lc ms ms analysis all peptide  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 82

    Structured Review

    Thermo Fisher lc ms ms analysis all peptide
    GPS leads to the identification of ADP-ribosylated ARTDs/PARPs other than ARTD1/PARP1. (A) A comparison using Venn diagrams for ADPr peptides found in two replicates for full scan (400–1500 m / z ) and combined 4× GPS scans (GPS-1, 400–605; GPS-2, 595–805; GPS-3, 795–1005; GPS-4, 995–1200 m / z ). (B) A comparison of ADPr peptides found in control and IFN-γ-treated THP-1 cells for the full scan and combined 4× GPS scans. (C) Sequence motif <t>analysis</t> for ADPr acceptor amino acids (N, number of ADPr peptides used for the analysis). (D) A plot of the number of ADP-ribosylation sites per protein. (E) Comparison of ADPr <t>peptide</t> abundances between control and IFN-γ in each replicate; regression lines, 95% confidence interval, and standard error of estimate (SEE) are provided (red dots are outliers). (F) <t>MS/MS</t> spectra of an ARTD8/PARP14 ADPr peptide using PRM acquisitions. Black peaks were manually annotated. *, ADPr site. (G) A comparison of the number of proteins identified in the Af1521 elution (ADPr proteins) and input samples (backbone proteins) per replicate. (H) A comparison of the relative changes to ADPr peptides versus their backbone proteins in response to IFN-γ (IFN-γ/control).
    Lc Ms Ms Analysis All Peptide, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 82/100, based on 5767 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lc ms ms analysis all peptide/product/Thermo Fisher
    Average 82 stars, based on 5767 article reviews
    Price from $9.99 to $1999.99
    lc ms ms analysis all peptide - by Bioz Stars, 2020-03
    82/100 stars

    Images

    1) Product Images from "A Study into the ADP-Ribosylome of IFN-γ-Stimulated THP-1 Human Macrophage-like Cells Identifies ARTD8/PARP14 and ARTD9/PARP9 ADP-Ribosylation"

    Article Title: A Study into the ADP-Ribosylome of IFN-γ-Stimulated THP-1 Human Macrophage-like Cells Identifies ARTD8/PARP14 and ARTD9/PARP9 ADP-Ribosylation

    Journal: Journal of Proteome Research

    doi: 10.1021/acs.jproteome.8b00895

    GPS leads to the identification of ADP-ribosylated ARTDs/PARPs other than ARTD1/PARP1. (A) A comparison using Venn diagrams for ADPr peptides found in two replicates for full scan (400–1500 m / z ) and combined 4× GPS scans (GPS-1, 400–605; GPS-2, 595–805; GPS-3, 795–1005; GPS-4, 995–1200 m / z ). (B) A comparison of ADPr peptides found in control and IFN-γ-treated THP-1 cells for the full scan and combined 4× GPS scans. (C) Sequence motif analysis for ADPr acceptor amino acids (N, number of ADPr peptides used for the analysis). (D) A plot of the number of ADP-ribosylation sites per protein. (E) Comparison of ADPr peptide abundances between control and IFN-γ in each replicate; regression lines, 95% confidence interval, and standard error of estimate (SEE) are provided (red dots are outliers). (F) MS/MS spectra of an ARTD8/PARP14 ADPr peptide using PRM acquisitions. Black peaks were manually annotated. *, ADPr site. (G) A comparison of the number of proteins identified in the Af1521 elution (ADPr proteins) and input samples (backbone proteins) per replicate. (H) A comparison of the relative changes to ADPr peptides versus their backbone proteins in response to IFN-γ (IFN-γ/control).
    Figure Legend Snippet: GPS leads to the identification of ADP-ribosylated ARTDs/PARPs other than ARTD1/PARP1. (A) A comparison using Venn diagrams for ADPr peptides found in two replicates for full scan (400–1500 m / z ) and combined 4× GPS scans (GPS-1, 400–605; GPS-2, 595–805; GPS-3, 795–1005; GPS-4, 995–1200 m / z ). (B) A comparison of ADPr peptides found in control and IFN-γ-treated THP-1 cells for the full scan and combined 4× GPS scans. (C) Sequence motif analysis for ADPr acceptor amino acids (N, number of ADPr peptides used for the analysis). (D) A plot of the number of ADP-ribosylation sites per protein. (E) Comparison of ADPr peptide abundances between control and IFN-γ in each replicate; regression lines, 95% confidence interval, and standard error of estimate (SEE) are provided (red dots are outliers). (F) MS/MS spectra of an ARTD8/PARP14 ADPr peptide using PRM acquisitions. Black peaks were manually annotated. *, ADPr site. (G) A comparison of the number of proteins identified in the Af1521 elution (ADPr proteins) and input samples (backbone proteins) per replicate. (H) A comparison of the relative changes to ADPr peptides versus their backbone proteins in response to IFN-γ (IFN-γ/control).

