Structured Review

Bio-Rad cm2 econo column
Cm2 Econo Column, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cm2 econo column/product/Bio-Rad
Average 90 stars, based on 1 article reviews
Price from $9.99 to $1999.99
cm2 econo column - by Bioz Stars, 2020-01
90/100 stars

Related Products / Commonly Used Together

talon superflow metal affinity resin

Images

Related Articles

Clone Assay:

Article Title: BtcA, A Class IA Type III Chaperone, Interacts with the BteA N-Terminal Domain through a Globular/Non-Globular Mechanism
Article Snippet: Paragraph title: Cloning, expression and purification of BtcA ... Batch purification was conducted by applying the supernatant to buffer equilibrated Ni-NTA beads (Novagen), followed by 3 washing steps using Econo-Column (Bio-Rad, Hercules, CA): buffer 1 (50 ml of 300 mM NaCl, 20 mM Tris pH 8, 20 mM imidazole), buffer 2 (50 ml of 600 mM NaCl, 20 mM Tris, pH 8, 30 mM imidazole) and buffer 3 (50 ml of 300 mM NaCl, 20 mM Tris pH 8, 40 mM imidazole).

Article Title: Human PSF binds to RAD51 and modulates its homologous-pairing and strand-exchange activities
Article Snippet: The DNA fragments encoding PSF(1–266) and PSF(267–468) were cloned into the pET-15b vector. .. The cell debris was removed by centrifugation for 20 min at 27 700×g , and the supernatant was mixed gently with 3 ml of Ni–NTA agarose beads (Qiagen, Hilden, Germany) at 4°C for 1 h. The protein-bound beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA), and were washed with 120 ml of buffer A, containing 20 mM imidazole.

Article Title: Single-stranded DNA catenation mediated by human EVL and a type I topoisomerase
Article Snippet: The TOPO IIIα DNA fragment was cloned in the Nde I site of the pET15b vector (Novagen, Darmstadt, Germany). .. The beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA) and were washed with 90 ml of 20 mM potassium phosphate buffer (pH 7.4), containing 500 mM NaCl, 5 mM 2-mercaptoethanol, 30 mM imidazole and 10% glycerol.

Article Title: Direct targets of the transcription factors ABA-Insensitive(ABI)4 and ABI5 reveal synergistic action by ABI4 and several bZIP ABA response factors
Article Snippet: The ABI4 DNA binding domain was amplified with primers containing the EcoRI site (forward: CGTACTGAATTCATGGACCCTTTAGCTTCCCAAC; reverse: CGTACTGAATTCTCAAGACGAAGGGGTTAGTTGAGCTG) and cloned into the EcoRI site of pBluescript. .. The soluble fraction was then incubated with Glutathione agarose (Sigma) for 30 min at 4°C and loaded onto an Econo-column (BioRad).

Centrifugation:

Article Title: Genetically encoded system to track histone modification in vivo
Article Snippet: .. After centrifugation, supernatants containing the His6 -scFv were mixed with 4 ml (50% slurry) of Ni-NTA agarose (Qiagen), and rotated at 4°C for 1 h. The beads were packed into an Econo-column (Bio-Rad), and washed with 50-column volume of 50 mM Tris-HCl (pH 8.0) buffer containing 500 mM NaCl, 6 M urea, 5% glycerol, and 5 mM imidazole. ..

Article Title: BtcA, A Class IA Type III Chaperone, Interacts with the BteA N-Terminal Domain through a Globular/Non-Globular Mechanism
Article Snippet: Cells were collected by centrifugation at 6000 rpm for 7 min at 4°C after which the pellet was resuspended with binding buffer (20 mM imidazole, 300 mM NaCl, 20 mM Tris pH 8, 0.02% Triton X-100). .. Batch purification was conducted by applying the supernatant to buffer equilibrated Ni-NTA beads (Novagen), followed by 3 washing steps using Econo-Column (Bio-Rad, Hercules, CA): buffer 1 (50 ml of 300 mM NaCl, 20 mM Tris pH 8, 20 mM imidazole), buffer 2 (50 ml of 600 mM NaCl, 20 mM Tris, pH 8, 30 mM imidazole) and buffer 3 (50 ml of 300 mM NaCl, 20 mM Tris pH 8, 40 mM imidazole).

Article Title: Human PSF binds to RAD51 and modulates its homologous-pairing and strand-exchange activities
Article Snippet: .. The cell debris was removed by centrifugation for 20 min at 27 700×g , and the supernatant was mixed gently with 3 ml of Ni–NTA agarose beads (Qiagen, Hilden, Germany) at 4°C for 1 h. The protein-bound beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA), and were washed with 120 ml of buffer A, containing 20 mM imidazole. .. The peak fractions were collected, and 2 units of thrombin protease (GE Healthcare Biosciences, Uppsala, Sweden) per mg of protein were added to remove the His6 tag.

Article Title: Single-stranded DNA catenation mediated by human EVL and a type I topoisomerase
Article Snippet: The cell debris was removed by centrifugation for 20 min at 30 000g , and the lysate was mixed gently by the batch method with Ni-NTA agarose beads (3 ml, Qiagen, Hilden, Germany) at 4°C for 1 h. The His6 -tagged TOPO IIIα-bound beads were washed with 40 ml of 20 mM potassium phosphate buffer (pH 7.4), containing 500 mM NaCl, 5 mM 2-mercaptoethanol, 40 mM imidazole and 10% glycerol, and then were washed again with 40 ml of 20 mM potassium phosphate buffer (pH 7.4), containing 500 mM NaCl, 5 mM 2-mercaptoethanol, 30 mM imidazole and 10% glycerol. .. The beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA) and were washed with 90 ml of 20 mM potassium phosphate buffer (pH 7.4), containing 500 mM NaCl, 5 mM 2-mercaptoethanol, 30 mM imidazole and 10% glycerol.

Article Title: Structure of human nucleosome containing the testis-specific histone variant TSH2B
Article Snippet: .. The resuspended pellets were stirred overnight and the supernatant was obtained by centrifugation at 39 191g for 15 min at 277 K. The supernatant including the His6 -tagged TSH2B was mixed with 4 ml (50% slurry) nickel–nitrilotriacetic acid (Ni–NTA) agarose resin (Qiagen) and the sample was rotated for 1 h at 277 K. The beads were then packed into an Econo-column (Bio-Rad) and washed with 100 ml 50 mM Tris–HCl buffer pH 8.0 containing 500 mM NaCl, 5% glycerol, 6 M urea, 5 mM imidazole. ..

Article Title: DNA robustly stimulates FANCD2 monoubiquitylation in the complex with FANCI
Article Snippet: .. After disruption, the supernatant was separated from the cell debris by centrifugation (27 200g ) at 4°C for 20 min, and was mixed gently with nickel-nitrilotriacetic acid (Ni-NTA) agarose resin (3 ml; Qiagen) at 4°C for 1 h. Later, the Ni-NTA beads were packed into an Econo-Column (Bio-Rad), and were washed with 150 ml buffer A. His6 -tagged FANCD2 or FANCI was eluted with a 60 ml linear gradient of 12 to 400 mM imidazole in buffer A. .. Since the His6 -tag may affect the DNA-binding property of the proteins, the His6 -tag was removed by digestion with thrombin protease (GE Healthcare; 3 U/mg protein for FANCD2, 20 U/mg protein for FANCI) during dialysis against 4 L of buffer B, containing 20 mM Tris–HCl (pH 8.0), 10% glycerol, 5 mM 2-mercaptoethanol and 0.2 M NaCl.

Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells
Article Snippet: Subsequently, inclusion bodies were collected by centrifugation (47.800 × g, 15 min, 4°C) and washed twice with buffer (0.1% (v/v) Tween® 20, 150 mM NaCl) and double-destilled water (ddH2 O) prior to solubilisation in 8 M urea, 50 mM Tris-HCl (pH 8) and 20 mM 2-mercapotethanol. .. For that purpose, solubilized inclusion bodies were applied to an Econo-column (BioRad, Hercules, CA, USA) filled with Ni2+ -nitrilotriacetic acid agarose (Qiagen, Hilden, Germany), washed and eluted using 250 mM imadazole according to the manufacturer's instructions.

Article Title: LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae
Article Snippet: After centrifugation to remove debris at 28 000g for 30 min, the supernatant was ultracentrifuged at 125 000g for 1 h to collect the membrane fraction. .. The membrane fraction was solubilized in 20 mM Tris–HCl pH 8.0, 300 mM NaCl, 20 mM imidazole, 1.5% n -dodecyl-β-d -maltoside (DDM) for 1 h at 277 K. After the removal of debris by ultracentrifugation at 125 000g for 30 min, the supernatant was mixed with 5 ml Ni–NTA resin (Qiagen) equilibrated with buffer A (20 mM Tris–HCl pH 8.0, 300 mM NaCl, 0.1% DDM) containing 20 mM imidazole for about 1 h at 277 K. The mixture was loaded into an Econo-column (Bio-Rad) and the flowthrough fraction was discarded.

Amplification:

Article Title: Direct targets of the transcription factors ABA-Insensitive(ABI)4 and ABI5 reveal synergistic action by ABI4 and several bZIP ABA response factors
Article Snippet: The ABI4 DNA binding domain was amplified with primers containing the EcoRI site (forward: CGTACTGAATTCATGGACCCTTTAGCTTCCCAAC; reverse: CGTACTGAATTCTCAAGACGAAGGGGTTAGTTGAGCTG) and cloned into the EcoRI site of pBluescript. .. The soluble fraction was then incubated with Glutathione agarose (Sigma) for 30 min at 4°C and loaded onto an Econo-column (BioRad).

Filtration:

Article Title: Uncovering the Basis of ATP Hydrolysis Activity in Purified Human p53 Protein: A Reinvestigation
Article Snippet: The beads were then packed into an Econo-column (Bio-Rad Laboratories). .. The dialysed protein was further purified by FPLC-gel filtration (size exclusion) chromatography using GE healthcare AKTA system and HiLoad 16/60 Superdex 200 pg.

Article Title: Genetically encoded system to track histone modification in vivo
Article Snippet: After centrifugation, supernatants containing the His6 -scFv were mixed with 4 ml (50% slurry) of Ni-NTA agarose (Qiagen), and rotated at 4°C for 1 h. The beads were packed into an Econo-column (Bio-Rad), and washed with 50-column volume of 50 mM Tris-HCl (pH 8.0) buffer containing 500 mM NaCl, 6 M urea, 5% glycerol, and 5 mM imidazole. .. His6 -scFv was further purified by Superdex 75 gel filtration column (HiLoad 16/60 prep grade, GE Healthcare Biosciences) chromatography.

