clonejet pcr cloning kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    CloneJET PCR Cloning Kit
    Description:
    Thermo Scientific CloneJET PCR Cloning Kit is an advanced positive selection system for high efficiency cloning of PCR products generated with any thermostable DNA polymerase Any other blunt or sticky end DNA fragment can be cloned It is ideal for phosphorylated or non phosphorylated DNA fragments Ligation into the included positive selection vector takes only 5 minutes yielding more than 99 recombinant clones Blunt ended PCR products generated with a proofreading enzyme are ligated directly into the cloning vector PCR products generated either with non proofreading DNA polymerases or mixtures of DNA polymerases are blunted prior to ligation in 5 minutes with the thermostable DNA Blunting Enzyme provided with the kit All common laboratory E coli strains can be directly transformed with the ligation product FeaturesThe CloneJET PCR Cloning Kit contains a novel ready to use positive selection cloning vector pJET1 2 blunt The vector contains a lethal restriction enzyme gene that is disrupted by ligation of a DNA insert into the cloning site As a result only bacterial cells with recombinant plasmids are able to form colonies Recircularized pJET1 2 blunt vector molecules lacking an insert express a lethal restriction enzyme which kills the host E coli cell after transformation This positive selection drastically accelerates the process of colony screening and eliminates additional costs required for blue white selection For convenience in mapping and manipulation of the insert the pJET1 2 blunt cloning vector multiple cloning site contains two BglII recognition sequences that flank the insertion site In addition the vector contains a T7 promoter for in vitro and in vivo transcription as well as sequencing of the insert Highlights• Fast PCR cloning in only 5 minutes• Highest efficiency 99 of positive clones• No cloning background positive selection vector• Versatile ideal for blunt end or sticky end cloning• Economical no expensive blue white screeningApplications• Cloning of blunt end or 3 dA tailed PCR products up to 10 kb• Cloning of DNA fragments generated by restriction enzymes• Sequencing of cloned DNA• in vitro and in vivo transcription of cloned inserts from the T7 promoterIncludes• pJET1 2 blunt Cloning Vector• T4 DNA Ligase• 2X Reaction Buffer• DNA Blunting Enzyme• pJET1 2 Forward Sequencing Primer 5 CGACTCACTATAGGGAGAGCGGC 3 • pJET1 2 Reverse Sequencing Primer 5 AAGAACATCGATTTTCCATGGCAG 3 • Control PCR Product• Water nuclease free• Detailed ProtocolPrior to electroporation always column purify the ligation mixture using e g GeneJET PCR Purification Kit K0701 or chloroform to extract it Electroporation is inhibited by the presence of proteins and salts in the mixture Related ProductsFast DNA End Repair KitCloneJET PCR Cloning Kit
    Catalog Number:
    k1231
    Price:
    None
    Applications:
    Cloning|PCR Cloning
    Category:
    DNA Vectors Clones Purified Nucleic Acids Libraries
    Buy from Supplier