    Techniques Used: Sequencing, Mass Spectrometry

    Data processing of product ion triggered MS/MS spectra. (A) A schematic of SEQUEST-HT searches of triggered EThcD and HCD spectra using the second Af1521 replicate of IFN-γ-treated THP-1 cells. (B) Number of peptide-spectrum matches (PSMs) of assigned ADPr and unmodified peptides from the triggered spectra. (C–E) Distribution of isolation interference for product ion triggered or DDA PSMs. (F) Number of ADPr peptides with high confidence detected by either EThcD or HCD. (G) Venn diagrams comparing ADPr peptide identifications between EThcD and HCD for all ADPr peptides, and those with > 95% ADPr acceptor site probability.
    Figure Legend Snippet: Data processing of product ion triggered MS/MS spectra. (A) A schematic of SEQUEST-HT searches of triggered EThcD and HCD spectra using the second Af1521 replicate of IFN-γ-treated THP-1 cells. (B) Number of peptide-spectrum matches (PSMs) of assigned ADPr and unmodified peptides from the triggered spectra. (C–E) Distribution of isolation interference for product ion triggered or DDA PSMs. (F) Number of ADPr peptides with high confidence detected by either EThcD or HCD. (G) Venn diagrams comparing ADPr peptide identifications between EThcD and HCD for all ADPr peptides, and those with > 95% ADPr acceptor site probability.

    Techniques Used: Mass Spectrometry, Isolation

    2) Product Images from "Separation and Identification of 1,2,4-Trihydroxynaphthalene-1-O-glucoside in Impatiens glandulifera Royle"

    Article Title: Separation and Identification of 1,2,4-Trihydroxynaphthalene-1-O-glucoside in Impatiens glandulifera Royle

    Journal: Molecules

    doi: 10.3390/molecules18078429

    Chromatographic profile of the Impatiens glandulifera Royle methanolic extract of the roots measured as total ion current (TIC) by LC-MS (APCI). MS spectrum of THNG is shown on the Figure 3 .
    Figure Legend Snippet: Chromatographic profile of the Impatiens glandulifera Royle methanolic extract of the roots measured as total ion current (TIC) by LC-MS (APCI). MS spectrum of THNG is shown on the Figure 3 .

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

    3) Product Images from "Multiplatform Physiologic and Metabolic Phenotyping Reveals Microbial Toxicity"

    Article Title: Multiplatform Physiologic and Metabolic Phenotyping Reveals Microbial Toxicity

    Journal: mSystems

    doi: 10.1128/mSystems.00123-18

    LC-MS revealed altered microbial metabolic profile in response to tempol. Z scores were created for the metabolomic data for each sample. Red shades represent metabolites that are increased or above the mean, and blue shades represent metabolites that are decreased or below the mean.
    Figure Legend Snippet: LC-MS revealed altered microbial metabolic profile in response to tempol. Z scores were created for the metabolomic data for each sample. Red shades represent metabolites that are increased or above the mean, and blue shades represent metabolites that are decreased or below the mean.

