clonejet pcr cloning  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    CloneJET PCR Cloning Kit
    Description:
    Thermo Scientific CloneJET PCR Cloning Kit is an advanced positive selection system for high efficiency cloning of PCR products generated with any thermostable DNA polymerase Any other blunt or sticky end DNA fragment can be cloned It is ideal for phosphorylated or non phosphorylated DNA fragments Ligation into the included positive selection vector takes only 5 minutes yielding more than 99 recombinant clones Blunt ended PCR products generated with a proofreading enzyme are ligated directly into the cloning vector PCR products generated either with non proofreading DNA polymerases or mixtures of DNA polymerases are blunted prior to ligation in 5 minutes with the thermostable DNA Blunting Enzyme provided with the kit All common laboratory E coli strains can be directly transformed with the ligation product FeaturesThe CloneJET PCR Cloning Kit contains a novel ready to use positive selection cloning vector pJET1 2 blunt The vector contains a lethal restriction enzyme gene that is disrupted by ligation of a DNA insert into the cloning site As a result only bacterial cells with recombinant plasmids are able to form colonies Recircularized pJET1 2 blunt vector molecules lacking an insert express a lethal restriction enzyme which kills the host E coli cell after transformation This positive selection drastically accelerates the process of colony screening and eliminates additional costs required for blue white selection For convenience in mapping and manipulation of the insert the pJET1 2 blunt cloning vector multiple cloning site contains two BglII recognition sequences that flank the insertion site In addition the vector contains a T7 promoter for in vitro and in vivo transcription as well as sequencing of the insert Highlights• Fast PCR cloning in only 5 minutes• Highest efficiency 99 of positive clones• No cloning background positive selection vector• Versatile ideal for blunt end or sticky end cloning• Economical no expensive blue white screeningApplications• Cloning of blunt end or 3 dA tailed PCR products up to 10 kb• Cloning of DNA fragments generated by restriction enzymes• Sequencing of cloned DNA• in vitro and in vivo transcription of cloned inserts from the T7 promoterIncludes• pJET1 2 blunt Cloning Vector• T4 DNA Ligase• 2X Reaction Buffer• DNA Blunting Enzyme• pJET1 2 Forward Sequencing Primer 5 CGACTCACTATAGGGAGAGCGGC 3 • pJET1 2 Reverse Sequencing Primer 5 AAGAACATCGATTTTCCATGGCAG 3 • Control PCR Product• Water nuclease free• Detailed ProtocolPrior to electroporation always column purify the ligation mixture using e g GeneJET PCR Purification Kit K0701 or chloroform to extract it Electroporation is inhibited by the presence of proteins and salts in the mixture Related ProductsFast DNA End Repair KitCloneJET PCR Cloning Kit
    Catalog Number:
    k1231
    Price:
    None
    Applications:
    Cloning|PCR Cloning
    Category:
    DNA Vectors Clones Purified Nucleic Acids Libraries
    Buy from Supplier


    Structured Review

    Thermo Fisher clonejet pcr cloning
    Thermo Scientific CloneJET PCR Cloning Kit is an advanced positive selection system for high efficiency cloning of PCR products generated with any thermostable DNA polymerase Any other blunt or sticky end DNA fragment can be cloned It is ideal for phosphorylated or non phosphorylated DNA fragments Ligation into the included positive selection vector takes only 5 minutes yielding more than 99 recombinant clones Blunt ended PCR products generated with a proofreading enzyme are ligated directly into the cloning vector PCR products generated either with non proofreading DNA polymerases or mixtures of DNA polymerases are blunted prior to ligation in 5 minutes with the thermostable DNA Blunting Enzyme provided with the kit All common laboratory E coli strains can be directly transformed with the ligation product FeaturesThe CloneJET PCR Cloning Kit contains a novel ready to use positive selection cloning vector pJET1 2 blunt The vector contains a lethal restriction enzyme gene that is disrupted by ligation of a DNA insert into the cloning site As a result only bacterial cells with recombinant plasmids are able to form colonies Recircularized pJET1 2 blunt vector molecules lacking an insert express a lethal restriction enzyme which kills the host E coli cell after transformation This positive selection drastically accelerates the process of colony screening and eliminates additional costs required for blue white selection For convenience in mapping and manipulation of the insert the pJET1 2 blunt cloning vector multiple cloning site contains two BglII recognition sequences that flank the insertion site In addition the vector contains a T7 promoter for in vitro and in vivo transcription as well as sequencing of the insert Highlights• Fast PCR cloning in only 5 minutes• Highest efficiency 99 of positive clones• No cloning background positive selection vector• Versatile ideal for blunt end or sticky end cloning• Economical no expensive blue white screeningApplications• Cloning of blunt end or 3 dA tailed PCR products up to 10 kb• Cloning of DNA fragments generated by restriction enzymes• Sequencing of cloned DNA• in vitro and in vivo transcription of cloned inserts from the T7 promoterIncludes• pJET1 2 blunt Cloning Vector• T4 DNA Ligase• 2X Reaction Buffer• DNA Blunting Enzyme• pJET1 2 Forward Sequencing Primer 5 CGACTCACTATAGGGAGAGCGGC 3 • pJET1 2 Reverse Sequencing Primer 5 AAGAACATCGATTTTCCATGGCAG 3 • Control PCR Product• Water nuclease free• Detailed ProtocolPrior to electroporation always column purify the ligation mixture using e g GeneJET PCR Purification Kit K0701 or chloroform to extract it Electroporation is inhibited by the presence of proteins and salts in the mixture Related ProductsFast DNA End Repair KitCloneJET PCR Cloning Kit
    https://www.bioz.com/result/clonejet pcr cloning/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    clonejet pcr cloning - by Bioz Stars, 2020-02
    90/100 stars

    Images

    Related Articles

    Transduction:

    Article Title: A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes
    Article Snippet: Viruses were harvested 48 hrs post-transfection and used to transduce target cells (MOI = 0.1). .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher).

    Article Title: A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC–Cas9 or cleavage by Cas9 in living cells
    Article Snippet: Virus was harvested 48 h post-transfection, frozen at –80°C for 8 h, thawed, and used to transduce target cells (MOI = 1). .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Fisher Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher Scientific).

    Clone Assay:

    Article Title: Mutational Profile Of Advanced Primary and Metastatic Radioactive Iodine-Refractory Thyroid Cancers Reveals Distinct Pathogenetic Roles for BRAF, PIK3CA and AKT1
    Article Snippet: .. The purified PCR products were ligated into the pJET1.2/blunt cloning vector using CloneJET PCR Cloning Kit (Fermentas, Vilnius, Lithuania) and the ligation products used to transform DH5α competent bacterial cells (Invitrogen). .. Positive colonies were screened by colony PCR using High-Fidelity Taq DNA Polymerase (Invitrogen) and analyzed by 2% agarose gel electrophoresis.

    Article Title: Hemocyte differentiation mediates the mosquito late-phase immune response against Plasmodium in Anopheles gambiae
    Article Snippet: .. PCR products were subcloned into a pJet1.2 vector using the CloneJet PCR cloning kit (Thermo Scientific) and used as a template for amplification with T7 promoter sequences to amplify T7-PCR products. .. Following PCR purification with the DNA Clean and Concentrator (Zymo Research), resultant T7-PCR templates were used for dsRNA production using the MEGAscript RNAi kit (Life Technologies).

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering
    Article Snippet: .. For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific). .. 1 μl of blunt vector (50 ng/μl), 50 ng/μl of the PCR product, and 10 μl of 2X reaction buffer (provided in the kit) were mixed and filled with water to a total volume of 20 μl.

    Article Title: Identification of a Two-Component Regulatory Pathway Essential for Mn(II) Oxidation in Pseudomonas putida GB-1 ▿
    Article Snippet: .. The gene of interest was PCR amplified (primers, Table ) using a high-fidelity DNA polymerase (Phusion Hot Start high-fidelity DNA polymerase), and the resulting PCR product was cloned into pJET1.2/blunt (CloneJet PCR cloning kit; Fermentas, Glen Burnie, MD). .. The genes were subsequently subcloned into the broad-host-range plasmid pUCP22 (Table ).

    Article Title: A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes
    Article Snippet: .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher). .. Sanger sequencing was done in 96-well format (Genewiz) using primers recommended with the CloneJET PCR Cloning Kit (Supplementary Table ).

    Article Title: Identification of the High-affinity Substrate-binding Site of the Multidrug and Toxic Compound Extrusion (MATE) Family Transporter from Pseudomonas stutzeri *
    Article Snippet: .. The resulting 1623-bp PCR product was cloned into the pJET1.2 vector using CloneJET PCR cloning kit (Thermo Fisher Scientific). .. Subsequently, a second PCR was performed to add BamHI and EcoRI restriction enzyme sites to flank the target gene.