    Structured Review

    Thermo Fisher clonejet pcr cloning kit
    <t>PCR,</t> cloning and sequencing. Total DNA was extracted from 100 mg paraffin-embedded cerebral tissue using the Wizard Genomic DNA purification kit (Promega, Madison, WI, USA). DNA was quantified in a NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA), obtaining an E. histolytica 128 bp amplicon for the rRNA gene, which was cloned with the <t>CloneJET</t> PCR Cloning Kit (Thermo Scientific) using a pJET1.2/blunt cloning vector. Then, the ligation mixture was used for transformation of Escherichia coli DH5a calcium-competent cells. Plasmid DNA was extracted from heat-shocked cells with the Zyppy Plasmid Miniprep (Zymo Research, Irvine, CA, USA). Clones were analyzed by PCR to verify the insertion of the amplicon into the pJET1.2/blunt vector. The plasmid sequence shows forward and reverse primers (electropherograms) that correspond to the E. histolytica rRNA gene sequence. Hu = 120 bp amplicon for human β-actin; M = bp marker; Eh = 128 bp amplicon for the E. histolytica rRNA 18 s gene, NTC = no template control
    Thermo Scientific CloneJET PCR Cloning Kit is an advanced positive selection system for high efficiency cloning of PCR products generated with any thermostable DNA polymerase Any other blunt or sticky end DNA fragment can be cloned It is ideal for phosphorylated or non phosphorylated DNA fragments Ligation into the included positive selection vector takes only 5 minutes yielding more than 99 recombinant clones Blunt ended PCR products generated with a proofreading enzyme are ligated directly into the cloning vector PCR products generated either with non proofreading DNA polymerases or mixtures of DNA polymerases are blunted prior to ligation in 5 minutes with the thermostable DNA Blunting Enzyme provided with the kit All common laboratory E coli strains can be directly transformed with the ligation product FeaturesThe CloneJET PCR Cloning Kit contains a novel ready to use positive selection cloning vector pJET1 2 blunt The vector contains a lethal restriction enzyme gene that is disrupted by ligation of a DNA insert into the cloning site As a result only bacterial cells with recombinant plasmids are able to form colonies Recircularized pJET1 2 blunt vector molecules lacking an insert express a lethal restriction enzyme which kills the host E coli cell after transformation This positive selection drastically accelerates the process of colony screening and eliminates additional costs required for blue white selection For convenience in mapping and manipulation of the insert the pJET1 2 blunt cloning vector multiple cloning site contains two BglII recognition sequences that flank the insertion site In addition the vector contains a T7 promoter for in vitro and in vivo transcription as well as sequencing of the insert Highlights• Fast PCR cloning in only 5 minutes• Highest efficiency 99 of positive clones• No cloning background positive selection vector• Versatile ideal for blunt end or sticky end cloning• Economical no expensive blue white screeningApplications• Cloning of blunt end or 3 dA tailed PCR products up to 10 kb• Cloning of DNA fragments generated by restriction enzymes• Sequencing of cloned DNA• in vitro and in vivo transcription of cloned inserts from the T7 promoterIncludes• pJET1 2 blunt Cloning Vector• T4 DNA Ligase• 2X Reaction Buffer• DNA Blunting Enzyme• pJET1 2 Forward Sequencing Primer 5 CGACTCACTATAGGGAGAGCGGC 3 • pJET1 2 Reverse Sequencing Primer 5 AAGAACATCGATTTTCCATGGCAG 3 • Control PCR Product• Water nuclease free• Detailed ProtocolPrior to electroporation always column purify the ligation mixture using e g GeneJET PCR Purification Kit K0701 or chloroform to extract it Electroporation is inhibited by the presence of proteins and salts in the mixture Related ProductsFast DNA End Repair KitCloneJET PCR Cloning Kit
    https://www.bioz.com/result/clonejet pcr cloning kit/product/Thermo Fisher
    Average 99 stars, based on 980 article reviews
    Price from $9.99 to $1999.99
    clonejet pcr cloning kit - by Bioz Stars, 2020-12
    99/100 stars

    Images

    1) Product Images from "Case report: multiple and atypical amoebic cerebral abscesses resistant to treatment"

    Article Title: Case report: multiple and atypical amoebic cerebral abscesses resistant to treatment

    Journal: BMC Infectious Diseases

    doi: 10.1186/s12879-020-05391-y

    PCR, cloning and sequencing. Total DNA was extracted from 100 mg paraffin-embedded cerebral tissue using the Wizard Genomic DNA purification kit (Promega, Madison, WI, USA). DNA was quantified in a NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA), obtaining an E. histolytica 128 bp amplicon for the rRNA gene, which was cloned with the CloneJET PCR Cloning Kit (Thermo Scientific) using a pJET1.2/blunt cloning vector. Then, the ligation mixture was used for transformation of Escherichia coli DH5a calcium-competent cells. Plasmid DNA was extracted from heat-shocked cells with the Zyppy Plasmid Miniprep (Zymo Research, Irvine, CA, USA). Clones were analyzed by PCR to verify the insertion of the amplicon into the pJET1.2/blunt vector. The plasmid sequence shows forward and reverse primers (electropherograms) that correspond to the E. histolytica rRNA gene sequence. Hu = 120 bp amplicon for human β-actin; M = bp marker; Eh = 128 bp amplicon for the E. histolytica rRNA 18 s gene, NTC = no template control
    Figure Legend Snippet: PCR, cloning and sequencing. Total DNA was extracted from 100 mg paraffin-embedded cerebral tissue using the Wizard Genomic DNA purification kit (Promega, Madison, WI, USA). DNA was quantified in a NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA), obtaining an E. histolytica 128 bp amplicon for the rRNA gene, which was cloned with the CloneJET PCR Cloning Kit (Thermo Scientific) using a pJET1.2/blunt cloning vector. Then, the ligation mixture was used for transformation of Escherichia coli DH5a calcium-competent cells. Plasmid DNA was extracted from heat-shocked cells with the Zyppy Plasmid Miniprep (Zymo Research, Irvine, CA, USA). Clones were analyzed by PCR to verify the insertion of the amplicon into the pJET1.2/blunt vector. The plasmid sequence shows forward and reverse primers (electropherograms) that correspond to the E. histolytica rRNA gene sequence. Hu = 120 bp amplicon for human β-actin; M = bp marker; Eh = 128 bp amplicon for the E. histolytica rRNA 18 s gene, NTC = no template control