    Techniques Used: Liquid Chromatography with Mass Spectroscopy

    4) Product Images from "A proteomic profiling dataset of recombinant Chinese hamster ovary cells showing enhanced cellular growth following miR-378 depletion"

    Article Title: A proteomic profiling dataset of recombinant Chinese hamster ovary cells showing enhanced cellular growth following miR-378 depletion

    Journal: Data in Brief

    doi: 10.1016/j.dib.2018.11.115

    Heat maps of differentially expressed proteins in miR-378-spg CHO cells. A and B show the clustering of significantly increased and decreased proteins identified in the cytosolic enriched fraction of miR-378-spg cells for day 4 and day 8, respectively. C and D show the clustering of differentially expressed proteins identified in the membrane enriched fraction of miR-378-spg when compared to control on day 4 and day 8 of culture, respectively. The normalised abundance values of differentially expressed proteins were log2 transformed and hierarchical Pearson clustering was performed on Z-score normalised intensity values.
    Figure Legend Snippet: Heat maps of differentially expressed proteins in miR-378-spg CHO cells. A and B show the clustering of significantly increased and decreased proteins identified in the cytosolic enriched fraction of miR-378-spg cells for day 4 and day 8, respectively. C and D show the clustering of differentially expressed proteins identified in the membrane enriched fraction of miR-378-spg when compared to control on day 4 and day 8 of culture, respectively. The normalised abundance values of differentially expressed proteins were log2 transformed and hierarchical Pearson clustering was performed on Z-score normalised intensity values.

    Techniques Used: Transformation Assay

    5) Product Images from "Protective Effect of a (Poly)phenol-Rich Extract Derived from Sweet Cherries Culls against Oxidative Cell Damage"

    Article Title: Protective Effect of a (Poly)phenol-Rich Extract Derived from Sweet Cherries Culls against Oxidative Cell Damage

    Journal: Molecules

    doi: 10.3390/molecules21040406

    Chromatographic profiles of Ch-PRE ( A1 ) High Performance Liquid Chromatography coupled with a diode-array detector (HPLC-DAD) profile at 280 nm; ( A2 ) HPLC-DAD profile at 527 nm; and ( B ) HPLC coupled with a DAD and electrochemical detector (ED) (HPLC-DAD-ED). Legend: 1—Neochlorogenic acid, 2—Catechin, 3—Chlorogenic acid, 4—Procyanidin B2, 5—Cyanidin-3-glucoside, 6—Cyanidin-3-rutinoside, 7—Peonidin-3-glucoside, 8—Quercetin-3-rutinoside, 9—Quercetin-3-glucoside, 10—Kaempferol-3-glucoside, 11—Sakuranin, 12—Isosakuranetin.
    Figure Legend Snippet: Chromatographic profiles of Ch-PRE ( A1 ) High Performance Liquid Chromatography coupled with a diode-array detector (HPLC-DAD) profile at 280 nm; ( A2 ) HPLC-DAD profile at 527 nm; and ( B ) HPLC coupled with a DAD and electrochemical detector (ED) (HPLC-DAD-ED). Legend: 1—Neochlorogenic acid, 2—Catechin, 3—Chlorogenic acid, 4—Procyanidin B2, 5—Cyanidin-3-glucoside, 6—Cyanidin-3-rutinoside, 7—Peonidin-3-glucoside, 8—Quercetin-3-rutinoside, 9—Quercetin-3-glucoside, 10—Kaempferol-3-glucoside, 11—Sakuranin, 12—Isosakuranetin.

    Techniques Used: High Performance Liquid Chromatography

    6) Product Images from "Crosstalk between Epigenetic Modulations in Valproic Acid Deactivated Hepatic Stellate Cells: An Integrated Protein and miRNA Profiling Study"

    Article Title: Crosstalk between Epigenetic Modulations in Valproic Acid Deactivated Hepatic Stellate Cells: An Integrated Protein and miRNA Profiling Study

