clonejet pcr cloning kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Name:
    CloneJET PCR Cloning Kit
    Description:
    Thermo Scientific CloneJET PCR Cloning Kit is an advanced positive selection system for high efficiency cloning of PCR products generated with any thermostable DNA polymerase Any other blunt or sticky end DNA fragment can be cloned It is ideal for phosphorylated or non phosphorylated DNA fragments Ligation into the included positive selection vector takes only 5 minutes yielding more than 99 recombinant clones Blunt ended PCR products generated with a proofreading enzyme are ligated directly into the cloning vector PCR products generated either with non proofreading DNA polymerases or mixtures of DNA polymerases are blunted prior to ligation in 5 minutes with the thermostable DNA Blunting Enzyme provided with the kit All common laboratory E coli strains can be directly transformed with the ligation product FeaturesThe CloneJET PCR Cloning Kit contains a novel ready to use positive selection cloning vector pJET1 2 blunt The vector contains a lethal restriction enzyme gene that is disrupted by ligation of a DNA insert into the cloning site As a result only bacterial cells with recombinant plasmids are able to form colonies Recircularized pJET1 2 blunt vector molecules lacking an insert express a lethal restriction enzyme which kills the host E coli cell after transformation This positive selection drastically accelerates the process of colony screening and eliminates additional costs required for blue white selection For convenience in mapping and manipulation of the insert the pJET1 2 blunt cloning vector multiple cloning site contains two BglII recognition sequences that flank the insertion site In addition the vector contains a T7 promoter for in vitro and in vivo transcription as well as sequencing of the insert Highlights• Fast PCR cloning in only 5 minutes• Highest efficiency 99 of positive clones• No cloning background positive selection vector• Versatile ideal for blunt end or sticky end cloning• Economical no expensive blue white screeningApplications• Cloning of blunt end or 3 dA tailed PCR products up to 10 kb• Cloning of DNA fragments generated by restriction enzymes• Sequencing of cloned DNA• in vitro and in vivo transcription of cloned inserts from the T7 promoterIncludes• pJET1 2 blunt Cloning Vector• T4 DNA Ligase• 2X Reaction Buffer• DNA Blunting Enzyme• pJET1 2 Forward Sequencing Primer 5 CGACTCACTATAGGGAGAGCGGC 3 • pJET1 2 Reverse Sequencing Primer 5 AAGAACATCGATTTTCCATGGCAG 3 • Control PCR Product• Water nuclease free• Detailed ProtocolPrior to electroporation always column purify the ligation mixture using e g GeneJET PCR Purification Kit K0701 or chloroform to extract it Electroporation is inhibited by the presence of proteins and salts in the mixture Related ProductsFast DNA End Repair KitCloneJET PCR Cloning Kit
    Catalog Number:
    K1231
    Price:
    None
    Category:
    DNA Vectors Clones Purified Nucleic Acids Libraries
    Applications:
    Cloning|PCR Cloning
    Buy from Supplier


