clonejet pcr cloning kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher clonejet pcr cloning kit
    Clonejet Pcr Cloning Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 746 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/clonejet pcr cloning kit/product/Thermo Fisher
    Average 90 stars, based on 746 article reviews
    Price from $9.99 to $1999.99
    clonejet pcr cloning kit - by Bioz Stars, 2020-02
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Molecular Cloning and Exploration of the Biochemical and Functional Analysis of Recombinant Glucose-6-Phosphate Dehydrogenase from Gluconoacetobacter diazotrophicus PAL5
    Article Snippet: .. The amplicon of the expected size (1530 bp) was purified and ligated into the pJET 1.2 vector (CloneJET PCR Cloning Kit; Thermo Scientific, Hudson, NH, USA), following the instructions of the protocol, to yield the plasmid named pJET/zwf , which was used to transform E. coli TOP10F’ competent cells. .. Then, from the transformant colonies, the plasmid DNA was extracted using the GeneJET Plasmid Miniprep Kit (Thermo Scientific, Waltham, MA, USA), according to the manufacturer’s instructions, and bidirectional DNA sequencing with verified internal forward and reverse sequencing primers was used to confirm that desired recombinant plasmids were obtained.

    Article Title: Astrocyte-secreted chordin like 1 drives synapse maturation and limits plasticity by increasing synaptic GluA2 AMPA receptors
    Article Snippet: .. For DNA sequencing, PCR products were cloned using the CloneJet PCR Cloning Kit (Thermo Scientific K1231), and mutations were identified by sequencing to identify the actual mutations (deletion or point mutations). .. A male mouse carrying a 2 nucleotide deletion in exon 3 of Chrdl1 was identified by DNA sequencing (see below).

    Article Title: Engineering the Direct Repeat Sequence of crRNA for Optimization of FnCpf1-Mediated Genome Editing in Human Cells
    Article Snippet: .. The crRNA expression cassette ( B) was generated by insertion of PCR products into vector pJET1.2 (CloneJET PCR Cloning Kit; Thermo Fisher Scientific). .. The direction of crRNA expression cassette was selected by primer-specific PCR.

    Article Title: Frequent cross-species transmissions of foamy virus between domestic and wild felids
    Article Snippet: .. Purified DNA was then cloned using pJET 1.2 blunt vector using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific, USA) and XL1-Blue E scheri chia coli competent cells (Agilent technologies, USA). .. Plasmids were isolated using DNA-spin Plasmid Purification Kit (iNtRON Biotechnology, Korea) and subsequently Sanger sequenced using primer walking at Quintarabio in San Francisco, CA.

    Article Title: The G119S Acetylcholinesterase (Ace-1) Target Site Mutation Confers Carbamate Resistance in the Major Malaria Vector Anopheles gambiae from Cameroon: A Challenge for the Coming IRS Implementation
    Article Snippet: .. To investigate the presence of Ace-1 duplication, purified DNA amplified from 18 alive mosquitoes after exposure to bendiocarb (8 mosquitoes) and propoxur (10 mosquitoes) were selected for cloning using the CloneJET™ PCR Cloning Kit (Thermo scientific, Waltham, MA, USA). .. The colonies were screened for the presence of the inserted amplicon using the supplied pJET1.2 primers according to the manufacturer’s instructions, and bands of approximately 900 bp were regarded as potential the Ace-1 clones.

    Article Title: High efficacy full allelic CRISPR/Cas9 gene editing in tetraploid potato
    Article Snippet: .. Gel purified PCR products were cloned using the CloneJet PCR cloning Kit (Thermo Scientific), sequenced by Sanger sequencing at Macrogen and analyzed on the CLC Main Workbench. .. Screening by Indel Detection by Amplicon Analysis (IDAA) Tri-primer PCR amplicons for IDAA were obtained using the primers + SNP FW, IDAA + SNP RV and Fluorescein Amidite (FAM) labelled FAMF, while primers –SNP FW and FAM-labelled -SNP RV were used for di-primer PCR.

    Article Title: Disease modeling of a mutation in α‐actinin 2 guides clinical therapy in hypertrophic cardiomyopathy
    Article Snippet: .. Additionally, PCR fragments of cells containing the modified ACTN2 locus were subcloned using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) for discrimination of allele‐specific genotypes. .. Finally, all used cell lines were genotyped by PCR for the ACTN2 locus and karyotyped by G‐banding as reported previously (Breckwoldt et al , ).

    Article Title: Disease modeling of a mutation in α‐actinin 2 guides clinical therapy in hypertrophic cardiomyopathy
    Article Snippet: .. Generated PCR fragments were purified with the QIAquick PCR Purification Kit (Qiagen) and cloned with the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) for discrimination of allele‐specific mRNA transcripts. .. Single colonies of transformed One Shot® TOP10 E. coli were transferred to overnight cultures [5 ml, lysogeny broth (BD), ampicillin (100 μg/ml; Serva)].

    Article Title: The Effect of a Combined Hydrogen Peroxide-MlrA Treatment on the Phytoplankton Community and Microcystin Concentrations in a Mesocosm Experiment in Lake Ludoš
    Article Snippet: .. The plasmids were prepared by cloning the amplicons of the mcyB and mcyE genes fragments using the CloneJET PCR Cloning Kit (Thermo Scientific) and linearized by FastDigest NotI restriction enzyme (Thermo Scientific). ..

    Article Title: Droplet digital PCR assays for the quantification of brown trout (Salmo trutta) and Arctic char (Salvelinus alpinus) from environmental DNA collected in the water of mountain lakes
    Article Snippet: .. PCR amplicons were cloned using CloneJet PCR cloning kit (ThermoScientific), followed by purification and Sanger sequencing (Eurofins). .. Sequencing results confirmed the specificity of each primer set.

    Article Title: High-frequency random DNA insertions upon co-delivery of CRISPR-Cas9 ribonucleoprotein and selectable marker plasmid in rice
    Article Snippet: .. PCR products were gel-purified using a QIAquick gel extraction kit (Qiagen Inc-USA, Germantown, MD), and cloned into vector pJET1.2 using a CloneJET PCR Cloning Kit (ThermoFisher Scientific, MA, USA) as per manufacturers instruction. ..

    Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
    Article Snippet: .. The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation. .. The plasmid DNA was purified from an overnight bacterial culture using a Nucleospin Plasmid Purification Kit (Macherey Nagel).

    Article Title: Retro-2 protects cells from ricin toxicity by inhibiting ASNA1-mediated ER targeting and insertion of tail-anchored proteins
    Article Snippet: .. The resulting amplicon was purified using a Zymoclean Gel DNA Recovery Kit (Zymo Research) and either hybridized and treated with T7 endonuclease I (New England Biolabs) according to manufacturer’s instruction or cloned into pJET1.2/blunt with the CloneJET PCR Cloning Kit (Thermo Fisher Scientific), and sequenced at Eton Bioscience. .. Lentiviral generation Wildtype cells were grown to 90% confluency in Gibco Opti-MEM reduced serum media (Thermo Fisher Scientific) supplemented with 5% FBS.

    Article Title: FGF and TGFβ signaling link form and function during jaw development and evolution
    Article Snippet: .. PCR products were ligated into pGEM-T Easy Vector System I (Promega, Madison, WI) or CloneJET PCR Cloning Kit (ThermoFisher, Waltham, MA) and used to transform NEB 5α E. coli cells (New England Biolabs, Ipswitch, MA). .. Clones were sequenced (McLab, South San Francisco, CA) using a T7 promoter primer.

    Article Title: Mechanisms of formation and accumulation of mitochondrial DNA deletions in aging neurons
    Article Snippet: .. For the characterization of deletions, PCR products unpurified or gel-purified were directly cloned into pJET2.1/Blunt vector using CloneJET PCR cloning kit (Fermentas) and sequenced. .. For the characterization of deletions, PCR products unpurified or gel-purified were directly cloned into pJET2.1/Blunt vector using CloneJET PCR cloning kit (Fermentas) and sequenced.