    Journal: International Journal of Biological Sciences

    doi: 10.7150/ijbs.28642

    Regulation of VPA on LX2 miRNA and protein expression (A) Heatmap representation of the deregulated proteins in 2.5mM VPA treated versus untreated LX2 cells. Only differentially expressed proteins pass Avg VPA/Control filtering (V/C ≥ 1.333) were included. Red: up-regulated; Green: down-regulated. (B) Heatmap representation of the deregulated miRNAs in 2.5mM VPA treated versus untreated LX2 cells. Only differentially expressed miRNAs passing fold change filtering (fold change ≥ 2.0) were included. (C) Comparison of expression levels of 6 miRNAs in VPA treated LX2 cells by microarray and qRT-PCR assay. The correlation coefficient r = 0.8772, P value (two-tail) = 0.0217. (D) Comparison of expression levels of 6 proteins and encoding genes in VPA treated LX2 cells by iTraq and qRT-PCR assay respectively. The correlation coefficient r = 0.8469, P value (two-tail) = 0.0334. (E) Relative renilla luciferase activity of psiCHECK-2/HMGA1MRE103a×3 or psiCHECK-2/HMGA1MRE195×3 in the presence of miR-103a mimic or miR-195 mimic in 293T cells, the 293T cells co-transfected with miR-neg served as control, normalized to firefly luciferase activity. *** P
    Figure Legend Snippet: Regulation of VPA on LX2 miRNA and protein expression (A) Heatmap representation of the deregulated proteins in 2.5mM VPA treated versus untreated LX2 cells. Only differentially expressed proteins pass Avg VPA/Control filtering (V/C ≥ 1.333) were included. Red: up-regulated; Green: down-regulated. (B) Heatmap representation of the deregulated miRNAs in 2.5mM VPA treated versus untreated LX2 cells. Only differentially expressed miRNAs passing fold change filtering (fold change ≥ 2.0) were included. (C) Comparison of expression levels of 6 miRNAs in VPA treated LX2 cells by microarray and qRT-PCR assay. The correlation coefficient r = 0.8772, P value (two-tail) = 0.0217. (D) Comparison of expression levels of 6 proteins and encoding genes in VPA treated LX2 cells by iTraq and qRT-PCR assay respectively. The correlation coefficient r = 0.8469, P value (two-tail) = 0.0334. (E) Relative renilla luciferase activity of psiCHECK-2/HMGA1MRE103a×3 or psiCHECK-2/HMGA1MRE195×3 in the presence of miR-103a mimic or miR-195 mimic in 293T cells, the 293T cells co-transfected with miR-neg served as control, normalized to firefly luciferase activity. *** P

    Techniques Used: Expressing, Microarray, Quantitative RT-PCR, Luciferase, Activity Assay, Transfection

    VPA inhibits the proliferation and migration of LX2 cells. (A) The mRNA and protein expression of α-SMA and collagen I in LX2 cells treated by 2.5mM VPA for 24h or 48h were detected by qRT-PCR and western blot respectively, (B) The effects of VPA on LX2 cells proliferation were examined by EDU incorporation analyses. (C) Migration assay for VPA pretreated LX2 cells, ×200. *** P
    Figure Legend Snippet: VPA inhibits the proliferation and migration of LX2 cells. (A) The mRNA and protein expression of α-SMA and collagen I in LX2 cells treated by 2.5mM VPA for 24h or 48h were detected by qRT-PCR and western blot respectively, (B) The effects of VPA on LX2 cells proliferation were examined by EDU incorporation analyses. (C) Migration assay for VPA pretreated LX2 cells, ×200. *** P

    Techniques Used: Migration, Expressing, Quantitative RT-PCR, Western Blot

    The biofunctional analyses of differentially expressed proteins (A) and paired miRNA targets in differentially expressed proteins (B) in VPA treated LX2 cells. The column chart represents the main biofunctions of differentially expressed miRNAs, proteins or paired miRNA targets in differentially expressed proteins respectively. The data were analyzed by IPA; statistical data were generated by the software using Fisher's exact T-test, the x-axis represents a negative logarithm of the P value.
    Figure Legend Snippet: The biofunctional analyses of differentially expressed proteins (A) and paired miRNA targets in differentially expressed proteins (B) in VPA treated LX2 cells. The column chart represents the main biofunctions of differentially expressed miRNAs, proteins or paired miRNA targets in differentially expressed proteins respectively. The data were analyzed by IPA; statistical data were generated by the software using Fisher's exact T-test, the x-axis represents a negative logarithm of the P value.