Article Title: A new type of protein chip to detect hepatocellular carcinoma-related autoimmune antibodies in the sera of hepatitis C virus-positive patients
Article Snippet: Recombinant proteins were batch-purified with 4 mL of HIS-Select Nickel Affinity Gel (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions except that they were washed with Econo-Column (Bio-Rad, Hercules, CA, USA) in phosphate-buffered saline (PBS, 6.4 mM Na2 HPO4 , 1.5 mM KH2 PO4 , 138 mM NaCl, 2.7 mM KCl, pH 7.4). .. Buffer was exchanged with PBS by repeated dilution and concentration using a Microcon YM-10 filtration column (Millipore, Billerica, MA, USA).

Construct:

Article Title: A new type of protein chip to detect hepatocellular carcinoma-related autoimmune antibodies in the sera of hepatitis C virus-positive patients
Article Snippet: Escherichia coli BL21 strains were transformed with newly constructed expression plasmids and the original 6×His-GFP-5×Cys plasmid (control). .. Recombinant proteins were batch-purified with 4 mL of HIS-Select Nickel Affinity Gel (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions except that they were washed with Econo-Column (Bio-Rad, Hercules, CA, USA) in phosphate-buffered saline (PBS, 6.4 mM Na2 HPO4 , 1.5 mM KH2 PO4 , 138 mM NaCl, 2.7 mM KCl, pH 7.4).

Article Title: Human PSF binds to RAD51 and modulates its homologous-pairing and strand-exchange activities
Article Snippet: In this construct, the His6 tag sequence was fused at the N-terminal end of the gene. .. The cell debris was removed by centrifugation for 20 min at 27 700×g , and the supernatant was mixed gently with 3 ml of Ni–NTA agarose beads (Qiagen, Hilden, Germany) at 4°C for 1 h. The protein-bound beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA), and were washed with 120 ml of buffer A, containing 20 mM imidazole.

Article Title: Single-stranded DNA catenation mediated by human EVL and a type I topoisomerase
Article Snippet: In this construct, the His6 tag sequence was fused to the N terminus of the protein. .. The beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA) and were washed with 90 ml of 20 mM potassium phosphate buffer (pH 7.4), containing 500 mM NaCl, 5 mM 2-mercaptoethanol, 30 mM imidazole and 10% glycerol.

Article Title: LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae
Article Snippet: The resulting construct was designated VcmNΔC. .. The membrane fraction was solubilized in 20 mM Tris–HCl pH 8.0, 300 mM NaCl, 20 mM imidazole, 1.5% n -dodecyl-β-d -maltoside (DDM) for 1 h at 277 K. After the removal of debris by ultracentrifugation at 125 000g for 30 min, the supernatant was mixed with 5 ml Ni–NTA resin (Qiagen) equilibrated with buffer A (20 mM Tris–HCl pH 8.0, 300 mM NaCl, 0.1% DDM) containing 20 mM imidazole for about 1 h at 277 K. The mixture was loaded into an Econo-column (Bio-Rad) and the flowthrough fraction was discarded.

Adsorption:

Article Title: A bone substitute with high affinity for vitamin D-binding protein―relationship with niche of osteoclasts
Article Snippet: Paragraph title: Serum protein adsorption to ceramic granules ... Four hundred mg of HHA or CHA granules was inserted into an Econo-Column® (Bio-Rad, Hercules, CA, USA), equilibrated with 0.05 M sodium phosphate buffer (pH.

Incubation:

Article Title: Uncovering the Basis of ATP Hydrolysis Activity in Purified Human p53 Protein: A Reinvestigation
Article Snippet: The supernatant was diluted five times in volume with 50 mM NaH2 PO4 (pH 8.0), 1 mM DTT, 1 mM Benzamidine, 0.1 mM PMSF and protease inhibitors cocktail (Roche), followed by incubation with pre-equilibriated Glutathione S sepharose beads (GE Healthcare) for 2 hours at 4°C. .. The beads were then packed into an Econo-column (Bio-Rad Laboratories).

Article Title: A quantized mechanism for activation of pannexin channels
Article Snippet: Unsolubilized material was removed by ultracentrifugation at 100,000g , and the supernatant was incubated overnight at 4 °C with Flag Affinity Resin (M2) (Sigma). .. After binding, the resin was packed in a Econo-column (Bio-Rad, 0.5 × 5 cm) and washed with 10 column volumes of 50 mM HEPES (pH 7.5), 300 mM NaCl, 0.2% (w/v) DDM, 0.04% (w/v) CHS, followed by 10 column volumes of 50 mM HEPES (pH 7.5), 1 M NaCl, 0.05% (w/v) DDM and 0.01% (w/v) CHS.

Article Title: Direct targets of the transcription factors ABA-Insensitive(ABI)4 and ABI5 reveal synergistic action by ABI4 and several bZIP ABA response factors
Article Snippet: .. The soluble fraction was then incubated with Glutathione agarose (Sigma) for 30 min at 4°C and loaded onto an Econo-column (BioRad). ..

Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells
Article Snippet: Following sonication on ice Triton® -X 100 (2% (w/v)), MgCl2 (1 mM) and DNase I (1 μL/mL) were added for 30 min of incubation at 25°C. .. For that purpose, solubilized inclusion bodies were applied to an Econo-column (BioRad, Hercules, CA, USA) filled with Ni2+ -nitrilotriacetic acid agarose (Qiagen, Hilden, Germany), washed and eluted using 250 mM imadazole according to the manufacturer's instructions.

Infection:

Article Title: Structural and Functional Analysis of DDX41: a bispecific immune receptor for DNA and cyclic dinucleotide
Article Snippet: Sf9 cells were infected with the baculovirus to express the N-terminal His6 -tag- and Tobacco Etch Virus (TEV) protease cleavage site-fused BTK. .. The protein was loaded again onto Ni-NTA Superflow resin (QIAGEN) packed in an Econo-Column (Bio-Rad).

Expressing:

Article Title: A quantized mechanism for activation of pannexin channels
Article Snippet: Paragraph title: Expression and purification of PANX1 concatemers ... After binding, the resin was packed in a Econo-column (Bio-Rad, 0.5 × 5 cm) and washed with 10 column volumes of 50 mM HEPES (pH 7.5), 300 mM NaCl, 0.2% (w/v) DDM, 0.04% (w/v) CHS, followed by 10 column volumes of 50 mM HEPES (pH 7.5), 1 M NaCl, 0.05% (w/v) DDM and 0.01% (w/v) CHS.

Article Title: Genetically encoded system to track histone modification in vivo
Article Snippet: Paragraph title: Bacterial expression of recombinant scFv and biochemical analysis ... After centrifugation, supernatants containing the His6 -scFv were mixed with 4 ml (50% slurry) of Ni-NTA agarose (Qiagen), and rotated at 4°C for 1 h. The beads were packed into an Econo-column (Bio-Rad), and washed with 50-column volume of 50 mM Tris-HCl (pH 8.0) buffer containing 500 mM NaCl, 6 M urea, 5% glycerol, and 5 mM imidazole.

Article Title: A new type of protein chip to detect hepatocellular carcinoma-related autoimmune antibodies in the sera of hepatitis C virus-positive patients
Article Snippet: Escherichia coli BL21 strains were transformed with newly constructed expression plasmids and the original 6×His-GFP-5×Cys plasmid (control). .. Recombinant proteins were batch-purified with 4 mL of HIS-Select Nickel Affinity Gel (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions except that they were washed with Econo-Column (Bio-Rad, Hercules, CA, USA) in phosphate-buffered saline (PBS, 6.4 mM Na2 HPO4 , 1.5 mM KH2 PO4 , 138 mM NaCl, 2.7 mM KCl, pH 7.4).

Article Title: BtcA, A Class IA Type III Chaperone, Interacts with the BteA N-Terminal Domain through a Globular/Non-Globular Mechanism
Article Snippet: Paragraph title: Cloning, expression and purification of BtcA ... Batch purification was conducted by applying the supernatant to buffer equilibrated Ni-NTA beads (Novagen), followed by 3 washing steps using Econo-Column (Bio-Rad, Hercules, CA): buffer 1 (50 ml of 300 mM NaCl, 20 mM Tris pH 8, 20 mM imidazole), buffer 2 (50 ml of 600 mM NaCl, 20 mM Tris, pH 8, 30 mM imidazole) and buffer 3 (50 ml of 300 mM NaCl, 20 mM Tris pH 8, 40 mM imidazole).

Article Title: Human PSF binds to RAD51 and modulates its homologous-pairing and strand-exchange activities
Article Snippet: The His6 -tagged PSF protein, the His6 -tagged PSF(1–266) mutant and the His6 -tagged PSF(267–468) mutant were each expressed in the Escherichia coli BL21(DE3) strain, which also carried an expression vector for the minor tRNAs (Codon(+)RP, Stratagene, La Jolla, CA, USA). .. The cell debris was removed by centrifugation for 20 min at 27 700×g , and the supernatant was mixed gently with 3 ml of Ni–NTA agarose beads (Qiagen, Hilden, Germany) at 4°C for 1 h. The protein-bound beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA), and were washed with 120 ml of buffer A, containing 20 mM imidazole.

Article Title: Structure of human nucleosome containing the testis-specific histone variant TSH2B
Article Snippet: The E. coli cells expressing recombinant TSH2B as a hexahistidine (His6 )-tagged protein were collected and resuspended in 50 ml 50 mM Tris–HCl buffer pH 7.5, containing 500 mM NaCl, 1 mM PMSF, 5% glycerol (Fig. 1 b ). .. The resuspended pellets were stirred overnight and the supernatant was obtained by centrifugation at 39 191g for 15 min at 277 K. The supernatant including the His6 -tagged TSH2B was mixed with 4 ml (50% slurry) nickel–nitrilotriacetic acid (Ni–NTA) agarose resin (Qiagen) and the sample was rotated for 1 h at 277 K. The beads were then packed into an Econo-column (Bio-Rad) and washed with 100 ml 50 mM Tris–HCl buffer pH 8.0 containing 500 mM NaCl, 5% glycerol, 6 M urea, 5 mM imidazole.

Article Title: LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae
Article Snippet: The transformed cells were grown in 2.5 l Luria–Bertani (LB) medium containing 30 µg ml−1 kanamycin at 310 K. When the absorbance at 600 nm (A 600 ) reached 0.5–0.8, expression was induced with 0.4 mM isopropyl β-d -1-thiogalactopyranoside (IPTG) and the cells were grown for about 20 h at 293 K. The cells were centrifuged at 5000g for 10 min and disrupted by 2–3 passes at 103 MPa using a Microfluidizer (Microfluidics). .. The membrane fraction was solubilized in 20 mM Tris–HCl pH 8.0, 300 mM NaCl, 20 mM imidazole, 1.5% n -dodecyl-β-d -maltoside (DDM) for 1 h at 277 K. After the removal of debris by ultracentrifugation at 125 000g for 30 min, the supernatant was mixed with 5 ml Ni–NTA resin (Qiagen) equilibrated with buffer A (20 mM Tris–HCl pH 8.0, 300 mM NaCl, 0.1% DDM) containing 20 mM imidazole for about 1 h at 277 K. The mixture was loaded into an Econo-column (Bio-Rad) and the flowthrough fraction was discarded.

