Article Snippet: .. The r Pf s25 expression construct was transformed into SHuffle T7 Express lysY competent E. coli cells (New England BioLabs). .. For expression, 3-liter bacterial cultures were grown by using a BioFlo115 benchtop bioreactor (New Brunswick Scientific).

    Purification:

    Article Title: Evaluation of a Plasmodium-Specific Carrier Protein To Enhance Production of Recombinant Pfs25, a Leading Transmission-Blocking Vaccine Candidate
    Article Snippet: .. The sequence-verified plasmid was transformed into competent E. coli SHuffle T7 Express lysY cells (New England BioLabs) for expression, and nonfused r Pf MSP8(CΔS) was purified by nickel chelate affinity chromatography and quantified by a BCA protein assay as previously described ( ). .. The final product was assessed for purity by SDS-PAGE on 10% polyacrylamide gels under reducing and nonreducing conditions, followed by Coomassie blue staining or an immunoblot assay using a His tag-specific MAb (0.04 μg/ml; EMD Millipore, Billerica, MA) as described above.

    Produced:

    Article Title: Comparison of periplasmic and intracellular expression of Arabidopsis thionin proproteins in E. coli
    Article Snippet: .. The amount of fusion protein that could be produced from the SHuffle strain C3030 is shown in Table and was higher than obtained with Rosetta(DE3)pLysS. .. Western blotting of the purified fusion proteins (Fig. ) showed less contaminating proteins than with the Rosetta(DE3)pLysS strain (Supplementary Fig. 6).

    Affinity Chromatography:

    Article Title: Evaluation of a Plasmodium-Specific Carrier Protein To Enhance Production of Recombinant Pfs25, a Leading Transmission-Blocking Vaccine Candidate
    Article Snippet: .. The sequence-verified plasmid was transformed into competent E. coli SHuffle T7 Express lysY cells (New England BioLabs) for expression, and nonfused r Pf MSP8(CΔS) was purified by nickel chelate affinity chromatography and quantified by a BCA protein assay as previously described ( ). .. The final product was assessed for purity by SDS-PAGE on 10% polyacrylamide gels under reducing and nonreducing conditions, followed by Coomassie blue staining or an immunoblot assay using a His tag-specific MAb (0.04 μg/ml; EMD Millipore, Billerica, MA) as described above.

    Cell Culture:

    Article Title: The crystal structure of SnTox3 from the necrotrophic fungus Parastagonospora nodorum reveals a unique effector fold and insights into Kex2 protease processing of fungal effectors
    Article Snippet: .. For recombinant expression, SHuffle® T7 Express lysY competent E. coli (NEB, C3030J) were cultured at 30°C in Terrific Broth media with appropriate antibiotics for plasmid selection. .. Vector construction The five effectors used in this study, SnTox3 and SnToxA from P. nodorum , and SIX1, SIX4 and SIX6 from Fusarium oxysporum f. sp. lycopersici , including their putative pro-domains, were codon-optimised for expression in E. coli (SnTox321-230 , SnToxA17-178 , FolSIX122-284 , FolSIX418-242 and FolSIX617-225 ) and were introduced into either the pET His6 Sumo TEV LIC cloning vector (2S-T; Addgene #29711) or the modified, Golden Gate-compatible, pOPIN expression vector.

    Expressing:

    Article Title: Comparison of periplasmic and intracellular expression of Arabidopsis thionin proproteins in E. coli
    Article Snippet: .. We therefore cloned the expression plasmids for all four fusion proteins into the SHuffle strain C3030 (New England Biolabs) in which the lethal phenotype of lacking the gor and trxB reductases is suppressed by a mutation in the peroxidase ahpC (Faulkner et al. ) thus providing an oxidising environment in the cytoplasm. .. Additionally, expression of periplasmic disulfide bond isomerase (DsbC) in the cytoplasm of these strains is supposed to enhance proper disulfide bond formation (Maskos et al. ).