    Techniques Used: Polymerase Chain Reaction, Clone Assay, Sequencing, DNA Purification, Amplification, Plasmid Preparation, Ligation, Transformation Assay, Marker

    2) Product Images from "Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering"

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering

    Journal: Journal of Biological Engineering

    doi: 10.1186/1754-1611-9-2

    Vector and insert plasmid maps A) Illustration of the CloneJET plasmid containing the PCR product. Insertion of the PCR product in the cloning site of the plasmid disrupts the integrity of the toxic gene eco47IR and allows the growth of transgene positive clones. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 3 kb and 0.7 kb in size. The 0.7 kb fragment (tdTomato gene) was used as the insert for cloning. (B) Illustration of the vector plasmid. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 4.9 kb and 0.7 kb in size. The 4.9 kb fragment was used as the vector for cloning. AMP: Ampicillin resistance gene; PRE: posttranscriptional regulatory element; MPSV: myeloproliferative sarcoma virus promoter.
    Figure Legend Snippet: Vector and insert plasmid maps A) Illustration of the CloneJET plasmid containing the PCR product. Insertion of the PCR product in the cloning site of the plasmid disrupts the integrity of the toxic gene eco47IR and allows the growth of transgene positive clones. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 3 kb and 0.7 kb in size. The 0.7 kb fragment (tdTomato gene) was used as the insert for cloning. (B) Illustration of the vector plasmid. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 4.9 kb and 0.7 kb in size. The 4.9 kb fragment was used as the vector for cloning. AMP: Ampicillin resistance gene; PRE: posttranscriptional regulatory element; MPSV: myeloproliferative sarcoma virus promoter.

    Techniques Used: Plasmid Preparation, Polymerase Chain Reaction, Clone Assay

    Related Articles

    Clone Assay:

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering
    Article Snippet: .. For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific). .. 1 μl of blunt vector (50 ng/μl), 50 ng/μl of the PCR product, and 10 μl of 2X reaction buffer (provided in the kit) were mixed and filled with water to a total volume of 20 μl.

    Article Title: Utilising datasheets for the informed automated design and build of a synthetic metabolic pathway
    Article Snippet: .. The final annealed product were ligated into a vector using CloneJET PCR Cloning Kit (Thermo Scientific,USA). .. DNA parts of greater then 100 bp were synthesised commercially into a self-replicating plasmid.

    Article Title: New microsatellite markers for population studies of Phytophthora cinnamomi, an important global pathogen
    Article Snippet: .. PCR products of homozygous alleles were sequenced directly whereas PCR products of heterozygous alleles were cloned using CloneJET PCR cloning kit (Thermo Scientific, USA), followed by colony PCR amplification and sequencing of the PCR products. .. Sequences obtained from sequencing with forward and reverse primers were assembled for each allele, and the exact allele size was determined directly from the sequence.

    Article Title: A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes
    Article Snippet: .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher). .. Sanger sequencing was done in 96-well format (Genewiz) using primers recommended with the CloneJET PCR Cloning Kit (Supplementary Table ).

    Article Title: Use of a temporary immersion bioreactor system for the sustainable production of thapsigargin in shoot cultures of Thapsia garganica
    Article Snippet: .. The following amplification program was used: 98 °C for 30 s and 34 cycles at 98 °C for 5 s, 58 °C for10 s and 72 °C for 20 s followed by 72 °C for 5 min. Amplified products were cloned with CloneJET PCR Cloning Kit (Thermo Scientific, Copenhagen, Denmark) for sequencing, according to the manufacturer’s instructions. .. E. coli strain (DH5α) was transformed with the ligation products, 4 colonies for each gene were analyzed by colony PCR with plasmid reverse specific primer (5′-AAGAACATCGATTTTCCATGGCAG-3′) at an annealing temperature of 60 °C.