    Article Title: Release of Antibiotic Resistant Bacteria by a Waste Treatment Plant from Romania
    Article Snippet: .. PCR products were cloned into the pJET1.2 vector (Thermo Scientific) using PCR Cloning Kit CloneJET (Thermo Scientific). .. Cloned sequences were compared with the NCBI database using BLASTN.

    Article Title: A novel type I cystatin of parasite origin with atypical legumain-binding domain
    Article Snippet: .. The PCR products were resolved in a 1% agarose gel, purified by MinElute PCR Purification Kit (Qiagen), and cloned using the CloneJET PCR Cloning Kit (Thermo Scientific) and E . coli XL-1 blue cells (Novagen). .. Clones were sequenced using pJET1.2 primers from the CloneJET PCR Cloning Kit (Thermo Scientific), the BigDye Terminator v. 3.1 Ready Reaction Cycle Sequencing kit (Applied Biosystems), the BigDye X-Terminator Purification Kit, and the ABI 3130 Genetic Analyzer (Applied Biosystems).

    Article Title: Gene expression profiling during hibernation in the European hamster
    Article Snippet: .. The eluted DNA was inserted into a blunt pJET vector using the CloneJET PCR cloning kit (Thermo Fisher Scientific, Waltham, USA), and transformed into DH10β chemically competent Escherichia Coli cells (NEB, Ipswich, MA, USA). .. Forward and reverse sequencing reactions were performed using the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA, USA) using vector primers for amplification.

    Article Title: Deamination-independent restriction of LINE-1 retrotransposition by APOBEC3H
    Article Snippet: .. The spliced product was gel purified with the GenElute Gel Extraction kit (Sigma) and cloned into pJET1.2/blunt vector (CloneJet PCR cloning kit, Thermo Scientific). .. After transformation into Escherichia coli DH5α cells, clones were picked and sent for sequencing using a kit-specific primer (pJET1.2 Forward) at the National Research Council DNA sequencing Facility (Saskatoon, SK).

    Article Title: Discovery, Prevalence, and Persistence of Novel Circular Single-Stranded DNA Viruses in the Ctenophores Mnemiopsis leidyi and Beroe ovata
    Article Snippet: .. Blunt-ended products were cloned using the CloneJET PCR Cloning kit (Life Technologies). ..

    Article Title: What is in your cup of tea? DNA Verity Test to characterize black and green commercial teas
    Article Snippet: .. PCR fragments with multiple peaks within the sequence were cloned using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. Transformation was performed using StrataClone SoloPack Competent Cells (Agilent Technologies).

    Article Title: The genomic basis of circadian and circalunar timing adaptations in a midge
    Article Snippet: .. Besides four assembled full-length transcripts (RA to RD) from RNAseq and assembled EST libraries, additional partial transcripts (RE to RO) were identified by PCR amplification (for PCR primers see ), gel extraction (QIAquick Gel Extraction Kit, Qiagen), cloning with the CloneJET PCR Cloning Kit (Thermo Scientific) and Sanger sequencing with pJET1.2 primers (LGC Genomics & Microsynth). cDNA was prepared from RNA extracted from LIII larvae of the Por and Jean laboratory strains (RNA extraction with RNeasy Plus Mini Kit, Qiagen; reverse transcription with QuantiTect Reverse Transcription Kit, Qiagen). qPCR was performed with variant-specific primers and actin as control gene ( ). cDNA was obtained from independent pools of 20 third instar larvae of the Por and Jean strains. .. Sample size was ten per strain to cover different time points during the day and to test for reproducibility (two samples each at Zeitgeber times 0, 4, 8, 16 and 20; for one Por sample extraction failed; RNA extraction and reverse transcription as above). qPCR was performed with Power SYBR Green PCR Master Mix on a StepOnePlus Real Time System (both Applied Biosystems).

    Article Title: A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC–Cas9 or cleavage by Cas9 in living cells
    Article Snippet: .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Fisher Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher Scientific). .. Sanger sequencing was done in 96-well format (Genewiz) using primers recommended with the CloneJET PCR Cloning Kit (Table ).

    Amplification:

    Article Title: Mutational Profile Of Advanced Primary and Metastatic Radioactive Iodine-Refractory Thyroid Cancers Reveals Distinct Pathogenetic Roles for BRAF, PIK3CA and AKT1
    Article Snippet: DNA samples were amplified by PCR using High-Fidelity Taq DNA Polymerase (Invitrogen, San Diego, CA, USA) and specific primers bracketing the mutation to be analyzed. .. The purified PCR products were ligated into the pJET1.2/blunt cloning vector using CloneJET PCR Cloning Kit (Fermentas, Vilnius, Lithuania) and the ligation products used to transform DH5α competent bacterial cells (Invitrogen).

    Article Title: Hemocyte differentiation mediates the mosquito late-phase immune response against Plasmodium in Anopheles gambiae
    Article Snippet: .. PCR products were subcloned into a pJet1.2 vector using the CloneJet PCR cloning kit (Thermo Scientific) and used as a template for amplification with T7 promoter sequences to amplify T7-PCR products. .. Following PCR purification with the DNA Clean and Concentrator (Zymo Research), resultant T7-PCR templates were used for dsRNA production using the MEGAscript RNAi kit (Life Technologies).

    Article Title: Identification of a Two-Component Regulatory Pathway Essential for Mn(II) Oxidation in Pseudomonas putida GB-1 ▿
    Article Snippet: .. The gene of interest was PCR amplified (primers, Table ) using a high-fidelity DNA polymerase (Phusion Hot Start high-fidelity DNA polymerase), and the resulting PCR product was cloned into pJET1.2/blunt (CloneJet PCR cloning kit; Fermentas, Glen Burnie, MD). .. The genes were subsequently subcloned into the broad-host-range plasmid pUCP22 (Table ).

    Article Title: A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes
    Article Snippet: PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher). .. To perform MiSeq experiments, eGFP target sequences were amplified using primers in Supplementary Table and Phusion high-fidelity DNA polymerase (NEB).

    Article Title: Identification of the High-affinity Substrate-binding Site of the Multidrug and Toxic Compound Extrusion (MATE) Family Transporter from Pseudomonas stutzeri *
    Article Snippet: The gene encoding the NorM_PS (GenBankTM ) was amplified from the genomic DNA of P. stutzeri strain ZoBell (ATCC14405). .. The resulting 1623-bp PCR product was cloned into the pJET1.2 vector using CloneJET PCR cloning kit (Thermo Fisher Scientific).

    Article Title: Release of Antibiotic Resistant Bacteria by a Waste Treatment Plant from Romania
    Article Snippet: Target gene fragments were amplified by PCR using gDNA extracted from a water treatment plant. .. PCR products were cloned into the pJET1.2 vector (Thermo Scientific) using PCR Cloning Kit CloneJET (Thermo Scientific).

    Article Title: A novel type I cystatin of parasite origin with atypical legumain-binding domain
    Article Snippet: Amplification of the cDNA ran as follows: initial denaturation (94 °C, 5 min), 35 denaturation cycles (94 °C, 1 min), primer annealing (60 °C, 1 min) and elongation (72 °C, 1 min), and a final elongation (72 °C, 10 min). .. The PCR products were resolved in a 1% agarose gel, purified by MinElute PCR Purification Kit (Qiagen), and cloned using the CloneJET PCR Cloning Kit (Thermo Scientific) and E . coli XL-1 blue cells (Novagen).

    Article Title: Gene expression profiling during hibernation in the European hamster
    Article Snippet: The eluted DNA was inserted into a blunt pJET vector using the CloneJET PCR cloning kit (Thermo Fisher Scientific, Waltham, USA), and transformed into DH10β chemically competent Escherichia Coli cells (NEB, Ipswich, MA, USA). .. Forward and reverse sequencing reactions were performed using the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA, USA) using vector primers for amplification.

    Article Title: Deamination-independent restriction of LINE-1 retrotransposition by APOBEC3H
    Article Snippet: The PCR cycle used had an initial denaturation step at 98 °C (3 min) followed by 35 cycles of amplification (30 sec at 98 °C, 30 sec at 65.5 °C and 18 sec at 72 °C). .. The spliced product was gel purified with the GenElute Gel Extraction kit (Sigma) and cloned into pJET1.2/blunt vector (CloneJet PCR cloning kit, Thermo Scientific).