Modification:

Article Title: Disease-Homologous Mutation in the Cation Diffusion Facilitator Protein MamM Causes Single-Domain Structural Loss and Signifies Its Importance
Article Snippet: Protein purification MamM CTD WT and M250L were purified as described previously for WT , with the modification of the Triton-X 100 concentration in buffer A to 0.01% (volume percentage). .. MamM CTD M250P-expressing cells were suspended in Buffer A (50 mM Tris-HCl pH = 8, 200 mM NaCl, 10 mM imidazole, 5 mM β-mercaptoethanol, 5% glycerol, 0.045% Triton X-100 and 0.03% TWEEN 20) at a weight ratio of 1:2, with DNaseI (10 μg mL−1 ) and a protease inhibitor cocktail (containing phenylmethylsulfonyl fluoride (PMSF), 100 μM; leupeptin, 1.2 μg mL−1 ; and pepstatin A, 1 μM) for 20 min at 277 K. Suspended cells were then disrupted by three cycles of French press pressure cell (Thermo Scientific, NC, US) at 207 MPa and centrifuged at 45,000 RPM (60 Ti fixed angle rotor, Beckman Coulter, CA, US) for 45 min at 277 K. Supernatant fraction was applied to a home-made gravity HIS-Select Cobalt Affinity Gel (5 mL bead volume; H8162, Sigma-Aldrich, Israel) in an Econo-Column (Bio-Rad, CA, US) chromatography column that was pre-equilibrated with buffer A.

Article Title: A quantized mechanism for activation of pannexin channels
Article Snippet: Expression and purification of PANX1 concatemers HEK293T cells (passages 8–15, American Type Culture Collection (ATCC)) were cultured at 37 °C with humidified air containing 5% CO2 in Dulbecco's Modified Eagle Medium (DMEM, high glucose, Gibco) containing 10% fetal bovine serum (FBS, Gibco), 1% penicillin and 1% streptomycin (PenStrep, Gibco). .. After binding, the resin was packed in a Econo-column (Bio-Rad, 0.5 × 5 cm) and washed with 10 column volumes of 50 mM HEPES (pH 7.5), 300 mM NaCl, 0.2% (w/v) DDM, 0.04% (w/v) CHS, followed by 10 column volumes of 50 mM HEPES (pH 7.5), 1 M NaCl, 0.05% (w/v) DDM and 0.01% (w/v) CHS.

Transformation Assay:

Article Title: Uncovering the Basis of ATP Hydrolysis Activity in Purified Human p53 Protein: A Reinvestigation
Article Snippet: The transformed cells, grown at 37°C till A600 of 0.5 in LB medium containing 50 μg/ml kanamycin, were induced with 0.5 mM IPTG at 25°C and harvested after 12 hours. .. The beads were then packed into an Econo-column (Bio-Rad Laboratories).

Article Title: A new type of protein chip to detect hepatocellular carcinoma-related autoimmune antibodies in the sera of hepatitis C virus-positive patients
Article Snippet: Escherichia coli BL21 strains were transformed with newly constructed expression plasmids and the original 6×His-GFP-5×Cys plasmid (control). .. Recombinant proteins were batch-purified with 4 mL of HIS-Select Nickel Affinity Gel (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions except that they were washed with Econo-Column (Bio-Rad, Hercules, CA, USA) in phosphate-buffered saline (PBS, 6.4 mM Na2 HPO4 , 1.5 mM KH2 PO4 , 138 mM NaCl, 2.7 mM KCl, pH 7.4).

Article Title: BtcA, A Class IA Type III Chaperone, Interacts with the BteA N-Terminal Domain through a Globular/Non-Globular Mechanism
Article Snippet: The ligated plasmid was transformed into E. coli BL21 Codon+ competent bacteria cells after which selected colonies were grown to mid-exponential phase. .. Batch purification was conducted by applying the supernatant to buffer equilibrated Ni-NTA beads (Novagen), followed by 3 washing steps using Econo-Column (Bio-Rad, Hercules, CA): buffer 1 (50 ml of 300 mM NaCl, 20 mM Tris pH 8, 20 mM imidazole), buffer 2 (50 ml of 600 mM NaCl, 20 mM Tris, pH 8, 30 mM imidazole) and buffer 3 (50 ml of 300 mM NaCl, 20 mM Tris pH 8, 40 mM imidazole).

Article Title: Structure of human nucleosome containing the testis-specific histone variant TSH2B
Article Snippet: Escherichia coli BL21(DE3) cells freshly transformed with the vector encoding TSH2B were grown on LB plates containing ampicillin (100 µg ml−1 ) at 310 K. Between five and 20 colonies grown on the LB plates were collected and inoculated into LB medium (2 l) containing ampicillin (50 µg ml−1 ). .. The resuspended pellets were stirred overnight and the supernatant was obtained by centrifugation at 39 191g for 15 min at 277 K. The supernatant including the His6 -tagged TSH2B was mixed with 4 ml (50% slurry) nickel–nitrilotriacetic acid (Ni–NTA) agarose resin (Qiagen) and the sample was rotated for 1 h at 277 K. The beads were then packed into an Econo-column (Bio-Rad) and washed with 100 ml 50 mM Tris–HCl buffer pH 8.0 containing 500 mM NaCl, 5% glycerol, 6 M urea, 5 mM imidazole.

Article Title: LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae
Article Snippet: The transformed cells were grown in 2.5 l Luria–Bertani (LB) medium containing 30 µg ml−1 kanamycin at 310 K. When the absorbance at 600 nm (A 600 ) reached 0.5–0.8, expression was induced with 0.4 mM isopropyl β-d -1-thiogalactopyranoside (IPTG) and the cells were grown for about 20 h at 293 K. The cells were centrifuged at 5000g for 10 min and disrupted by 2–3 passes at 103 MPa using a Microfluidizer (Microfluidics). .. The membrane fraction was solubilized in 20 mM Tris–HCl pH 8.0, 300 mM NaCl, 20 mM imidazole, 1.5% n -dodecyl-β-d -maltoside (DDM) for 1 h at 277 K. After the removal of debris by ultracentrifugation at 125 000g for 30 min, the supernatant was mixed with 5 ml Ni–NTA resin (Qiagen) equilibrated with buffer A (20 mM Tris–HCl pH 8.0, 300 mM NaCl, 0.1% DDM) containing 20 mM imidazole for about 1 h at 277 K. The mixture was loaded into an Econo-column (Bio-Rad) and the flowthrough fraction was discarded.

Crystallization Assay:

Article Title: Disease-Homologous Mutation in the Cation Diffusion Facilitator Protein MamM Causes Single-Domain Structural Loss and Signifies Its Importance
Article Snippet: For crystallization of MamM CTD M250L, a fraction of 6xHis-tagged protein was not cleaved after the Ni-NTA affinity purification step (the same protocol was used, but without thrombin). .. MamM CTD M250P-expressing cells were suspended in Buffer A (50 mM Tris-HCl pH = 8, 200 mM NaCl, 10 mM imidazole, 5 mM β-mercaptoethanol, 5% glycerol, 0.045% Triton X-100 and 0.03% TWEEN 20) at a weight ratio of 1:2, with DNaseI (10 μg mL−1 ) and a protease inhibitor cocktail (containing phenylmethylsulfonyl fluoride (PMSF), 100 μM; leupeptin, 1.2 μg mL−1 ; and pepstatin A, 1 μM) for 20 min at 277 K. Suspended cells were then disrupted by three cycles of French press pressure cell (Thermo Scientific, NC, US) at 207 MPa and centrifuged at 45,000 RPM (60 Ti fixed angle rotor, Beckman Coulter, CA, US) for 45 min at 277 K. Supernatant fraction was applied to a home-made gravity HIS-Select Cobalt Affinity Gel (5 mL bead volume; H8162, Sigma-Aldrich, Israel) in an Econo-Column (Bio-Rad, CA, US) chromatography column that was pre-equilibrated with buffer A.

Flow Cytometry:

Article Title: Structural and Functional Analysis of DDX41: a bispecific immune receptor for DNA and cyclic dinucleotide
Article Snippet: The protein was loaded again onto Ni-NTA Superflow resin (QIAGEN) packed in an Econo-Column (Bio-Rad). .. The flow-through and wash fractions were collected and loaded onto a Resource Q column (GE Healthcare), equilibrated with buffer G (20 mM Tris-HCl, pH 8.5, 20 mM NaCl, 1 mM DTT).

Chromatography:

Article Title: Disease-Homologous Mutation in the Cation Diffusion Facilitator Protein MamM Causes Single-Domain Structural Loss and Signifies Its Importance
Article Snippet: .. MamM CTD M250P-expressing cells were suspended in Buffer A (50 mM Tris-HCl pH = 8, 200 mM NaCl, 10 mM imidazole, 5 mM β-mercaptoethanol, 5% glycerol, 0.045% Triton X-100 and 0.03% TWEEN 20) at a weight ratio of 1:2, with DNaseI (10 μg mL−1 ) and a protease inhibitor cocktail (containing phenylmethylsulfonyl fluoride (PMSF), 100 μM; leupeptin, 1.2 μg mL−1 ; and pepstatin A, 1 μM) for 20 min at 277 K. Suspended cells were then disrupted by three cycles of French press pressure cell (Thermo Scientific, NC, US) at 207 MPa and centrifuged at 45,000 RPM (60 Ti fixed angle rotor, Beckman Coulter, CA, US) for 45 min at 277 K. Supernatant fraction was applied to a home-made gravity HIS-Select Cobalt Affinity Gel (5 mL bead volume; H8162, Sigma-Aldrich, Israel) in an Econo-Column (Bio-Rad, CA, US) chromatography column that was pre-equilibrated with buffer A. .. Protein was washed with two washing buffers for further purification: Buffer B (20 mM Tris-HCl pH = 8, 500 mM NaCl, 10 mM imidazole, 5 mM β-mercaptoethanol and 5% glycerol) and Buffer C (20 mM Tris-HCl pH = 8, 150 mM NaCl, 10 mM imidazole, 5 mM β-mercaptoethanol and 5% glycerol) and eluted using Buffer D (20 mM Tris-HCl pH = 8, 150 mM NaCl, 500 mM imidazole, 5 mM β-mercaptoethanol and 5% glycerol).

