clonejet pcr cloning  (Thermo Fisher)

Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    CloneJET PCR Cloning Kit
    Thermo Scientific CloneJET PCR Cloning Kit is an advanced positive selection system for high efficiency cloning of PCR products generated with any thermostable DNA polymerase Any other blunt or sticky end DNA fragment can be cloned It is ideal for phosphorylated or non phosphorylated DNA fragments Ligation into the included positive selection vector takes only 5 minutes yielding more than 99 recombinant clones Blunt ended PCR products generated with a proofreading enzyme are ligated directly into the cloning vector PCR products generated either with non proofreading DNA polymerases or mixtures of DNA polymerases are blunted prior to ligation in 5 minutes with the thermostable DNA Blunting Enzyme provided with the kit All common laboratory E coli strains can be directly transformed with the ligation product FeaturesThe CloneJET PCR Cloning Kit contains a novel ready to use positive selection cloning vector pJET1 2 blunt The vector contains a lethal restriction enzyme gene that is disrupted by ligation of a DNA insert into the cloning site As a result only bacterial cells with recombinant plasmids are able to form colonies Recircularized pJET1 2 blunt vector molecules lacking an insert express a lethal restriction enzyme which kills the host E coli cell after transformation This positive selection drastically accelerates the process of colony screening and eliminates additional costs required for blue white selection For convenience in mapping and manipulation of the insert the pJET1 2 blunt cloning vector multiple cloning site contains two BglII recognition sequences that flank the insertion site In addition the vector contains a T7 promoter for in vitro and in vivo transcription as well as sequencing of the insert Highlights• Fast PCR cloning in only 5 minutes• Highest efficiency 99 of positive clones• No cloning background positive selection vector• Versatile ideal for blunt end or sticky end cloning• Economical no expensive blue white screeningApplications• Cloning of blunt end or 3 dA tailed PCR products up to 10 kb• Cloning of DNA fragments generated by restriction enzymes• Sequencing of cloned DNA• in vitro and in vivo transcription of cloned inserts from the T7 promoterIncludes• pJET1 2 blunt Cloning Vector• T4 DNA Ligase• 2X Reaction Buffer• DNA Blunting Enzyme• pJET1 2 Forward Sequencing Primer 5 CGACTCACTATAGGGAGAGCGGC 3 • pJET1 2 Reverse Sequencing Primer 5 AAGAACATCGATTTTCCATGGCAG 3 • Control PCR Product• Water nuclease free• Detailed ProtocolPrior to electroporation always column purify the ligation mixture using e g GeneJET PCR Purification Kit K0701 or chloroform to extract it Electroporation is inhibited by the presence of proteins and salts in the mixture Related ProductsFast DNA End Repair KitCloneJET PCR Cloning Kit
    Catalog Number:
    Cloning|PCR Cloning
    DNA Vectors Clones Purified Nucleic Acids Libraries
    Buy from Supplier