    Techniques Used: Indirect Immunoperoxidase Assay, Generated, Software

    VPA regulated miRNA expression through increased histone acetylation. (A) VPA treatment increased the global protein acetylation of LX2 cells as detected by western blot using an antibody against pan acetyl-lysine, the band for histone was about 15KD. (B) The transfection condition for LX2 cells was optimized by Cy3 labeled siRNA transfection control (Cy3-siTC), and a minimal concentration of 50nM was used in the present study according to transfection efficiency, ×200. (C) The expression of HDAC2 or 3 mRNA in siHDAC2 or 3 transfected LX2 cells was detected by qRT-PCR. (D) Knockdown of HDAC2 and HDAC3 by siRNAs enhanced the acetylation of Histone H3, detected by western blot using an antibody against acetylated lysine (K) 27 of histone H3 (AcH3K27). (E, F) The expression of VPA-miRNAs (E) and mRNAs of VPA-protein-encoding genes (F) in siHDAC2 and 3 co-transfected LX2 cells was detected by qRT-PCR, all expressions were compared to untreated control or non-targeting siRNA negative control (siNC), *** P
    Figure Legend Snippet: VPA regulated miRNA expression through increased histone acetylation. (A) VPA treatment increased the global protein acetylation of LX2 cells as detected by western blot using an antibody against pan acetyl-lysine, the band for histone was about 15KD. (B) The transfection condition for LX2 cells was optimized by Cy3 labeled siRNA transfection control (Cy3-siTC), and a minimal concentration of 50nM was used in the present study according to transfection efficiency, ×200. (C) The expression of HDAC2 or 3 mRNA in siHDAC2 or 3 transfected LX2 cells was detected by qRT-PCR. (D) Knockdown of HDAC2 and HDAC3 by siRNAs enhanced the acetylation of Histone H3, detected by western blot using an antibody against acetylated lysine (K) 27 of histone H3 (AcH3K27). (E, F) The expression of VPA-miRNAs (E) and mRNAs of VPA-protein-encoding genes (F) in siHDAC2 and 3 co-transfected LX2 cells was detected by qRT-PCR, all expressions were compared to untreated control or non-targeting siRNA negative control (siNC), *** P

    Techniques Used: Expressing, Western Blot, Transfection, Labeling, Concentration Assay, Quantitative RT-PCR, Negative Control

    7) Product Images from "Novel Pro-resolving Aspirin-Triggered DHA Pathway"

    Article Title: Novel Pro-resolving Aspirin-Triggered DHA Pathway

    Journal: Chemistry & biology

    doi: 10.1016/j.chembiol.2011.06.008

    LC-MS-MS lipidomics and properties of synthetic AT-(NPD1/PD1), NPD1/PD1,and their isomers MRM chromatogram (m/z 359 > 153) co-injection of synthetic AT- (NPD1/PD1), 10 S ,17 R -AT-(NPD1/PD1) isomer and NPD1/PD1. AT-(NPD1/PD1) and NPD1/PD1 separate in this LC system with retention times of 8.2 and 12.0 min. Representative tandem mass and UV spectra of synthetic AT-(NPD1/PD1) (B), Δ 15 -trans-NPD1/PD1 (C) and NPD1/PD1 (D).
    Figure Legend Snippet: LC-MS-MS lipidomics and properties of synthetic AT-(NPD1/PD1), NPD1/PD1,and their isomers MRM chromatogram (m/z 359 > 153) co-injection of synthetic AT- (NPD1/PD1), 10 S ,17 R -AT-(NPD1/PD1) isomer and NPD1/PD1. AT-(NPD1/PD1) and NPD1/PD1 separate in this LC system with retention times of 8.2 and 12.0 min. Representative tandem mass and UV spectra of synthetic AT-(NPD1/PD1) (B), Δ 15 -trans-NPD1/PD1 (C) and NPD1/PD1 (D).