Article Title: Genetically encoded system to track histone modification in vivo
Article Snippet: After centrifugation, supernatants containing the His6 -scFv were mixed with 4 ml (50% slurry) of Ni-NTA agarose (Qiagen), and rotated at 4°C for 1 h. The beads were packed into an Econo-column (Bio-Rad), and washed with 50-column volume of 50 mM Tris-HCl (pH 8.0) buffer containing 500 mM NaCl, 6 M urea, 5% glycerol, and 5 mM imidazole. .. His6 -scFv was further purified by Superdex 75 gel filtration column (HiLoad 16/60 prep grade, GE Healthcare Biosciences) chromatography.

Protease Inhibitor:

Article Title: Disease-Homologous Mutation in the Cation Diffusion Facilitator Protein MamM Causes Single-Domain Structural Loss and Signifies Its Importance
Article Snippet: .. MamM CTD M250P-expressing cells were suspended in Buffer A (50 mM Tris-HCl pH = 8, 200 mM NaCl, 10 mM imidazole, 5 mM β-mercaptoethanol, 5% glycerol, 0.045% Triton X-100 and 0.03% TWEEN 20) at a weight ratio of 1:2, with DNaseI (10 μg mL−1 ) and a protease inhibitor cocktail (containing phenylmethylsulfonyl fluoride (PMSF), 100 μM; leupeptin, 1.2 μg mL−1 ; and pepstatin A, 1 μM) for 20 min at 277 K. Suspended cells were then disrupted by three cycles of French press pressure cell (Thermo Scientific, NC, US) at 207 MPa and centrifuged at 45,000 RPM (60 Ti fixed angle rotor, Beckman Coulter, CA, US) for 45 min at 277 K. Supernatant fraction was applied to a home-made gravity HIS-Select Cobalt Affinity Gel (5 mL bead volume; H8162, Sigma-Aldrich, Israel) in an Econo-Column (Bio-Rad, CA, US) chromatography column that was pre-equilibrated with buffer A. .. Protein was washed with two washing buffers for further purification: Buffer B (20 mM Tris-HCl pH = 8, 500 mM NaCl, 10 mM imidazole, 5 mM β-mercaptoethanol and 5% glycerol) and Buffer C (20 mM Tris-HCl pH = 8, 150 mM NaCl, 10 mM imidazole, 5 mM β-mercaptoethanol and 5% glycerol) and eluted using Buffer D (20 mM Tris-HCl pH = 8, 150 mM NaCl, 500 mM imidazole, 5 mM β-mercaptoethanol and 5% glycerol).

Article Title: A quantized mechanism for activation of pannexin channels
Article Snippet: Membranes were isolated as described above and solubilized for 2 h at 4 °C with 1% (w/v) n -dodecyl-β-D -maltoside (DDM; Anatrace) and 0.2% cholesteryl hemisuccinate (CHS; Sigma) in 50 mM HEPES, pH 7.5, 300 mM NaCl, 2.5% glycerol and protease inhibitor cocktails. .. After binding, the resin was packed in a Econo-column (Bio-Rad, 0.5 × 5 cm) and washed with 10 column volumes of 50 mM HEPES (pH 7.5), 300 mM NaCl, 0.2% (w/v) DDM, 0.04% (w/v) CHS, followed by 10 column volumes of 50 mM HEPES (pH 7.5), 1 M NaCl, 0.05% (w/v) DDM and 0.01% (w/v) CHS.

Article Title: Structural and Functional Analysis of DDX41: a bispecific immune receptor for DNA and cyclic dinucleotide
Article Snippet: The harvested cells were resuspended in buffer E (50 mM Tris-HCl, pH 8.0, 300 mM NaCl, 20 mM imidazole, 5 mM 2-mercaptoethanol), containing complete protease inhibitor (Roche), and lysed by sonication. .. The protein was loaded again onto Ni-NTA Superflow resin (QIAGEN) packed in an Econo-Column (Bio-Rad).

Cell Culture:

Article Title: A quantized mechanism for activation of pannexin channels
Article Snippet: Expression and purification of PANX1 concatemers HEK293T cells (passages 8–15, American Type Culture Collection (ATCC)) were cultured at 37 °C with humidified air containing 5% CO2 in Dulbecco's Modified Eagle Medium (DMEM, high glucose, Gibco) containing 10% fetal bovine serum (FBS, Gibco), 1% penicillin and 1% streptomycin (PenStrep, Gibco). .. After binding, the resin was packed in a Econo-column (Bio-Rad, 0.5 × 5 cm) and washed with 10 column volumes of 50 mM HEPES (pH 7.5), 300 mM NaCl, 0.2% (w/v) DDM, 0.04% (w/v) CHS, followed by 10 column volumes of 50 mM HEPES (pH 7.5), 1 M NaCl, 0.05% (w/v) DDM and 0.01% (w/v) CHS.

Article Title: A new type of protein chip to detect hepatocellular carcinoma-related autoimmune antibodies in the sera of hepatitis C virus-positive patients
Article Snippet: An inducible GFP clone was cultured in 200 mL of Overnight Express Medium (Novagen, Merck, Darmstadt, Germany) at 28°C with vigorous shaking. .. Recombinant proteins were batch-purified with 4 mL of HIS-Select Nickel Affinity Gel (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions except that they were washed with Econo-Column (Bio-Rad, Hercules, CA, USA) in phosphate-buffered saline (PBS, 6.4 mM Na2 HPO4 , 1.5 mM KH2 PO4 , 138 mM NaCl, 2.7 mM KCl, pH 7.4).

Article Title: DNA robustly stimulates FANCD2 monoubiquitylation in the complex with FANCI
Article Snippet: The cells were cultured in LB medium supplemented with ampicillin (100 µg/ml) and chloramphenicol (35 µg/ml) at 30°C to an OD600 = 0.6, and then protein production was induced by adding 0.5 mM Isopropyl β-D-1-thiogalactopyranoside and culturing the cells overnight at 18°C. .. After disruption, the supernatant was separated from the cell debris by centrifugation (27 200g ) at 4°C for 20 min, and was mixed gently with nickel-nitrilotriacetic acid (Ni-NTA) agarose resin (3 ml; Qiagen) at 4°C for 1 h. Later, the Ni-NTA beads were packed into an Econo-Column (Bio-Rad), and were washed with 150 ml buffer A. His6 -tagged FANCD2 or FANCI was eluted with a 60 ml linear gradient of 12 to 400 mM imidazole in buffer A.

DNA Sequencing:

Article Title: A new type of protein chip to detect hepatocellular carcinoma-related autoimmune antibodies in the sera of hepatitis C virus-positive patients
Article Snippet: PCR-amplified DNA fragments were verified by DNA sequencing. .. Recombinant proteins were batch-purified with 4 mL of HIS-Select Nickel Affinity Gel (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions except that they were washed with Econo-Column (Bio-Rad, Hercules, CA, USA) in phosphate-buffered saline (PBS, 6.4 mM Na2 HPO4 , 1.5 mM KH2 PO4 , 138 mM NaCl, 2.7 mM KCl, pH 7.4).

Sequencing:

Article Title: Genetically encoded system to track histone modification in vivo
Article Snippet: Bacterial expression of recombinant scFv and biochemical analysis scFv sequence was subcloned into pET15b (Novagen) which harbors the His6 tag at the N-terminus. .. After centrifugation, supernatants containing the His6 -scFv were mixed with 4 ml (50% slurry) of Ni-NTA agarose (Qiagen), and rotated at 4°C for 1 h. The beads were packed into an Econo-column (Bio-Rad), and washed with 50-column volume of 50 mM Tris-HCl (pH 8.0) buffer containing 500 mM NaCl, 6 M urea, 5% glycerol, and 5 mM imidazole.

Article Title: Human PSF binds to RAD51 and modulates its homologous-pairing and strand-exchange activities
Article Snippet: In this construct, the His6 tag sequence was fused at the N-terminal end of the gene. .. The cell debris was removed by centrifugation for 20 min at 27 700×g , and the supernatant was mixed gently with 3 ml of Ni–NTA agarose beads (Qiagen, Hilden, Germany) at 4°C for 1 h. The protein-bound beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA), and were washed with 120 ml of buffer A, containing 20 mM imidazole.

Article Title: Single-stranded DNA catenation mediated by human EVL and a type I topoisomerase
Article Snippet: In this construct, the His6 tag sequence was fused to the N terminus of the protein. .. The beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA) and were washed with 90 ml of 20 mM potassium phosphate buffer (pH 7.4), containing 500 mM NaCl, 5 mM 2-mercaptoethanol, 30 mM imidazole and 10% glycerol.

Article Title: Direct targets of the transcription factors ABA-Insensitive(ABI)4 and ABI5 reveal synergistic action by ABI4 and several bZIP ABA response factors
Article Snippet: After sequencing, the ABI4 DNA binding domain was subcloned into the EcoRI site of pGEX, downstream of GST. .. The soluble fraction was then incubated with Glutathione agarose (Sigma) for 30 min at 4°C and loaded onto an Econo-column (BioRad).

Sonication:

Article Title: Uncovering the Basis of ATP Hydrolysis Activity in Purified Human p53 Protein: A Reinvestigation
Article Snippet: The cells were resuspended in 25 mM HEPES-KOH (pH 7.6), 0.1 M KCl, 2 mM EDTA, 2 mM DTT, 20% glycerol, 1 mM Benzamidine, 0.25 mM PMSF and protease inhibitors cocktail (Roche), incubated with lysozyme (1 mg/ml) on ice for 30 minutes and sonicated after adding 0.1% NP-40. .. The beads were then packed into an Econo-column (Bio-Rad Laboratories).

Article Title: Genetically encoded system to track histone modification in vivo
Article Snippet: The cells producing His6 -scFv were collected by centrifugation and sheared by sonication in 50 mM Tris-HCl (pH 7.5) buffer containing 500 mM NaCl, 1 mM PMSF, 10% glycerol, and 0.01% Triton X-100. .. After centrifugation, supernatants containing the His6 -scFv were mixed with 4 ml (50% slurry) of Ni-NTA agarose (Qiagen), and rotated at 4°C for 1 h. The beads were packed into an Econo-column (Bio-Rad), and washed with 50-column volume of 50 mM Tris-HCl (pH 8.0) buffer containing 500 mM NaCl, 6 M urea, 5% glycerol, and 5 mM imidazole.

Article Title: Human PSF binds to RAD51 and modulates its homologous-pairing and strand-exchange activities
Article Snippet: The cells producing the proteins were resuspended in buffer A [50 mM Tris-HCl (pH 8.0), 500 mM NaCl, 2 mM 2-mercaptoethanol and 10% glycerol], and were disrupted by sonication. .. The cell debris was removed by centrifugation for 20 min at 27 700×g , and the supernatant was mixed gently with 3 ml of Ni–NTA agarose beads (Qiagen, Hilden, Germany) at 4°C for 1 h. The protein-bound beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA), and were washed with 120 ml of buffer A, containing 20 mM imidazole.