    Structured Review

    Thermo Fisher clonejet pcr cloning
    Thermo Scientific CloneJET PCR Cloning Kit is an advanced positive selection system for high efficiency cloning of PCR products generated with any thermostable DNA polymerase Any other blunt or sticky end DNA fragment can be cloned It is ideal for phosphorylated or non phosphorylated DNA fragments Ligation into the included positive selection vector takes only 5 minutes yielding more than 99 recombinant clones Blunt ended PCR products generated with a proofreading enzyme are ligated directly into the cloning vector PCR products generated either with non proofreading DNA polymerases or mixtures of DNA polymerases are blunted prior to ligation in 5 minutes with the thermostable DNA Blunting Enzyme provided with the kit All common laboratory E coli strains can be directly transformed with the ligation product FeaturesThe CloneJET PCR Cloning Kit contains a novel ready to use positive selection cloning vector pJET1 2 blunt The vector contains a lethal restriction enzyme gene that is disrupted by ligation of a DNA insert into the cloning site As a result only bacterial cells with recombinant plasmids are able to form colonies Recircularized pJET1 2 blunt vector molecules lacking an insert express a lethal restriction enzyme which kills the host E coli cell after transformation This positive selection drastically accelerates the process of colony screening and eliminates additional costs required for blue white selection For convenience in mapping and manipulation of the insert the pJET1 2 blunt cloning vector multiple cloning site contains two BglII recognition sequences that flank the insertion site In addition the vector contains a T7 promoter for in vitro and in vivo transcription as well as sequencing of the insert Highlights• Fast PCR cloning in only 5 minutes• Highest efficiency 99 of positive clones• No cloning background positive selection vector• Versatile ideal for blunt end or sticky end cloning• Economical no expensive blue white screeningApplications• Cloning of blunt end or 3 dA tailed PCR products up to 10 kb• Cloning of DNA fragments generated by restriction enzymes• Sequencing of cloned DNA• in vitro and in vivo transcription of cloned inserts from the T7 promoterIncludes• pJET1 2 blunt Cloning Vector• T4 DNA Ligase• 2X Reaction Buffer• DNA Blunting Enzyme• pJET1 2 Forward Sequencing Primer 5 CGACTCACTATAGGGAGAGCGGC 3 • pJET1 2 Reverse Sequencing Primer 5 AAGAACATCGATTTTCCATGGCAG 3 • Control PCR Product• Water nuclease free• Detailed ProtocolPrior to electroporation always column purify the ligation mixture using e g GeneJET PCR Purification Kit K0701 or chloroform to extract it Electroporation is inhibited by the presence of proteins and salts in the mixture Related ProductsFast DNA End Repair KitCloneJET PCR Cloning Kit pcr cloning/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    clonejet pcr cloning - by Bioz Stars, 2020-09
    99/100 stars


    Related Articles

    Clone Assay:

    Article Title: Inhibition of Acetyl Phosphate-dependent Transcription by an Acetylatable Lysine on RNA Polymerase *
    Article Snippet: .. The resulting amplicon was ligated into pJET1.2, using the CloneJETTM PCR Cloning Kit (Fermentas). ..

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering
    Article Snippet: .. For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific). .. 1 μl of blunt vector (50 ng/μl), 50 ng/μl of the PCR product, and 10 μl of 2X reaction buffer (provided in the kit) were mixed and filled with water to a total volume of 20 μl.

    Article Title: Neoprotoparmelia gen. nov. and Maronina ( Lecanorales, Protoparmelioideae): species description and generic delimitation using DNA barcodes and phenotypical characters
    Article Snippet: .. The amplified products were cloned into the pJET1.2 / blunt cloning vector using the Thermo Scientific CloneJET PCR cloning kit and transformed into E. coli XL1-Blue cells (for details see: ). .. The cloned PCR products were analysed using the “colony PCR”.

    Article Title: Active Autotrophic Ammonia-Oxidizing Bacteria in Biofilm Enrichments from Simulated Creek Ecosystems at Two Ammonium Concentrations Respond to Temperature Manipulation ▿Active Autotrophic Ammonia-Oxidizing Bacteria in Biofilm Enrichments from Simulated Creek Ecosystems at Two Ammonium Concentrations Respond to Temperature Manipulation ▿ †
    Article Snippet: .. The clones were screened by amplification with the pJet1.2 forward and pJet1.2 reverse primer set (CloneJET PCR cloning kit, Fermentas, St. Leon-Rot, Germany) according to the manufacturer's instructions, and 50 clones in the expected size of each library were sequenced by Macrogen (Seoul, South Korea). ..

    Article Title: Yeast Cell Wall Chitin Reduces Wine Haze Formation
    Article Snippet: .. The amplified chitinase class IVD fragment (accession number ) was cloned into a shuttle vector pJet1.2/blunt (CloneJET PCR cloning kit; Thermo Fisher Scientific), according to the protocol described by the manufacturer, before subcloning into the pET14b vector (Novagen, Madison, WI, USA), also using the pET system manual. .. Green fluorescent protein was PCR amplified from pKEN mut 2 vector (Addgene, Cambridge, MA) using 5′- CTCGAG ATGAGTAAAGGAGAAGAACTTTTCAC-3′ (XhoI) as the forward primer and 5′-GATC GGATCC TTATTTGTATAGTTCATCCATGCC-3′ (BamHI) as the reverse primer, cloned first in pJet1.2 vector (catalog no. K1232; Fermentas), according to the CloneJET PCR cloning kit instruction manual for further sequencing.