    Article Title: Discovery, Prevalence, and Persistence of Novel Circular Single-Stranded DNA Viruses in the Ctenophores Mnemiopsis leidyi and Beroe ovata
    Article Snippet: The DNA extract from each specimen was amplified via rolling circle amplification (RCA) using the Illustra TempliPhi Amplification kit (GE Healthcare), which preferentially amplifies small circular templates (Kim et al., ; Kim and Bae, ). .. Blunt-ended products were cloned using the CloneJET PCR Cloning kit (Life Technologies).

    Article Title: What is in your cup of tea? DNA Verity Test to characterize black and green commercial teas
    Article Snippet: PCR fragments with multiple peaks within the sequence were cloned using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. Ninety-six randomly selected clones from each transformation were amplified using the corresponding DNA barcoding primers.

    Article Title: The genomic basis of circadian and circalunar timing adaptations in a midge
    Article Snippet: .. Besides four assembled full-length transcripts (RA to RD) from RNAseq and assembled EST libraries, additional partial transcripts (RE to RO) were identified by PCR amplification (for PCR primers see ), gel extraction (QIAquick Gel Extraction Kit, Qiagen), cloning with the CloneJET PCR Cloning Kit (Thermo Scientific) and Sanger sequencing with pJET1.2 primers (LGC Genomics & Microsynth). cDNA was prepared from RNA extracted from LIII larvae of the Por and Jean laboratory strains (RNA extraction with RNeasy Plus Mini Kit, Qiagen; reverse transcription with QuantiTect Reverse Transcription Kit, Qiagen). qPCR was performed with variant-specific primers and actin as control gene ( ). cDNA was obtained from independent pools of 20 third instar larvae of the Por and Jean strains. .. Sample size was ten per strain to cover different time points during the day and to test for reproducibility (two samples each at Zeitgeber times 0, 4, 8, 16 and 20; for one Por sample extraction failed; RNA extraction and reverse transcription as above). qPCR was performed with Power SYBR Green PCR Master Mix on a StepOnePlus Real Time System (both Applied Biosystems).

    Article Title: Novel Papillomaviruses in Free-Ranging Iberian Bats: No Virus-Host Co-evolution, No Strict Host Specificity, and Hints for Recombination
    Article Snippet: Paragraph title: Viral Genome Amplification, Sequencing, and Cloning ... Overlapping fragments were generated and used to clone each of the four novel PVs using the CloneJet PCR Cloning Kit (Fermentas) and DH5α cells (Invitrogen).

    Article Title: A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC–Cas9 or cleavage by Cas9 in living cells
    Article Snippet: PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Fisher Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher Scientific). .. Seventy two hours post-transfection, cells were harvested and FACS was used to collect cells expressing mCherry. gDNA was harvested and a 452 bp fragment of FANCF was PCR amplified using nested primers shown in Table .

    Cytometry:

    Article Title: A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes
    Article Snippet: Cells were harvested 72 hrs post-transfection and editing was quantified by flow cytometry (fraction of eGFP and mCherry double-positive cells in total mCherry-positive population). .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher).

    Construct:

    Article Title: Hemocyte differentiation mediates the mosquito late-phase immune response against Plasmodium in Anopheles gambiae
    Article Snippet: PCR products for TEP1, STAT-A, and SOCS were produced with slight modification from previous reports ( , ) to create plasmid constructs for dsRNA production. .. PCR products were subcloned into a pJet1.2 vector using the CloneJet PCR cloning kit (Thermo Scientific) and used as a template for amplification with T7 promoter sequences to amplify T7-PCR products.

    Article Title: Identification of a Two-Component Regulatory Pathway Essential for Mn(II) Oxidation in Pseudomonas putida GB-1 ▿
    Article Snippet: Paragraph title: Plasmid constructs for complementation. ... The gene of interest was PCR amplified (primers, Table ) using a high-fidelity DNA polymerase (Phusion Hot Start high-fidelity DNA polymerase), and the resulting PCR product was cloned into pJET1.2/blunt (CloneJet PCR cloning kit; Fermentas, Glen Burnie, MD).

    Article Title: Identification of the High-affinity Substrate-binding Site of the Multidrug and Toxic Compound Extrusion (MATE) Family Transporter from Pseudomonas stutzeri *
    Article Snippet: The resulting 1623-bp PCR product was cloned into the pJET1.2 vector using CloneJET PCR cloning kit (Thermo Fisher Scientific). .. Site-directed mutations were constructed using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies).

    Real-time Polymerase Chain Reaction:

    Article Title: Release of Antibiotic Resistant Bacteria by a Waste Treatment Plant from Romania
    Article Snippet: Paragraph title: qPCR ... PCR products were cloned into the pJET1.2 vector (Thermo Scientific) using PCR Cloning Kit CloneJET (Thermo Scientific).

    Article Title: The genomic basis of circadian and circalunar timing adaptations in a midge
    Article Snippet: .. Besides four assembled full-length transcripts (RA to RD) from RNAseq and assembled EST libraries, additional partial transcripts (RE to RO) were identified by PCR amplification (for PCR primers see ), gel extraction (QIAquick Gel Extraction Kit, Qiagen), cloning with the CloneJET PCR Cloning Kit (Thermo Scientific) and Sanger sequencing with pJET1.2 primers (LGC Genomics & Microsynth). cDNA was prepared from RNA extracted from LIII larvae of the Por and Jean laboratory strains (RNA extraction with RNeasy Plus Mini Kit, Qiagen; reverse transcription with QuantiTect Reverse Transcription Kit, Qiagen). qPCR was performed with variant-specific primers and actin as control gene ( ). cDNA was obtained from independent pools of 20 third instar larvae of the Por and Jean strains. .. Sample size was ten per strain to cover different time points during the day and to test for reproducibility (two samples each at Zeitgeber times 0, 4, 8, 16 and 20; for one Por sample extraction failed; RNA extraction and reverse transcription as above). qPCR was performed with Power SYBR Green PCR Master Mix on a StepOnePlus Real Time System (both Applied Biosystems).

    Incubation:

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering
    Article Snippet: For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific). .. 1 μl of T4 DNA ligase (5 U/μl) was added to the mixture, mixed and incubated at room temperature for 30 minutes.

    Expressing:

    Article Title: A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC–Cas9 or cleavage by Cas9 in living cells
    Article Snippet: Chromosomal DNA editing experiments A semi-confluent 10 cm plate of 293T cells was transfected with 8 μg of an HIV-1 Gag-Pol packaging plasmid, 1.5 μg of a VSV-G expression plasmid, and 3 μg of the ACE lentiviral reporter plasmid. .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Fisher Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher Scientific).

    Modification:

    Article Title: Hemocyte differentiation mediates the mosquito late-phase immune response against Plasmodium in Anopheles gambiae
    Article Snippet: PCR products for TEP1, STAT-A, and SOCS were produced with slight modification from previous reports ( , ) to create plasmid constructs for dsRNA production. .. PCR products were subcloned into a pJet1.2 vector using the CloneJet PCR cloning kit (Thermo Scientific) and used as a template for amplification with T7 promoter sequences to amplify T7-PCR products.

    Transformation Assay:

    Article Title: Mutational Profile Of Advanced Primary and Metastatic Radioactive Iodine-Refractory Thyroid Cancers Reveals Distinct Pathogenetic Roles for BRAF, PIK3CA and AKT1
    Article Snippet: Paragraph title: Vector Ligation and Transformation ... The purified PCR products were ligated into the pJET1.2/blunt cloning vector using CloneJET PCR Cloning Kit (Fermentas, Vilnius, Lithuania) and the ligation products used to transform DH5α competent bacterial cells (Invitrogen).

    Article Title: Gene expression profiling during hibernation in the European hamster
    Article Snippet: .. The eluted DNA was inserted into a blunt pJET vector using the CloneJET PCR cloning kit (Thermo Fisher Scientific, Waltham, USA), and transformed into DH10β chemically competent Escherichia Coli cells (NEB, Ipswich, MA, USA). .. Forward and reverse sequencing reactions were performed using the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA, USA) using vector primers for amplification.

    Article Title: Deamination-independent restriction of LINE-1 retrotransposition by APOBEC3H
    Article Snippet: The spliced product was gel purified with the GenElute Gel Extraction kit (Sigma) and cloned into pJET1.2/blunt vector (CloneJet PCR cloning kit, Thermo Scientific). .. After transformation into Escherichia coli DH5α cells, clones were picked and sent for sequencing using a kit-specific primer (pJET1.2 Forward) at the National Research Council DNA sequencing Facility (Saskatoon, SK).

    Article Title: What is in your cup of tea? DNA Verity Test to characterize black and green commercial teas
    Article Snippet: PCR fragments with multiple peaks within the sequence were cloned using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. Transformation was performed using StrataClone SoloPack Competent Cells (Agilent Technologies).