Article Title: Single-stranded DNA catenation mediated by human EVL and a type I topoisomerase
Article Snippet: The cells producing His6 -tagged TOPO IIIα were resuspended in a 50 mM Tris–HCl buffer (pH 7.5), containing 1M NaCl, 5 mM 2-mercaptoethanol and 10% glycerol, and were disrupted by sonication. .. The beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA) and were washed with 90 ml of 20 mM potassium phosphate buffer (pH 7.4), containing 500 mM NaCl, 5 mM 2-mercaptoethanol, 30 mM imidazole and 10% glycerol.

Article Title: Direct targets of the transcription factors ABA-Insensitive(ABI)4 and ABI5 reveal synergistic action by ABI4 and several bZIP ABA response factors
Article Snippet: After sonication, Triton X-100 was added to 1% and the sonicate was incubated for 30 min at 4°C for 30 min. .. The soluble fraction was then incubated with Glutathione agarose (Sigma) for 30 min at 4°C and loaded onto an Econo-column (BioRad).

Article Title: Structure of human nucleosome containing the testis-specific histone variant TSH2B
Article Snippet: The pellets were resuspended in 50 ml 50 mM Tris–HCl buffer pH 7.5 containing 500 mM NaCl, 5% glycerol, 7 M guanidine hydrochloride and were dissolved by sonication. .. The resuspended pellets were stirred overnight and the supernatant was obtained by centrifugation at 39 191g for 15 min at 277 K. The supernatant including the His6 -tagged TSH2B was mixed with 4 ml (50% slurry) nickel–nitrilotriacetic acid (Ni–NTA) agarose resin (Qiagen) and the sample was rotated for 1 h at 277 K. The beads were then packed into an Econo-column (Bio-Rad) and washed with 100 ml 50 mM Tris–HCl buffer pH 8.0 containing 500 mM NaCl, 5% glycerol, 6 M urea, 5 mM imidazole.

Article Title: DNA robustly stimulates FANCD2 monoubiquitylation in the complex with FANCI
Article Snippet: The cells were collected, resuspended in buffer A containing 50 mM Tris–HCl (pH 8.0), 10% glycerol, 0.5 M NaCl, 1 mM PMSF, 12 mM imidazole and 5 mM 2-mercaptoethanol, and disrupted by sonication. .. After disruption, the supernatant was separated from the cell debris by centrifugation (27 200g ) at 4°C for 20 min, and was mixed gently with nickel-nitrilotriacetic acid (Ni-NTA) agarose resin (3 ml; Qiagen) at 4°C for 1 h. Later, the Ni-NTA beads were packed into an Econo-Column (Bio-Rad), and were washed with 150 ml buffer A. His6 -tagged FANCD2 or FANCI was eluted with a 60 ml linear gradient of 12 to 400 mM imidazole in buffer A.

Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells
Article Snippet: Following sonication on ice Triton® -X 100 (2% (w/v)), MgCl2 (1 mM) and DNase I (1 μL/mL) were added for 30 min of incubation at 25°C. .. For that purpose, solubilized inclusion bodies were applied to an Econo-column (BioRad, Hercules, CA, USA) filled with Ni2+ -nitrilotriacetic acid agarose (Qiagen, Hilden, Germany), washed and eluted using 250 mM imadazole according to the manufacturer's instructions.

Article Title: Structural and Functional Analysis of DDX41: a bispecific immune receptor for DNA and cyclic dinucleotide
Article Snippet: The harvested cells were resuspended in buffer E (50 mM Tris-HCl, pH 8.0, 300 mM NaCl, 20 mM imidazole, 5 mM 2-mercaptoethanol), containing complete protease inhibitor (Roche), and lysed by sonication. .. The protein was loaded again onto Ni-NTA Superflow resin (QIAGEN) packed in an Econo-Column (Bio-Rad).

Affinity Purification:

Article Title: Disease-Homologous Mutation in the Cation Diffusion Facilitator Protein MamM Causes Single-Domain Structural Loss and Signifies Its Importance
Article Snippet: For crystallization of MamM CTD M250L, a fraction of 6xHis-tagged protein was not cleaved after the Ni-NTA affinity purification step (the same protocol was used, but without thrombin). .. MamM CTD M250P-expressing cells were suspended in Buffer A (50 mM Tris-HCl pH = 8, 200 mM NaCl, 10 mM imidazole, 5 mM β-mercaptoethanol, 5% glycerol, 0.045% Triton X-100 and 0.03% TWEEN 20) at a weight ratio of 1:2, with DNaseI (10 μg mL−1 ) and a protease inhibitor cocktail (containing phenylmethylsulfonyl fluoride (PMSF), 100 μM; leupeptin, 1.2 μg mL−1 ; and pepstatin A, 1 μM) for 20 min at 277 K. Suspended cells were then disrupted by three cycles of French press pressure cell (Thermo Scientific, NC, US) at 207 MPa and centrifuged at 45,000 RPM (60 Ti fixed angle rotor, Beckman Coulter, CA, US) for 45 min at 277 K. Supernatant fraction was applied to a home-made gravity HIS-Select Cobalt Affinity Gel (5 mL bead volume; H8162, Sigma-Aldrich, Israel) in an Econo-Column (Bio-Rad, CA, US) chromatography column that was pre-equilibrated with buffer A.

Binding Assay:

Article Title: A quantized mechanism for activation of pannexin channels
Article Snippet: .. After binding, the resin was packed in a Econo-column (Bio-Rad, 0.5 × 5 cm) and washed with 10 column volumes of 50 mM HEPES (pH 7.5), 300 mM NaCl, 0.2% (w/v) DDM, 0.04% (w/v) CHS, followed by 10 column volumes of 50 mM HEPES (pH 7.5), 1 M NaCl, 0.05% (w/v) DDM and 0.01% (w/v) CHS. .. The concatemer was eluted at 17 °C with 50 mM HEPES (pH 7.5), 500 mM NaCl, 0.02% (w/v) DDM, 0.004% (w/v) CHS containing the peptide DYKDDDDK (Bio Basic) at a concentration of 0.2 mg ml−1 .

Article Title: BtcA, A Class IA Type III Chaperone, Interacts with the BteA N-Terminal Domain through a Globular/Non-Globular Mechanism
Article Snippet: Cells were collected by centrifugation at 6000 rpm for 7 min at 4°C after which the pellet was resuspended with binding buffer (20 mM imidazole, 300 mM NaCl, 20 mM Tris pH 8, 0.02% Triton X-100). .. Batch purification was conducted by applying the supernatant to buffer equilibrated Ni-NTA beads (Novagen), followed by 3 washing steps using Econo-Column (Bio-Rad, Hercules, CA): buffer 1 (50 ml of 300 mM NaCl, 20 mM Tris pH 8, 20 mM imidazole), buffer 2 (50 ml of 600 mM NaCl, 20 mM Tris, pH 8, 30 mM imidazole) and buffer 3 (50 ml of 300 mM NaCl, 20 mM Tris pH 8, 40 mM imidazole).

Article Title: Direct targets of the transcription factors ABA-Insensitive(ABI)4 and ABI5 reveal synergistic action by ABI4 and several bZIP ABA response factors
Article Snippet: After sequencing, the ABI4 DNA binding domain was subcloned into the EcoRI site of pGEX, downstream of GST. .. The soluble fraction was then incubated with Glutathione agarose (Sigma) for 30 min at 4°C and loaded onto an Econo-column (BioRad).

Molecular Weight:

Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells
Article Snippet: For that purpose, solubilized inclusion bodies were applied to an Econo-column (BioRad, Hercules, CA, USA) filled with Ni2+ -nitrilotriacetic acid agarose (Qiagen, Hilden, Germany), washed and eluted using 250 mM imadazole according to the manufacturer's instructions. .. Finally, refolded, dimeric VEGF-A165 was dialyzed against 100 mM sodium acetate buffer (pH 5) and concentrated using Amicon Ultra centrifugal filter devices (10 kDa molecular weight cut-off; Millipore, Bedford, MA, USA).

Fluorescence:

Article Title: A quantized mechanism for activation of pannexin channels
Article Snippet: After binding, the resin was packed in a Econo-column (Bio-Rad, 0.5 × 5 cm) and washed with 10 column volumes of 50 mM HEPES (pH 7.5), 300 mM NaCl, 0.2% (w/v) DDM, 0.04% (w/v) CHS, followed by 10 column volumes of 50 mM HEPES (pH 7.5), 1 M NaCl, 0.05% (w/v) DDM and 0.01% (w/v) CHS. .. The concatemer was then purified by fluorescence-detection size-exclusion chromatography (FSEC) on a Superose 6 10/300 column (GE Healthcare) attached to a fluorescence detector (Hitachi LaChrom Elite L-2485; λ exc of 488 nm and λ em of 509 nm for eGFP fluorescence; λ exc of 280 nm and λ em of 325 nm for tryptophan fluorescence) with a mobile phase of 50 mM HEPES (pH 7.5), 500 mM NaCl.

Mutagenesis:

Article Title: Human PSF binds to RAD51 and modulates its homologous-pairing and strand-exchange activities
Article Snippet: The His6 -tagged PSF protein, the His6 -tagged PSF(1–266) mutant and the His6 -tagged PSF(267–468) mutant were each expressed in the Escherichia coli BL21(DE3) strain, which also carried an expression vector for the minor tRNAs (Codon(+)RP, Stratagene, La Jolla, CA, USA). .. The cell debris was removed by centrifugation for 20 min at 27 700×g , and the supernatant was mixed gently with 3 ml of Ni–NTA agarose beads (Qiagen, Hilden, Germany) at 4°C for 1 h. The protein-bound beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA), and were washed with 120 ml of buffer A, containing 20 mM imidazole.

Isolation:

Article Title: A quantized mechanism for activation of pannexin channels
Article Snippet: Membranes were isolated as described above and solubilized for 2 h at 4 °C with 1% (w/v) n -dodecyl-β-D -maltoside (DDM; Anatrace) and 0.2% cholesteryl hemisuccinate (CHS; Sigma) in 50 mM HEPES, pH 7.5, 300 mM NaCl, 2.5% glycerol and protease inhibitor cocktails. .. After binding, the resin was packed in a Econo-column (Bio-Rad, 0.5 × 5 cm) and washed with 10 column volumes of 50 mM HEPES (pH 7.5), 300 mM NaCl, 0.2% (w/v) DDM, 0.04% (w/v) CHS, followed by 10 column volumes of 50 mM HEPES (pH 7.5), 1 M NaCl, 0.05% (w/v) DDM and 0.01% (w/v) CHS.