    Article Title: Different Relationship between hsp70 mRNA and hsp70 Levels in the Heat Shock Response of Two Salmonids with Dissimilar Temperature Preference
    Article Snippet: .. Gene fragments were ligated onto a pJET1.2/blunt cloning vector with a CloneJet PCR Cloning kit (ThermoScientific, USA), propagated in CaCl2 competent DH5α E. coli and screened on LB-agar containing ampicillin. .. Positive colonies were selected for further propagation then purified with a NucleoSpin Plasmid EasyPure Kit (Macherey-Nagel, Germany).

    Article Title: Novel Papillomaviruses in Free-Ranging Iberian Bats: No Virus-Host Co-evolution, No Strict Host Specificity, and Hints for Recombination
    Article Snippet: .. Overlapping fragments were generated and used to clone each of the four novel PVs using the CloneJet PCR Cloning Kit (Fermentas) and DH5α cells (Invitrogen). .. Two clones per overlapping fragment were selected and sequenced to further confirm the PVs genome sequence.


    Article Title: Inhibition of Acetyl Phosphate-dependent Transcription by an Acetylatable Lysine on RNA Polymerase *
    Article Snippet: .. The resulting amplicon was ligated into pJET1.2, using the CloneJETTM PCR Cloning Kit (Fermentas). ..

    Article Title: Neoprotoparmelia gen. nov. and Maronina ( Lecanorales, Protoparmelioideae): species description and generic delimitation using DNA barcodes and phenotypical characters
    Article Snippet: .. The amplified products were cloned into the pJET1.2 / blunt cloning vector using the Thermo Scientific CloneJET PCR cloning kit and transformed into E. coli XL1-Blue cells (for details see: ). .. The cloned PCR products were analysed using the “colony PCR”.

    Article Title: Active Autotrophic Ammonia-Oxidizing Bacteria in Biofilm Enrichments from Simulated Creek Ecosystems at Two Ammonium Concentrations Respond to Temperature Manipulation ▿Active Autotrophic Ammonia-Oxidizing Bacteria in Biofilm Enrichments from Simulated Creek Ecosystems at Two Ammonium Concentrations Respond to Temperature Manipulation ▿ †
    Article Snippet: .. The clones were screened by amplification with the pJet1.2 forward and pJet1.2 reverse primer set (CloneJET PCR cloning kit, Fermentas, St. Leon-Rot, Germany) according to the manufacturer's instructions, and 50 clones in the expected size of each library were sequenced by Macrogen (Seoul, South Korea). ..

    Article Title: Yeast Cell Wall Chitin Reduces Wine Haze Formation
    Article Snippet: .. The amplified chitinase class IVD fragment (accession number ) was cloned into a shuttle vector pJet1.2/blunt (CloneJET PCR cloning kit; Thermo Fisher Scientific), according to the protocol described by the manufacturer, before subcloning into the pET14b vector (Novagen, Madison, WI, USA), also using the pET system manual. .. Green fluorescent protein was PCR amplified from pKEN mut 2 vector (Addgene, Cambridge, MA) using 5′- CTCGAG ATGAGTAAAGGAGAAGAACTTTTCAC-3′ (XhoI) as the forward primer and 5′-GATC GGATCC TTATTTGTATAGTTCATCCATGCC-3′ (BamHI) as the reverse primer, cloned first in pJet1.2 vector (catalog no. K1232; Fermentas), according to the CloneJET PCR cloning kit instruction manual for further sequencing.