    Amplification:

    Article Title: Molecular Cloning and Exploration of the Biochemical and Functional Analysis of Recombinant Glucose-6-Phosphate Dehydrogenase from Gluconoacetobacter diazotrophicus PAL5
    Article Snippet: .. The amplicon of the expected size (1530 bp) was purified and ligated into the pJET 1.2 vector (CloneJET PCR Cloning Kit; Thermo Scientific, Hudson, NH, USA), following the instructions of the protocol, to yield the plasmid named pJET/zwf , which was used to transform E. coli TOP10F’ competent cells. .. Then, from the transformant colonies, the plasmid DNA was extracted using the GeneJET Plasmid Miniprep Kit (Thermo Scientific, Waltham, MA, USA), according to the manufacturer’s instructions, and bidirectional DNA sequencing with verified internal forward and reverse sequencing primers was used to confirm that desired recombinant plasmids were obtained.

    Article Title: The G119S Acetylcholinesterase (Ace-1) Target Site Mutation Confers Carbamate Resistance in the Major Malaria Vector Anopheles gambiae from Cameroon: A Challenge for the Coming IRS Implementation
    Article Snippet: .. To investigate the presence of Ace-1 duplication, purified DNA amplified from 18 alive mosquitoes after exposure to bendiocarb (8 mosquitoes) and propoxur (10 mosquitoes) were selected for cloning using the CloneJET™ PCR Cloning Kit (Thermo scientific, Waltham, MA, USA). .. The colonies were screened for the presence of the inserted amplicon using the supplied pJET1.2 primers according to the manufacturer’s instructions, and bands of approximately 900 bp were regarded as potential the Ace-1 clones.

    Article Title: High efficacy full allelic CRISPR/Cas9 gene editing in tetraploid potato
    Article Snippet: For genotyping of edited plants and protoplasts, the edited region was amplified with + SNP FW and + SNP RV. .. Gel purified PCR products were cloned using the CloneJet PCR cloning Kit (Thermo Scientific), sequenced by Sanger sequencing at Macrogen and analyzed on the CLC Main Workbench.

    Article Title: Disease modeling of a mutation in α‐actinin 2 guides clinical therapy in hypertrophic cardiomyopathy
    Article Snippet: RNA (200 ng) was reverse‐transcribed to cDNA according to the instructions of the manufacturer's protocol (SuperScript™ III First‐Strand Synthesis System, Invitrogen). cDNA was amplified with PrimeStar® HS DNA Polymerase in a 50‐μl PCR approach, for 35 cycles according to the instructions of the manufacturer's protocol (Primers, ). .. Generated PCR fragments were purified with the QIAquick PCR Purification Kit (Qiagen) and cloned with the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) for discrimination of allele‐specific mRNA transcripts.

    Article Title: Droplet digital PCR assays for the quantification of brown trout (Salmo trutta) and Arctic char (Salvelinus alpinus) from environmental DNA collected in the water of mountain lakes
    Article Snippet: We suspected a slight cross-contamination between fish tissues or the resulting DNA extracts during handling, a specific amplification being highly unlikely due to the high specificity of the molecular tools (two level of specificities with primers and probes and at least two mismatches in primers and probes). .. PCR amplicons were cloned using CloneJet PCR cloning kit (ThermoScientific), followed by purification and Sanger sequencing (Eurofins).

    Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
    Article Snippet: The virus-specific cDNA was then used as a template for PCR amplification with Q5 High-Fidelity DNA Polymerase (New England Biolabs) (initial denaturation for 30 s at 98 °C, 40 cycles of denaturation for 10 s at 98 °C, annealing for 30 s at 70 °C, extension for 3 min at 72 °C, and a final extension for 2 min at 72 °C) using the primers H14_HedgehogT7_1F and H14_Hedgehog_4118RXbaI. .. The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation.

    Article Title: Retro-2 protects cells from ricin toxicity by inhibiting ASNA1-mediated ER targeting and insertion of tail-anchored proteins
    Article Snippet: .. The resulting amplicon was purified using a Zymoclean Gel DNA Recovery Kit (Zymo Research) and either hybridized and treated with T7 endonuclease I (New England Biolabs) according to manufacturer’s instruction or cloned into pJET1.2/blunt with the CloneJET PCR Cloning Kit (Thermo Fisher Scientific), and sequenced at Eton Bioscience. .. Lentiviral generation Wildtype cells were grown to 90% confluency in Gibco Opti-MEM reduced serum media (Thermo Fisher Scientific) supplemented with 5% FBS.

    Article Title: Mechanisms of formation and accumulation of mitochondrial DNA deletions in aging neurons
    Article Snippet: Amplified PCR products were separated and visualized on agarose gels containing ethidium bromide. .. For the characterization of deletions, PCR products unpurified or gel-purified were directly cloned into pJET2.1/Blunt vector using CloneJET PCR cloning kit (Fermentas) and sequenced.

    Synthesized:

    Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
    Article Snippet: Briefly, primers were designed based on the sequence of the putative H14-hedgehog/2015/HUN (H14_HedgehogT7_1F, TAATACGACTCACTATA GGGTACATTATGGCCCAAAATGATG ; H14_Hedgehog_4118RXbaI, TCTCTAGACTCGA GCACTTATCTTGTACTAGGTTATC ; bold letters represent sequences from the virus under study). cDNA was synthesized using a RevertAid First Strand cDNA Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions from RNA extracted from hedgehog faeces using the primer H14_Hedgehog_4118RXbaI. .. The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation.

    Article Title: FGF and TGFβ signaling link form and function during jaw development and evolution
    Article Snippet: PCR products were ligated into pGEM-T Easy Vector System I (Promega, Madison, WI) or CloneJET PCR Cloning Kit (ThermoFisher, Waltham, MA) and used to transform NEB 5α E. coli cells (New England Biolabs, Ipswitch, MA). .. Once probe sequences were confirmed, DIG-labeled RNA probes were synthesized using DIG RNA labeling mix (Roche, Basel, Switzerland).

    Construct:

    Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
    Article Snippet: Dendrograms were constructed by the maximum-likelihood method based on the Poisson model with gamma distribution (+G) and invariable sites (+I). .. The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation.

    SYBR Green Assay:

    Article Title: The Effect of a Combined Hydrogen Peroxide-MlrA Treatment on the Phytoplankton Community and Microcystin Concentrations in a Mesocosm Experiment in Lake Ludoš
    Article Snippet: Real-time PCR was performed in duplicate (three biological replicates) using the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) and the PowerUp SYBR Green Master Mix (Thermo Scientific, Waltham, MA, USA). .. The plasmids were prepared by cloning the amplicons of the mcyB and mcyE genes fragments using the CloneJET PCR Cloning Kit (Thermo Scientific) and linearized by FastDigest NotI restriction enzyme (Thermo Scientific).

    Spectrophotometry:

    Article Title: The Effect of a Combined Hydrogen Peroxide-MlrA Treatment on the Phytoplankton Community and Microcystin Concentrations in a Mesocosm Experiment in Lake Ludoš
    Article Snippet: 1000 ng of RNA, quantified with a spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA), were used for cDNA synthesis using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) as per the manufacturer’s instructions. .. The plasmids were prepared by cloning the amplicons of the mcyB and mcyE genes fragments using the CloneJET PCR Cloning Kit (Thermo Scientific) and linearized by FastDigest NotI restriction enzyme (Thermo Scientific).

    Expressing:

    Article Title: Engineering the Direct Repeat Sequence of crRNA for Optimization of FnCpf1-Mediated Genome Editing in Human Cells
    Article Snippet: .. The crRNA expression cassette ( B) was generated by insertion of PCR products into vector pJET1.2 (CloneJET PCR Cloning Kit; Thermo Fisher Scientific). .. The direction of crRNA expression cassette was selected by primer-specific PCR.

    Modification:

    Article Title: Astrocyte-secreted chordin like 1 drives synapse maturation and limits plasticity by increasing synaptic GluA2 AMPA receptors
    Article Snippet: Paragraph title: T7 endonuclease Assay for Genome Modification. ... For DNA sequencing, PCR products were cloned using the CloneJet PCR Cloning Kit (Thermo Scientific K1231), and mutations were identified by sequencing to identify the actual mutations (deletion or point mutations).

    Article Title: Disease modeling of a mutation in α‐actinin 2 guides clinical therapy in hypertrophic cardiomyopathy
    Article Snippet: .. Additionally, PCR fragments of cells containing the modified ACTN2 locus were subcloned using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) for discrimination of allele‐specific genotypes. .. Finally, all used cell lines were genotyped by PCR for the ACTN2 locus and karyotyped by G‐banding as reported previously (Breckwoldt et al , ).