    Article Title: A high-throughput expression screening platform to optimize the production of antimicrobial peptides
    Article Snippet: .. Transformation of E. coli expression strains Six different E. coli strains were used for expression screening: Rosetta-gami 2 (DE3) pLysS (Merck Millipore), Origami 2 (Merck Millipore), BL21 (DE3) (NEB), SHuffle T7 Express lysY (NEB), OverExpress C41 (DE3) pLysS (Sigma-Aldrich), OverExpress C43 (DE3) pLysS (Sigma-Aldrich). .. E. coli expression strains were transformed with the expression plasmids by heat shock.

    Article Title: The crystal structure of SnTox3 from the necrotrophic fungus Parastagonospora nodorum reveals a unique effector fold and insights into Kex2 protease processing of fungal effectors
    Article Snippet: .. For recombinant expression, SHuffle® T7 Express lysY competent E. coli (NEB, C3030J) were cultured at 30°C in Terrific Broth media with appropriate antibiotics for plasmid selection. .. Vector construction The five effectors used in this study, SnTox3 and SnToxA from P. nodorum , and SIX1, SIX4 and SIX6 from Fusarium oxysporum f. sp. lycopersici , including their putative pro-domains, were codon-optimised for expression in E. coli (SnTox321-230 , SnToxA17-178 , FolSIX122-284 , FolSIX418-242 and FolSIX617-225 ) and were introduced into either the pET His6 Sumo TEV LIC cloning vector (2S-T; Addgene #29711) or the modified, Golden Gate-compatible, pOPIN expression vector.

    Article Title: Evaluation of a Plasmodium-Specific Carrier Protein To Enhance Production of Recombinant Pfs25, a Leading Transmission-Blocking Vaccine Candidate
    Article Snippet: .. The sequence-verified plasmid was transformed into competent E. coli SHuffle T7 Express lysY cells (New England BioLabs) for expression, and nonfused r Pf MSP8(CΔS) was purified by nickel chelate affinity chromatography and quantified by a BCA protein assay as previously described ( ). .. The final product was assessed for purity by SDS-PAGE on 10% polyacrylamide gels under reducing and nonreducing conditions, followed by Coomassie blue staining or an immunoblot assay using a His tag-specific MAb (0.04 μg/ml; EMD Millipore, Billerica, MA) as described above.

    Article Title: Evaluation of a Plasmodium-Specific Carrier Protein To Enhance Production of Recombinant Pfs25, a Leading Transmission-Blocking Vaccine Candidate
    Article Snippet: .. The r Pf s25 expression construct was transformed into SHuffle T7 Express lysY competent E. coli cells (New England BioLabs). .. For expression, 3-liter bacterial cultures were grown by using a BioFlo115 benchtop bioreactor (New Brunswick Scientific).

    BIA-KA:

    Article Title: Evaluation of a Plasmodium-Specific Carrier Protein To Enhance Production of Recombinant Pfs25, a Leading Transmission-Blocking Vaccine Candidate
    Article Snippet: .. The sequence-verified plasmid was transformed into competent E. coli SHuffle T7 Express lysY cells (New England BioLabs) for expression, and nonfused r Pf MSP8(CΔS) was purified by nickel chelate affinity chromatography and quantified by a BCA protein assay as previously described ( ). .. The final product was assessed for purity by SDS-PAGE on 10% polyacrylamide gels under reducing and nonreducing conditions, followed by Coomassie blue staining or an immunoblot assay using a His tag-specific MAb (0.04 μg/ml; EMD Millipore, Billerica, MA) as described above.

    Sequencing:

    Article Title: Evaluation of a Plasmodium-Specific Carrier Protein To Enhance Production of Recombinant Pfs25, a Leading Transmission-Blocking Vaccine Candidate
    Article Snippet: .. The resulting construct, pET28a- Pf MSP1/8(CΔS), was sequence verified and transformed into competent Escherichia coli SHuffle T7 Express lysY cells (New England BioLabs, Ipswich, MA). .. The expression and purification of r Pf MSP1/8(CΔS) were performed according to protocols reported previously for unmodified r Pf MSP1/8, at a 5-liter scale, using a BioFlo115 benchtop bioreactor (New Brunswick Scientific, Edison, NJ) with nickel chelate affinity chromatography conducted under nondenaturing conditions ( ).