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Injection

    Synthetic protectins prepared for lipidomics and matching Neuroprotectin D1/protectin D1, aspirin-triggered neuroprotectin D1/protectin D1 and related isomers.
    Figure Legend Snippet: Synthetic protectins prepared for lipidomics and matching Neuroprotectin D1/protectin D1, aspirin-triggered neuroprotectin D1/protectin D1 and related isomers.

    Techniques Used:

    8) Product Images from "PINK1 is activated by mitochondrial membrane potential depolarization and stimulates Parkin E3 ligase activity by phosphorylating Serine 65"

    Article Title: PINK1 is activated by mitochondrial membrane potential depolarization and stimulates Parkin E3 ligase activity by phosphorylating Serine 65

    Journal: Open Biology

    doi: 10.1098/rsob.120080

    Human Parkin Ser 65 is a substrate of human PINK1 upon CCCP stimulation. ( a ) Confirmation by mass spectrometry that Ser 65 of human Parkin is phosphorylated by CCCP-induced activation of human wild-type PINK1-FLAG. Flp-In T-Rex HEK293 cells expressing FLAG-empty, wild-type PINK1-FLAG, and kinase-inactive PINK1-FLAG (D384A) were co-transfected with HA-Parkin, induced with doxycycline and stimulated with 10 μM of CCCP for 3 h. Whole-cell extracts were obtained following lysis with 1% Triton and approximately 30 mg of whole-cell extract were subjected to immunoprecipitation with anti-HA-agarose and run on 10% SDS-PAGE and stained with colloidal Coomassie blue. Coomassie-stained bands migrating with the expected molecular mass of HA-Parkin were excised from the gel, digested with trypsin, and subjected to high performance liquid chromatography with tandem mass spectrometry (LC-MS-MS) on an LTQ-Orbitrap mass spectrometer. Extracted ion chromatogram analysis of Ser 131 and Ser 65 phosphopeptide (3 + R.NDWTVQNCDLDQQ S IVHIVQRPWR.K+P). The total signal intensity of the phosphopeptide is plotted on the y -axis and retention time is plotted on the x -axis. The m / z value corresponding to the Ser 131 phosphopeptide was detected in all conditions whilst that of the Ser 65 phosphopeptide was only detected in samples from wild-type PINK1-FLAG-expressing cells following CCCP treatment. ( b ) Characterization of Parkin phospho-Ser 65 antibody. Flp-In T-Rex HEK293 cells expressing FLAG-empty, wild-type PINK1-FLAG, and kinase-inactive PINK1-FLAG were co-transfected with untagged wild-type (WT) or Ser 65 Ala (S65A) mutant Parkin, induced with doxycycline and stimulated with 10 μM of CCCP for 3 h. 0.25 mg of 1% Triton whole-cell lysate were subjected to immunoprecipitation with anti-Parkin antibody (S966C) covalently coupled to protein G Sepharose and then immunoblotted with anti-phospho-Ser 65 antibody in the presence of dephosphorylated peptide. Ten per cent of the immunoprecipitate (IP) was immunoblotted with total anti-Parkin antibody. Twenty five micrograms of whole cell lysate was immunoblotted with total PINK1 antibody.
    Figure Legend Snippet: Human Parkin Ser 65 is a substrate of human PINK1 upon CCCP stimulation. ( a ) Confirmation by mass spectrometry that Ser 65 of human Parkin is phosphorylated by CCCP-induced activation of human wild-type PINK1-FLAG. Flp-In T-Rex HEK293 cells expressing FLAG-empty, wild-type PINK1-FLAG, and kinase-inactive PINK1-FLAG (D384A) were co-transfected with HA-Parkin, induced with doxycycline and stimulated with 10 μM of CCCP for 3 h. Whole-cell extracts were obtained following lysis with 1% Triton and approximately 30 mg of whole-cell extract were subjected to immunoprecipitation with anti-HA-agarose and run on 10% SDS-PAGE and stained with colloidal Coomassie blue. Coomassie-stained bands migrating with the expected molecular mass of HA-Parkin were excised from the gel, digested with trypsin, and subjected to high performance liquid chromatography with tandem mass spectrometry (LC-MS-MS) on an LTQ-Orbitrap mass spectrometer. Extracted ion chromatogram analysis of Ser 131 and Ser 65 phosphopeptide (3 + R.NDWTVQNCDLDQQ S IVHIVQRPWR.K+P). The total signal intensity of the phosphopeptide is plotted on the y -axis and retention time is plotted on the x -axis. The m / z value corresponding to the Ser 131 phosphopeptide was detected in all conditions whilst that of the Ser 65 phosphopeptide was only detected in samples from wild-type PINK1-FLAG-expressing cells following CCCP treatment. ( b ) Characterization of Parkin phospho-Ser 65 antibody. Flp-In T-Rex HEK293 cells expressing FLAG-empty, wild-type PINK1-FLAG, and kinase-inactive PINK1-FLAG were co-transfected with untagged wild-type (WT) or Ser 65 Ala (S65A) mutant Parkin, induced with doxycycline and stimulated with 10 μM of CCCP for 3 h. 0.25 mg of 1% Triton whole-cell lysate were subjected to immunoprecipitation with anti-Parkin antibody (S966C) covalently coupled to protein G Sepharose and then immunoblotted with anti-phospho-Ser 65 antibody in the presence of dephosphorylated peptide. Ten per cent of the immunoprecipitate (IP) was immunoblotted with total anti-Parkin antibody. Twenty five micrograms of whole cell lysate was immunoblotted with total PINK1 antibody.