    Article Title: Gene expression profiling during hibernation in the European hamster
    Article Snippet: .. The eluted DNA was inserted into a blunt pJET vector using the CloneJET PCR cloning kit (Thermo Fisher Scientific, Waltham, USA), and transformed into DH10β chemically competent Escherichia Coli cells (NEB, Ipswich, MA, USA). .. Forward and reverse sequencing reactions were performed using the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA, USA) using vector primers for amplification.

    Article Title: A modified, hypoallergenic variant of the Ricinus communis Ric c1 protein retains biological activity
    Article Snippet: .. The PCR product was cloned in E. coli using the pJET 1.2/blunt vector following the manufacturer’s protocol (CloneJET PCR cloning kit, Thermo Scientific). .. The PCR products were first blunt-ended following the manufacturer’s protocol using 75 ng of each PCR product and then incubated with 12.5 ng of the pJET 1.2/blunt vector and 0.5 U of T4 DNA ligase.

    Article Title: Case report: multiple and atypical amoebic cerebral abscesses resistant to treatment
    Article Snippet: .. The presence of E. histolytica in the cerebral tissue was corroborated by PCR, and an 128 bp amplicon of the E. histolytica rRNA gene (NCBI Accession number X65163.1) was cloned from cerebral tissue with the CloneJET PCR Cloning Kit (Thermo Scientific). .. DNA sequencing was performed in the Unit of Molecular Biology of the Institute of Cellular Physiology (National Autonomous University of Mexico) (Fig. ).

    Amplification:

    Article Title: New microsatellite markers for population studies of Phytophthora cinnamomi, an important global pathogen
    Article Snippet: .. PCR products of homozygous alleles were sequenced directly whereas PCR products of heterozygous alleles were cloned using CloneJET PCR cloning kit (Thermo Scientific, USA), followed by colony PCR amplification and sequencing of the PCR products. .. Sequences obtained from sequencing with forward and reverse primers were assembled for each allele, and the exact allele size was determined directly from the sequence.

    Article Title: Use of a temporary immersion bioreactor system for the sustainable production of thapsigargin in shoot cultures of Thapsia garganica
    Article Snippet: .. The following amplification program was used: 98 °C for 30 s and 34 cycles at 98 °C for 5 s, 58 °C for10 s and 72 °C for 20 s followed by 72 °C for 5 min. Amplified products were cloned with CloneJET PCR Cloning Kit (Thermo Scientific, Copenhagen, Denmark) for sequencing, according to the manufacturer’s instructions. .. E. coli strain (DH5α) was transformed with the ligation products, 4 colonies for each gene were analyzed by colony PCR with plasmid reverse specific primer (5′-AAGAACATCGATTTTCCATGGCAG-3′) at an annealing temperature of 60 °C.

    Article Title: Case report: multiple and atypical amoebic cerebral abscesses resistant to treatment
    Article Snippet: .. The presence of E. histolytica in the cerebral tissue was corroborated by PCR, and an 128 bp amplicon of the E. histolytica rRNA gene (NCBI Accession number X65163.1) was cloned from cerebral tissue with the CloneJET PCR Cloning Kit (Thermo Scientific). .. DNA sequencing was performed in the Unit of Molecular Biology of the Institute of Cellular Physiology (National Autonomous University of Mexico) (Fig. ).

    Sequencing:

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering
    Article Snippet: .. For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific). .. 1 μl of blunt vector (50 ng/μl), 50 ng/μl of the PCR product, and 10 μl of 2X reaction buffer (provided in the kit) were mixed and filled with water to a total volume of 20 μl.

    Article Title: New microsatellite markers for population studies of Phytophthora cinnamomi, an important global pathogen
    Article Snippet: .. PCR products of homozygous alleles were sequenced directly whereas PCR products of heterozygous alleles were cloned using CloneJET PCR cloning kit (Thermo Scientific, USA), followed by colony PCR amplification and sequencing of the PCR products. .. Sequences obtained from sequencing with forward and reverse primers were assembled for each allele, and the exact allele size was determined directly from the sequence.