    Transfection:

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering
    Article Snippet: For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific). .. For bacterial transfection, 10 μl of the mixture was mixed with 100 μl of HB101 E. coli competent cells and incubated on ice for 45 minutes.

    Article Title: A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes
    Article Snippet: Transduced, mCherry-positive cells were transfected with 800 ng APOBEC-Cas9n-UGI editor and 200 ng of targeting or NS-gRNA were transfected into a semi-confluent 6-well plate of reporter-transduced cells. .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher).

    Article Title: Deamination-independent restriction of LINE-1 retrotransposition by APOBEC3H
    Article Snippet: Cellular DNA from the transfected cells was extracted 72 hr post-transfection using DNAzol reagent (Thermo Fisher). .. The spliced product was gel purified with the GenElute Gel Extraction kit (Sigma) and cloned into pJET1.2/blunt vector (CloneJet PCR cloning kit, Thermo Scientific).

    Article Title: A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC–Cas9 or cleavage by Cas9 in living cells
    Article Snippet: Forty eight hours post-transduction, 600 ng APOBEC–Cas9n-UGI editor and 250 ng of targeting or NS-gRNA were transfected into a semi-confluent six-well plate of ACE-transduced cells. .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Fisher Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher Scientific).

    Ligation:

    Article Title: Mutational Profile Of Advanced Primary and Metastatic Radioactive Iodine-Refractory Thyroid Cancers Reveals Distinct Pathogenetic Roles for BRAF, PIK3CA and AKT1
    Article Snippet: .. The purified PCR products were ligated into the pJET1.2/blunt cloning vector using CloneJET PCR Cloning Kit (Fermentas, Vilnius, Lithuania) and the ligation products used to transform DH5α competent bacterial cells (Invitrogen). .. Positive colonies were screened by colony PCR using High-Fidelity Taq DNA Polymerase (Invitrogen) and analyzed by 2% agarose gel electrophoresis.

    Article Title: Identification of a Two-Component Regulatory Pathway Essential for Mn(II) Oxidation in Pseudomonas putida GB-1 ▿
    Article Snippet: The gene of interest was PCR amplified (primers, Table ) using a high-fidelity DNA polymerase (Phusion Hot Start high-fidelity DNA polymerase), and the resulting PCR product was cloned into pJET1.2/blunt (CloneJet PCR cloning kit; Fermentas, Glen Burnie, MD). .. It was then subcloned by digestion with XbaI and XhoI and ligation of the resulting fragment into pUCP22 digested with XbaI and SalI.

    Generated:

    Article Title: Release of Antibiotic Resistant Bacteria by a Waste Treatment Plant from Romania
    Article Snippet: Standard curves were generated using recombinant plasmids produced by the cloning genes of interest into a cloning vector. .. PCR products were cloned into the pJET1.2 vector (Thermo Scientific) using PCR Cloning Kit CloneJET (Thermo Scientific).

    Article Title: Novel Papillomaviruses in Free-Ranging Iberian Bats: No Virus-Host Co-evolution, No Strict Host Specificity, and Hints for Recombination
    Article Snippet: .. Overlapping fragments were generated and used to clone each of the four novel PVs using the CloneJet PCR Cloning Kit (Fermentas) and DH5α cells (Invitrogen). .. Two clones per overlapping fragment were selected and sequenced to further confirm the PVs genome sequence.

    DNA Sequencing:

    Article Title: Deamination-independent restriction of LINE-1 retrotransposition by APOBEC3H
    Article Snippet: The spliced product was gel purified with the GenElute Gel Extraction kit (Sigma) and cloned into pJET1.2/blunt vector (CloneJet PCR cloning kit, Thermo Scientific). .. After transformation into Escherichia coli DH5α cells, clones were picked and sent for sequencing using a kit-specific primer (pJET1.2 Forward) at the National Research Council DNA sequencing Facility (Saskatoon, SK).

    Article Title: What is in your cup of tea? DNA Verity Test to characterize black and green commercial teas
    Article Snippet: The sequences were analyzed using AB DNA Sequencing Analysis version 5.2 software (Applied Biosystems, Thermo Fisher Scientific Inc.), edited in Chromas lite ver. .. PCR fragments with multiple peaks within the sequence were cloned using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions.

    Sequencing:

    Article Title: Mutational Profile Of Advanced Primary and Metastatic Radioactive Iodine-Refractory Thyroid Cancers Reveals Distinct Pathogenetic Roles for BRAF, PIK3CA and AKT1
    Article Snippet: The purified PCR products were ligated into the pJET1.2/blunt cloning vector using CloneJET PCR Cloning Kit (Fermentas, Vilnius, Lithuania) and the ligation products used to transform DH5α competent bacterial cells (Invitrogen). .. PCR products of the expected size were sequenced using pJET1.2 sequencing primers.

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering
    Article Snippet: .. For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific). .. 1 μl of blunt vector (50 ng/μl), 50 ng/μl of the PCR product, and 10 μl of 2X reaction buffer (provided in the kit) were mixed and filled with water to a total volume of 20 μl.

    Article Title: A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes
    Article Snippet: .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher). .. Sanger sequencing was done in 96-well format (Genewiz) using primers recommended with the CloneJET PCR Cloning Kit (Supplementary Table ).

    Article Title: A novel type I cystatin of parasite origin with atypical legumain-binding domain
    Article Snippet: Forward (EnStefFWD: 5′-ATGCAAATGGTTGGAGGAATTGGTGCTTCA-3′) and reverse (EnStefREV: 5′-TCAAAAATATTCCAAGATATCGTCTTCAGA-3′) primers for amplification of the full-length stefin-coding sequence were designed on the basis of the 297 bp sequence of plathyhelminth stefin ortholog that was identified in the E . nipponicum transcriptome. .. The PCR products were resolved in a 1% agarose gel, purified by MinElute PCR Purification Kit (Qiagen), and cloned using the CloneJET PCR Cloning Kit (Thermo Scientific) and E . coli XL-1 blue cells (Novagen).

    Article Title: Gene expression profiling during hibernation in the European hamster
    Article Snippet: The eluted DNA was inserted into a blunt pJET vector using the CloneJET PCR cloning kit (Thermo Fisher Scientific, Waltham, USA), and transformed into DH10β chemically competent Escherichia Coli cells (NEB, Ipswich, MA, USA). .. Forward and reverse sequencing reactions were performed using the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA, USA) using vector primers for amplification.

    Article Title: Deamination-independent restriction of LINE-1 retrotransposition by APOBEC3H
    Article Snippet: The spliced product was gel purified with the GenElute Gel Extraction kit (Sigma) and cloned into pJET1.2/blunt vector (CloneJet PCR cloning kit, Thermo Scientific). .. After transformation into Escherichia coli DH5α cells, clones were picked and sent for sequencing using a kit-specific primer (pJET1.2 Forward) at the National Research Council DNA sequencing Facility (Saskatoon, SK).

    Article Title: What is in your cup of tea? DNA Verity Test to characterize black and green commercial teas
    Article Snippet: .. PCR fragments with multiple peaks within the sequence were cloned using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. Transformation was performed using StrataClone SoloPack Competent Cells (Agilent Technologies).

    Article Title: The genomic basis of circadian and circalunar timing adaptations in a midge
    Article Snippet: .. Besides four assembled full-length transcripts (RA to RD) from RNAseq and assembled EST libraries, additional partial transcripts (RE to RO) were identified by PCR amplification (for PCR primers see ), gel extraction (QIAquick Gel Extraction Kit, Qiagen), cloning with the CloneJET PCR Cloning Kit (Thermo Scientific) and Sanger sequencing with pJET1.2 primers (LGC Genomics & Microsynth). cDNA was prepared from RNA extracted from LIII larvae of the Por and Jean laboratory strains (RNA extraction with RNeasy Plus Mini Kit, Qiagen; reverse transcription with QuantiTect Reverse Transcription Kit, Qiagen). qPCR was performed with variant-specific primers and actin as control gene ( ). cDNA was obtained from independent pools of 20 third instar larvae of the Por and Jean strains. .. Sample size was ten per strain to cover different time points during the day and to test for reproducibility (two samples each at Zeitgeber times 0, 4, 8, 16 and 20; for one Por sample extraction failed; RNA extraction and reverse transcription as above). qPCR was performed with Power SYBR Green PCR Master Mix on a StepOnePlus Real Time System (both Applied Biosystems).