    Structured Review

    Thermo Fisher clonejet pcr cloning kit
    <t>PCR,</t> cloning and sequencing. Total DNA was extracted from 100 mg paraffin-embedded cerebral tissue using the Wizard Genomic DNA purification kit (Promega, Madison, WI, USA). DNA was quantified in a NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA), obtaining an E. histolytica 128 bp amplicon for the rRNA gene, which was cloned with the <t>CloneJET</t> PCR Cloning Kit (Thermo Scientific) using a pJET1.2/blunt cloning vector. Then, the ligation mixture was used for transformation of Escherichia coli DH5a calcium-competent cells. Plasmid DNA was extracted from heat-shocked cells with the Zyppy Plasmid Miniprep (Zymo Research, Irvine, CA, USA). Clones were analyzed by PCR to verify the insertion of the amplicon into the pJET1.2/blunt vector. The plasmid sequence shows forward and reverse primers (electropherograms) that correspond to the E. histolytica rRNA gene sequence. Hu = 120 bp amplicon for human β-actin; M = bp marker; Eh = 128 bp amplicon for the E. histolytica rRNA 18 s gene, NTC = no template control
    Thermo Scientific CloneJET PCR Cloning Kit is an advanced positive selection system for high efficiency cloning of PCR products generated with any thermostable DNA polymerase Any other blunt or sticky end DNA fragment can be cloned It is ideal for phosphorylated or non phosphorylated DNA fragments Ligation into the included positive selection vector takes only 5 minutes yielding more than 99 recombinant clones Blunt ended PCR products generated with a proofreading enzyme are ligated directly into the cloning vector PCR products generated either with non proofreading DNA polymerases or mixtures of DNA polymerases are blunted prior to ligation in 5 minutes with the thermostable DNA Blunting Enzyme provided with the kit All common laboratory E coli strains can be directly transformed with the ligation product FeaturesThe CloneJET PCR Cloning Kit contains a novel ready to use positive selection cloning vector pJET1 2 blunt The vector contains a lethal restriction enzyme gene that is disrupted by ligation of a DNA insert into the cloning site As a result only bacterial cells with recombinant plasmids are able to form colonies Recircularized pJET1 2 blunt vector molecules lacking an insert express a lethal restriction enzyme which kills the host E coli cell after transformation This positive selection drastically accelerates the process of colony screening and eliminates additional costs required for blue white selection For convenience in mapping and manipulation of the insert the pJET1 2 blunt cloning vector multiple cloning site contains two BglII recognition sequences that flank the insertion site In addition the vector contains a T7 promoter for in vitro and in vivo transcription as well as sequencing of the insert Highlights• Fast PCR cloning in only 5 minutes• Highest efficiency 99 of positive clones• No cloning background positive selection vector• Versatile ideal for blunt end or sticky end cloning• Economical no expensive blue white screeningApplications• Cloning of blunt end or 3 dA tailed PCR products up to 10 kb• Cloning of DNA fragments generated by restriction enzymes• Sequencing of cloned DNA• in vitro and in vivo transcription of cloned inserts from the T7 promoterIncludes• pJET1 2 blunt Cloning Vector• T4 DNA Ligase• 2X Reaction Buffer• DNA Blunting Enzyme• pJET1 2 Forward Sequencing Primer 5 CGACTCACTATAGGGAGAGCGGC 3 • pJET1 2 Reverse Sequencing Primer 5 AAGAACATCGATTTTCCATGGCAG 3 • Control PCR Product• Water nuclease free• Detailed ProtocolPrior to electroporation always column purify the ligation mixture using e g GeneJET PCR Purification Kit K0701 or chloroform to extract it Electroporation is inhibited by the presence of proteins and salts in the mixture Related ProductsFast DNA End Repair KitCloneJET PCR Cloning Kit
    https://www.bioz.com/result/clonejet pcr cloning kit/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    clonejet pcr cloning kit - by Bioz Stars, 2021-07
    97/100 stars

    Images

    1) Product Images from "Case report: multiple and atypical amoebic cerebral abscesses resistant to treatment"

    Article Title: Case report: multiple and atypical amoebic cerebral abscesses resistant to treatment

    Journal: BMC Infectious Diseases

    doi: 10.1186/s12879-020-05391-y

    PCR, cloning and sequencing. Total DNA was extracted from 100 mg paraffin-embedded cerebral tissue using the Wizard Genomic DNA purification kit (Promega, Madison, WI, USA). DNA was quantified in a NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA), obtaining an E. histolytica 128 bp amplicon for the rRNA gene, which was cloned with the CloneJET PCR Cloning Kit (Thermo Scientific) using a pJET1.2/blunt cloning vector. Then, the ligation mixture was used for transformation of Escherichia coli DH5a calcium-competent cells. Plasmid DNA was extracted from heat-shocked cells with the Zyppy Plasmid Miniprep (Zymo Research, Irvine, CA, USA). Clones were analyzed by PCR to verify the insertion of the amplicon into the pJET1.2/blunt vector. The plasmid sequence shows forward and reverse primers (electropherograms) that correspond to the E. histolytica rRNA gene sequence. Hu = 120 bp amplicon for human β-actin; M = bp marker; Eh = 128 bp amplicon for the E. histolytica rRNA 18 s gene, NTC = no template control
    Figure Legend Snippet: PCR, cloning and sequencing. Total DNA was extracted from 100 mg paraffin-embedded cerebral tissue using the Wizard Genomic DNA purification kit (Promega, Madison, WI, USA). DNA was quantified in a NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA), obtaining an E. histolytica 128 bp amplicon for the rRNA gene, which was cloned with the CloneJET PCR Cloning Kit (Thermo Scientific) using a pJET1.2/blunt cloning vector. Then, the ligation mixture was used for transformation of Escherichia coli DH5a calcium-competent cells. Plasmid DNA was extracted from heat-shocked cells with the Zyppy Plasmid Miniprep (Zymo Research, Irvine, CA, USA). Clones were analyzed by PCR to verify the insertion of the amplicon into the pJET1.2/blunt vector. The plasmid sequence shows forward and reverse primers (electropherograms) that correspond to the E. histolytica rRNA gene sequence. Hu = 120 bp amplicon for human β-actin; M = bp marker; Eh = 128 bp amplicon for the E. histolytica rRNA 18 s gene, NTC = no template control