    Techniques Used: Mass Spectrometry, Activation Assay, Expressing, Transfection, Lysis, Immunoprecipitation, SDS Page, Staining, High Performance Liquid Chromatography, Liquid Chromatography with Mass Spectroscopy, Mutagenesis

    9) Product Images from "The IkappaB Kinase Family Phosphorylates the Parkinson's Disease Kinase LRRK2 at Ser935 and Ser910 during Toll-Like Receptor Signaling"

    Article Title: The IkappaB Kinase Family Phosphorylates the Parkinson's Disease Kinase LRRK2 at Ser935 and Ser910 during Toll-Like Receptor Signaling

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0039132

    TBK1 and IKKε regulate LRRK2 Ser935 phosphorylation following TLR activation. A ) Schematic of SILAC experiment. B-E ) Extracted Ion Current for phosphopeptides encompassing Ser935 ( B ), Ser910 ( C ) and Ser955 ( D ) of LRRK2 and Ser177 of optineurin ( E ). The results for unstimulated RAW264.7 macrophages are presented in blue, results for RAW264.7 macrophages stimulated for 60 min with Pam 3 CSK 4 (1 µg/ml) are in green and the results from RAW264.7 macrophages pre-treated with 2 µM MRT67307 prior to stimulation with Pam 3 CSK 4 (1 µg/ml) for 60 min are depicted in red. ( F ) Table summarizing the results of the phosphopeptides from LRRK2 identified in the phosphoproteomics screen. G ) Primary bone marrow derived macrophages were pre-treated with 2 µM MRT67307 or DMSO control for 1 h before stimulation with 100 ng/ml LPS for the indicated time points. Immunoblots are representative of at least two independent experiments.
    Figure Legend Snippet: TBK1 and IKKε regulate LRRK2 Ser935 phosphorylation following TLR activation. A ) Schematic of SILAC experiment. B-E ) Extracted Ion Current for phosphopeptides encompassing Ser935 ( B ), Ser910 ( C ) and Ser955 ( D ) of LRRK2 and Ser177 of optineurin ( E ). The results for unstimulated RAW264.7 macrophages are presented in blue, results for RAW264.7 macrophages stimulated for 60 min with Pam 3 CSK 4 (1 µg/ml) are in green and the results from RAW264.7 macrophages pre-treated with 2 µM MRT67307 prior to stimulation with Pam 3 CSK 4 (1 µg/ml) for 60 min are depicted in red. ( F ) Table summarizing the results of the phosphopeptides from LRRK2 identified in the phosphoproteomics screen. G ) Primary bone marrow derived macrophages were pre-treated with 2 µM MRT67307 or DMSO control for 1 h before stimulation with 100 ng/ml LPS for the indicated time points. Immunoblots are representative of at least two independent experiments.