    Article Title: Novel Papillomaviruses in Free-Ranging Iberian Bats: No Virus-Host Co-evolution, No Strict Host Specificity, and Hints for Recombination
    Article Snippet: Paragraph title: Viral Genome Amplification, Sequencing, and Cloning ... Overlapping fragments were generated and used to clone each of the four novel PVs using the CloneJet PCR Cloning Kit (Fermentas) and DH5α cells (Invitrogen).

    Article Title: A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC–Cas9 or cleavage by Cas9 in living cells
    Article Snippet: .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Fisher Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher Scientific). .. Sanger sequencing was done in 96-well format (Genewiz) using primers recommended with the CloneJET PCR Cloning Kit (Table ).

    Recombinant:

    Article Title: Release of Antibiotic Resistant Bacteria by a Waste Treatment Plant from Romania
    Article Snippet: Standard curves were generated using recombinant plasmids produced by the cloning genes of interest into a cloning vector. .. PCR products were cloned into the pJET1.2 vector (Thermo Scientific) using PCR Cloning Kit CloneJET (Thermo Scientific).

    RNA Sequencing Assay:

    Article Title: The genomic basis of circadian and circalunar timing adaptations in a midge
    Article Snippet: Molecular characterization of CaMKII.1 RNAseq data of the Por and Jean strains for CaMKII.1 were obtained from the larval RNA sequencing experiment described above. .. Besides four assembled full-length transcripts (RA to RD) from RNAseq and assembled EST libraries, additional partial transcripts (RE to RO) were identified by PCR amplification (for PCR primers see ), gel extraction (QIAquick Gel Extraction Kit, Qiagen), cloning with the CloneJET PCR Cloning Kit (Thermo Scientific) and Sanger sequencing with pJET1.2 primers (LGC Genomics & Microsynth). cDNA was prepared from RNA extracted from LIII larvae of the Por and Jean laboratory strains (RNA extraction with RNeasy Plus Mini Kit, Qiagen; reverse transcription with QuantiTect Reverse Transcription Kit, Qiagen). qPCR was performed with variant-specific primers and actin as control gene ( ). cDNA was obtained from independent pools of 20 third instar larvae of the Por and Jean strains.

    Fluorescence:

    Article Title: A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes
    Article Snippet: 48 hrs post-transduction cells were sorted to enrich for a mCherry-positive population (confirmed > 85% by subsequent flow cytometry and fluorescence microscopy). .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher).

    Mutagenesis:

    Article Title: Mutational Profile Of Advanced Primary and Metastatic Radioactive Iodine-Refractory Thyroid Cancers Reveals Distinct Pathogenetic Roles for BRAF, PIK3CA and AKT1
    Article Snippet: DNA samples were amplified by PCR using High-Fidelity Taq DNA Polymerase (Invitrogen, San Diego, CA, USA) and specific primers bracketing the mutation to be analyzed. .. The purified PCR products were ligated into the pJET1.2/blunt cloning vector using CloneJET PCR Cloning Kit (Fermentas, Vilnius, Lithuania) and the ligation products used to transform DH5α competent bacterial cells (Invitrogen).

    Article Title: Identification of the High-affinity Substrate-binding Site of the Multidrug and Toxic Compound Extrusion (MATE) Family Transporter from Pseudomonas stutzeri *
    Article Snippet: The resulting 1623-bp PCR product was cloned into the pJET1.2 vector using CloneJET PCR cloning kit (Thermo Fisher Scientific). .. Site-directed mutations were constructed using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies).

    Isolation:

    Article Title: A novel type I cystatin of parasite origin with atypical legumain-binding domain
    Article Snippet: The cloning of EnStef Total RNA from adult E . nipponicum worms was isolated using the High Pure RNA Tissue Kit (Roche) following the manufacturer’s instructions. .. The PCR products were resolved in a 1% agarose gel, purified by MinElute PCR Purification Kit (Qiagen), and cloned using the CloneJET PCR Cloning Kit (Thermo Scientific) and E . coli XL-1 blue cells (Novagen).

    Flow Cytometry:

    Article Title: A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes
    Article Snippet: Cells were harvested 72 hrs post-transfection and editing was quantified by flow cytometry (fraction of eGFP and mCherry double-positive cells in total mCherry-positive population). .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher).

    Article Title: A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC–Cas9 or cleavage by Cas9 in living cells
    Article Snippet: Cells were harvested 96 h post-transfection and editing was quantified by flow-cytometry. .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Fisher Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher Scientific).

    Microscopy:

    Article Title: A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes
    Article Snippet: 48 hrs post-transduction cells were sorted to enrich for a mCherry-positive population (confirmed > 85% by subsequent flow cytometry and fluorescence microscopy). .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher).

    Purification:

    Article Title: Mutational Profile Of Advanced Primary and Metastatic Radioactive Iodine-Refractory Thyroid Cancers Reveals Distinct Pathogenetic Roles for BRAF, PIK3CA and AKT1
    Article Snippet: .. The purified PCR products were ligated into the pJET1.2/blunt cloning vector using CloneJET PCR Cloning Kit (Fermentas, Vilnius, Lithuania) and the ligation products used to transform DH5α competent bacterial cells (Invitrogen). .. Positive colonies were screened by colony PCR using High-Fidelity Taq DNA Polymerase (Invitrogen) and analyzed by 2% agarose gel electrophoresis.

    Article Title: Hemocyte differentiation mediates the mosquito late-phase immune response against Plasmodium in Anopheles gambiae
    Article Snippet: PCR products were subcloned into a pJet1.2 vector using the CloneJet PCR cloning kit (Thermo Scientific) and used as a template for amplification with T7 promoter sequences to amplify T7-PCR products. .. Following PCR purification with the DNA Clean and Concentrator (Zymo Research), resultant T7-PCR templates were used for dsRNA production using the MEGAscript RNAi kit (Life Technologies).

    Article Title: A novel type I cystatin of parasite origin with atypical legumain-binding domain
    Article Snippet: .. The PCR products were resolved in a 1% agarose gel, purified by MinElute PCR Purification Kit (Qiagen), and cloned using the CloneJET PCR Cloning Kit (Thermo Scientific) and E . coli XL-1 blue cells (Novagen). .. Clones were sequenced using pJET1.2 primers from the CloneJET PCR Cloning Kit (Thermo Scientific), the BigDye Terminator v. 3.1 Ready Reaction Cycle Sequencing kit (Applied Biosystems), the BigDye X-Terminator Purification Kit, and the ABI 3130 Genetic Analyzer (Applied Biosystems).

    Article Title: Gene expression profiling during hibernation in the European hamster
    Article Snippet: If multiple bands were observed, the PCR products were purified using the high pure purification kit (Roche Mannheim, Germany). .. The eluted DNA was inserted into a blunt pJET vector using the CloneJET PCR cloning kit (Thermo Fisher Scientific, Waltham, USA), and transformed into DH10β chemically competent Escherichia Coli cells (NEB, Ipswich, MA, USA).

    Article Title: Deamination-independent restriction of LINE-1 retrotransposition by APOBEC3H
    Article Snippet: .. The spliced product was gel purified with the GenElute Gel Extraction kit (Sigma) and cloned into pJET1.2/blunt vector (CloneJet PCR cloning kit, Thermo Scientific). .. After transformation into Escherichia coli DH5α cells, clones were picked and sent for sequencing using a kit-specific primer (pJET1.2 Forward) at the National Research Council DNA sequencing Facility (Saskatoon, SK).

    Article Title: Discovery, Prevalence, and Persistence of Novel Circular Single-Stranded DNA Viruses in the Ctenophores Mnemiopsis leidyi and Beroe ovata
    Article Snippet: RE digestions were visualized on a 1.5% agarose gel, then bands within a size range of 1000–4000 bp were excised and purified using the Zymoclean Gel DNA Recovery Kit (Zymo Research). .. Blunt-ended products were cloned using the CloneJET PCR Cloning kit (Life Technologies).

    Article Title: What is in your cup of tea? DNA Verity Test to characterize black and green commercial teas
    Article Snippet: The reactions were purified using BigDye XTerminator Purification Kit (Applied Biosystems, Thermo Fisher Scientific) and read using an automated sequencer (3130 Genetic Analyzer, Life Technologies, Thermo Fisher Scientific). .. PCR fragments with multiple peaks within the sequence were cloned using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions.

    Polymerase Chain Reaction:

    Article Title: Mutational Profile Of Advanced Primary and Metastatic Radioactive Iodine-Refractory Thyroid Cancers Reveals Distinct Pathogenetic Roles for BRAF, PIK3CA and AKT1
    Article Snippet: .. The purified PCR products were ligated into the pJET1.2/blunt cloning vector using CloneJET PCR Cloning Kit (Fermentas, Vilnius, Lithuania) and the ligation products used to transform DH5α competent bacterial cells (Invitrogen). .. Positive colonies were screened by colony PCR using High-Fidelity Taq DNA Polymerase (Invitrogen) and analyzed by 2% agarose gel electrophoresis.