    Transformation Assay:

    Article Title: Disease modeling of a mutation in α‐actinin 2 guides clinical therapy in hypertrophic cardiomyopathy
    Article Snippet: Generated PCR fragments were purified with the QIAquick PCR Purification Kit (Qiagen) and cloned with the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) for discrimination of allele‐specific mRNA transcripts. .. Single colonies of transformed One Shot® TOP10 E. coli were transferred to overnight cultures [5 ml, lysogeny broth (BD), ampicillin (100 μg/ml; Serva)].

    Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
    Article Snippet: .. The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation. .. The plasmid DNA was purified from an overnight bacterial culture using a Nucleospin Plasmid Purification Kit (Macherey Nagel).

    Derivative Assay:

    Article Title: High efficacy full allelic CRISPR/Cas9 gene editing in tetraploid potato
    Article Snippet: In the attempts to reduce PCR derived chimeras, extension time was doubled and the primer concentration increased twofold. .. Gel purified PCR products were cloned using the CloneJet PCR cloning Kit (Thermo Scientific), sequenced by Sanger sequencing at Macrogen and analyzed on the CLC Main Workbench.

    Southern Blot:

    Article Title: Mechanisms of formation and accumulation of mitochondrial DNA deletions in aging neurons
    Article Snippet: Paragraph title: PCR and southern blotting ... For the characterization of deletions, PCR products unpurified or gel-purified were directly cloned into pJET2.1/Blunt vector using CloneJET PCR cloning kit (Fermentas) and sequenced.

    Concentration Assay:

    Article Title: High efficacy full allelic CRISPR/Cas9 gene editing in tetraploid potato
    Article Snippet: In the attempts to reduce PCR derived chimeras, extension time was doubled and the primer concentration increased twofold. .. Gel purified PCR products were cloned using the CloneJet PCR cloning Kit (Thermo Scientific), sequenced by Sanger sequencing at Macrogen and analyzed on the CLC Main Workbench.

    Cell Culture:

    Article Title: Disease modeling of a mutation in α‐actinin 2 guides clinical therapy in hypertrophic cardiomyopathy
    Article Snippet: Subcloned repaired HCM hiPSC clones were again picked and cultured, until characterization could be repeated as described above. .. Additionally, PCR fragments of cells containing the modified ACTN2 locus were subcloned using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) for discrimination of allele‐specific genotypes.

    Generated:

    Article Title: Engineering the Direct Repeat Sequence of crRNA for Optimization of FnCpf1-Mediated Genome Editing in Human Cells
    Article Snippet: .. The crRNA expression cassette ( B) was generated by insertion of PCR products into vector pJET1.2 (CloneJET PCR Cloning Kit; Thermo Fisher Scientific). .. The direction of crRNA expression cassette was selected by primer-specific PCR.

    Article Title: Disease modeling of a mutation in α‐actinin 2 guides clinical therapy in hypertrophic cardiomyopathy
    Article Snippet: Clones were maintained until sufficient cell material was generated for cryopreservation and genomic analysis by PCR. .. Additionally, PCR fragments of cells containing the modified ACTN2 locus were subcloned using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) for discrimination of allele‐specific genotypes.

    Article Title: Disease modeling of a mutation in α‐actinin 2 guides clinical therapy in hypertrophic cardiomyopathy
    Article Snippet: .. Generated PCR fragments were purified with the QIAquick PCR Purification Kit (Qiagen) and cloned with the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) for discrimination of allele‐specific mRNA transcripts. .. Single colonies of transformed One Shot® TOP10 E. coli were transferred to overnight cultures [5 ml, lysogeny broth (BD), ampicillin (100 μg/ml; Serva)].

    Article Title: The Effect of a Combined Hydrogen Peroxide-MlrA Treatment on the Phytoplankton Community and Microcystin Concentrations in a Mesocosm Experiment in Lake Ludoš
    Article Snippet: An end-point melt-curve analysis was generated after each run and was analysed to assure the absence of nonspecific PCR products. .. The plasmids were prepared by cloning the amplicons of the mcyB and mcyE genes fragments using the CloneJET PCR Cloning Kit (Thermo Scientific) and linearized by FastDigest NotI restriction enzyme (Thermo Scientific).

    DNA Sequencing:

    Article Title: Molecular Cloning and Exploration of the Biochemical and Functional Analysis of Recombinant Glucose-6-Phosphate Dehydrogenase from Gluconoacetobacter diazotrophicus PAL5
    Article Snippet: The amplicon of the expected size (1530 bp) was purified and ligated into the pJET 1.2 vector (CloneJET PCR Cloning Kit; Thermo Scientific, Hudson, NH, USA), following the instructions of the protocol, to yield the plasmid named pJET/zwf , which was used to transform E. coli TOP10F’ competent cells. .. Then, from the transformant colonies, the plasmid DNA was extracted using the GeneJET Plasmid Miniprep Kit (Thermo Scientific, Waltham, MA, USA), according to the manufacturer’s instructions, and bidirectional DNA sequencing with verified internal forward and reverse sequencing primers was used to confirm that desired recombinant plasmids were obtained.

    Article Title: Astrocyte-secreted chordin like 1 drives synapse maturation and limits plasticity by increasing synaptic GluA2 AMPA receptors
    Article Snippet: .. For DNA sequencing, PCR products were cloned using the CloneJet PCR Cloning Kit (Thermo Scientific K1231), and mutations were identified by sequencing to identify the actual mutations (deletion or point mutations). .. A male mouse carrying a 2 nucleotide deletion in exon 3 of Chrdl1 was identified by DNA sequencing (see below).

    Sequencing:

    Article Title: Molecular Cloning and Exploration of the Biochemical and Functional Analysis of Recombinant Glucose-6-Phosphate Dehydrogenase from Gluconoacetobacter diazotrophicus PAL5
    Article Snippet: Cloning of zwf from GDI The zwf gene from Reference Sequence GenBank: CAP54231.1 was amplified by polymerase chain reaction (PCR) using template genomic DNA from GDI and specific primers. .. The amplicon of the expected size (1530 bp) was purified and ligated into the pJET 1.2 vector (CloneJET PCR Cloning Kit; Thermo Scientific, Hudson, NH, USA), following the instructions of the protocol, to yield the plasmid named pJET/zwf , which was used to transform E. coli TOP10F’ competent cells.

    Article Title: Astrocyte-secreted chordin like 1 drives synapse maturation and limits plasticity by increasing synaptic GluA2 AMPA receptors
    Article Snippet: .. For DNA sequencing, PCR products were cloned using the CloneJet PCR Cloning Kit (Thermo Scientific K1231), and mutations were identified by sequencing to identify the actual mutations (deletion or point mutations). .. A male mouse carrying a 2 nucleotide deletion in exon 3 of Chrdl1 was identified by DNA sequencing (see below).

    Article Title: Frequent cross-species transmissions of foamy virus between domestic and wild felids
    Article Snippet: Nested PCR was used to recover proviral sequences for Sanger sequencing as follows: First Round 5 µl Kapa Hotstart Hifi polymerase (Kapa Biosystems, USA), 2 µl H2 O, 1 µl of both the forward and reverse primer ( ) and 2 µl of DNA. .. Purified DNA was then cloned using pJET 1.2 blunt vector using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific, USA) and XL1-Blue E scheri chia coli competent cells (Agilent technologies, USA).

    Article Title: The G119S Acetylcholinesterase (Ace-1) Target Site Mutation Confers Carbamate Resistance in the Major Malaria Vector Anopheles gambiae from Cameroon: A Challenge for the Coming IRS Implementation
    Article Snippet: Paragraph title: 2.4. Ace-1 Gene Amplification, Sequencing, and Cloning ... To investigate the presence of Ace-1 duplication, purified DNA amplified from 18 alive mosquitoes after exposure to bendiocarb (8 mosquitoes) and propoxur (10 mosquitoes) were selected for cloning using the CloneJET™ PCR Cloning Kit (Thermo scientific, Waltham, MA, USA).

    Article Title: High efficacy full allelic CRISPR/Cas9 gene editing in tetraploid potato
    Article Snippet: .. Gel purified PCR products were cloned using the CloneJet PCR cloning Kit (Thermo Scientific), sequenced by Sanger sequencing at Macrogen and analyzed on the CLC Main Workbench. .. Screening by Indel Detection by Amplicon Analysis (IDAA) Tri-primer PCR amplicons for IDAA were obtained using the primers + SNP FW, IDAA + SNP RV and Fluorescein Amidite (FAM) labelled FAMF, while primers –SNP FW and FAM-labelled -SNP RV were used for di-primer PCR.