Article Title: Human PSF binds to RAD51 and modulates its homologous-pairing and strand-exchange activities
Article Snippet: Protein purification The human PSF gene was isolated from a human cDNA pool by polymerase chain reaction, and was cloned into the pET-15b vector (Novagen, Darmstadt, Germany). .. The cell debris was removed by centrifugation for 20 min at 27 700×g , and the supernatant was mixed gently with 3 ml of Ni–NTA agarose beads (Qiagen, Hilden, Germany) at 4°C for 1 h. The protein-bound beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA), and were washed with 120 ml of buffer A, containing 20 mM imidazole.

Transfection:

Article Title: A quantized mechanism for activation of pannexin channels
Article Snippet: Transfections with GFP-tagged PANX1 concatemers lacking the CT (6(0CT)-GFP) were performed using polyethylenimine (PEI 25,000; Polysciences, Inc). .. After binding, the resin was packed in a Econo-column (Bio-Rad, 0.5 × 5 cm) and washed with 10 column volumes of 50 mM HEPES (pH 7.5), 300 mM NaCl, 0.2% (w/v) DDM, 0.04% (w/v) CHS, followed by 10 column volumes of 50 mM HEPES (pH 7.5), 1 M NaCl, 0.05% (w/v) DDM and 0.01% (w/v) CHS.

Size-exclusion Chromatography:

Article Title: Uncovering the Basis of ATP Hydrolysis Activity in Purified Human p53 Protein: A Reinvestigation
Article Snippet: The beads were then packed into an Econo-column (Bio-Rad Laboratories). .. The dialysed protein was further purified by FPLC-gel filtration (size exclusion) chromatography using GE healthcare AKTA system and HiLoad 16/60 Superdex 200 pg.

Article Title: A quantized mechanism for activation of pannexin channels
Article Snippet: After binding, the resin was packed in a Econo-column (Bio-Rad, 0.5 × 5 cm) and washed with 10 column volumes of 50 mM HEPES (pH 7.5), 300 mM NaCl, 0.2% (w/v) DDM, 0.04% (w/v) CHS, followed by 10 column volumes of 50 mM HEPES (pH 7.5), 1 M NaCl, 0.05% (w/v) DDM and 0.01% (w/v) CHS. .. The concatemer was then purified by fluorescence-detection size-exclusion chromatography (FSEC) on a Superose 6 10/300 column (GE Healthcare) attached to a fluorescence detector (Hitachi LaChrom Elite L-2485; λ exc of 488 nm and λ em of 509 nm for eGFP fluorescence; λ exc of 280 nm and λ em of 325 nm for tryptophan fluorescence) with a mobile phase of 50 mM HEPES (pH 7.5), 500 mM NaCl.

Protein Purification:

Article Title: Disease-Homologous Mutation in the Cation Diffusion Facilitator Protein MamM Causes Single-Domain Structural Loss and Signifies Its Importance
Article Snippet: Paragraph title: Protein purification ... MamM CTD M250P-expressing cells were suspended in Buffer A (50 mM Tris-HCl pH = 8, 200 mM NaCl, 10 mM imidazole, 5 mM β-mercaptoethanol, 5% glycerol, 0.045% Triton X-100 and 0.03% TWEEN 20) at a weight ratio of 1:2, with DNaseI (10 μg mL−1 ) and a protease inhibitor cocktail (containing phenylmethylsulfonyl fluoride (PMSF), 100 μM; leupeptin, 1.2 μg mL−1 ; and pepstatin A, 1 μM) for 20 min at 277 K. Suspended cells were then disrupted by three cycles of French press pressure cell (Thermo Scientific, NC, US) at 207 MPa and centrifuged at 45,000 RPM (60 Ti fixed angle rotor, Beckman Coulter, CA, US) for 45 min at 277 K. Supernatant fraction was applied to a home-made gravity HIS-Select Cobalt Affinity Gel (5 mL bead volume; H8162, Sigma-Aldrich, Israel) in an Econo-Column (Bio-Rad, CA, US) chromatography column that was pre-equilibrated with buffer A.

Article Title: Human PSF binds to RAD51 and modulates its homologous-pairing and strand-exchange activities
Article Snippet: Paragraph title: Protein purification ... The cell debris was removed by centrifugation for 20 min at 27 700×g , and the supernatant was mixed gently with 3 ml of Ni–NTA agarose beads (Qiagen, Hilden, Germany) at 4°C for 1 h. The protein-bound beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA), and were washed with 120 ml of buffer A, containing 20 mM imidazole.

Polymerase Chain Reaction:

Article Title: A new type of protein chip to detect hepatocellular carcinoma-related autoimmune antibodies in the sera of hepatitis C virus-positive patients
Article Snippet: PCR-amplified DNA fragments were verified by DNA sequencing. .. Recombinant proteins were batch-purified with 4 mL of HIS-Select Nickel Affinity Gel (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions except that they were washed with Econo-Column (Bio-Rad, Hercules, CA, USA) in phosphate-buffered saline (PBS, 6.4 mM Na2 HPO4 , 1.5 mM KH2 PO4 , 138 mM NaCl, 2.7 mM KCl, pH 7.4).

Article Title: Human PSF binds to RAD51 and modulates its homologous-pairing and strand-exchange activities
Article Snippet: Protein purification The human PSF gene was isolated from a human cDNA pool by polymerase chain reaction, and was cloned into the pET-15b vector (Novagen, Darmstadt, Germany). .. The cell debris was removed by centrifugation for 20 min at 27 700×g , and the supernatant was mixed gently with 3 ml of Ni–NTA agarose beads (Qiagen, Hilden, Germany) at 4°C for 1 h. The protein-bound beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA), and were washed with 120 ml of buffer A, containing 20 mM imidazole.

Fast Protein Liquid Chromatography:

Article Title: Uncovering the Basis of ATP Hydrolysis Activity in Purified Human p53 Protein: A Reinvestigation
Article Snippet: The beads were then packed into an Econo-column (Bio-Rad Laboratories). .. The dialysed protein was further purified by FPLC-gel filtration (size exclusion) chromatography using GE healthcare AKTA system and HiLoad 16/60 Superdex 200 pg.

Lysis:

Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells
Article Snippet: To that end, frozen cell pellets of E. coli BL21(DE3) pET16b-VEGFA165 were resuspended (Ultraturrax T 25; Jahnke & Kunkel, Staufen, Germany) in lysis buffer (0.1 M Tris-HCl pH 7.5, 5 mM EDTA, 150 mM NaCl) containing lysozyme (0.1% (w/v)), phenylmethylsulfonyl fluoride and benzamidine (1 mM each). .. For that purpose, solubilized inclusion bodies were applied to an Econo-column (BioRad, Hercules, CA, USA) filled with Ni2+ -nitrilotriacetic acid agarose (Qiagen, Hilden, Germany), washed and eluted using 250 mM imadazole according to the manufacturer's instructions.

Purification:

Article Title: Uncovering the Basis of ATP Hydrolysis Activity in Purified Human p53 Protein: A Reinvestigation
Article Snippet: The beads were then packed into an Econo-column (Bio-Rad Laboratories). .. The dialysed protein was further purified by FPLC-gel filtration (size exclusion) chromatography using GE healthcare AKTA system and HiLoad 16/60 Superdex 200 pg.

Article Title: Disease-Homologous Mutation in the Cation Diffusion Facilitator Protein MamM Causes Single-Domain Structural Loss and Signifies Its Importance
Article Snippet: Protein purification MamM CTD WT and M250L were purified as described previously for WT , with the modification of the Triton-X 100 concentration in buffer A to 0.01% (volume percentage). .. MamM CTD M250P-expressing cells were suspended in Buffer A (50 mM Tris-HCl pH = 8, 200 mM NaCl, 10 mM imidazole, 5 mM β-mercaptoethanol, 5% glycerol, 0.045% Triton X-100 and 0.03% TWEEN 20) at a weight ratio of 1:2, with DNaseI (10 μg mL−1 ) and a protease inhibitor cocktail (containing phenylmethylsulfonyl fluoride (PMSF), 100 μM; leupeptin, 1.2 μg mL−1 ; and pepstatin A, 1 μM) for 20 min at 277 K. Suspended cells were then disrupted by three cycles of French press pressure cell (Thermo Scientific, NC, US) at 207 MPa and centrifuged at 45,000 RPM (60 Ti fixed angle rotor, Beckman Coulter, CA, US) for 45 min at 277 K. Supernatant fraction was applied to a home-made gravity HIS-Select Cobalt Affinity Gel (5 mL bead volume; H8162, Sigma-Aldrich, Israel) in an Econo-Column (Bio-Rad, CA, US) chromatography column that was pre-equilibrated with buffer A.

Article Title: A quantized mechanism for activation of pannexin channels
Article Snippet: Paragraph title: Expression and purification of PANX1 concatemers ... After binding, the resin was packed in a Econo-column (Bio-Rad, 0.5 × 5 cm) and washed with 10 column volumes of 50 mM HEPES (pH 7.5), 300 mM NaCl, 0.2% (w/v) DDM, 0.04% (w/v) CHS, followed by 10 column volumes of 50 mM HEPES (pH 7.5), 1 M NaCl, 0.05% (w/v) DDM and 0.01% (w/v) CHS.

Article Title: Genetically encoded system to track histone modification in vivo
Article Snippet: After centrifugation, supernatants containing the His6 -scFv were mixed with 4 ml (50% slurry) of Ni-NTA agarose (Qiagen), and rotated at 4°C for 1 h. The beads were packed into an Econo-column (Bio-Rad), and washed with 50-column volume of 50 mM Tris-HCl (pH 8.0) buffer containing 500 mM NaCl, 6 M urea, 5% glycerol, and 5 mM imidazole. .. His6 -scFv was further purified by Superdex 75 gel filtration column (HiLoad 16/60 prep grade, GE Healthcare Biosciences) chromatography.

Article Title: BtcA, A Class IA Type III Chaperone, Interacts with the BteA N-Terminal Domain through a Globular/Non-Globular Mechanism
Article Snippet: .. Batch purification was conducted by applying the supernatant to buffer equilibrated Ni-NTA beads (Novagen), followed by 3 washing steps using Econo-Column (Bio-Rad, Hercules, CA): buffer 1 (50 ml of 300 mM NaCl, 20 mM Tris pH 8, 20 mM imidazole), buffer 2 (50 ml of 600 mM NaCl, 20 mM Tris, pH 8, 30 mM imidazole) and buffer 3 (50 ml of 300 mM NaCl, 20 mM Tris pH 8, 40 mM imidazole). .. Elution was performed in the presence of elution buffer (350 mM NaCl, 20 mM Tris pH 8, 300 mM imidazole) after which eluted samples of BtcA were concentrated and injected onto a Superdex 75 26/60 column (GE healthcare, Little Chalfont, UK) pre-equilibrated with BtcA buffer (20 mM Tris pH 8, 350 mM NaCl).