    Article Title: Deciphering host lysosome-mediated elimination of Plasmodium berghei liver stage parasites
    Article Snippet: .. After subcloning the cDNA via blunt ends into pJET1.2 (#K1232, Thermo Fisher Scientific, Reinach, Switzerland), the sequence was verified by the sequencing service of Microsynth AG in Balgach, Switzerland. .. Subsequently, mEos3.2 was cloned into the final vector pLAMP1-GFP after excising the GFP cDNA insert with the restriction enzymes BamHI and XbaI.

    Article Title: Yeast Cell Wall Chitin Reduces Wine Haze Formation
    Article Snippet: .. The amplified chitinase class IVD fragment (accession number ) was cloned into a shuttle vector pJet1.2/blunt (CloneJET PCR cloning kit; Thermo Fisher Scientific), according to the protocol described by the manufacturer, before subcloning into the pET14b vector (Novagen, Madison, WI, USA), also using the pET system manual. .. Green fluorescent protein was PCR amplified from pKEN mut 2 vector (Addgene, Cambridge, MA) using 5′- CTCGAG ATGAGTAAAGGAGAAGAACTTTTCAC-3′ (XhoI) as the forward primer and 5′-GATC GGATCC TTATTTGTATAGTTCATCCATGCC-3′ (BamHI) as the reverse primer, cloned first in pJet1.2 vector (catalog no. K1232; Fermentas), according to the CloneJET PCR cloning kit instruction manual for further sequencing.


    Article Title: Deciphering host lysosome-mediated elimination of Plasmodium berghei liver stage parasites
    Article Snippet: .. After subcloning the cDNA via blunt ends into pJET1.2 (#K1232, Thermo Fisher Scientific, Reinach, Switzerland), the sequence was verified by the sequencing service of Microsynth AG in Balgach, Switzerland. .. Subsequently, mEos3.2 was cloned into the final vector pLAMP1-GFP after excising the GFP cDNA insert with the restriction enzymes BamHI and XbaI.

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering
    Article Snippet: .. For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific). .. 1 μl of blunt vector (50 ng/μl), 50 ng/μl of the PCR product, and 10 μl of 2X reaction buffer (provided in the kit) were mixed and filled with water to a total volume of 20 μl.


    Article Title: Novel Papillomaviruses in Free-Ranging Iberian Bats: No Virus-Host Co-evolution, No Strict Host Specificity, and Hints for Recombination
    Article Snippet: .. Overlapping fragments were generated and used to clone each of the four novel PVs using the CloneJet PCR Cloning Kit (Fermentas) and DH5α cells (Invitrogen). .. Two clones per overlapping fragment were selected and sequenced to further confirm the PVs genome sequence.

    Positron Emission Tomography:

    Article Title: Yeast Cell Wall Chitin Reduces Wine Haze Formation
    Article Snippet: .. The amplified chitinase class IVD fragment (accession number ) was cloned into a shuttle vector pJet1.2/blunt (CloneJET PCR cloning kit; Thermo Fisher Scientific), according to the protocol described by the manufacturer, before subcloning into the pET14b vector (Novagen, Madison, WI, USA), also using the pET system manual. .. Green fluorescent protein was PCR amplified from pKEN mut 2 vector (Addgene, Cambridge, MA) using 5′- CTCGAG ATGAGTAAAGGAGAAGAACTTTTCAC-3′ (XhoI) as the forward primer and 5′-GATC GGATCC TTATTTGTATAGTTCATCCATGCC-3′ (BamHI) as the reverse primer, cloned first in pJet1.2 vector (catalog no. K1232; Fermentas), according to the CloneJET PCR cloning kit instruction manual for further sequencing.

    Polymerase Chain Reaction:

    Article Title: Inhibition of Acetyl Phosphate-dependent Transcription by an Acetylatable Lysine on RNA Polymerase *
    Article Snippet: .. The resulting amplicon was ligated into pJET1.2, using the CloneJETTM PCR Cloning Kit (Fermentas). ..

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering
    Article Snippet: .. For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific). .. 1 μl of blunt vector (50 ng/μl), 50 ng/μl of the PCR product, and 10 μl of 2X reaction buffer (provided in the kit) were mixed and filled with water to a total volume of 20 μl.