    Article Title: Disease modeling of a mutation in α‐actinin 2 guides clinical therapy in hypertrophic cardiomyopathy
    Article Snippet: Generated PCR fragments were purified with the QIAquick PCR Purification Kit (Qiagen) and cloned with the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) for discrimination of allele‐specific mRNA transcripts. .. Plasmid extraction (NucleoSpin® Plasmid, Macheray‐Nagel) was performed the next day and send for sequencing (Eurofins Genomics).

    Article Title: Droplet digital PCR assays for the quantification of brown trout (Salmo trutta) and Arctic char (Salvelinus alpinus) from environmental DNA collected in the water of mountain lakes
    Article Snippet: .. PCR amplicons were cloned using CloneJet PCR cloning kit (ThermoScientific), followed by purification and Sanger sequencing (Eurofins). .. Sequencing results confirmed the specificity of each primer set.

    Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
    Article Snippet: Briefly, primers were designed based on the sequence of the putative H14-hedgehog/2015/HUN (H14_HedgehogT7_1F, TAATACGACTCACTATA GGGTACATTATGGCCCAAAATGATG ; H14_Hedgehog_4118RXbaI, TCTCTAGACTCGA GCACTTATCTTGTACTAGGTTATC ; bold letters represent sequences from the virus under study). cDNA was synthesized using a RevertAid First Strand cDNA Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions from RNA extracted from hedgehog faeces using the primer H14_Hedgehog_4118RXbaI. .. The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation.

    Article Title: Retro-2 protects cells from ricin toxicity by inhibiting ASNA1-mediated ER targeting and insertion of tail-anchored proteins
    Article Snippet: Indel formation in the ASNA1KO cells was confirmed by T7 endonuclease assay and standard commercial Sanger sequencing (Eton Bioscience). .. The resulting amplicon was purified using a Zymoclean Gel DNA Recovery Kit (Zymo Research) and either hybridized and treated with T7 endonuclease I (New England Biolabs) according to manufacturer’s instruction or cloned into pJET1.2/blunt with the CloneJET PCR Cloning Kit (Thermo Fisher Scientific), and sequenced at Eton Bioscience.

    Article Title: FGF and TGFβ signaling link form and function during jaw development and evolution
    Article Snippet: PCR products were ligated into pGEM-T Easy Vector System I (Promega, Madison, WI) or CloneJET PCR Cloning Kit (ThermoFisher, Waltham, MA) and used to transform NEB 5α E. coli cells (New England Biolabs, Ipswitch, MA). .. Sequencing results were analyzed using Geneious (Biomatters, Auckland, New Zealand).

    Recombinant:

    Article Title: Molecular Cloning and Exploration of the Biochemical and Functional Analysis of Recombinant Glucose-6-Phosphate Dehydrogenase from Gluconoacetobacter diazotrophicus PAL5
    Article Snippet: The amplicon of the expected size (1530 bp) was purified and ligated into the pJET 1.2 vector (CloneJET PCR Cloning Kit; Thermo Scientific, Hudson, NH, USA), following the instructions of the protocol, to yield the plasmid named pJET/zwf , which was used to transform E. coli TOP10F’ competent cells. .. Then, from the transformant colonies, the plasmid DNA was extracted using the GeneJET Plasmid Miniprep Kit (Thermo Scientific, Waltham, MA, USA), according to the manufacturer’s instructions, and bidirectional DNA sequencing with verified internal forward and reverse sequencing primers was used to confirm that desired recombinant plasmids were obtained.

    Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
    Article Snippet: The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation. .. The recombinant plasmid was then linearized with XbaI, treated with proteinase K, purified by phenol/chloroform extraction, and precipitated with ethanol.

    Molecular Weight:

    Article Title: FGF and TGFβ signaling link form and function during jaw development and evolution
    Article Snippet: Bands of the appropriate molecular weight were gel extracted using QIAEX II Gel Extraction Kit (Qiagen, Hilden, Germany). .. PCR products were ligated into pGEM-T Easy Vector System I (Promega, Madison, WI) or CloneJET PCR Cloning Kit (ThermoFisher, Waltham, MA) and used to transform NEB 5α E. coli cells (New England Biolabs, Ipswitch, MA).

    Imaging:

    Article Title: Molecular Cloning and Exploration of the Biochemical and Functional Analysis of Recombinant Glucose-6-Phosphate Dehydrogenase from Gluconoacetobacter diazotrophicus PAL5
    Article Snippet: The PCR product was separated using 1% agarose gel electrophoresis, stained with GelRed (Nucleic Acid Gel, Biotium, Fremon, CA, USA), and visualized in a MultiDoc-It Digital Imaging System (UVP, Upland, CA, USA). .. The amplicon of the expected size (1530 bp) was purified and ligated into the pJET 1.2 vector (CloneJET PCR Cloning Kit; Thermo Scientific, Hudson, NH, USA), following the instructions of the protocol, to yield the plasmid named pJET/zwf , which was used to transform E. coli TOP10F’ competent cells.

    DNA Extraction:

    Article Title: Droplet digital PCR assays for the quantification of brown trout (Salmo trutta) and Arctic char (Salvelinus alpinus) from environmental DNA collected in the water of mountain lakes
    Article Snippet: PCR amplicons were cloned using CloneJet PCR cloning kit (ThermoScientific), followed by purification and Sanger sequencing (Eurofins). .. The ddPCR reactions were run in triplicates for a total number of 256 DNA extracts (229 from water samples, 14 from sampling controls, 13 from DNA extraction controls).

    Article Title: Retro-2 protects cells from ricin toxicity by inhibiting ASNA1-mediated ER targeting and insertion of tail-anchored proteins
    Article Snippet: In brief, genomic DNA (gDNA) was extracted using QuickExtract DNA extraction solution (Lucigen) according to manufacturer’s instructions. .. The resulting amplicon was purified using a Zymoclean Gel DNA Recovery Kit (Zymo Research) and either hybridized and treated with T7 endonuclease I (New England Biolabs) according to manufacturer’s instruction or cloned into pJET1.2/blunt with the CloneJET PCR Cloning Kit (Thermo Fisher Scientific), and sequenced at Eton Bioscience.

    In Vivo:

    Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
    Article Snippet: The genomic DNA of H14-hedgehog/2015/HUN was cloned for in vitro transcription and in vivo plant inoculation studies. .. The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation.

    Real-time Polymerase Chain Reaction:

    Article Title: The Effect of a Combined Hydrogen Peroxide-MlrA Treatment on the Phytoplankton Community and Microcystin Concentrations in a Mesocosm Experiment in Lake Ludoš
    Article Snippet: Paragraph title: 5.6. Real Time PCR ... The plasmids were prepared by cloning the amplicons of the mcyB and mcyE genes fragments using the CloneJET PCR Cloning Kit (Thermo Scientific) and linearized by FastDigest NotI restriction enzyme (Thermo Scientific).

    Mutagenesis:

    Article Title: Astrocyte-secreted chordin like 1 drives synapse maturation and limits plasticity by increasing synaptic GluA2 AMPA receptors
    Article Snippet: Two steps of PCR (nested PCR strategy, two sets of primers around the mutation site) were performed to get a single PCR product (a single band checked on the gel). .. For DNA sequencing, PCR products were cloned using the CloneJet PCR Cloning Kit (Thermo Scientific K1231), and mutations were identified by sequencing to identify the actual mutations (deletion or point mutations).

    Article Title: The G119S Acetylcholinesterase (Ace-1) Target Site Mutation Confers Carbamate Resistance in the Major Malaria Vector Anopheles gambiae from Cameroon: A Challenge for the Coming IRS Implementation
    Article Snippet: These amplicons were sequenced directly using the primers Ex2Agdir1 and Ex4Agrev2 to confirm the presence of the G119S mutation and assess signature of selection at this Ace-1 in this location. .. To investigate the presence of Ace-1 duplication, purified DNA amplified from 18 alive mosquitoes after exposure to bendiocarb (8 mosquitoes) and propoxur (10 mosquitoes) were selected for cloning using the CloneJET™ PCR Cloning Kit (Thermo scientific, Waltham, MA, USA).

    Isolation:

    Article Title: Engineering the Direct Repeat Sequence of crRNA for Optimization of FnCpf1-Mediated Genome Editing in Human Cells
    Article Snippet: The crRNA expression cassette ( B) was generated by insertion of PCR products into vector pJET1.2 (CloneJET PCR Cloning Kit; Thermo Fisher Scientific). .. Plasmid DNA and genomic DNA were isolated by standard techniques.