    Techniques Used: Polymerase Chain Reaction, Clone Assay, Sequencing, DNA Purification, Amplification, Plasmid Preparation, Ligation, Transformation Assay, Marker

    2) Product Images from "Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering"

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering

    Journal: Journal of Biological Engineering

    doi: 10.1186/1754-1611-9-2

    Vector and insert plasmid maps A) Illustration of the CloneJET plasmid containing the PCR product. Insertion of the PCR product in the cloning site of the plasmid disrupts the integrity of the toxic gene eco47IR and allows the growth of transgene positive clones. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 3 kb and 0.7 kb in size. The 0.7 kb fragment (tdTomato gene) was used as the insert for cloning. (B) Illustration of the vector plasmid. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 4.9 kb and 0.7 kb in size. The 4.9 kb fragment was used as the vector for cloning. AMP: Ampicillin resistance gene; PRE: posttranscriptional regulatory element; MPSV: myeloproliferative sarcoma virus promoter.
    Figure Legend Snippet: Vector and insert plasmid maps A) Illustration of the CloneJET plasmid containing the PCR product. Insertion of the PCR product in the cloning site of the plasmid disrupts the integrity of the toxic gene eco47IR and allows the growth of transgene positive clones. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 3 kb and 0.7 kb in size. The 0.7 kb fragment (tdTomato gene) was used as the insert for cloning. (B) Illustration of the vector plasmid. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 4.9 kb and 0.7 kb in size. The 4.9 kb fragment was used as the vector for cloning. AMP: Ampicillin resistance gene; PRE: posttranscriptional regulatory element; MPSV: myeloproliferative sarcoma virus promoter.

    Techniques Used: Plasmid Preparation, Polymerase Chain Reaction, Clone Assay

    Related Articles

    Plasmid Preparation:

    Article Title: Efficient precise knockin with a double cut HDR donor after CRISPR/Cas9-mediated double-stranded DNA cleavage
    Article Snippet: Multiple colonies were chosen for Sanger sequencing (MCLAB) to identify the correct clones using the primer U6-F: GGGCAGGAAGAGGGCCTAT. .. Donor plasmid construction All of the donor plasmids used in this study were generated with a CloneJET PCR Cloning Kit (Thermo Scientific). .. To construct pJET donor plasmids, the homology repair templates were amplified by PCR using KAPA HiFi polymerase (KAPA Biosystems) and purified using a GeneJET Gel Extraction Kit.

    Article Title: The 20-hydroxyecdysone agonist, halofenozide, primes anti-Plasmodium immunity in Anopheles gambiae via the ecdysone receptor
    Article Snippet: .. dsRNA synthesis and gene-silencing T7 primers for GFP and ultraspiricle (USP) were used to amplify cDNA prepared from whole An. gambiae mosquitoes and cloned into a pJET1.2 vector using a CloneJET PCR Cloning Kit (Thermo Fisher). .. The resulting plasmids were used as a template for amplification using the corresponding T7 primers (Table S2).

    Article Title: Anaerobic Degradation of the Plant Sugar Sulfoquinovose Concomitant With H2S Production: Escherichia coli K-12 and Desulfovibrio sp. Strain DF1 as Co-culture Model
    Article Snippet: .. The PCR product was first cloned by blunt end cloning into a pJet suicide vector using the CloneJet PCR cloning kit (ThermoFisher Scientific). .. The plasmid was transformed into chemically competent E. coli NovaBlue cells, which were streaked onto a selective LB plates containing ampicillin; E. coli NovaBlue were chosen for improved transformation efficiency and plasmid stability.