    Article Title: Neoprotoparmelia gen. nov. and Maronina ( Lecanorales, Protoparmelioideae): species description and generic delimitation using DNA barcodes and phenotypical characters
    Article Snippet: .. The amplified products were cloned into the pJET1.2 / blunt cloning vector using the Thermo Scientific CloneJET PCR cloning kit and transformed into E. coli XL1-Blue cells (for details see: ). .. The cloned PCR products were analysed using the “colony PCR”.

    Article Title: Active Autotrophic Ammonia-Oxidizing Bacteria in Biofilm Enrichments from Simulated Creek Ecosystems at Two Ammonium Concentrations Respond to Temperature Manipulation ▿Active Autotrophic Ammonia-Oxidizing Bacteria in Biofilm Enrichments from Simulated Creek Ecosystems at Two Ammonium Concentrations Respond to Temperature Manipulation ▿ †
    Article Snippet: .. The clones were screened by amplification with the pJet1.2 forward and pJet1.2 reverse primer set (CloneJET PCR cloning kit, Fermentas, St. Leon-Rot, Germany) according to the manufacturer's instructions, and 50 clones in the expected size of each library were sequenced by Macrogen (Seoul, South Korea). ..

    Article Title: Yeast Cell Wall Chitin Reduces Wine Haze Formation
    Article Snippet: .. The amplified chitinase class IVD fragment (accession number ) was cloned into a shuttle vector pJet1.2/blunt (CloneJET PCR cloning kit; Thermo Fisher Scientific), according to the protocol described by the manufacturer, before subcloning into the pET14b vector (Novagen, Madison, WI, USA), also using the pET system manual. .. Green fluorescent protein was PCR amplified from pKEN mut 2 vector (Addgene, Cambridge, MA) using 5′- CTCGAG ATGAGTAAAGGAGAAGAACTTTTCAC-3′ (XhoI) as the forward primer and 5′-GATC GGATCC TTATTTGTATAGTTCATCCATGCC-3′ (BamHI) as the reverse primer, cloned first in pJet1.2 vector (catalog no. K1232; Fermentas), according to the CloneJET PCR cloning kit instruction manual for further sequencing.

    Article Title: Different Relationship between hsp70 mRNA and hsp70 Levels in the Heat Shock Response of Two Salmonids with Dissimilar Temperature Preference
    Article Snippet: .. Gene fragments were ligated onto a pJET1.2/blunt cloning vector with a CloneJet PCR Cloning kit (ThermoScientific, USA), propagated in CaCl2 competent DH5α E. coli and screened on LB-agar containing ampicillin. .. Positive colonies were selected for further propagation then purified with a NucleoSpin Plasmid EasyPure Kit (Macherey-Nagel, Germany).

    Article Title: Novel Papillomaviruses in Free-Ranging Iberian Bats: No Virus-Host Co-evolution, No Strict Host Specificity, and Hints for Recombination
    Article Snippet: .. Overlapping fragments were generated and used to clone each of the four novel PVs using the CloneJet PCR Cloning Kit (Fermentas) and DH5α cells (Invitrogen). .. Two clones per overlapping fragment were selected and sequenced to further confirm the PVs genome sequence.

    Transformation Assay:

    Article Title: Neoprotoparmelia gen. nov. and Maronina ( Lecanorales, Protoparmelioideae): species description and generic delimitation using DNA barcodes and phenotypical characters
    Article Snippet: .. The amplified products were cloned into the pJET1.2 / blunt cloning vector using the Thermo Scientific CloneJET PCR cloning kit and transformed into E. coli XL1-Blue cells (for details see: ). .. The cloned PCR products were analysed using the “colony PCR”.

    Plasmid Preparation:

    Article Title: Neoprotoparmelia gen. nov. and Maronina ( Lecanorales, Protoparmelioideae): species description and generic delimitation using DNA barcodes and phenotypical characters
    Article Snippet: .. The amplified products were cloned into the pJET1.2 / blunt cloning vector using the Thermo Scientific CloneJET PCR cloning kit and transformed into E. coli XL1-Blue cells (for details see: ). .. The cloned PCR products were analysed using the “colony PCR”.