    Article Title: Frequent cross-species transmissions of foamy virus between domestic and wild felids
    Article Snippet: Purified DNA was then cloned using pJET 1.2 blunt vector using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific, USA) and XL1-Blue E scheri chia coli competent cells (Agilent technologies, USA). .. Plasmids were isolated using DNA-spin Plasmid Purification Kit (iNtRON Biotechnology, Korea) and subsequently Sanger sequenced using primer walking at Quintarabio in San Francisco, CA.

    Article Title: High-frequency random DNA insertions upon co-delivery of CRISPR-Cas9 ribonucleoprotein and selectable marker plasmid in rice
    Article Snippet: Genotyping Genomic DNA was isolated from leaves of transgenic rice plants as described previously . .. PCR products were gel-purified using a QIAquick gel extraction kit (Qiagen Inc-USA, Germantown, MD), and cloned into vector pJET1.2 using a CloneJET PCR Cloning Kit (ThermoFisher Scientific, MA, USA) as per manufacturers instruction.

    Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
    Article Snippet: .. The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation. .. The plasmid DNA was purified from an overnight bacterial culture using a Nucleospin Plasmid Purification Kit (Macherey Nagel).

    Article Title: Mechanisms of formation and accumulation of mitochondrial DNA deletions in aging neurons
    Article Snippet: Total DNA was isolated from the cortex, hippocampus or cerebellum using phenol–chloroform extraction. .. For the characterization of deletions, PCR products unpurified or gel-purified were directly cloned into pJET2.1/Blunt vector using CloneJET PCR cloning kit (Fermentas) and sequenced.

    Subcloning:

    Article Title: Disease modeling of a mutation in α‐actinin 2 guides clinical therapy in hypertrophic cardiomyopathy
    Article Snippet: Subcloning was introduced to minimize chances of mixed clonal populations. .. Additionally, PCR fragments of cells containing the modified ACTN2 locus were subcloned using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) for discrimination of allele‐specific genotypes.

    Labeling:

    Article Title: FGF and TGFβ signaling link form and function during jaw development and evolution
    Article Snippet: PCR products were ligated into pGEM-T Easy Vector System I (Promega, Madison, WI) or CloneJET PCR Cloning Kit (ThermoFisher, Waltham, MA) and used to transform NEB 5α E. coli cells (New England Biolabs, Ipswitch, MA). .. Once probe sequences were confirmed, DIG-labeled RNA probes were synthesized using DIG RNA labeling mix (Roche, Basel, Switzerland).

    Purification:

    Article Title: Molecular Cloning and Exploration of the Biochemical and Functional Analysis of Recombinant Glucose-6-Phosphate Dehydrogenase from Gluconoacetobacter diazotrophicus PAL5
    Article Snippet: .. The amplicon of the expected size (1530 bp) was purified and ligated into the pJET 1.2 vector (CloneJET PCR Cloning Kit; Thermo Scientific, Hudson, NH, USA), following the instructions of the protocol, to yield the plasmid named pJET/zwf , which was used to transform E. coli TOP10F’ competent cells. .. Then, from the transformant colonies, the plasmid DNA was extracted using the GeneJET Plasmid Miniprep Kit (Thermo Scientific, Waltham, MA, USA), according to the manufacturer’s instructions, and bidirectional DNA sequencing with verified internal forward and reverse sequencing primers was used to confirm that desired recombinant plasmids were obtained.

    Article Title: Frequent cross-species transmissions of foamy virus between domestic and wild felids
    Article Snippet: .. Purified DNA was then cloned using pJET 1.2 blunt vector using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific, USA) and XL1-Blue E scheri chia coli competent cells (Agilent technologies, USA). .. Plasmids were isolated using DNA-spin Plasmid Purification Kit (iNtRON Biotechnology, Korea) and subsequently Sanger sequenced using primer walking at Quintarabio in San Francisco, CA.

    Article Title: The G119S Acetylcholinesterase (Ace-1) Target Site Mutation Confers Carbamate Resistance in the Major Malaria Vector Anopheles gambiae from Cameroon: A Challenge for the Coming IRS Implementation
    Article Snippet: .. To investigate the presence of Ace-1 duplication, purified DNA amplified from 18 alive mosquitoes after exposure to bendiocarb (8 mosquitoes) and propoxur (10 mosquitoes) were selected for cloning using the CloneJET™ PCR Cloning Kit (Thermo scientific, Waltham, MA, USA). .. The colonies were screened for the presence of the inserted amplicon using the supplied pJET1.2 primers according to the manufacturer’s instructions, and bands of approximately 900 bp were regarded as potential the Ace-1 clones.

    Article Title: High efficacy full allelic CRISPR/Cas9 gene editing in tetraploid potato
    Article Snippet: .. Gel purified PCR products were cloned using the CloneJet PCR cloning Kit (Thermo Scientific), sequenced by Sanger sequencing at Macrogen and analyzed on the CLC Main Workbench. .. Screening by Indel Detection by Amplicon Analysis (IDAA) Tri-primer PCR amplicons for IDAA were obtained using the primers + SNP FW, IDAA + SNP RV and Fluorescein Amidite (FAM) labelled FAMF, while primers –SNP FW and FAM-labelled -SNP RV were used for di-primer PCR.

    Article Title: Disease modeling of a mutation in α‐actinin 2 guides clinical therapy in hypertrophic cardiomyopathy
    Article Snippet: .. Generated PCR fragments were purified with the QIAquick PCR Purification Kit (Qiagen) and cloned with the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) for discrimination of allele‐specific mRNA transcripts. .. Single colonies of transformed One Shot® TOP10 E. coli were transferred to overnight cultures [5 ml, lysogeny broth (BD), ampicillin (100 μg/ml; Serva)].

    Article Title: Droplet digital PCR assays for the quantification of brown trout (Salmo trutta) and Arctic char (Salvelinus alpinus) from environmental DNA collected in the water of mountain lakes
    Article Snippet: .. PCR amplicons were cloned using CloneJet PCR cloning kit (ThermoScientific), followed by purification and Sanger sequencing (Eurofins). .. Sequencing results confirmed the specificity of each primer set.

    Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
    Article Snippet: The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation. .. The plasmid DNA was purified from an overnight bacterial culture using a Nucleospin Plasmid Purification Kit (Macherey Nagel).

    Article Title: Retro-2 protects cells from ricin toxicity by inhibiting ASNA1-mediated ER targeting and insertion of tail-anchored proteins
    Article Snippet: .. The resulting amplicon was purified using a Zymoclean Gel DNA Recovery Kit (Zymo Research) and either hybridized and treated with T7 endonuclease I (New England Biolabs) according to manufacturer’s instruction or cloned into pJET1.2/blunt with the CloneJET PCR Cloning Kit (Thermo Fisher Scientific), and sequenced at Eton Bioscience. .. Lentiviral generation Wildtype cells were grown to 90% confluency in Gibco Opti-MEM reduced serum media (Thermo Fisher Scientific) supplemented with 5% FBS.

    Polymerase Chain Reaction:

    Article Title: Molecular Cloning and Exploration of the Biochemical and Functional Analysis of Recombinant Glucose-6-Phosphate Dehydrogenase from Gluconoacetobacter diazotrophicus PAL5
    Article Snippet: .. The amplicon of the expected size (1530 bp) was purified and ligated into the pJET 1.2 vector (CloneJET PCR Cloning Kit; Thermo Scientific, Hudson, NH, USA), following the instructions of the protocol, to yield the plasmid named pJET/zwf , which was used to transform E. coli TOP10F’ competent cells. .. Then, from the transformant colonies, the plasmid DNA was extracted using the GeneJET Plasmid Miniprep Kit (Thermo Scientific, Waltham, MA, USA), according to the manufacturer’s instructions, and bidirectional DNA sequencing with verified internal forward and reverse sequencing primers was used to confirm that desired recombinant plasmids were obtained.

    Article Title: Astrocyte-secreted chordin like 1 drives synapse maturation and limits plasticity by increasing synaptic GluA2 AMPA receptors
    Article Snippet: .. For DNA sequencing, PCR products were cloned using the CloneJet PCR Cloning Kit (Thermo Scientific K1231), and mutations were identified by sequencing to identify the actual mutations (deletion or point mutations). .. A male mouse carrying a 2 nucleotide deletion in exon 3 of Chrdl1 was identified by DNA sequencing (see below).