    Article Title: A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes
    Article Snippet: .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher). .. Sanger sequencing was done in 96-well format (Genewiz) using primers recommended with the CloneJET PCR Cloning Kit (Supplementary Table ).

    Article Title: Use of a temporary immersion bioreactor system for the sustainable production of thapsigargin in shoot cultures of Thapsia garganica
    Article Snippet: .. The following amplification program was used: 98 °C for 30 s and 34 cycles at 98 °C for 5 s, 58 °C for10 s and 72 °C for 20 s followed by 72 °C for 5 min. Amplified products were cloned with CloneJET PCR Cloning Kit (Thermo Scientific, Copenhagen, Denmark) for sequencing, according to the manufacturer’s instructions. .. E. coli strain (DH5α) was transformed with the ligation products, 4 colonies for each gene were analyzed by colony PCR with plasmid reverse specific primer (5′-AAGAACATCGATTTTCCATGGCAG-3′) at an annealing temperature of 60 °C.

    Polymerase Chain Reaction:

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering
    Article Snippet: .. For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific). .. 1 μl of blunt vector (50 ng/μl), 50 ng/μl of the PCR product, and 10 μl of 2X reaction buffer (provided in the kit) were mixed and filled with water to a total volume of 20 μl.

    Article Title: Utilising datasheets for the informed automated design and build of a synthetic metabolic pathway
    Article Snippet: .. The final annealed product were ligated into a vector using CloneJET PCR Cloning Kit (Thermo Scientific,USA). .. DNA parts of greater then 100 bp were synthesised commercially into a self-replicating plasmid.

    Article Title: New microsatellite markers for population studies of Phytophthora cinnamomi, an important global pathogen
    Article Snippet: .. PCR products of homozygous alleles were sequenced directly whereas PCR products of heterozygous alleles were cloned using CloneJET PCR cloning kit (Thermo Scientific, USA), followed by colony PCR amplification and sequencing of the PCR products. .. Sequences obtained from sequencing with forward and reverse primers were assembled for each allele, and the exact allele size was determined directly from the sequence.

    Article Title: A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes
    Article Snippet: .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher). .. Sanger sequencing was done in 96-well format (Genewiz) using primers recommended with the CloneJET PCR Cloning Kit (Supplementary Table ).

    Article Title: Use of a temporary immersion bioreactor system for the sustainable production of thapsigargin in shoot cultures of Thapsia garganica
    Article Snippet: .. The following amplification program was used: 98 °C for 30 s and 34 cycles at 98 °C for 5 s, 58 °C for10 s and 72 °C for 20 s followed by 72 °C for 5 min. Amplified products were cloned with CloneJET PCR Cloning Kit (Thermo Scientific, Copenhagen, Denmark) for sequencing, according to the manufacturer’s instructions. .. E. coli strain (DH5α) was transformed with the ligation products, 4 colonies for each gene were analyzed by colony PCR with plasmid reverse specific primer (5′-AAGAACATCGATTTTCCATGGCAG-3′) at an annealing temperature of 60 °C.

    Article Title: Gene expression profiling during hibernation in the European hamster
    Article Snippet: .. The eluted DNA was inserted into a blunt pJET vector using the CloneJET PCR cloning kit (Thermo Fisher Scientific, Waltham, USA), and transformed into DH10β chemically competent Escherichia Coli cells (NEB, Ipswich, MA, USA). .. Forward and reverse sequencing reactions were performed using the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA, USA) using vector primers for amplification.

    Article Title: A modified, hypoallergenic variant of the Ricinus communis Ric c1 protein retains biological activity
    Article Snippet: .. The PCR product was cloned in E. coli using the pJET 1.2/blunt vector following the manufacturer’s protocol (CloneJET PCR cloning kit, Thermo Scientific). .. The PCR products were first blunt-ended following the manufacturer’s protocol using 75 ng of each PCR product and then incubated with 12.5 ng of the pJET 1.2/blunt vector and 0.5 U of T4 DNA ligase.