    Article Title: Evaluation of a Plasmodium-Specific Carrier Protein To Enhance Production of Recombinant Pfs25, a Leading Transmission-Blocking Vaccine Candidate
    Article Snippet: .. The sequence-verified plasmid was transformed into competent E. coli SHuffle T7 Express lysY cells (New England BioLabs) for expression, and nonfused r Pf MSP8(CΔS) was purified by nickel chelate affinity chromatography and quantified by a BCA protein assay as previously described ( ). .. The final product was assessed for purity by SDS-PAGE on 10% polyacrylamide gels under reducing and nonreducing conditions, followed by Coomassie blue staining or an immunoblot assay using a His tag-specific MAb (0.04 μg/ml; EMD Millipore, Billerica, MA) as described above.

    Transformation Assay:

    Article Title: Evaluation of a Plasmodium-Specific Carrier Protein To Enhance Production of Recombinant Pfs25, a Leading Transmission-Blocking Vaccine Candidate
    Article Snippet: .. The resulting construct, pET28a- Pf MSP1/8(CΔS), was sequence verified and transformed into competent Escherichia coli SHuffle T7 Express lysY cells (New England BioLabs, Ipswich, MA). .. The expression and purification of r Pf MSP1/8(CΔS) were performed according to protocols reported previously for unmodified r Pf MSP1/8, at a 5-liter scale, using a BioFlo115 benchtop bioreactor (New Brunswick Scientific, Edison, NJ) with nickel chelate affinity chromatography conducted under nondenaturing conditions ( ).

    Article Title: A high-throughput expression screening platform to optimize the production of antimicrobial peptides
    Article Snippet: .. Transformation of E. coli expression strains Six different E. coli strains were used for expression screening: Rosetta-gami 2 (DE3) pLysS (Merck Millipore), Origami 2 (Merck Millipore), BL21 (DE3) (NEB), SHuffle T7 Express lysY (NEB), OverExpress C41 (DE3) pLysS (Sigma-Aldrich), OverExpress C43 (DE3) pLysS (Sigma-Aldrich). .. E. coli expression strains were transformed with the expression plasmids by heat shock.

    Article Title: Evaluation of a Plasmodium-Specific Carrier Protein To Enhance Production of Recombinant Pfs25, a Leading Transmission-Blocking Vaccine Candidate
    Article Snippet: .. The sequence-verified plasmid was transformed into competent E. coli SHuffle T7 Express lysY cells (New England BioLabs) for expression, and nonfused r Pf MSP8(CΔS) was purified by nickel chelate affinity chromatography and quantified by a BCA protein assay as previously described ( ). .. The final product was assessed for purity by SDS-PAGE on 10% polyacrylamide gels under reducing and nonreducing conditions, followed by Coomassie blue staining or an immunoblot assay using a His tag-specific MAb (0.04 μg/ml; EMD Millipore, Billerica, MA) as described above.

    Article Title: Evaluation of a Plasmodium-Specific Carrier Protein To Enhance Production of Recombinant Pfs25, a Leading Transmission-Blocking Vaccine Candidate
    Article Snippet: .. The r Pf s25 expression construct was transformed into SHuffle T7 Express lysY competent E. coli cells (New England BioLabs). .. For expression, 3-liter bacterial cultures were grown by using a BioFlo115 benchtop bioreactor (New Brunswick Scientific).

    Recombinant:

    Article Title: The crystal structure of SnTox3 from the necrotrophic fungus Parastagonospora nodorum reveals a unique effector fold and insights into Kex2 protease processing of fungal effectors
    Article Snippet: .. For recombinant expression, SHuffle® T7 Express lysY competent E. coli (NEB, C3030J) were cultured at 30°C in Terrific Broth media with appropriate antibiotics for plasmid selection. .. Vector construction The five effectors used in this study, SnTox3 and SnToxA from P. nodorum , and SIX1, SIX4 and SIX6 from Fusarium oxysporum f. sp. lycopersici , including their putative pro-domains, were codon-optimised for expression in E. coli (SnTox321-230 , SnToxA17-178 , FolSIX122-284 , FolSIX418-242 and FolSIX617-225 ) and were introduced into either the pET His6 Sumo TEV LIC cloning vector (2S-T; Addgene #29711) or the modified, Golden Gate-compatible, pOPIN expression vector.