    Generated:

    Article Title: Efficient precise knockin with a double cut HDR donor after CRISPR/Cas9-mediated double-stranded DNA cleavage
    Article Snippet: Multiple colonies were chosen for Sanger sequencing (MCLAB) to identify the correct clones using the primer U6-F: GGGCAGGAAGAGGGCCTAT. .. Donor plasmid construction All of the donor plasmids used in this study were generated with a CloneJET PCR Cloning Kit (Thermo Scientific). .. To construct pJET donor plasmids, the homology repair templates were amplified by PCR using KAPA HiFi polymerase (KAPA Biosystems) and purified using a GeneJET Gel Extraction Kit.

    Polymerase Chain Reaction:

    Article Title: Efficient precise knockin with a double cut HDR donor after CRISPR/Cas9-mediated double-stranded DNA cleavage
    Article Snippet: Multiple colonies were chosen for Sanger sequencing (MCLAB) to identify the correct clones using the primer U6-F: GGGCAGGAAGAGGGCCTAT. .. Donor plasmid construction All of the donor plasmids used in this study were generated with a CloneJET PCR Cloning Kit (Thermo Scientific). .. To construct pJET donor plasmids, the homology repair templates were amplified by PCR using KAPA HiFi polymerase (KAPA Biosystems) and purified using a GeneJET Gel Extraction Kit.

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering
    Article Snippet: .. For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific). .. 1 μl of blunt vector (50 ng/μl), 50 ng/μl of the PCR product, and 10 μl of 2X reaction buffer (provided in the kit) were mixed and filled with water to a total volume of 20 μl.

    Article Title: Bioconversion of Beet Molasses to Alpha-Galactosidase and Ethanol
    Article Snippet: PCRs were performed using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). .. Construction of Plasmids pJETSUC2, pSparkURA3, and pJETsuc2Δ(266–388)URA3 The PCR products obtained from amplification of SUC2 and URA3 cassettes were cloned into vectors pJET1.2/blunt (CloneJET PCR Cloning Kit, Thermo Fisher Scientific) and pSpark IV (pSpark DNA Cloning System, Canvax Biotech) respectively, following the protocol recommended by each supplier, to create the plasmids pJETSUC2 and pSparkURA3 . .. The Bam HI-Kpn I fragment of 1,308 bp from pSparkURA3 was cloned between the Bam HI-Kpn I sites of pJETSUC2 into chemically competent XL1-Blue cells to construct the plasmid pJETsuc2 Δ(266–388)URA3 with the recombination sequences SR1 (1,962 bp) and SR2 (1,503 bp) that allowed the chromosomal integration ( ).

    Article Title: Case report: multiple and atypical amoebic cerebral abscesses resistant to treatment
    Article Snippet: The rest of the brain tissue was positive for glial fibrillary acidic protein (GFAP) (Fig. d) by immunofluorescence. .. The presence of E. histolytica in the cerebral tissue was corroborated by PCR, and an 128 bp amplicon of the E. histolytica rRNA gene (NCBI Accession number X65163.1) was cloned from cerebral tissue with the CloneJET PCR Cloning Kit (Thermo Scientific). .. DNA sequencing was performed in the Unit of Molecular Biology of the Institute of Cellular Physiology (National Autonomous University of Mexico) (Fig. ).

    Article Title: The 20-hydroxyecdysone agonist, halofenozide, primes anti-Plasmodium immunity in Anopheles gambiae via the ecdysone receptor
    Article Snippet: .. dsRNA synthesis and gene-silencing T7 primers for GFP and ultraspiricle (USP) were used to amplify cDNA prepared from whole An. gambiae mosquitoes and cloned into a pJET1.2 vector using a CloneJET PCR Cloning Kit (Thermo Fisher). .. The resulting plasmids were used as a template for amplification using the corresponding T7 primers (Table S2).

    Article Title: Targeted genomic rearrangements using CRISPR/Cas technology
    Article Snippet: Purified PCR products were directly sequenced using the forward PCR primer. .. CD74-ROS1 and ROS1-CD74 genomic breakpoint PCR products were cloned into pJET1.2 using the CloneJET PCR Cloning Kit (Thermo Scientific #K1231) and individual clones were sequenced. .. PCR primers are listed in .