    Article Title: Case report: multiple and atypical amoebic cerebral abscesses resistant to treatment
    Article Snippet: .. The presence of E. histolytica in the cerebral tissue was corroborated by PCR, and an 128 bp amplicon of the E. histolytica rRNA gene (NCBI Accession number X65163.1) was cloned from cerebral tissue with the CloneJET PCR Cloning Kit (Thermo Scientific). .. DNA sequencing was performed in the Unit of Molecular Biology of the Institute of Cellular Physiology (National Autonomous University of Mexico) (Fig. ).

    Gel Extraction:

    Article Title: A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes
    Article Snippet: .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher). .. Sanger sequencing was done in 96-well format (Genewiz) using primers recommended with the CloneJET PCR Cloning Kit (Supplementary Table ).

    Transformation Assay:

    Article Title: Gene expression profiling during hibernation in the European hamster
    Article Snippet: .. The eluted DNA was inserted into a blunt pJET vector using the CloneJET PCR cloning kit (Thermo Fisher Scientific, Waltham, USA), and transformed into DH10β chemically competent Escherichia Coli cells (NEB, Ipswich, MA, USA). .. Forward and reverse sequencing reactions were performed using the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA, USA) using vector primers for amplification.

    Plasmid Preparation:

    Article Title: Utilising datasheets for the informed automated design and build of a synthetic metabolic pathway
    Article Snippet: .. The final annealed product were ligated into a vector using CloneJET PCR Cloning Kit (Thermo Scientific,USA). .. DNA parts of greater then 100 bp were synthesised commercially into a self-replicating plasmid.

    Article Title: A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes
    Article Snippet: .. PCR products were gel-purified (GeneJET Gel Extraction Kit, Thermo Scientific) and cloned into a sequencing plasmid (CloneJET PCR Cloning Kit, Thermo Fisher). .. Sanger sequencing was done in 96-well format (Genewiz) using primers recommended with the CloneJET PCR Cloning Kit (Supplementary Table ).

    Article Title: Gene expression profiling during hibernation in the European hamster
    Article Snippet: .. The eluted DNA was inserted into a blunt pJET vector using the CloneJET PCR cloning kit (Thermo Fisher Scientific, Waltham, USA), and transformed into DH10β chemically competent Escherichia Coli cells (NEB, Ipswich, MA, USA). .. Forward and reverse sequencing reactions were performed using the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA, USA) using vector primers for amplification.

    Article Title: A modified, hypoallergenic variant of the Ricinus communis Ric c1 protein retains biological activity
    Article Snippet: .. The PCR product was cloned in E. coli using the pJET 1.2/blunt vector following the manufacturer’s protocol (CloneJET PCR cloning kit, Thermo Scientific). .. The PCR products were first blunt-ended following the manufacturer’s protocol using 75 ng of each PCR product and then incubated with 12.5 ng of the pJET 1.2/blunt vector and 0.5 U of T4 DNA ligase.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher clonejet pcr cloning kit
    <t>PCR,</t> cloning and sequencing. Total DNA was extracted from 100 mg paraffin-embedded cerebral tissue using the Wizard Genomic DNA purification kit (Promega, Madison, WI, USA). DNA was quantified in a NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA), obtaining an E. histolytica 128 bp amplicon for the rRNA gene, which was cloned with the <t>CloneJET</t> PCR Cloning Kit (Thermo Scientific) using a pJET1.2/blunt cloning vector. Then, the ligation mixture was used for transformation of Escherichia coli DH5a calcium-competent cells. Plasmid DNA was extracted from heat-shocked cells with the Zyppy Plasmid Miniprep (Zymo Research, Irvine, CA, USA). Clones were analyzed by PCR to verify the insertion of the amplicon into the pJET1.2/blunt vector. The plasmid sequence shows forward and reverse primers (electropherograms) that correspond to the E. histolytica rRNA gene sequence. Hu = 120 bp amplicon for human β-actin; M = bp marker; Eh = 128 bp amplicon for the E. histolytica rRNA 18 s gene, NTC = no template control
    Clonejet Pcr Cloning Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 980 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/clonejet pcr cloning kit/product/Thermo Fisher
    Average 99 stars, based on 980 article reviews
    Price from $9.99 to $1999.99
    clonejet pcr cloning kit - by Bioz Stars, 2020-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    PCR, cloning and sequencing. Total DNA was extracted from 100 mg paraffin-embedded cerebral tissue using the Wizard Genomic DNA purification kit (Promega, Madison, WI, USA). DNA was quantified in a NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA), obtaining an E. histolytica 128 bp amplicon for the rRNA gene, which was cloned with the CloneJET PCR Cloning Kit (Thermo Scientific) using a pJET1.2/blunt cloning vector. Then, the ligation mixture was used for transformation of Escherichia coli DH5a calcium-competent cells. Plasmid DNA was extracted from heat-shocked cells with the Zyppy Plasmid Miniprep (Zymo Research, Irvine, CA, USA). Clones were analyzed by PCR to verify the insertion of the amplicon into the pJET1.2/blunt vector. The plasmid sequence shows forward and reverse primers (electropherograms) that correspond to the E. histolytica rRNA gene sequence. Hu = 120 bp amplicon for human β-actin; M = bp marker; Eh = 128 bp amplicon for the E. histolytica rRNA 18 s gene, NTC = no template control