    Plasmid Preparation:

    Article Title: The crystal structure of SnTox3 from the necrotrophic fungus Parastagonospora nodorum reveals a unique effector fold and insights into Kex2 protease processing of fungal effectors
    Article Snippet: .. For recombinant expression, SHuffle® T7 Express lysY competent E. coli (NEB, C3030J) were cultured at 30°C in Terrific Broth media with appropriate antibiotics for plasmid selection. .. Vector construction The five effectors used in this study, SnTox3 and SnToxA from P. nodorum , and SIX1, SIX4 and SIX6 from Fusarium oxysporum f. sp. lycopersici , including their putative pro-domains, were codon-optimised for expression in E. coli (SnTox321-230 , SnToxA17-178 , FolSIX122-284 , FolSIX418-242 and FolSIX617-225 ) and were introduced into either the pET His6 Sumo TEV LIC cloning vector (2S-T; Addgene #29711) or the modified, Golden Gate-compatible, pOPIN expression vector.

    Article Title: Evaluation of a Plasmodium-Specific Carrier Protein To Enhance Production of Recombinant Pfs25, a Leading Transmission-Blocking Vaccine Candidate
    Article Snippet: .. The sequence-verified plasmid was transformed into competent E. coli SHuffle T7 Express lysY cells (New England BioLabs) for expression, and nonfused r Pf MSP8(CΔS) was purified by nickel chelate affinity chromatography and quantified by a BCA protein assay as previously described ( ). .. The final product was assessed for purity by SDS-PAGE on 10% polyacrylamide gels under reducing and nonreducing conditions, followed by Coomassie blue staining or an immunoblot assay using a His tag-specific MAb (0.04 μg/ml; EMD Millipore, Billerica, MA) as described above.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    New England Biolabs recombinant mouse nde1
    Requirement of <t>Nde1</t> for dynein recruitment to the kinetochore. (A) HeLa cells treated with Nde1 siRNA, exposed to nococazole, and immunostained for endogenous NDE1/NDEL1 or dynein intermediate chain. (B) Nde1 siRNA-treated HeLa cells rescued with expression of GFP WT Nde1 or GFP Nde1-del-dynein and stained for GFP and dynein intermediate chain. (C) Quantification of mean kinetochore dynein levels relative to mean ACA immunofluorescence signal. Dynein/ACA values were plotted ± SEM. Paired Student’s t test was performed to analyze significance between conditions. (D) Nde1 siRNA-treated HeLa cells rescued by expression of WT Nde1, Nde1-3E, or Nde1-3A and stained for GFP and dynein intermediate chain. Bars, 5 µm. (E) Quantification of mean dynein intensity relative to mean ACA immunofluorescence signal. Mean ± SEM of three independent experiments is represented. Student’s t tests were performed to analyze significance between conditions and revealed a significant difference in the levels of kinetochore dynein between Nde1 siRNA and WT Nde1, Nde1-3E, or Nde1-3A. *, P
    Recombinant Mouse Nde1, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant mouse nde1/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    recombinant mouse nde1 - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    Image Search Results


    Requirement of Nde1 for dynein recruitment to the kinetochore. (A) HeLa cells treated with Nde1 siRNA, exposed to nococazole, and immunostained for endogenous NDE1/NDEL1 or dynein intermediate chain. (B) Nde1 siRNA-treated HeLa cells rescued with expression of GFP WT Nde1 or GFP Nde1-del-dynein and stained for GFP and dynein intermediate chain. (C) Quantification of mean kinetochore dynein levels relative to mean ACA immunofluorescence signal. Dynein/ACA values were plotted ± SEM. Paired Student’s t test was performed to analyze significance between conditions. (D) Nde1 siRNA-treated HeLa cells rescued by expression of WT Nde1, Nde1-3E, or Nde1-3A and stained for GFP and dynein intermediate chain. Bars, 5 µm. (E) Quantification of mean dynein intensity relative to mean ACA immunofluorescence signal. Mean ± SEM of three independent experiments is represented. Student’s t tests were performed to analyze significance between conditions and revealed a significant difference in the levels of kinetochore dynein between Nde1 siRNA and WT Nde1, Nde1-3E, or Nde1-3A. *, P