Article Title: Single-stranded DNA catenation mediated by human EVL and a type I topoisomerase
Article Snippet: Human TOPO IIIα was produced in the E. coli BL21(DE3) codon plus-RP strain (Stratagene, La Jolla, CA, USA) and was purified by the following procedure. .. The beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA) and were washed with 90 ml of 20 mM potassium phosphate buffer (pH 7.4), containing 500 mM NaCl, 5 mM 2-mercaptoethanol, 30 mM imidazole and 10% glycerol.

Article Title: Direct targets of the transcription factors ABA-Insensitive(ABI)4 and ABI5 reveal synergistic action by ABI4 and several bZIP ABA response factors
Article Snippet: The soluble fraction was then incubated with Glutathione agarose (Sigma) for 30 min at 4°C and loaded onto an Econo-column (BioRad). .. Eluted purified protein was stored at −80°C; small aliquots were diluted to make a working stock of 100 ng/μl in 20 mM Tris pH 8, 10% glycerol and 1 mM EDTA.

Article Title: Structure of human nucleosome containing the testis-specific histone variant TSH2B
Article Snippet: Paragraph title: Purification of human histones TSH2B, H2A, H2B, H3.1 and H4   ... The resuspended pellets were stirred overnight and the supernatant was obtained by centrifugation at 39 191g for 15 min at 277 K. The supernatant including the His6 -tagged TSH2B was mixed with 4 ml (50% slurry) nickel–nitrilotriacetic acid (Ni–NTA) agarose resin (Qiagen) and the sample was rotated for 1 h at 277 K. The beads were then packed into an Econo-column (Bio-Rad) and washed with 100 ml 50 mM Tris–HCl buffer pH 8.0 containing 500 mM NaCl, 5% glycerol, 6 M urea, 5 mM imidazole.

Article Title: DNA robustly stimulates FANCD2 monoubiquitylation in the complex with FANCI
Article Snippet: Paragraph title: Purification of chicken FANCD2, FANCI, FANCL and human UBE2T ... After disruption, the supernatant was separated from the cell debris by centrifugation (27 200g ) at 4°C for 20 min, and was mixed gently with nickel-nitrilotriacetic acid (Ni-NTA) agarose resin (3 ml; Qiagen) at 4°C for 1 h. Later, the Ni-NTA beads were packed into an Econo-Column (Bio-Rad), and were washed with 150 ml buffer A. His6 -tagged FANCD2 or FANCI was eluted with a 60 ml linear gradient of 12 to 400 mM imidazole in buffer A.

Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells
Article Snippet: Paragraph title: Production and purification of recombinant human VEGF-A165 ... For that purpose, solubilized inclusion bodies were applied to an Econo-column (BioRad, Hercules, CA, USA) filled with Ni2+ -nitrilotriacetic acid agarose (Qiagen, Hilden, Germany), washed and eluted using 250 mM imadazole according to the manufacturer's instructions.

Injection:

Article Title: BtcA, A Class IA Type III Chaperone, Interacts with the BteA N-Terminal Domain through a Globular/Non-Globular Mechanism
Article Snippet: Batch purification was conducted by applying the supernatant to buffer equilibrated Ni-NTA beads (Novagen), followed by 3 washing steps using Econo-Column (Bio-Rad, Hercules, CA): buffer 1 (50 ml of 300 mM NaCl, 20 mM Tris pH 8, 20 mM imidazole), buffer 2 (50 ml of 600 mM NaCl, 20 mM Tris, pH 8, 30 mM imidazole) and buffer 3 (50 ml of 300 mM NaCl, 20 mM Tris pH 8, 40 mM imidazole). .. Elution was performed in the presence of elution buffer (350 mM NaCl, 20 mM Tris pH 8, 300 mM imidazole) after which eluted samples of BtcA were concentrated and injected onto a Superdex 75 26/60 column (GE healthcare, Little Chalfont, UK) pre-equilibrated with BtcA buffer (20 mM Tris pH 8, 350 mM NaCl).

Plasmid Preparation:

Article Title: Uncovering the Basis of ATP Hydrolysis Activity in Purified Human p53 Protein: A Reinvestigation
Article Snippet: Full length human p53 The protein was expressed in E.coli BL21(DE3) transformed with pET28a-GST vector containing human p53 gene (kind gift from Jörg Kobarg, CBME, Brazil). .. The beads were then packed into an Econo-column (Bio-Rad Laboratories).

Article Title: A new type of protein chip to detect hepatocellular carcinoma-related autoimmune antibodies in the sera of hepatitis C virus-positive patients
Article Snippet: Escherichia coli BL21 strains were transformed with newly constructed expression plasmids and the original 6×His-GFP-5×Cys plasmid (control). .. Recombinant proteins were batch-purified with 4 mL of HIS-Select Nickel Affinity Gel (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions except that they were washed with Econo-Column (Bio-Rad, Hercules, CA, USA) in phosphate-buffered saline (PBS, 6.4 mM Na2 HPO4 , 1.5 mM KH2 PO4 , 138 mM NaCl, 2.7 mM KCl, pH 7.4).

Article Title: BtcA, A Class IA Type III Chaperone, Interacts with the BteA N-Terminal Domain through a Globular/Non-Globular Mechanism
Article Snippet: The ligated plasmid was transformed into E. coli BL21 Codon+ competent bacteria cells after which selected colonies were grown to mid-exponential phase. .. Batch purification was conducted by applying the supernatant to buffer equilibrated Ni-NTA beads (Novagen), followed by 3 washing steps using Econo-Column (Bio-Rad, Hercules, CA): buffer 1 (50 ml of 300 mM NaCl, 20 mM Tris pH 8, 20 mM imidazole), buffer 2 (50 ml of 600 mM NaCl, 20 mM Tris, pH 8, 30 mM imidazole) and buffer 3 (50 ml of 300 mM NaCl, 20 mM Tris pH 8, 40 mM imidazole).

Article Title: Human PSF binds to RAD51 and modulates its homologous-pairing and strand-exchange activities
Article Snippet: The His6 -tagged PSF protein, the His6 -tagged PSF(1–266) mutant and the His6 -tagged PSF(267–468) mutant were each expressed in the Escherichia coli BL21(DE3) strain, which also carried an expression vector for the minor tRNAs (Codon(+)RP, Stratagene, La Jolla, CA, USA). .. The cell debris was removed by centrifugation for 20 min at 27 700×g , and the supernatant was mixed gently with 3 ml of Ni–NTA agarose beads (Qiagen, Hilden, Germany) at 4°C for 1 h. The protein-bound beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA), and were washed with 120 ml of buffer A, containing 20 mM imidazole.

Article Title: Single-stranded DNA catenation mediated by human EVL and a type I topoisomerase
Article Snippet: The TOPO IIIα DNA fragment was cloned in the Nde I site of the pET15b vector (Novagen, Darmstadt, Germany). .. The beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA) and were washed with 90 ml of 20 mM potassium phosphate buffer (pH 7.4), containing 500 mM NaCl, 5 mM 2-mercaptoethanol, 30 mM imidazole and 10% glycerol.

Article Title: Structure of human nucleosome containing the testis-specific histone variant TSH2B
Article Snippet: Escherichia coli BL21(DE3) cells freshly transformed with the vector encoding TSH2B were grown on LB plates containing ampicillin (100 µg ml−1 ) at 310 K. Between five and 20 colonies grown on the LB plates were collected and inoculated into LB medium (2 l) containing ampicillin (50 µg ml−1 ). .. The resuspended pellets were stirred overnight and the supernatant was obtained by centrifugation at 39 191g for 15 min at 277 K. The supernatant including the His6 -tagged TSH2B was mixed with 4 ml (50% slurry) nickel–nitrilotriacetic acid (Ni–NTA) agarose resin (Qiagen) and the sample was rotated for 1 h at 277 K. The beads were then packed into an Econo-column (Bio-Rad) and washed with 100 ml 50 mM Tris–HCl buffer pH 8.0 containing 500 mM NaCl, 5% glycerol, 6 M urea, 5 mM imidazole.

Article Title: DNA robustly stimulates FANCD2 monoubiquitylation in the complex with FANCI
Article Snippet: Purification of chicken FANCD2, FANCI, FANCL and human UBE2T The DNA fragments encoding chicken FANCD2 and FANCI were ligated into the Nde I-Bam HI and Nde I-Xho I sites of the pET-15 b vector, respectively, and the proteins were overexpressed in the Escherichia coli BL21(DE3) strain, which also carried an expression vector for the minor tRNAs [Codon(+)RIL, Stratagene]. .. After disruption, the supernatant was separated from the cell debris by centrifugation (27 200g ) at 4°C for 20 min, and was mixed gently with nickel-nitrilotriacetic acid (Ni-NTA) agarose resin (3 ml; Qiagen) at 4°C for 1 h. Later, the Ni-NTA beads were packed into an Econo-Column (Bio-Rad), and were washed with 150 ml buffer A. His6 -tagged FANCD2 or FANCI was eluted with a 60 ml linear gradient of 12 to 400 mM imidazole in buffer A.

Article Title: LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae
Article Snippet: The plasmid was introduced into Escherichia coli C41(DE3) Rosetta cells harbouring pRARE, which encodes the tRNAs for codons rarely used in E. coli . .. The membrane fraction was solubilized in 20 mM Tris–HCl pH 8.0, 300 mM NaCl, 20 mM imidazole, 1.5% n -dodecyl-β-d -maltoside (DDM) for 1 h at 277 K. After the removal of debris by ultracentrifugation at 125 000g for 30 min, the supernatant was mixed with 5 ml Ni–NTA resin (Qiagen) equilibrated with buffer A (20 mM Tris–HCl pH 8.0, 300 mM NaCl, 0.1% DDM) containing 20 mM imidazole for about 1 h at 277 K. The mixture was loaded into an Econo-column (Bio-Rad) and the flowthrough fraction was discarded.

Positron Emission Tomography:

Article Title: Human PSF binds to RAD51 and modulates its homologous-pairing and strand-exchange activities
Article Snippet: The DNA fragments encoding PSF(1–266) and PSF(267–468) were cloned into the pET-15b vector. .. The cell debris was removed by centrifugation for 20 min at 27 700×g , and the supernatant was mixed gently with 3 ml of Ni–NTA agarose beads (Qiagen, Hilden, Germany) at 4°C for 1 h. The protein-bound beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA), and were washed with 120 ml of buffer A, containing 20 mM imidazole.