    Article Title: Yeast Cell Wall Chitin Reduces Wine Haze Formation
    Article Snippet: .. The amplified chitinase class IVD fragment (accession number ) was cloned into a shuttle vector pJet1.2/blunt (CloneJET PCR cloning kit; Thermo Fisher Scientific), according to the protocol described by the manufacturer, before subcloning into the pET14b vector (Novagen, Madison, WI, USA), also using the pET system manual. .. Green fluorescent protein was PCR amplified from pKEN mut 2 vector (Addgene, Cambridge, MA) using 5′- CTCGAG ATGAGTAAAGGAGAAGAACTTTTCAC-3′ (XhoI) as the forward primer and 5′-GATC GGATCC TTATTTGTATAGTTCATCCATGCC-3′ (BamHI) as the reverse primer, cloned first in pJet1.2 vector (catalog no. K1232; Fermentas), according to the CloneJET PCR cloning kit instruction manual for further sequencing.

    Article Title: Different Relationship between hsp70 mRNA and hsp70 Levels in the Heat Shock Response of Two Salmonids with Dissimilar Temperature Preference
    Article Snippet: .. Gene fragments were ligated onto a pJET1.2/blunt cloning vector with a CloneJet PCR Cloning kit (ThermoScientific, USA), propagated in CaCl2 competent DH5α E. coli and screened on LB-agar containing ampicillin. .. Positive colonies were selected for further propagation then purified with a NucleoSpin Plasmid EasyPure Kit (Macherey-Nagel, Germany).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher clonejet pcr cloning kit
    Vector and insert plasmid maps A) Illustration of the <t>CloneJET</t> plasmid containing the <t>PCR</t> product. Insertion of the PCR product in the cloning site of the plasmid disrupts the integrity of the toxic gene eco47IR and allows the growth of transgene positive clones. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 3 kb and 0.7 kb in size. The 0.7 kb fragment (tdTomato gene) was used as the insert for cloning. (B) Illustration of the vector plasmid. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 4.9 kb and 0.7 kb in size. The 4.9 kb fragment was used as the vector for cloning. AMP: Ampicillin resistance gene; PRE: posttranscriptional regulatory element; MPSV: myeloproliferative sarcoma virus promoter.
    Clonejet Pcr Cloning Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 980 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more pcr cloning kit/product/Thermo Fisher
    Average 99 stars, based on 980 article reviews
    Price from $9.99 to $1999.99
    clonejet pcr cloning kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results

    Vector and insert plasmid maps A) Illustration of the CloneJET plasmid containing the PCR product. Insertion of the PCR product in the cloning site of the plasmid disrupts the integrity of the toxic gene eco47IR and allows the growth of transgene positive clones. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 3 kb and 0.7 kb in size. The 0.7 kb fragment (tdTomato gene) was used as the insert for cloning. (B) Illustration of the vector plasmid. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 4.9 kb and 0.7 kb in size. The 4.9 kb fragment was used as the vector for cloning. AMP: Ampicillin resistance gene; PRE: posttranscriptional regulatory element; MPSV: myeloproliferative sarcoma virus promoter.

    Journal: Journal of Biological Engineering

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering

    doi: 10.1186/1754-1611-9-2

    Figure Lengend Snippet: Vector and insert plasmid maps A) Illustration of the CloneJET plasmid containing the PCR product. Insertion of the PCR product in the cloning site of the plasmid disrupts the integrity of the toxic gene eco47IR and allows the growth of transgene positive clones. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 3 kb and 0.7 kb in size. The 0.7 kb fragment (tdTomato gene) was used as the insert for cloning. (B) Illustration of the vector plasmid. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 4.9 kb and 0.7 kb in size. The 4.9 kb fragment was used as the vector for cloning. AMP: Ampicillin resistance gene; PRE: posttranscriptional regulatory element; MPSV: myeloproliferative sarcoma virus promoter.

    Article Snippet: For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific).

    Techniques: Plasmid Preparation, Polymerase Chain Reaction, Clone Assay