    Article Title: Hemocyte differentiation mediates the mosquito late-phase immune response against Plasmodium in Anopheles gambiae
    Article Snippet: .. PCR products were subcloned into a pJet1.2 vector using the CloneJet PCR cloning kit (Thermo Scientific) and used as a template for amplification with T7 promoter sequences to amplify T7-PCR products. .. Following PCR purification with the DNA Clean and Concentrator (Zymo Research), resultant T7-PCR templates were used for dsRNA production using the MEGAscript RNAi kit (Life Technologies).

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering
    Article Snippet: .. For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific). .. 1 μl of blunt vector (50 ng/μl), 50 ng/μl of the PCR product, and 10 μl of 2X reaction buffer (provided in the kit) were mixed and filled with water to a total volume of 20 μl.

    Article Title: Identification of a Two-Component Regulatory Pathway Essential for Mn(II) Oxidation in Pseudomonas putida GB-1 ▿
    Article Snippet: .. The gene of interest was PCR amplified (primers, Table ) using a high-fidelity DNA polymerase (Phusion Hot Start high-fidelity DNA polymerase), and the resulting PCR product was cloned into pJET1.2/blunt (CloneJet PCR cloning kit; Fermentas, Glen Burnie, MD). .. The genes were subsequently subcloned into the broad-host-range plasmid pUCP22 (Table ).

    Article Title: A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes
    Article Snippet: .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher). .. Sanger sequencing was done in 96-well format (Genewiz) using primers recommended with the CloneJET PCR Cloning Kit (Supplementary Table ).

    Article Title: Identification of the High-affinity Substrate-binding Site of the Multidrug and Toxic Compound Extrusion (MATE) Family Transporter from Pseudomonas stutzeri *
    Article Snippet: .. The resulting 1623-bp PCR product was cloned into the pJET1.2 vector using CloneJET PCR cloning kit (Thermo Fisher Scientific). .. Subsequently, a second PCR was performed to add BamHI and EcoRI restriction enzyme sites to flank the target gene.

    Article Title: Release of Antibiotic Resistant Bacteria by a Waste Treatment Plant from Romania
    Article Snippet: .. PCR products were cloned into the pJET1.2 vector (Thermo Scientific) using PCR Cloning Kit CloneJET (Thermo Scientific). .. Cloned sequences were compared with the NCBI database using BLASTN.

    Article Title: A novel type I cystatin of parasite origin with atypical legumain-binding domain
    Article Snippet: .. The PCR products were resolved in a 1% agarose gel, purified by MinElute PCR Purification Kit (Qiagen), and cloned using the CloneJET PCR Cloning Kit (Thermo Scientific) and E . coli XL-1 blue cells (Novagen). .. Clones were sequenced using pJET1.2 primers from the CloneJET PCR Cloning Kit (Thermo Scientific), the BigDye Terminator v. 3.1 Ready Reaction Cycle Sequencing kit (Applied Biosystems), the BigDye X-Terminator Purification Kit, and the ABI 3130 Genetic Analyzer (Applied Biosystems).

    Article Title: Gene expression profiling during hibernation in the European hamster
    Article Snippet: .. The eluted DNA was inserted into a blunt pJET vector using the CloneJET PCR cloning kit (Thermo Fisher Scientific, Waltham, USA), and transformed into DH10β chemically competent Escherichia Coli cells (NEB, Ipswich, MA, USA). .. Forward and reverse sequencing reactions were performed using the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA, USA) using vector primers for amplification.

    Article Title: Deamination-independent restriction of LINE-1 retrotransposition by APOBEC3H
    Article Snippet: .. The spliced product was gel purified with the GenElute Gel Extraction kit (Sigma) and cloned into pJET1.2/blunt vector (CloneJet PCR cloning kit, Thermo Scientific). .. After transformation into Escherichia coli DH5α cells, clones were picked and sent for sequencing using a kit-specific primer (pJET1.2 Forward) at the National Research Council DNA sequencing Facility (Saskatoon, SK).

    Article Title: Discovery, Prevalence, and Persistence of Novel Circular Single-Stranded DNA Viruses in the Ctenophores Mnemiopsis leidyi and Beroe ovata
    Article Snippet: .. Blunt-ended products were cloned using the CloneJET PCR Cloning kit (Life Technologies). ..

    Article Title: What is in your cup of tea? DNA Verity Test to characterize black and green commercial teas
    Article Snippet: .. PCR fragments with multiple peaks within the sequence were cloned using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. .. Transformation was performed using StrataClone SoloPack Competent Cells (Agilent Technologies).

    Article Title: The genomic basis of circadian and circalunar timing adaptations in a midge
    Article Snippet: .. Besides four assembled full-length transcripts (RA to RD) from RNAseq and assembled EST libraries, additional partial transcripts (RE to RO) were identified by PCR amplification (for PCR primers see ), gel extraction (QIAquick Gel Extraction Kit, Qiagen), cloning with the CloneJET PCR Cloning Kit (Thermo Scientific) and Sanger sequencing with pJET1.2 primers (LGC Genomics & Microsynth). cDNA was prepared from RNA extracted from LIII larvae of the Por and Jean laboratory strains (RNA extraction with RNeasy Plus Mini Kit, Qiagen; reverse transcription with QuantiTect Reverse Transcription Kit, Qiagen). qPCR was performed with variant-specific primers and actin as control gene ( ). cDNA was obtained from independent pools of 20 third instar larvae of the Por and Jean strains. .. Sample size was ten per strain to cover different time points during the day and to test for reproducibility (two samples each at Zeitgeber times 0, 4, 8, 16 and 20; for one Por sample extraction failed; RNA extraction and reverse transcription as above). qPCR was performed with Power SYBR Green PCR Master Mix on a StepOnePlus Real Time System (both Applied Biosystems).

    Article Title: A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC–Cas9 or cleavage by Cas9 in living cells
    Article Snippet: .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Fisher Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher Scientific). .. Sanger sequencing was done in 96-well format (Genewiz) using primers recommended with the CloneJET PCR Cloning Kit (Table ).

    FACS:

    Article Title: A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes
    Article Snippet: In a subset of chromosomal editing experiments, eGFP-positive cells were recovered by FACS, converted to genomic DNA (Qiagen Gentra Puregene), and subjected to high-fidelity PCR using Phusion (NEB) to amplify eGFP target sequences. .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher).

    Article Title: A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC–Cas9 or cleavage by Cas9 in living cells
    Article Snippet: In a subset of experiments, mCherry-positive cells were recovered by FACS, converted to genomic DNA (Gentra Puregene), and subjected to high-fidelity PCR using Phusion (NEB) to amplify mCherry target sequences (primers in Table ). .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Fisher Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher Scientific).

    Gel Extraction:

    Article Title: A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes
    Article Snippet: .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher). .. Sanger sequencing was done in 96-well format (Genewiz) using primers recommended with the CloneJET PCR Cloning Kit (Supplementary Table ).

    Article Title: Deamination-independent restriction of LINE-1 retrotransposition by APOBEC3H
    Article Snippet: .. The spliced product was gel purified with the GenElute Gel Extraction kit (Sigma) and cloned into pJET1.2/blunt vector (CloneJet PCR cloning kit, Thermo Scientific). .. After transformation into Escherichia coli DH5α cells, clones were picked and sent for sequencing using a kit-specific primer (pJET1.2 Forward) at the National Research Council DNA sequencing Facility (Saskatoon, SK).

    Article Title: The genomic basis of circadian and circalunar timing adaptations in a midge
    Article Snippet: .. Besides four assembled full-length transcripts (RA to RD) from RNAseq and assembled EST libraries, additional partial transcripts (RE to RO) were identified by PCR amplification (for PCR primers see ), gel extraction (QIAquick Gel Extraction Kit, Qiagen), cloning with the CloneJET PCR Cloning Kit (Thermo Scientific) and Sanger sequencing with pJET1.2 primers (LGC Genomics & Microsynth). cDNA was prepared from RNA extracted from LIII larvae of the Por and Jean laboratory strains (RNA extraction with RNeasy Plus Mini Kit, Qiagen; reverse transcription with QuantiTect Reverse Transcription Kit, Qiagen). qPCR was performed with variant-specific primers and actin as control gene ( ). cDNA was obtained from independent pools of 20 third instar larvae of the Por and Jean strains. .. Sample size was ten per strain to cover different time points during the day and to test for reproducibility (two samples each at Zeitgeber times 0, 4, 8, 16 and 20; for one Por sample extraction failed; RNA extraction and reverse transcription as above). qPCR was performed with Power SYBR Green PCR Master Mix on a StepOnePlus Real Time System (both Applied Biosystems).