    Journal: The Journal of Cell Biology

    Article Title: Cdk1 phosphorylation of the dynein adapter Nde1 controls cargo binding from G2 to anaphase

    doi: 10.1083/jcb.201707081

    Figure Lengend Snippet: Requirement of Nde1 for dynein recruitment to the kinetochore. (A) HeLa cells treated with Nde1 siRNA, exposed to nococazole, and immunostained for endogenous NDE1/NDEL1 or dynein intermediate chain. (B) Nde1 siRNA-treated HeLa cells rescued with expression of GFP WT Nde1 or GFP Nde1-del-dynein and stained for GFP and dynein intermediate chain. (C) Quantification of mean kinetochore dynein levels relative to mean ACA immunofluorescence signal. Dynein/ACA values were plotted ± SEM. Paired Student’s t test was performed to analyze significance between conditions. (D) Nde1 siRNA-treated HeLa cells rescued by expression of WT Nde1, Nde1-3E, or Nde1-3A and stained for GFP and dynein intermediate chain. Bars, 5 µm. (E) Quantification of mean dynein intensity relative to mean ACA immunofluorescence signal. Mean ± SEM of three independent experiments is represented. Student’s t tests were performed to analyze significance between conditions and revealed a significant difference in the levels of kinetochore dynein between Nde1 siRNA and WT Nde1, Nde1-3E, or Nde1-3A. *, P

    Article Snippet: 250 ng CyclinB/Cdk1 was incubated with 5–10 µg of bacterially purified recombinant mouse Nde1, 200 µM ATP, and 5× PK (NEB) buffer in a total volume of 50 µl.

    Techniques: Expressing, Staining, Immunofluorescence

    Role of Nde1 phosphorylation in mitotic progression. (A–F) Duration of mitotic events for individual H2B-RFP HeLa cells expressing GFP or GFP-tagged WT Nde1, Nde1-3E, Nde1-3A, Nde1-del-dynein, or Nde1-del-Lis1. (G) Duration of prometaphase (“unaligned”) and metaphase (“aligned”) is shown and replotted as the complete time from NEBD to anaphase onset. Mean ± SEM for each condition is shown. Mann–Whitney statistical tests revealed a significant increase in the time from NEBD to anaphase onset for cells expressing GFP Nde1-3A, GFP Nde1-del-dynein, and GFP Nde1-del-Lis1 relative to GFP alone control. (H–N) Same as above, but in H2B-RFP–expressing HeLa cells treated with control or Nde1 siRNAs for 48 h and then rescued with GFP, WT Nde1, Nde1-3E, Nde1-3A, Nde1-del-dynein, or Nde1-del-Lis1 for 24 h before live-cell imaging. (O) Data replotted as complete time from NEBD to anaphase onset. Mann–Whitney statistical tests were performed to compare Nde1 siRNA to each GFP Nde1 rescue condition. All of the Nde1 constructs to some extent rescued effects of Nde1RNAi, whereas Nde1-del-dynein showed no such effect. Mean ± SEM for each condition is shown. **, P