    Article Title: The N-terminal domain of the thermo-regulated surface protein PrpA of Enterococcus faecium binds to fibrinogen, fibronectin and platelets
    Article Snippet: Determination of the 5′ end of the prpA transcript We used 5′RACE (Life Technologies) to map the 5′-end of the prpA mRNA, following the manufacturer’s instructions using two prpA -specific primers (GSP1 and GSP2) ( ). .. The amplified product was cloned using the CloneJET PCR cloning kit (Thermo Scientific) and sequenced by Sanger sequencing. .. Heterologous overexpression and purification of PrpA A gene fragment of prpA , encoding the N-terminal domain of PrpA excluding the N-terminal signal sequence, was amplified with the primers PrpA-BamHI and PrpA27-167 -R-NotI-STOP.

    Article Title: Anaerobic Degradation of the Plant Sugar Sulfoquinovose Concomitant With H2S Production: Escherichia coli K-12 and Desulfovibrio sp. Strain DF1 as Co-culture Model
    Article Snippet: .. The PCR product was first cloned by blunt end cloning into a pJet suicide vector using the CloneJet PCR cloning kit (ThermoFisher Scientific). .. The plasmid was transformed into chemically competent E. coli NovaBlue cells, which were streaked onto a selective LB plates containing ampicillin; E. coli NovaBlue were chosen for improved transformation efficiency and plasmid stability.

    Clone Assay:

    Article Title: Efficient precise knockin with a double cut HDR donor after CRISPR/Cas9-mediated double-stranded DNA cleavage
    Article Snippet: Multiple colonies were chosen for Sanger sequencing (MCLAB) to identify the correct clones using the primer U6-F: GGGCAGGAAGAGGGCCTAT. .. Donor plasmid construction All of the donor plasmids used in this study were generated with a CloneJET PCR Cloning Kit (Thermo Scientific). .. To construct pJET donor plasmids, the homology repair templates were amplified by PCR using KAPA HiFi polymerase (KAPA Biosystems) and purified using a GeneJET Gel Extraction Kit.

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering
    Article Snippet: .. For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific). .. 1 μl of blunt vector (50 ng/μl), 50 ng/μl of the PCR product, and 10 μl of 2X reaction buffer (provided in the kit) were mixed and filled with water to a total volume of 20 μl.

    Article Title: Bioconversion of Beet Molasses to Alpha-Galactosidase and Ethanol
    Article Snippet: PCRs were performed using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). .. Construction of Plasmids pJETSUC2, pSparkURA3, and pJETsuc2Δ(266–388)URA3 The PCR products obtained from amplification of SUC2 and URA3 cassettes were cloned into vectors pJET1.2/blunt (CloneJET PCR Cloning Kit, Thermo Fisher Scientific) and pSpark IV (pSpark DNA Cloning System, Canvax Biotech) respectively, following the protocol recommended by each supplier, to create the plasmids pJETSUC2 and pSparkURA3 . .. The Bam HI-Kpn I fragment of 1,308 bp from pSparkURA3 was cloned between the Bam HI-Kpn I sites of pJETSUC2 into chemically competent XL1-Blue cells to construct the plasmid pJETsuc2 Δ(266–388)URA3 with the recombination sequences SR1 (1,962 bp) and SR2 (1,503 bp) that allowed the chromosomal integration ( ).

    Article Title: Case report: multiple and atypical amoebic cerebral abscesses resistant to treatment
    Article Snippet: The rest of the brain tissue was positive for glial fibrillary acidic protein (GFAP) (Fig. d) by immunofluorescence. .. The presence of E. histolytica in the cerebral tissue was corroborated by PCR, and an 128 bp amplicon of the E. histolytica rRNA gene (NCBI Accession number X65163.1) was cloned from cerebral tissue with the CloneJET PCR Cloning Kit (Thermo Scientific). .. DNA sequencing was performed in the Unit of Molecular Biology of the Institute of Cellular Physiology (National Autonomous University of Mexico) (Fig. ).