    Article Title: A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC–Cas9 or cleavage by Cas9 in living cells
    Article Snippet: .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Fisher Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher Scientific). .. Sanger sequencing was done in 96-well format (Genewiz) using primers recommended with the CloneJET PCR Cloning Kit (Table ).

    Activated Clotting Time Assay:

    Article Title: Release of Antibiotic Resistant Bacteria by a Waste Treatment Plant from Romania
    Article Snippet: PCR products were cloned into the pJET1.2 vector (Thermo Scientific) using PCR Cloning Kit CloneJET (Thermo Scientific). .. In the standard curve for all bacteria, a fragment of the 16S rRNA gene from Escherichia coli was amplified by PCR with the universal primers 27F (5′-TCM TGA AGA TGG GTT CTC AG-3′) ( ) and 1492R (5′-ACG ACT GTT CTT GGT TAC T-3′) ( ) and then cloned.

    Plasmid Preparation:

    Article Title: Mutational Profile Of Advanced Primary and Metastatic Radioactive Iodine-Refractory Thyroid Cancers Reveals Distinct Pathogenetic Roles for BRAF, PIK3CA and AKT1
    Article Snippet: .. The purified PCR products were ligated into the pJET1.2/blunt cloning vector using CloneJET PCR Cloning Kit (Fermentas, Vilnius, Lithuania) and the ligation products used to transform DH5α competent bacterial cells (Invitrogen). .. Positive colonies were screened by colony PCR using High-Fidelity Taq DNA Polymerase (Invitrogen) and analyzed by 2% agarose gel electrophoresis.

    Article Title: Hemocyte differentiation mediates the mosquito late-phase immune response against Plasmodium in Anopheles gambiae
    Article Snippet: .. PCR products were subcloned into a pJet1.2 vector using the CloneJet PCR cloning kit (Thermo Scientific) and used as a template for amplification with T7 promoter sequences to amplify T7-PCR products. .. Following PCR purification with the DNA Clean and Concentrator (Zymo Research), resultant T7-PCR templates were used for dsRNA production using the MEGAscript RNAi kit (Life Technologies).

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering
    Article Snippet: For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific). .. 1 μl of blunt vector (50 ng/μl), 50 ng/μl of the PCR product, and 10 μl of 2X reaction buffer (provided in the kit) were mixed and filled with water to a total volume of 20 μl.

    Article Title: Identification of a Two-Component Regulatory Pathway Essential for Mn(II) Oxidation in Pseudomonas putida GB-1 ▿
    Article Snippet: Paragraph title: Plasmid constructs for complementation. ... The gene of interest was PCR amplified (primers, Table ) using a high-fidelity DNA polymerase (Phusion Hot Start high-fidelity DNA polymerase), and the resulting PCR product was cloned into pJET1.2/blunt (CloneJet PCR cloning kit; Fermentas, Glen Burnie, MD).

    Article Title: A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes
    Article Snippet: .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher). .. Sanger sequencing was done in 96-well format (Genewiz) using primers recommended with the CloneJET PCR Cloning Kit (Supplementary Table ).

    Article Title: Identification of the High-affinity Substrate-binding Site of the Multidrug and Toxic Compound Extrusion (MATE) Family Transporter from Pseudomonas stutzeri *
    Article Snippet: .. The resulting 1623-bp PCR product was cloned into the pJET1.2 vector using CloneJET PCR cloning kit (Thermo Fisher Scientific). .. Subsequently, a second PCR was performed to add BamHI and EcoRI restriction enzyme sites to flank the target gene.

    Article Title: Release of Antibiotic Resistant Bacteria by a Waste Treatment Plant from Romania
    Article Snippet: .. PCR products were cloned into the pJET1.2 vector (Thermo Scientific) using PCR Cloning Kit CloneJET (Thermo Scientific). .. Cloned sequences were compared with the NCBI database using BLASTN.

    Article Title: Gene expression profiling during hibernation in the European hamster
    Article Snippet: .. The eluted DNA was inserted into a blunt pJET vector using the CloneJET PCR cloning kit (Thermo Fisher Scientific, Waltham, USA), and transformed into DH10β chemically competent Escherichia Coli cells (NEB, Ipswich, MA, USA). .. Forward and reverse sequencing reactions were performed using the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA, USA) using vector primers for amplification.

    Article Title: Deamination-independent restriction of LINE-1 retrotransposition by APOBEC3H
    Article Snippet: .. The spliced product was gel purified with the GenElute Gel Extraction kit (Sigma) and cloned into pJET1.2/blunt vector (CloneJet PCR cloning kit, Thermo Scientific). .. After transformation into Escherichia coli DH5α cells, clones were picked and sent for sequencing using a kit-specific primer (pJET1.2 Forward) at the National Research Council DNA sequencing Facility (Saskatoon, SK).

    Article Title: A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC–Cas9 or cleavage by Cas9 in living cells
    Article Snippet: .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Fisher Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher Scientific). .. Sanger sequencing was done in 96-well format (Genewiz) using primers recommended with the CloneJET PCR Cloning Kit (Table ).

    Software:

    Article Title: Gene expression profiling during hibernation in the European hamster
    Article Snippet: The eluted DNA was inserted into a blunt pJET vector using the CloneJET PCR cloning kit (Thermo Fisher Scientific, Waltham, USA), and transformed into DH10β chemically competent Escherichia Coli cells (NEB, Ipswich, MA, USA). .. Data analysis was performed using Sequencher® version 5.4.6 DNA sequence analysis software (Gene Codes Corporation, Ann Arbor, MI, USA).

    Article Title: What is in your cup of tea? DNA Verity Test to characterize black and green commercial teas
    Article Snippet: 7.2.5 software [ ]. .. PCR fragments with multiple peaks within the sequence were cloned using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions.

    SYBR Green Assay:

    Article Title: The genomic basis of circadian and circalunar timing adaptations in a midge
    Article Snippet: Besides four assembled full-length transcripts (RA to RD) from RNAseq and assembled EST libraries, additional partial transcripts (RE to RO) were identified by PCR amplification (for PCR primers see ), gel extraction (QIAquick Gel Extraction Kit, Qiagen), cloning with the CloneJET PCR Cloning Kit (Thermo Scientific) and Sanger sequencing with pJET1.2 primers (LGC Genomics & Microsynth). cDNA was prepared from RNA extracted from LIII larvae of the Por and Jean laboratory strains (RNA extraction with RNeasy Plus Mini Kit, Qiagen; reverse transcription with QuantiTect Reverse Transcription Kit, Qiagen). qPCR was performed with variant-specific primers and actin as control gene ( ). cDNA was obtained from independent pools of 20 third instar larvae of the Por and Jean strains. .. Sample size was ten per strain to cover different time points during the day and to test for reproducibility (two samples each at Zeitgeber times 0, 4, 8, 16 and 20; for one Por sample extraction failed; RNA extraction and reverse transcription as above). qPCR was performed with Power SYBR Green PCR Master Mix on a StepOnePlus Real Time System (both Applied Biosystems).

    RNA Extraction:

    Article Title: The genomic basis of circadian and circalunar timing adaptations in a midge
    Article Snippet: .. Besides four assembled full-length transcripts (RA to RD) from RNAseq and assembled EST libraries, additional partial transcripts (RE to RO) were identified by PCR amplification (for PCR primers see ), gel extraction (QIAquick Gel Extraction Kit, Qiagen), cloning with the CloneJET PCR Cloning Kit (Thermo Scientific) and Sanger sequencing with pJET1.2 primers (LGC Genomics & Microsynth). cDNA was prepared from RNA extracted from LIII larvae of the Por and Jean laboratory strains (RNA extraction with RNeasy Plus Mini Kit, Qiagen; reverse transcription with QuantiTect Reverse Transcription Kit, Qiagen). qPCR was performed with variant-specific primers and actin as control gene ( ). cDNA was obtained from independent pools of 20 third instar larvae of the Por and Jean strains. .. Sample size was ten per strain to cover different time points during the day and to test for reproducibility (two samples each at Zeitgeber times 0, 4, 8, 16 and 20; for one Por sample extraction failed; RNA extraction and reverse transcription as above). qPCR was performed with Power SYBR Green PCR Master Mix on a StepOnePlus Real Time System (both Applied Biosystems).