    Journal: The Journal of Cell Biology

    Article Title: Cdk1 phosphorylation of the dynein adapter Nde1 controls cargo binding from G2 to anaphase

    doi: 10.1083/jcb.201707081

    Figure Lengend Snippet: Role of Nde1 phosphorylation in mitotic progression. (A–F) Duration of mitotic events for individual H2B-RFP HeLa cells expressing GFP or GFP-tagged WT Nde1, Nde1-3E, Nde1-3A, Nde1-del-dynein, or Nde1-del-Lis1. (G) Duration of prometaphase (“unaligned”) and metaphase (“aligned”) is shown and replotted as the complete time from NEBD to anaphase onset. Mean ± SEM for each condition is shown. Mann–Whitney statistical tests revealed a significant increase in the time from NEBD to anaphase onset for cells expressing GFP Nde1-3A, GFP Nde1-del-dynein, and GFP Nde1-del-Lis1 relative to GFP alone control. (H–N) Same as above, but in H2B-RFP–expressing HeLa cells treated with control or Nde1 siRNAs for 48 h and then rescued with GFP, WT Nde1, Nde1-3E, Nde1-3A, Nde1-del-dynein, or Nde1-del-Lis1 for 24 h before live-cell imaging. (O) Data replotted as complete time from NEBD to anaphase onset. Mann–Whitney statistical tests were performed to compare Nde1 siRNA to each GFP Nde1 rescue condition. All of the Nde1 constructs to some extent rescued effects of Nde1RNAi, whereas Nde1-del-dynein showed no such effect. Mean ± SEM for each condition is shown. **, P

    Article Snippet: 250 ng CyclinB/Cdk1 was incubated with 5–10 µg of bacterially purified recombinant mouse Nde1, 200 µM ATP, and 5× PK (NEB) buffer in a total volume of 50 µl.

    Techniques: Expressing, MANN-WHITNEY, Live Cell Imaging, Construct

    Nde1 Cdk1 phosphorylation of Nde1 enhances CENP-F interaction. (A) Diagram showing CENP-F fragment used for biochemical analysis (NBD: amino acids 2,122–2,297). (B) GST-CENP-F NBD pull-down of GPF-Nde1 constructs from HeLa cells demonstrates increased binding of GFP-phosphomimetic Nde1. (C) GST-CENP-F NBD pull-down of bacterially expressed HA-Nde1 after in vitro phosphorylation with recombinant Cdk1/CyclinB. Levels of Nde1 in the CENP-F NBD pull-downs were quantified and again revealed an increased binding of Cdk1-phosphorylated Nde1 to the GST CENP-F NBD fragment. (D) Anti-GFP immunoprecipitation of endogenous CENP-F with GFP-tagged Nde1 phosphorylation state constructs. Immunoprecipitation of GFP WT Nde1 and GFP-Nde1-3E each specially coprecipitated endogenous CENP-F. Mean ± SEM of three independent experiments is represented. **, P

    Journal: The Journal of Cell Biology

    Article Title: Cdk1 phosphorylation of the dynein adapter Nde1 controls cargo binding from G2 to anaphase

    doi: 10.1083/jcb.201707081

    Figure Lengend Snippet: Nde1 Cdk1 phosphorylation of Nde1 enhances CENP-F interaction. (A) Diagram showing CENP-F fragment used for biochemical analysis (NBD: amino acids 2,122–2,297). (B) GST-CENP-F NBD pull-down of GPF-Nde1 constructs from HeLa cells demonstrates increased binding of GFP-phosphomimetic Nde1. (C) GST-CENP-F NBD pull-down of bacterially expressed HA-Nde1 after in vitro phosphorylation with recombinant Cdk1/CyclinB. Levels of Nde1 in the CENP-F NBD pull-downs were quantified and again revealed an increased binding of Cdk1-phosphorylated Nde1 to the GST CENP-F NBD fragment. (D) Anti-GFP immunoprecipitation of endogenous CENP-F with GFP-tagged Nde1 phosphorylation state constructs. Immunoprecipitation of GFP WT Nde1 and GFP-Nde1-3E each specially coprecipitated endogenous CENP-F. Mean ± SEM of three independent experiments is represented. **, P

    Article Snippet: 250 ng CyclinB/Cdk1 was incubated with 5–10 µg of bacterially purified recombinant mouse Nde1, 200 µM ATP, and 5× PK (NEB) buffer in a total volume of 50 µl.