    Article Title: Engineering the Direct Repeat Sequence of crRNA for Optimization of FnCpf1-Mediated Genome Editing in Human Cells
    Article Snippet: .. The crRNA expression cassette ( B) was generated by insertion of PCR products into vector pJET1.2 (CloneJET PCR Cloning Kit; Thermo Fisher Scientific). .. The direction of crRNA expression cassette was selected by primer-specific PCR.

    Article Title: Frequent cross-species transmissions of foamy virus between domestic and wild felids
    Article Snippet: .. Purified DNA was then cloned using pJET 1.2 blunt vector using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific, USA) and XL1-Blue E scheri chia coli competent cells (Agilent technologies, USA). .. Plasmids were isolated using DNA-spin Plasmid Purification Kit (iNtRON Biotechnology, Korea) and subsequently Sanger sequenced using primer walking at Quintarabio in San Francisco, CA.

    Article Title: The G119S Acetylcholinesterase (Ace-1) Target Site Mutation Confers Carbamate Resistance in the Major Malaria Vector Anopheles gambiae from Cameroon: A Challenge for the Coming IRS Implementation
    Article Snippet: .. To investigate the presence of Ace-1 duplication, purified DNA amplified from 18 alive mosquitoes after exposure to bendiocarb (8 mosquitoes) and propoxur (10 mosquitoes) were selected for cloning using the CloneJET™ PCR Cloning Kit (Thermo scientific, Waltham, MA, USA). .. The colonies were screened for the presence of the inserted amplicon using the supplied pJET1.2 primers according to the manufacturer’s instructions, and bands of approximately 900 bp were regarded as potential the Ace-1 clones.

    Article Title: High efficacy full allelic CRISPR/Cas9 gene editing in tetraploid potato
    Article Snippet: .. Gel purified PCR products were cloned using the CloneJet PCR cloning Kit (Thermo Scientific), sequenced by Sanger sequencing at Macrogen and analyzed on the CLC Main Workbench. .. Screening by Indel Detection by Amplicon Analysis (IDAA) Tri-primer PCR amplicons for IDAA were obtained using the primers + SNP FW, IDAA + SNP RV and Fluorescein Amidite (FAM) labelled FAMF, while primers –SNP FW and FAM-labelled -SNP RV were used for di-primer PCR.

    Article Title: Disease modeling of a mutation in α‐actinin 2 guides clinical therapy in hypertrophic cardiomyopathy
    Article Snippet: .. Additionally, PCR fragments of cells containing the modified ACTN2 locus were subcloned using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) for discrimination of allele‐specific genotypes. .. Finally, all used cell lines were genotyped by PCR for the ACTN2 locus and karyotyped by G‐banding as reported previously (Breckwoldt et al , ).

    Article Title: Disease modeling of a mutation in α‐actinin 2 guides clinical therapy in hypertrophic cardiomyopathy
    Article Snippet: .. Generated PCR fragments were purified with the QIAquick PCR Purification Kit (Qiagen) and cloned with the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) for discrimination of allele‐specific mRNA transcripts. .. Single colonies of transformed One Shot® TOP10 E. coli were transferred to overnight cultures [5 ml, lysogeny broth (BD), ampicillin (100 μg/ml; Serva)].

    Article Title: The Effect of a Combined Hydrogen Peroxide-MlrA Treatment on the Phytoplankton Community and Microcystin Concentrations in a Mesocosm Experiment in Lake Ludoš
    Article Snippet: .. The plasmids were prepared by cloning the amplicons of the mcyB and mcyE genes fragments using the CloneJET PCR Cloning Kit (Thermo Scientific) and linearized by FastDigest NotI restriction enzyme (Thermo Scientific). ..

    Article Title: Droplet digital PCR assays for the quantification of brown trout (Salmo trutta) and Arctic char (Salvelinus alpinus) from environmental DNA collected in the water of mountain lakes
    Article Snippet: .. PCR amplicons were cloned using CloneJet PCR cloning kit (ThermoScientific), followed by purification and Sanger sequencing (Eurofins). .. Sequencing results confirmed the specificity of each primer set.

    Article Title: High-frequency random DNA insertions upon co-delivery of CRISPR-Cas9 ribonucleoprotein and selectable marker plasmid in rice
    Article Snippet: .. PCR products were gel-purified using a QIAquick gel extraction kit (Qiagen Inc-USA, Germantown, MD), and cloned into vector pJET1.2 using a CloneJET PCR Cloning Kit (ThermoFisher Scientific, MA, USA) as per manufacturers instruction. ..

    Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
    Article Snippet: .. The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation. .. The plasmid DNA was purified from an overnight bacterial culture using a Nucleospin Plasmid Purification Kit (Macherey Nagel).

    Article Title: Retro-2 protects cells from ricin toxicity by inhibiting ASNA1-mediated ER targeting and insertion of tail-anchored proteins
    Article Snippet: .. The resulting amplicon was purified using a Zymoclean Gel DNA Recovery Kit (Zymo Research) and either hybridized and treated with T7 endonuclease I (New England Biolabs) according to manufacturer’s instruction or cloned into pJET1.2/blunt with the CloneJET PCR Cloning Kit (Thermo Fisher Scientific), and sequenced at Eton Bioscience. .. Lentiviral generation Wildtype cells were grown to 90% confluency in Gibco Opti-MEM reduced serum media (Thermo Fisher Scientific) supplemented with 5% FBS.

    Article Title: FGF and TGFβ signaling link form and function during jaw development and evolution
    Article Snippet: .. PCR products were ligated into pGEM-T Easy Vector System I (Promega, Madison, WI) or CloneJET PCR Cloning Kit (ThermoFisher, Waltham, MA) and used to transform NEB 5α E. coli cells (New England Biolabs, Ipswitch, MA). .. Clones were sequenced (McLab, South San Francisco, CA) using a T7 promoter primer.

    Article Title: Mechanisms of formation and accumulation of mitochondrial DNA deletions in aging neurons
    Article Snippet: .. For the characterization of deletions, PCR products unpurified or gel-purified were directly cloned into pJET2.1/Blunt vector using CloneJET PCR cloning kit (Fermentas) and sequenced. .. For the characterization of deletions, PCR products unpurified or gel-purified were directly cloned into pJET2.1/Blunt vector using CloneJET PCR cloning kit (Fermentas) and sequenced.

    Staining:

    Article Title: Molecular Cloning and Exploration of the Biochemical and Functional Analysis of Recombinant Glucose-6-Phosphate Dehydrogenase from Gluconoacetobacter diazotrophicus PAL5
    Article Snippet: The PCR product was separated using 1% agarose gel electrophoresis, stained with GelRed (Nucleic Acid Gel, Biotium, Fremon, CA, USA), and visualized in a MultiDoc-It Digital Imaging System (UVP, Upland, CA, USA). .. The amplicon of the expected size (1530 bp) was purified and ligated into the pJET 1.2 vector (CloneJET PCR Cloning Kit; Thermo Scientific, Hudson, NH, USA), following the instructions of the protocol, to yield the plasmid named pJET/zwf , which was used to transform E. coli TOP10F’ competent cells.

    Nested PCR:

    Article Title: Astrocyte-secreted chordin like 1 drives synapse maturation and limits plasticity by increasing synaptic GluA2 AMPA receptors
    Article Snippet: Two steps of PCR (nested PCR strategy, two sets of primers around the mutation site) were performed to get a single PCR product (a single band checked on the gel). .. For DNA sequencing, PCR products were cloned using the CloneJet PCR Cloning Kit (Thermo Scientific K1231), and mutations were identified by sequencing to identify the actual mutations (deletion or point mutations).

    Article Title: Frequent cross-species transmissions of foamy virus between domestic and wild felids
    Article Snippet: Nested PCR was used to recover proviral sequences for Sanger sequencing as follows: First Round 5 µl Kapa Hotstart Hifi polymerase (Kapa Biosystems, USA), 2 µl H2 O, 1 µl of both the forward and reverse primer ( ) and 2 µl of DNA. .. Purified DNA was then cloned using pJET 1.2 blunt vector using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific, USA) and XL1-Blue E scheri chia coli competent cells (Agilent technologies, USA).