Article Title: DNA robustly stimulates FANCD2 monoubiquitylation in the complex with FANCI
Article Snippet: Purification of chicken FANCD2, FANCI, FANCL and human UBE2T The DNA fragments encoding chicken FANCD2 and FANCI were ligated into the Nde I-Bam HI and Nde I-Xho I sites of the pET-15 b vector, respectively, and the proteins were overexpressed in the Escherichia coli BL21(DE3) strain, which also carried an expression vector for the minor tRNAs [Codon(+)RIL, Stratagene]. .. After disruption, the supernatant was separated from the cell debris by centrifugation (27 200g ) at 4°C for 20 min, and was mixed gently with nickel-nitrilotriacetic acid (Ni-NTA) agarose resin (3 ml; Qiagen) at 4°C for 1 h. Later, the Ni-NTA beads were packed into an Econo-Column (Bio-Rad), and were washed with 150 ml buffer A. His6 -tagged FANCD2 or FANCI was eluted with a 60 ml linear gradient of 12 to 400 mM imidazole in buffer A.

Ion Chromatography:

Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells
Article Snippet: VEGF-A165 was purified from this solution by immobilized metal ion chromatography. .. For that purpose, solubilized inclusion bodies were applied to an Econo-column (BioRad, Hercules, CA, USA) filled with Ni2+ -nitrilotriacetic acid agarose (Qiagen, Hilden, Germany), washed and eluted using 250 mM imadazole according to the manufacturer's instructions.

Column Chromatography:

Article Title: A bone substitute with high affinity for vitamin D-binding protein―relationship with niche of osteoclasts
Article Snippet: Serum protein adsorption to ceramic granules To analyse the optimum conditions of adsorption and elution of serum proteins, standard procedures for HA column chromatography were used , . .. Four hundred mg of HHA or CHA granules was inserted into an Econo-Column® (Bio-Rad, Hercules, CA, USA), equilibrated with 0.05 M sodium phosphate buffer (pH.

Article Title: Structure of human nucleosome containing the testis-specific histone variant TSH2B
Article Snippet: The resuspended pellets were stirred overnight and the supernatant was obtained by centrifugation at 39 191g for 15 min at 277 K. The supernatant including the His6 -tagged TSH2B was mixed with 4 ml (50% slurry) nickel–nitrilotriacetic acid (Ni–NTA) agarose resin (Qiagen) and the sample was rotated for 1 h at 277 K. The beads were then packed into an Econo-column (Bio-Rad) and washed with 100 ml 50 mM Tris–HCl buffer pH 8.0 containing 500 mM NaCl, 5% glycerol, 6 M urea, 5 mM imidazole. .. The purity of TSH2B was about 70% after Ni–NTA agarose column chromatography (Fig. 1 c , lane 2) and the protein was further purified by Mono S column chromatography (GE Healthcare).

Produced:

Article Title: Single-stranded DNA catenation mediated by human EVL and a type I topoisomerase
Article Snippet: Human TOPO IIIα was produced in the E. coli BL21(DE3) codon plus-RP strain (Stratagene, La Jolla, CA, USA) and was purified by the following procedure. .. The beads were then packed into an Econo-column (Bio-Rad Laboratories, Hercules, CA, USA) and were washed with 90 ml of 20 mM potassium phosphate buffer (pH 7.4), containing 500 mM NaCl, 5 mM 2-mercaptoethanol, 30 mM imidazole and 10% glycerol.

Article Title: LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae
Article Snippet: The membrane fraction was solubilized in 20 mM Tris–HCl pH 8.0, 300 mM NaCl, 20 mM imidazole, 1.5% n -dodecyl-β-d -maltoside (DDM) for 1 h at 277 K. After the removal of debris by ultracentrifugation at 125 000g for 30 min, the supernatant was mixed with 5 ml Ni–NTA resin (Qiagen) equilibrated with buffer A (20 mM Tris–HCl pH 8.0, 300 mM NaCl, 0.1% DDM) containing 20 mM imidazole for about 1 h at 277 K. The mixture was loaded into an Econo-column (Bio-Rad) and the flowthrough fraction was discarded. .. To cleave the His6 tag, His-tagged TEV protease (produced in-house) was added to the eluted fraction in a 10:1(w :w ) protein:TEV protease ratio.

Concentration Assay:

Article Title: Disease-Homologous Mutation in the Cation Diffusion Facilitator Protein MamM Causes Single-Domain Structural Loss and Signifies Its Importance
Article Snippet: Protein purification MamM CTD WT and M250L were purified as described previously for WT , with the modification of the Triton-X 100 concentration in buffer A to 0.01% (volume percentage). .. MamM CTD M250P-expressing cells were suspended in Buffer A (50 mM Tris-HCl pH = 8, 200 mM NaCl, 10 mM imidazole, 5 mM β-mercaptoethanol, 5% glycerol, 0.045% Triton X-100 and 0.03% TWEEN 20) at a weight ratio of 1:2, with DNaseI (10 μg mL−1 ) and a protease inhibitor cocktail (containing phenylmethylsulfonyl fluoride (PMSF), 100 μM; leupeptin, 1.2 μg mL−1 ; and pepstatin A, 1 μM) for 20 min at 277 K. Suspended cells were then disrupted by three cycles of French press pressure cell (Thermo Scientific, NC, US) at 207 MPa and centrifuged at 45,000 RPM (60 Ti fixed angle rotor, Beckman Coulter, CA, US) for 45 min at 277 K. Supernatant fraction was applied to a home-made gravity HIS-Select Cobalt Affinity Gel (5 mL bead volume; H8162, Sigma-Aldrich, Israel) in an Econo-Column (Bio-Rad, CA, US) chromatography column that was pre-equilibrated with buffer A.

Article Title: A quantized mechanism for activation of pannexin channels
Article Snippet: After binding, the resin was packed in a Econo-column (Bio-Rad, 0.5 × 5 cm) and washed with 10 column volumes of 50 mM HEPES (pH 7.5), 300 mM NaCl, 0.2% (w/v) DDM, 0.04% (w/v) CHS, followed by 10 column volumes of 50 mM HEPES (pH 7.5), 1 M NaCl, 0.05% (w/v) DDM and 0.01% (w/v) CHS. .. The concatemer was eluted at 17 °C with 50 mM HEPES (pH 7.5), 500 mM NaCl, 0.02% (w/v) DDM, 0.004% (w/v) CHS containing the peptide DYKDDDDK (Bio Basic) at a concentration of 0.2 mg ml−1 .

Article Title: A new type of protein chip to detect hepatocellular carcinoma-related autoimmune antibodies in the sera of hepatitis C virus-positive patients
Article Snippet: Recombinant proteins were batch-purified with 4 mL of HIS-Select Nickel Affinity Gel (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions except that they were washed with Econo-Column (Bio-Rad, Hercules, CA, USA) in phosphate-buffered saline (PBS, 6.4 mM Na2 HPO4 , 1.5 mM KH2 PO4 , 138 mM NaCl, 2.7 mM KCl, pH 7.4). .. Buffer was exchanged with PBS by repeated dilution and concentration using a Microcon YM-10 filtration column (Millipore, Billerica, MA, USA).

Article Title: BtcA, A Class IA Type III Chaperone, Interacts with the BteA N-Terminal Domain through a Globular/Non-Globular Mechanism
Article Snippet: At this point expression of the proteins was induced by addition of isopropyl β-D-1-thiogalactopyranoside (IPTG) to 1 mM final concentration for 18 hr at 25°C. .. Batch purification was conducted by applying the supernatant to buffer equilibrated Ni-NTA beads (Novagen), followed by 3 washing steps using Econo-Column (Bio-Rad, Hercules, CA): buffer 1 (50 ml of 300 mM NaCl, 20 mM Tris pH 8, 20 mM imidazole), buffer 2 (50 ml of 600 mM NaCl, 20 mM Tris, pH 8, 30 mM imidazole) and buffer 3 (50 ml of 300 mM NaCl, 20 mM Tris pH 8, 40 mM imidazole).

Article Title: A bone substitute with high affinity for vitamin D-binding protein―relationship with niche of osteoclasts
Article Snippet: Four hundred mg of HHA or CHA granules was inserted into an Econo-Column® (Bio-Rad, Hercules, CA, USA), equilibrated with 0.05 M sodium phosphate buffer (pH. .. Each column was washed with 3 ml of 0.05 M sodium phosphate buffer three times, and bound materials were eluted with 2 ml each of 0.05 M sodium phosphate buffer with stepwise increase in the concentration of NaCl (0.2, 0.4, 0.6, 0.8 and 1.0 M).

Recombinant:

Article Title: Genetically encoded system to track histone modification in vivo
Article Snippet: Paragraph title: Bacterial expression of recombinant scFv and biochemical analysis ... After centrifugation, supernatants containing the His6 -scFv were mixed with 4 ml (50% slurry) of Ni-NTA agarose (Qiagen), and rotated at 4°C for 1 h. The beads were packed into an Econo-column (Bio-Rad), and washed with 50-column volume of 50 mM Tris-HCl (pH 8.0) buffer containing 500 mM NaCl, 6 M urea, 5% glycerol, and 5 mM imidazole.

Article Title: A new type of protein chip to detect hepatocellular carcinoma-related autoimmune antibodies in the sera of hepatitis C virus-positive patients
Article Snippet: .. Recombinant proteins were batch-purified with 4 mL of HIS-Select Nickel Affinity Gel (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions except that they were washed with Econo-Column (Bio-Rad, Hercules, CA, USA) in phosphate-buffered saline (PBS, 6.4 mM Na2 HPO4 , 1.5 mM KH2 PO4 , 138 mM NaCl, 2.7 mM KCl, pH 7.4). ..

Article Title: Structure of human nucleosome containing the testis-specific histone variant TSH2B
Article Snippet: The E. coli cells expressing recombinant TSH2B as a hexahistidine (His6 )-tagged protein were collected and resuspended in 50 ml 50 mM Tris–HCl buffer pH 7.5, containing 500 mM NaCl, 1 mM PMSF, 5% glycerol (Fig. 1 b ). .. The resuspended pellets were stirred overnight and the supernatant was obtained by centrifugation at 39 191g for 15 min at 277 K. The supernatant including the His6 -tagged TSH2B was mixed with 4 ml (50% slurry) nickel–nitrilotriacetic acid (Ni–NTA) agarose resin (Qiagen) and the sample was rotated for 1 h at 277 K. The beads were then packed into an Econo-column (Bio-Rad) and washed with 100 ml 50 mM Tris–HCl buffer pH 8.0 containing 500 mM NaCl, 5% glycerol, 6 M urea, 5 mM imidazole.

Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells
Article Snippet: Paragraph title: Production and purification of recombinant human VEGF-A165 ... For that purpose, solubilized inclusion bodies were applied to an Econo-column (BioRad, Hercules, CA, USA) filled with Ni2+ -nitrilotriacetic acid agarose (Qiagen, Hilden, Germany), washed and eluted using 250 mM imadazole according to the manufacturer's instructions.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Bio-Rad cm2 econo column
    Cm2 Econo Column, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cm2 econo column/product/Bio-Rad
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cm2 econo column - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results