    Article Title: The 20-hydroxyecdysone agonist, halofenozide, primes anti-Plasmodium immunity in Anopheles gambiae via the ecdysone receptor
    Article Snippet: .. dsRNA synthesis and gene-silencing T7 primers for GFP and ultraspiricle (USP) were used to amplify cDNA prepared from whole An. gambiae mosquitoes and cloned into a pJET1.2 vector using a CloneJET PCR Cloning Kit (Thermo Fisher). .. The resulting plasmids were used as a template for amplification using the corresponding T7 primers (Table S2).

    Article Title: Targeted genomic rearrangements using CRISPR/Cas technology
    Article Snippet: Purified PCR products were directly sequenced using the forward PCR primer. .. CD74-ROS1 and ROS1-CD74 genomic breakpoint PCR products were cloned into pJET1.2 using the CloneJET PCR Cloning Kit (Thermo Scientific #K1231) and individual clones were sequenced. .. PCR primers are listed in .

    Article Title: The N-terminal domain of the thermo-regulated surface protein PrpA of Enterococcus faecium binds to fibrinogen, fibronectin and platelets
    Article Snippet: Determination of the 5′ end of the prpA transcript We used 5′RACE (Life Technologies) to map the 5′-end of the prpA mRNA, following the manufacturer’s instructions using two prpA -specific primers (GSP1 and GSP2) ( ). .. The amplified product was cloned using the CloneJET PCR cloning kit (Thermo Scientific) and sequenced by Sanger sequencing. .. Heterologous overexpression and purification of PrpA A gene fragment of prpA , encoding the N-terminal domain of PrpA excluding the N-terminal signal sequence, was amplified with the primers PrpA-BamHI and PrpA27-167 -R-NotI-STOP.

    Article Title: Anaerobic Degradation of the Plant Sugar Sulfoquinovose Concomitant With H2S Production: Escherichia coli K-12 and Desulfovibrio sp. Strain DF1 as Co-culture Model
    Article Snippet: .. The PCR product was first cloned by blunt end cloning into a pJet suicide vector using the CloneJet PCR cloning kit (ThermoFisher Scientific). .. The plasmid was transformed into chemically competent E. coli NovaBlue cells, which were streaked onto a selective LB plates containing ampicillin; E. coli NovaBlue were chosen for improved transformation efficiency and plasmid stability.

    Sequencing:

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering
    Article Snippet: .. For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific). .. 1 μl of blunt vector (50 ng/μl), 50 ng/μl of the PCR product, and 10 μl of 2X reaction buffer (provided in the kit) were mixed and filled with water to a total volume of 20 μl.

    Article Title: The N-terminal domain of the thermo-regulated surface protein PrpA of Enterococcus faecium binds to fibrinogen, fibronectin and platelets
    Article Snippet: Determination of the 5′ end of the prpA transcript We used 5′RACE (Life Technologies) to map the 5′-end of the prpA mRNA, following the manufacturer’s instructions using two prpA -specific primers (GSP1 and GSP2) ( ). .. The amplified product was cloned using the CloneJET PCR cloning kit (Thermo Scientific) and sequenced by Sanger sequencing. .. Heterologous overexpression and purification of PrpA A gene fragment of prpA , encoding the N-terminal domain of PrpA excluding the N-terminal signal sequence, was amplified with the primers PrpA-BamHI and PrpA27-167 -R-NotI-STOP.

    Amplification:

    Article Title: Bioconversion of Beet Molasses to Alpha-Galactosidase and Ethanol
    Article Snippet: PCRs were performed using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). .. Construction of Plasmids pJETSUC2, pSparkURA3, and pJETsuc2Δ(266–388)URA3 The PCR products obtained from amplification of SUC2 and URA3 cassettes were cloned into vectors pJET1.2/blunt (CloneJET PCR Cloning Kit, Thermo Fisher Scientific) and pSpark IV (pSpark DNA Cloning System, Canvax Biotech) respectively, following the protocol recommended by each supplier, to create the plasmids pJETSUC2 and pSparkURA3 . .. The Bam HI-Kpn I fragment of 1,308 bp from pSparkURA3 was cloned between the Bam HI-Kpn I sites of pJETSUC2 into chemically competent XL1-Blue cells to construct the plasmid pJETsuc2 Δ(266–388)URA3 with the recombination sequences SR1 (1,962 bp) and SR2 (1,503 bp) that allowed the chromosomal integration ( ).