    Journal: BMC Infectious Diseases

    Article Title: Case report: multiple and atypical amoebic cerebral abscesses resistant to treatment

    doi: 10.1186/s12879-020-05391-y

    Figure Lengend Snippet: PCR, cloning and sequencing. Total DNA was extracted from 100 mg paraffin-embedded cerebral tissue using the Wizard Genomic DNA purification kit (Promega, Madison, WI, USA). DNA was quantified in a NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA), obtaining an E. histolytica 128 bp amplicon for the rRNA gene, which was cloned with the CloneJET PCR Cloning Kit (Thermo Scientific) using a pJET1.2/blunt cloning vector. Then, the ligation mixture was used for transformation of Escherichia coli DH5a calcium-competent cells. Plasmid DNA was extracted from heat-shocked cells with the Zyppy Plasmid Miniprep (Zymo Research, Irvine, CA, USA). Clones were analyzed by PCR to verify the insertion of the amplicon into the pJET1.2/blunt vector. The plasmid sequence shows forward and reverse primers (electropherograms) that correspond to the E. histolytica rRNA gene sequence. Hu = 120 bp amplicon for human β-actin; M = bp marker; Eh = 128 bp amplicon for the E. histolytica rRNA 18 s gene, NTC = no template control

    Article Snippet: The presence of E. histolytica in the cerebral tissue was corroborated by PCR, and an 128 bp amplicon of the E. histolytica rRNA gene (NCBI Accession number X65163.1) was cloned from cerebral tissue with the CloneJET PCR Cloning Kit (Thermo Scientific).

    Techniques: Polymerase Chain Reaction, Clone Assay, Sequencing, DNA Purification, Amplification, Plasmid Preparation, Ligation, Transformation Assay, Marker

    Vector and insert plasmid maps A) Illustration of the CloneJET plasmid containing the PCR product. Insertion of the PCR product in the cloning site of the plasmid disrupts the integrity of the toxic gene eco47IR and allows the growth of transgene positive clones. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 3 kb and 0.7 kb in size. The 0.7 kb fragment (tdTomato gene) was used as the insert for cloning. (B) Illustration of the vector plasmid. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 4.9 kb and 0.7 kb in size. The 4.9 kb fragment was used as the vector for cloning. AMP: Ampicillin resistance gene; PRE: posttranscriptional regulatory element; MPSV: myeloproliferative sarcoma virus promoter.

    Journal: Journal of Biological Engineering

    Article Title: Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering

    doi: 10.1186/1754-1611-9-2

    Figure Lengend Snippet: Vector and insert plasmid maps A) Illustration of the CloneJET plasmid containing the PCR product. Insertion of the PCR product in the cloning site of the plasmid disrupts the integrity of the toxic gene eco47IR and allows the growth of transgene positive clones. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 3 kb and 0.7 kb in size. The 0.7 kb fragment (tdTomato gene) was used as the insert for cloning. (B) Illustration of the vector plasmid. The plasmid was cut with the Age I and Sal I enzymes generating two fragments of 4.9 kb and 0.7 kb in size. The 4.9 kb fragment was used as the vector for cloning. AMP: Ampicillin resistance gene; PRE: posttranscriptional regulatory element; MPSV: myeloproliferative sarcoma virus promoter.

    Article Snippet: For sequence validation, the PCR product was subcloned using CloneJET PCR cloning kit (Thermo Scientific).

    Techniques: Plasmid Preparation, Polymerase Chain Reaction, Clone Assay