    In Situ Hybridization:

    Article Title: FGF and TGFβ signaling link form and function during jaw development and evolution
    Article Snippet: Paragraph title: 2.5. In situ hybridization ... PCR products were ligated into pGEM-T Easy Vector System I (Promega, Madison, WI) or CloneJET PCR Cloning Kit (ThermoFisher, Waltham, MA) and used to transform NEB 5α E. coli cells (New England Biolabs, Ipswitch, MA).

    Plasmid Preparation:

    Article Title: Molecular Cloning and Exploration of the Biochemical and Functional Analysis of Recombinant Glucose-6-Phosphate Dehydrogenase from Gluconoacetobacter diazotrophicus PAL5
    Article Snippet: .. The amplicon of the expected size (1530 bp) was purified and ligated into the pJET 1.2 vector (CloneJET PCR Cloning Kit; Thermo Scientific, Hudson, NH, USA), following the instructions of the protocol, to yield the plasmid named pJET/zwf , which was used to transform E. coli TOP10F’ competent cells. .. Then, from the transformant colonies, the plasmid DNA was extracted using the GeneJET Plasmid Miniprep Kit (Thermo Scientific, Waltham, MA, USA), according to the manufacturer’s instructions, and bidirectional DNA sequencing with verified internal forward and reverse sequencing primers was used to confirm that desired recombinant plasmids were obtained.

    Article Title: Engineering the Direct Repeat Sequence of crRNA for Optimization of FnCpf1-Mediated Genome Editing in Human Cells
    Article Snippet: .. The crRNA expression cassette ( B) was generated by insertion of PCR products into vector pJET1.2 (CloneJET PCR Cloning Kit; Thermo Fisher Scientific). .. The direction of crRNA expression cassette was selected by primer-specific PCR.

    Article Title: Frequent cross-species transmissions of foamy virus between domestic and wild felids
    Article Snippet: .. Purified DNA was then cloned using pJET 1.2 blunt vector using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific, USA) and XL1-Blue E scheri chia coli competent cells (Agilent technologies, USA). .. Plasmids were isolated using DNA-spin Plasmid Purification Kit (iNtRON Biotechnology, Korea) and subsequently Sanger sequenced using primer walking at Quintarabio in San Francisco, CA.

    Article Title: Disease modeling of a mutation in α‐actinin 2 guides clinical therapy in hypertrophic cardiomyopathy
    Article Snippet: Generated PCR fragments were purified with the QIAquick PCR Purification Kit (Qiagen) and cloned with the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) for discrimination of allele‐specific mRNA transcripts. .. Plasmid extraction (NucleoSpin® Plasmid, Macheray‐Nagel) was performed the next day and send for sequencing (Eurofins Genomics).

    Article Title: High-frequency random DNA insertions upon co-delivery of CRISPR-Cas9 ribonucleoprotein and selectable marker plasmid in rice
    Article Snippet: .. PCR products were gel-purified using a QIAquick gel extraction kit (Qiagen Inc-USA, Germantown, MD), and cloned into vector pJET1.2 using a CloneJET PCR Cloning Kit (ThermoFisher Scientific, MA, USA) as per manufacturers instruction. ..

    Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
    Article Snippet: .. The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation. .. The plasmid DNA was purified from an overnight bacterial culture using a Nucleospin Plasmid Purification Kit (Macherey Nagel).

    Article Title: FGF and TGFβ signaling link form and function during jaw development and evolution
    Article Snippet: .. PCR products were ligated into pGEM-T Easy Vector System I (Promega, Madison, WI) or CloneJET PCR Cloning Kit (ThermoFisher, Waltham, MA) and used to transform NEB 5α E. coli cells (New England Biolabs, Ipswitch, MA). .. Clones were sequenced (McLab, South San Francisco, CA) using a T7 promoter primer.

    Article Title: Mechanisms of formation and accumulation of mitochondrial DNA deletions in aging neurons
    Article Snippet: .. For the characterization of deletions, PCR products unpurified or gel-purified were directly cloned into pJET2.1/Blunt vector using CloneJET PCR cloning kit (Fermentas) and sequenced. .. For the characterization of deletions, PCR products unpurified or gel-purified were directly cloned into pJET2.1/Blunt vector using CloneJET PCR cloning kit (Fermentas) and sequenced.

    Software:

    Article Title: The G119S Acetylcholinesterase (Ace-1) Target Site Mutation Confers Carbamate Resistance in the Major Malaria Vector Anopheles gambiae from Cameroon: A Challenge for the Coming IRS Implementation
    Article Snippet: To investigate the presence of Ace-1 duplication, purified DNA amplified from 18 alive mosquitoes after exposure to bendiocarb (8 mosquitoes) and propoxur (10 mosquitoes) were selected for cloning using the CloneJET™ PCR Cloning Kit (Thermo scientific, Waltham, MA, USA). .. All the successfully sequenced samples were aligned using ClustalW [ ] as implemented in Bioedit software [ ].

    Electrophoresis:

    Article Title: Frequent cross-species transmissions of foamy virus between domestic and wild felids
    Article Snippet: PCR products were resolved on a 0.7 per cent agarose gel using electrophoresis for 30 min at 110 V. Bands of the correct size were excised from the gel and purified using a MEGAquick-spin™ Total Fragment DNA Purification Kit (iNtRON Biotechnology, Korea). .. Purified DNA was then cloned using pJET 1.2 blunt vector using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific, USA) and XL1-Blue E scheri chia coli competent cells (Agilent technologies, USA).

    Multiplex Assay:

    Article Title: Droplet digital PCR assays for the quantification of brown trout (Salmo trutta) and Arctic char (Salvelinus alpinus) from environmental DNA collected in the water of mountain lakes
    Article Snippet: Paragraph title: DNA extractions and multiplex ddPCR assays ... PCR amplicons were cloned using CloneJet PCR cloning kit (ThermoScientific), followed by purification and Sanger sequencing (Eurofins).

    Selection:

    Article Title: The G119S Acetylcholinesterase (Ace-1) Target Site Mutation Confers Carbamate Resistance in the Major Malaria Vector Anopheles gambiae from Cameroon: A Challenge for the Coming IRS Implementation
    Article Snippet: These amplicons were sequenced directly using the primers Ex2Agdir1 and Ex4Agrev2 to confirm the presence of the G119S mutation and assess signature of selection at this Ace-1 in this location. .. To investigate the presence of Ace-1 duplication, purified DNA amplified from 18 alive mosquitoes after exposure to bendiocarb (8 mosquitoes) and propoxur (10 mosquitoes) were selected for cloning using the CloneJET™ PCR Cloning Kit (Thermo scientific, Waltham, MA, USA).

    Agarose Gel Electrophoresis:

    Article Title: Molecular Cloning and Exploration of the Biochemical and Functional Analysis of Recombinant Glucose-6-Phosphate Dehydrogenase from Gluconoacetobacter diazotrophicus PAL5
    Article Snippet: The PCR product was separated using 1% agarose gel electrophoresis, stained with GelRed (Nucleic Acid Gel, Biotium, Fremon, CA, USA), and visualized in a MultiDoc-It Digital Imaging System (UVP, Upland, CA, USA). .. The amplicon of the expected size (1530 bp) was purified and ligated into the pJET 1.2 vector (CloneJET PCR Cloning Kit; Thermo Scientific, Hudson, NH, USA), following the instructions of the protocol, to yield the plasmid named pJET/zwf , which was used to transform E. coli TOP10F’ competent cells.

    Article Title: Astrocyte-secreted chordin like 1 drives synapse maturation and limits plasticity by increasing synaptic GluA2 AMPA receptors
    Article Snippet: Digested PCR products were separated on an ethidium bromide-stained agarose gel (2%). .. For DNA sequencing, PCR products were cloned using the CloneJet PCR Cloning Kit (Thermo Scientific K1231), and mutations were identified by sequencing to identify the actual mutations (deletion or point mutations).

    Article Title: Frequent cross-species transmissions of foamy virus between domestic and wild felids
    Article Snippet: PCR products were resolved on a 0.7 per cent agarose gel using electrophoresis for 30 min at 110 V. Bands of the correct size were excised from the gel and purified using a MEGAquick-spin™ Total Fragment DNA Purification Kit (iNtRON Biotechnology, Korea). .. Purified DNA was then cloned using pJET 1.2 blunt vector using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific, USA) and XL1-Blue E scheri chia coli competent cells (Agilent technologies, USA).

    Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
    Article Snippet: .. The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation. .. The plasmid DNA was purified from an overnight bacterial culture using a Nucleospin Plasmid Purification Kit (Macherey Nagel).

    Article Title: Mechanisms of formation and accumulation of mitochondrial DNA deletions in aging neurons
    Article Snippet: For the characterization of deletions, PCR products unpurified or gel-purified were directly cloned into pJET2.1/Blunt vector using CloneJET PCR cloning kit (Fermentas) and sequenced. .. Unless otherwise indicated, 5 µg of total DNA was digested with Mlu I, separated on 0.7% agarose gel and transferred to a Zeta-probe GT membrane (Biorad).

    In Vitro:

    Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
    Article Snippet: The genomic DNA of H14-hedgehog/2015/HUN was cloned for in vitro transcription and in vivo plant inoculation studies. .. The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation.

    Transgenic Assay:

    Article Title: High-frequency random DNA insertions upon co-delivery of CRISPR-Cas9 ribonucleoprotein and selectable marker plasmid in rice
    Article Snippet: Genotyping Genomic DNA was isolated from leaves of transgenic rice plants as described previously . .. PCR products were gel-purified using a QIAquick gel extraction kit (Qiagen Inc-USA, Germantown, MD), and cloned into vector pJET1.2 using a CloneJET PCR Cloning Kit (ThermoFisher Scientific, MA, USA) as per manufacturers instruction.

    Chromosome Walking:

    Article Title: Frequent cross-species transmissions of foamy virus between domestic and wild felids
    Article Snippet: Purified DNA was then cloned using pJET 1.2 blunt vector using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific, USA) and XL1-Blue E scheri chia coli competent cells (Agilent technologies, USA). .. Plasmids were isolated using DNA-spin Plasmid Purification Kit (iNtRON Biotechnology, Korea) and subsequently Sanger sequenced using primer walking at Quintarabio in San Francisco, CA.

    Knock-Out:

    Article Title: Retro-2 protects cells from ricin toxicity by inhibiting ASNA1-mediated ER targeting and insertion of tail-anchored proteins
    Article Snippet: Knockout cells were confirmed by immunoblot against ASNA1. .. The resulting amplicon was purified using a Zymoclean Gel DNA Recovery Kit (Zymo Research) and either hybridized and treated with T7 endonuclease I (New England Biolabs) according to manufacturer’s instruction or cloned into pJET1.2/blunt with the CloneJET PCR Cloning Kit (Thermo Fisher Scientific), and sequenced at Eton Bioscience.

    Sampling:

    Article Title: Droplet digital PCR assays for the quantification of brown trout (Salmo trutta) and Arctic char (Salvelinus alpinus) from environmental DNA collected in the water of mountain lakes
    Article Snippet: PCR amplicons were cloned using CloneJet PCR cloning kit (ThermoScientific), followed by purification and Sanger sequencing (Eurofins). .. The ddPCR reactions were run in triplicates for a total number of 256 DNA extracts (229 from water samples, 14 from sampling controls, 13 from DNA extraction controls).

    Activation Assay:

    Article Title: The Effect of a Combined Hydrogen Peroxide-MlrA Treatment on the Phytoplankton Community and Microcystin Concentrations in a Mesocosm Experiment in Lake Ludoš
    Article Snippet: The real-time PCR programme was as follows: an UDG activation step of 2 min at 50 °C, a Dual-Lock DNA polymerase activation step of 2 min at 95 °C, and 40 cycles of 15 s at 95 °C and 60 s at 60 °C. .. The plasmids were prepared by cloning the amplicons of the mcyB and mcyE genes fragments using the CloneJET PCR Cloning Kit (Thermo Scientific) and linearized by FastDigest NotI restriction enzyme (Thermo Scientific).

    DNA Purification:

    Article Title: Frequent cross-species transmissions of foamy virus between domestic and wild felids
    Article Snippet: PCR products were resolved on a 0.7 per cent agarose gel using electrophoresis for 30 min at 110 V. Bands of the correct size were excised from the gel and purified using a MEGAquick-spin™ Total Fragment DNA Purification Kit (iNtRON Biotechnology, Korea). .. Purified DNA was then cloned using pJET 1.2 blunt vector using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific, USA) and XL1-Blue E scheri chia coli competent cells (Agilent technologies, USA).

    Gel Extraction:

    Article Title: High-frequency random DNA insertions upon co-delivery of CRISPR-Cas9 ribonucleoprotein and selectable marker plasmid in rice
    Article Snippet: .. PCR products were gel-purified using a QIAquick gel extraction kit (Qiagen Inc-USA, Germantown, MD), and cloned into vector pJET1.2 using a CloneJET PCR Cloning Kit (ThermoFisher Scientific, MA, USA) as per manufacturers instruction. ..

    Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
    Article Snippet: .. The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation. .. The plasmid DNA was purified from an overnight bacterial culture using a Nucleospin Plasmid Purification Kit (Macherey Nagel).

    Article Title: FGF and TGFβ signaling link form and function during jaw development and evolution
    Article Snippet: Bands of the appropriate molecular weight were gel extracted using QIAEX II Gel Extraction Kit (Qiagen, Hilden, Germany). .. PCR products were ligated into pGEM-T Easy Vector System I (Promega, Madison, WI) or CloneJET PCR Cloning Kit (ThermoFisher, Waltham, MA) and used to transform NEB 5α E. coli cells (New England Biolabs, Ipswitch, MA).

    Fluorescence In Situ Hybridization:

    Article Title: Droplet digital PCR assays for the quantification of brown trout (Salmo trutta) and Arctic char (Salvelinus alpinus) from environmental DNA collected in the water of mountain lakes
    Article Snippet: We suspected a slight cross-contamination between fish tissues or the resulting DNA extracts during handling, a specific amplification being highly unlikely due to the high specificity of the molecular tools (two level of specificities with primers and probes and at least two mismatches in primers and probes). .. PCR amplicons were cloned using CloneJet PCR cloning kit (ThermoScientific), followed by purification and Sanger sequencing (Eurofins).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher clonejet pcr cloning kit
    Vector and insert plasmid maps A) Illustration of the <t>CloneJET</t> plasmid containing the <t>PCR</t> product. Insertion of the PCR product in the cloning site of the plasmid disrupts the integrity of the toxic gene eco47IR and allows the growth of transgene positive clones. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 3 kb and 0.7 kb in size. The 0.7 kb fragment (tdTomato gene) was used as the insert for cloning. (B) Illustration of the vector plasmid. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 4.9 kb and 0.7 kb in size. The 4.9 kb fragment was used as the vector for cloning. AMP: Ampicillin resistance gene; PRE: posttranscriptional regulatory element; MPSV: myeloproliferative sarcoma virus promoter.
    Clonejet Pcr Cloning Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 746 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/clonejet pcr cloning kit/product/Thermo Fisher
    Average 90 stars, based on 746 article reviews
    Price from $9.99 to $1999.99
    clonejet pcr cloning kit - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    Vector and insert plasmid maps A) Illustration of the CloneJET plasmid containing the PCR product. Insertion of the PCR product in the cloning site of the plasmid disrupts the integrity of the toxic gene eco47IR and allows the growth of transgene positive clones. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 3 kb and 0.7 kb in size. The 0.7 kb fragment (tdTomato gene) was used as the insert for cloning. (B) Illustration of the vector plasmid. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 4.9 kb and 0.7 kb in size. The 4.9 kb fragment was used as the vector for cloning. AMP: Ampicillin resistance gene; PRE: posttranscriptional regulatory element; MPSV: myeloproliferative sarcoma virus promoter.

    Journal: Journal of Biological Engineering

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering

    doi: 10.1186/1754-1611-9-2

    Figure Lengend Snippet: Vector and insert plasmid maps A) Illustration of the CloneJET plasmid containing the PCR product. Insertion of the PCR product in the cloning site of the plasmid disrupts the integrity of the toxic gene eco47IR and allows the growth of transgene positive clones. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 3 kb and 0.7 kb in size. The 0.7 kb fragment (tdTomato gene) was used as the insert for cloning. (B) Illustration of the vector plasmid. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 4.9 kb and 0.7 kb in size. The 4.9 kb fragment was used as the vector for cloning. AMP: Ampicillin resistance gene; PRE: posttranscriptional regulatory element; MPSV: myeloproliferative sarcoma virus promoter.

    Article Snippet: For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific).

    Techniques: Plasmid Preparation, Polymerase Chain Reaction, Clone Assay