    Article Title: Case report: multiple and atypical amoebic cerebral abscesses resistant to treatment
    Article Snippet: The rest of the brain tissue was positive for glial fibrillary acidic protein (GFAP) (Fig. d) by immunofluorescence. .. The presence of E. histolytica in the cerebral tissue was corroborated by PCR, and an 128 bp amplicon of the E. histolytica rRNA gene (NCBI Accession number X65163.1) was cloned from cerebral tissue with the CloneJET PCR Cloning Kit (Thermo Scientific). .. DNA sequencing was performed in the Unit of Molecular Biology of the Institute of Cellular Physiology (National Autonomous University of Mexico) (Fig. ).

    Article Title: The N-terminal domain of the thermo-regulated surface protein PrpA of Enterococcus faecium binds to fibrinogen, fibronectin and platelets
    Article Snippet: Determination of the 5′ end of the prpA transcript We used 5′RACE (Life Technologies) to map the 5′-end of the prpA mRNA, following the manufacturer’s instructions using two prpA -specific primers (GSP1 and GSP2) ( ). .. The amplified product was cloned using the CloneJET PCR cloning kit (Thermo Scientific) and sequenced by Sanger sequencing. .. Heterologous overexpression and purification of PrpA A gene fragment of prpA , encoding the N-terminal domain of PrpA excluding the N-terminal signal sequence, was amplified with the primers PrpA-BamHI and PrpA27-167 -R-NotI-STOP.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Thermo Fisher clonejet pcr cloning kit
    <t>PCR,</t> cloning and sequencing. Total DNA was extracted from 100 mg paraffin-embedded cerebral tissue using the Wizard Genomic DNA purification kit (Promega, Madison, WI, USA). DNA was quantified in a NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA), obtaining an E. histolytica 128 bp amplicon for the rRNA gene, which was cloned with the <t>CloneJET</t> PCR Cloning Kit (Thermo Scientific) using a pJET1.2/blunt cloning vector. Then, the ligation mixture was used for transformation of Escherichia coli DH5a calcium-competent cells. Plasmid DNA was extracted from heat-shocked cells with the Zyppy Plasmid Miniprep (Zymo Research, Irvine, CA, USA). Clones were analyzed by PCR to verify the insertion of the amplicon into the pJET1.2/blunt vector. The plasmid sequence shows forward and reverse primers (electropherograms) that correspond to the E. histolytica rRNA gene sequence. Hu = 120 bp amplicon for human β-actin; M = bp marker; Eh = 128 bp amplicon for the E. histolytica rRNA 18 s gene, NTC = no template control
    Clonejet Pcr Cloning Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/clonejet pcr cloning kit/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    clonejet pcr cloning kit - by Bioz Stars, 2021-07
    97/100 stars
      Buy from Supplier

    86
    Thermo Fisher clonejet cloning kit
    <t>PCR,</t> cloning and sequencing. Total DNA was extracted from 100 mg paraffin-embedded cerebral tissue using the Wizard Genomic DNA purification kit (Promega, Madison, WI, USA). DNA was quantified in a NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA), obtaining an E. histolytica 128 bp amplicon for the rRNA gene, which was cloned with the <t>CloneJET</t> PCR Cloning Kit (Thermo Scientific) using a pJET1.2/blunt cloning vector. Then, the ligation mixture was used for transformation of Escherichia coli DH5a calcium-competent cells. Plasmid DNA was extracted from heat-shocked cells with the Zyppy Plasmid Miniprep (Zymo Research, Irvine, CA, USA). Clones were analyzed by PCR to verify the insertion of the amplicon into the pJET1.2/blunt vector. The plasmid sequence shows forward and reverse primers (electropherograms) that correspond to the E. histolytica rRNA gene sequence. Hu = 120 bp amplicon for human β-actin; M = bp marker; Eh = 128 bp amplicon for the E. histolytica rRNA 18 s gene, NTC = no template control
    Clonejet Cloning Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/clonejet cloning kit/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    clonejet cloning kit - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    Image Search Results