    Techniques: Construct, Binding Assay, In Vitro, Recombinant, Immunoprecipitation

    Subcellular localization of Cdk1 phosphomimetic and phosphomutant Nde1 in G2 and mitosis. (A) Diagram of Nde1 showing Cdk1 phosphorylation sites (T215, T243, and T246) and interaction sites. (B–D) HeLa cells were transfected with GFP-tagged WT, phosphomimetic, and phosphomutant Nde1 and examined for localization to the G2 NE and mitotic kinetochores. GFP was detected by immunocytochemistry. WT and phospho-Nde1 colocalize with CENP-F at the NE and prophase–anaphase kinetochores. The phosphomutant Nde1 was weakly detected at these sites and absent from metaphase and anaphase kinetochores. (E) HeLa cells were stained with CDK1-phospho-specific antibody (p246; Alkuraya et al., 2011 ), which reacted with prometaphase-to-anaphase kinetochores, consistent with the distribution of the expressed phosphomimetic Nde1. Bars, 5 µm.

    Journal: The Journal of Cell Biology

    Article Title: Cdk1 phosphorylation of the dynein adapter Nde1 controls cargo binding from G2 to anaphase

    doi: 10.1083/jcb.201707081

    Figure Lengend Snippet: Subcellular localization of Cdk1 phosphomimetic and phosphomutant Nde1 in G2 and mitosis. (A) Diagram of Nde1 showing Cdk1 phosphorylation sites (T215, T243, and T246) and interaction sites. (B–D) HeLa cells were transfected with GFP-tagged WT, phosphomimetic, and phosphomutant Nde1 and examined for localization to the G2 NE and mitotic kinetochores. GFP was detected by immunocytochemistry. WT and phospho-Nde1 colocalize with CENP-F at the NE and prophase–anaphase kinetochores. The phosphomutant Nde1 was weakly detected at these sites and absent from metaphase and anaphase kinetochores. (E) HeLa cells were stained with CDK1-phospho-specific antibody (p246; Alkuraya et al., 2011 ), which reacted with prometaphase-to-anaphase kinetochores, consistent with the distribution of the expressed phosphomimetic Nde1. Bars, 5 µm.

    Article Snippet: 250 ng CyclinB/Cdk1 was incubated with 5–10 µg of bacterially purified recombinant mouse Nde1, 200 µM ATP, and 5× PK (NEB) buffer in a total volume of 50 µl.

    Techniques: Transfection, Immunocytochemistry, Staining

    Effects of Nde1 phosphorylation on localization at unattached kinetochores. (A) Distribution of GFP-WT and phosphorylation-state mutant Nde1 in nocodazole-treated HeLa cells showing clear localization of each construct to kinetochores in the absence of MTs. The intensity of phosphomutant Nde1 appeared to be decreased relative to WT and phosphomimetic nde1. Bar, 5 µm. (B) Quantification of (anti-GFP vs. anti-ACA immunofluorescence intensity). Student’s t test showed a significant decrease in phosphomutant Nde1 intensity relative to the other conditions. **, P

    Journal: The Journal of Cell Biology

    Article Title: Cdk1 phosphorylation of the dynein adapter Nde1 controls cargo binding from G2 to anaphase

    doi: 10.1083/jcb.201707081

    Figure Lengend Snippet: Effects of Nde1 phosphorylation on localization at unattached kinetochores. (A) Distribution of GFP-WT and phosphorylation-state mutant Nde1 in nocodazole-treated HeLa cells showing clear localization of each construct to kinetochores in the absence of MTs. The intensity of phosphomutant Nde1 appeared to be decreased relative to WT and phosphomimetic nde1. Bar, 5 µm. (B) Quantification of (anti-GFP vs. anti-ACA immunofluorescence intensity). Student’s t test showed a significant decrease in phosphomutant Nde1 intensity relative to the other conditions. **, P

    Article Snippet: 250 ng CyclinB/Cdk1 was incubated with 5–10 µg of bacterially purified recombinant mouse Nde1, 200 µM ATP, and 5× PK (NEB) buffer in a total volume of 50 µl.

    Techniques: Mutagenesis, Construct, Immunofluorescence