    Agarose Gel Electrophoresis:

    Article Title: Mutational Profile Of Advanced Primary and Metastatic Radioactive Iodine-Refractory Thyroid Cancers Reveals Distinct Pathogenetic Roles for BRAF, PIK3CA and AKT1
    Article Snippet: The purified PCR products were ligated into the pJET1.2/blunt cloning vector using CloneJET PCR Cloning Kit (Fermentas, Vilnius, Lithuania) and the ligation products used to transform DH5α competent bacterial cells (Invitrogen). .. Positive colonies were screened by colony PCR using High-Fidelity Taq DNA Polymerase (Invitrogen) and analyzed by 2% agarose gel electrophoresis.

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering
    Article Snippet: DNA was mixed with 10 μl loading dye (6X) (Thermo Scientific) and loaded on the agarose gel (CARL ROTH) using 80 V for one hour in TAE buffer. .. For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific).

    Article Title: A novel type I cystatin of parasite origin with atypical legumain-binding domain
    Article Snippet: .. The PCR products were resolved in a 1% agarose gel, purified by MinElute PCR Purification Kit (Qiagen), and cloned using the CloneJET PCR Cloning Kit (Thermo Scientific) and E . coli XL-1 blue cells (Novagen). .. Clones were sequenced using pJET1.2 primers from the CloneJET PCR Cloning Kit (Thermo Scientific), the BigDye Terminator v. 3.1 Ready Reaction Cycle Sequencing kit (Applied Biosystems), the BigDye X-Terminator Purification Kit, and the ABI 3130 Genetic Analyzer (Applied Biosystems).

    Article Title: Discovery, Prevalence, and Persistence of Novel Circular Single-Stranded DNA Viruses in the Ctenophores Mnemiopsis leidyi and Beroe ovata
    Article Snippet: RE digestions were visualized on a 1.5% agarose gel, then bands within a size range of 1000–4000 bp were excised and purified using the Zymoclean Gel DNA Recovery Kit (Zymo Research). .. Blunt-ended products were cloned using the CloneJET PCR Cloning kit (Life Technologies).

    Size-exclusion Chromatography:

    Article Title: Deamination-independent restriction of LINE-1 retrotransposition by APOBEC3H
    Article Snippet: The PCR cycle used had an initial denaturation step at 98 °C (3 min) followed by 35 cycles of amplification (30 sec at 98 °C, 30 sec at 65.5 °C and 18 sec at 72 °C). .. The spliced product was gel purified with the GenElute Gel Extraction kit (Sigma) and cloned into pJET1.2/blunt vector (CloneJet PCR cloning kit, Thermo Scientific).

    Chromosome Walking:

    Article Title: Discovery, Prevalence, and Persistence of Novel Circular Single-Stranded DNA Viruses in the Ctenophores Mnemiopsis leidyi and Beroe ovata
    Article Snippet: Blunt-ended products were cloned using the CloneJET PCR Cloning kit (Life Technologies). .. Genomes exhibiting significant similarities to eukaryotic CRESS-DNA viruses as determined by BLASTx searches against GenBank (Altschul et al., ) were completed through primer walking with a minimum of 2x coverage.

    Spectrophotometry:

    Article Title: Release of Antibiotic Resistant Bacteria by a Waste Treatment Plant from Romania
    Article Snippet: PCR products were cloned into the pJET1.2 vector (Thermo Scientific) using PCR Cloning Kit CloneJET (Thermo Scientific). .. Plasmid DNA concentrations were measured using the NanoDrop spectrophotometer ND-1000.

    Produced:

    Article Title: Hemocyte differentiation mediates the mosquito late-phase immune response against Plasmodium in Anopheles gambiae
    Article Snippet: PCR products for TEP1, STAT-A, and SOCS were produced with slight modification from previous reports ( , ) to create plasmid constructs for dsRNA production. .. PCR products were subcloned into a pJet1.2 vector using the CloneJet PCR cloning kit (Thermo Scientific) and used as a template for amplification with T7 promoter sequences to amplify T7-PCR products.

    Article Title: Release of Antibiotic Resistant Bacteria by a Waste Treatment Plant from Romania
    Article Snippet: Standard curves were generated using recombinant plasmids produced by the cloning genes of interest into a cloning vector. .. PCR products were cloned into the pJET1.2 vector (Thermo Scientific) using PCR Cloning Kit CloneJET (Thermo Scientific).

    Staining:

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering
    Article Snippet: Then 3 μl SafeView nucleic acid stain (NBS Biologicals) was added to the solution and the mixture was poured into a gel-casting tray. .. For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific).

    Article Title: Gene expression profiling during hibernation in the European hamster
    Article Snippet: Amplicons were separated in 1% agarose gels stained with ethidium bromide, and the gel bands were visualized using U Genius (Syngene, Frederick, USA). .. The eluted DNA was inserted into a blunt pJET vector using the CloneJET PCR cloning kit (Thermo Fisher Scientific, Waltham, USA), and transformed into DH10β chemically competent Escherichia Coli cells (NEB, Ipswich, MA, USA).

    Variant Assay:

    Article Title: The genomic basis of circadian and circalunar timing adaptations in a midge
    Article Snippet: .. Besides four assembled full-length transcripts (RA to RD) from RNAseq and assembled EST libraries, additional partial transcripts (RE to RO) were identified by PCR amplification (for PCR primers see ), gel extraction (QIAquick Gel Extraction Kit, Qiagen), cloning with the CloneJET PCR Cloning Kit (Thermo Scientific) and Sanger sequencing with pJET1.2 primers (LGC Genomics & Microsynth). cDNA was prepared from RNA extracted from LIII larvae of the Por and Jean laboratory strains (RNA extraction with RNeasy Plus Mini Kit, Qiagen; reverse transcription with QuantiTect Reverse Transcription Kit, Qiagen). qPCR was performed with variant-specific primers and actin as control gene ( ). cDNA was obtained from independent pools of 20 third instar larvae of the Por and Jean strains. .. Sample size was ten per strain to cover different time points during the day and to test for reproducibility (two samples each at Zeitgeber times 0, 4, 8, 16 and 20; for one Por sample extraction failed; RNA extraction and reverse transcription as above). qPCR was performed with Power SYBR Green PCR Master Mix on a StepOnePlus Real Time System (both Applied Biosystems).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher clonejet pcr cloning kit
    Vector and insert plasmid maps A) Illustration of the <t>CloneJET</t> plasmid containing the <t>PCR</t> product. Insertion of the PCR product in the cloning site of the plasmid disrupts the integrity of the toxic gene eco47IR and allows the growth of transgene positive clones. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 3 kb and 0.7 kb in size. The 0.7 kb fragment (tdTomato gene) was used as the insert for cloning. (B) Illustration of the vector plasmid. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 4.9 kb and 0.7 kb in size. The 4.9 kb fragment was used as the vector for cloning. AMP: Ampicillin resistance gene; PRE: posttranscriptional regulatory element; MPSV: myeloproliferative sarcoma virus promoter.
    Clonejet Pcr Cloning Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 746 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/clonejet pcr cloning kit/product/Thermo Fisher
    Average 90 stars, based on 746 article reviews
    Price from $9.99 to $1999.99
    clonejet pcr cloning kit - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    Vector and insert plasmid maps A) Illustration of the CloneJET plasmid containing the PCR product. Insertion of the PCR product in the cloning site of the plasmid disrupts the integrity of the toxic gene eco47IR and allows the growth of transgene positive clones. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 3 kb and 0.7 kb in size. The 0.7 kb fragment (tdTomato gene) was used as the insert for cloning. (B) Illustration of the vector plasmid. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 4.9 kb and 0.7 kb in size. The 4.9 kb fragment was used as the vector for cloning. AMP: Ampicillin resistance gene; PRE: posttranscriptional regulatory element; MPSV: myeloproliferative sarcoma virus promoter.

    Journal: Journal of Biological Engineering

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering

    doi: 10.1186/1754-1611-9-2

    Figure Lengend Snippet: Vector and insert plasmid maps A) Illustration of the CloneJET plasmid containing the PCR product. Insertion of the PCR product in the cloning site of the plasmid disrupts the integrity of the toxic gene eco47IR and allows the growth of transgene positive clones. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 3 kb and 0.7 kb in size. The 0.7 kb fragment (tdTomato gene) was used as the insert for cloning. (B) Illustration of the vector plasmid. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 4.9 kb and 0.7 kb in size. The 4.9 kb fragment was used as the vector for cloning. AMP: Ampicillin resistance gene; PRE: posttranscriptional regulatory element; MPSV: myeloproliferative sarcoma virus promoter.

    Article Snippet: For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific).

    Techniques: Plasmid Preparation, Polymerase Chain Reaction, Clone Assay