    PCR, cloning and sequencing. Total DNA was extracted from 100 mg paraffin-embedded cerebral tissue using the Wizard Genomic DNA purification kit (Promega, Madison, WI, USA). DNA was quantified in a NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA), obtaining an E. histolytica 128 bp amplicon for the rRNA gene, which was cloned with the CloneJET PCR Cloning Kit (Thermo Scientific) using a pJET1.2/blunt cloning vector. Then, the ligation mixture was used for transformation of Escherichia coli DH5a calcium-competent cells. Plasmid DNA was extracted from heat-shocked cells with the Zyppy Plasmid Miniprep (Zymo Research, Irvine, CA, USA). Clones were analyzed by PCR to verify the insertion of the amplicon into the pJET1.2/blunt vector. The plasmid sequence shows forward and reverse primers (electropherograms) that correspond to the E. histolytica rRNA gene sequence. Hu = 120 bp amplicon for human β-actin; M = bp marker; Eh = 128 bp amplicon for the E. histolytica rRNA 18 s gene, NTC = no template control

    Journal: BMC Infectious Diseases

    Article Title: Case report: multiple and atypical amoebic cerebral abscesses resistant to treatment

    doi: 10.1186/s12879-020-05391-y

    Figure Lengend Snippet: PCR, cloning and sequencing. Total DNA was extracted from 100 mg paraffin-embedded cerebral tissue using the Wizard Genomic DNA purification kit (Promega, Madison, WI, USA). DNA was quantified in a NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA), obtaining an E. histolytica 128 bp amplicon for the rRNA gene, which was cloned with the CloneJET PCR Cloning Kit (Thermo Scientific) using a pJET1.2/blunt cloning vector. Then, the ligation mixture was used for transformation of Escherichia coli DH5a calcium-competent cells. Plasmid DNA was extracted from heat-shocked cells with the Zyppy Plasmid Miniprep (Zymo Research, Irvine, CA, USA). Clones were analyzed by PCR to verify the insertion of the amplicon into the pJET1.2/blunt vector. The plasmid sequence shows forward and reverse primers (electropherograms) that correspond to the E. histolytica rRNA gene sequence. Hu = 120 bp amplicon for human β-actin; M = bp marker; Eh = 128 bp amplicon for the E. histolytica rRNA 18 s gene, NTC = no template control

    Article Snippet: The presence of E. histolytica in the cerebral tissue was corroborated by PCR, and an 128 bp amplicon of the E. histolytica rRNA gene (NCBI Accession number X65163.1) was cloned from cerebral tissue with the CloneJET PCR Cloning Kit (Thermo Scientific).

    Techniques: Polymerase Chain Reaction, Clone Assay, Sequencing, DNA Purification, Amplification, Plasmid Preparation, Ligation, Transformation Assay, Marker

    Vector and insert plasmid maps A) Illustration of the CloneJET plasmid containing the PCR product. Insertion of the PCR product in the cloning site of the plasmid disrupts the integrity of the toxic gene eco47IR and allows the growth of transgene positive clones. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 3 kb and 0.7 kb in size. The 0.7 kb fragment (tdTomato gene) was used as the insert for cloning. (B) Illustration of the vector plasmid. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 4.9 kb and 0.7 kb in size. The 4.9 kb fragment was used as the vector for cloning. AMP: Ampicillin resistance gene; PRE: posttranscriptional regulatory element; MPSV: myeloproliferative sarcoma virus promoter.

    Journal: Journal of Biological Engineering

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering

    doi: 10.1186/1754-1611-9-2

    Figure Lengend Snippet: Vector and insert plasmid maps A) Illustration of the CloneJET plasmid containing the PCR product. Insertion of the PCR product in the cloning site of the plasmid disrupts the integrity of the toxic gene eco47IR and allows the growth of transgene positive clones. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 3 kb and 0.7 kb in size. The 0.7 kb fragment (tdTomato gene) was used as the insert for cloning. (B) Illustration of the vector plasmid. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 4.9 kb and 0.7 kb in size. The 4.9 kb fragment was used as the vector for cloning. AMP: Ampicillin resistance gene; PRE: posttranscriptional regulatory element; MPSV: myeloproliferative sarcoma virus promoter.

    Article Snippet: For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific).

    Techniques: Plasmid Preparation, Polymerase Chain Reaction, Clone Assay