    Techniques Used: Activation Assay, Derivative Assay, Western Blot

    10) Product Images from "Interaction proteome of human Hippo signaling: modular control of the co-activator YAP1"

    Article Title: Interaction proteome of human Hippo signaling: modular control of the co-activator YAP1

    Journal: Molecular Systems Biology

    doi: 10.1002/msb.201304750

    A systematic affinity purification mass spectrometry ( AP ‐ MS ) approach to define the human Hpo pathway interaction proteome Selection of primary and secondary baits in this study. Baits were selected sequentially, starting with the core components of the Hpo kinase signaling pathway and extended based on obtained AP ‐ MS results or homology to D rosophila H po components. Biochemical workflow for native protein complex purification from HEK 293‐Flp T‐rex cells. Bait proteins were expressed from a tetracycline‐inducible CMV promoter, with a N‐terminal Strep‐ HA fusion tag following induction with doxycycline for 24 h. Cells were lysed, complexes affinity‐purified and processed for analysis by tandem mass spectrometry. Data analysis pipeline. Acquired mass spectra from 90 experiments (at least 2 biological replicates per bait) were searched with X!Tandem. Search results were statistically validated by the Trans‐Proteomic Pipeline ( TPP ) to match a protein identification false discovery rate of
    Figure Legend Snippet: A systematic affinity purification mass spectrometry ( AP ‐ MS ) approach to define the human Hpo pathway interaction proteome Selection of primary and secondary baits in this study. Baits were selected sequentially, starting with the core components of the Hpo kinase signaling pathway and extended based on obtained AP ‐ MS results or homology to D rosophila H po components. Biochemical workflow for native protein complex purification from HEK 293‐Flp T‐rex cells. Bait proteins were expressed from a tetracycline‐inducible CMV promoter, with a N‐terminal Strep‐ HA fusion tag following induction with doxycycline for 24 h. Cells were lysed, complexes affinity‐purified and processed for analysis by tandem mass spectrometry. Data analysis pipeline. Acquired mass spectra from 90 experiments (at least 2 biological replicates per bait) were searched with X!Tandem. Search results were statistically validated by the Trans‐Proteomic Pipeline ( TPP ) to match a protein identification false discovery rate of

    Techniques Used: Affinity Purification, Mass Spectrometry, Selection, Purification

    11) Product Images from "Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides"

    Article Title: Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gku1317

    Purification and sequencing of BCG 5S rRNA and a proposed model for 5S rRNA processing. ( A ) A Bioanalyzer electropherogram for HPLC-purified 5S rRNA shows high purity. ( B ) Comparison of sequenced 5S rRNA against its annotated gene sequence. A total of six nucleotides are absent from the sequenced 5S rRNA (highlighted in red). ( C ) Possible fates of the putative 9S RNA, a precursor of functional 5S rRNA. Zeller et al . demonstrated in vitro processing of 9S rRNA to a 116-nt 5S rRNA by MycRNE/RNase E/G ( 44 ), while our analysis reveals different or further in vivo processing to yield a 109-nt functional 5S rRNA molecule.
    Figure Legend Snippet: Purification and sequencing of BCG 5S rRNA and a proposed model for 5S rRNA processing. ( A ) A Bioanalyzer electropherogram for HPLC-purified 5S rRNA shows high purity. ( B ) Comparison of sequenced 5S rRNA against its annotated gene sequence. A total of six nucleotides are absent from the sequenced 5S rRNA (highlighted in red). ( C ) Possible fates of the putative 9S RNA, a precursor of functional 5S rRNA. Zeller et al . demonstrated in vitro processing of 9S rRNA to a 116-nt 5S rRNA by MycRNE/RNase E/G ( 44 ), while our analysis reveals different or further in vivo processing to yield a 109-nt functional 5S rRNA molecule.

    Techniques Used: Purification, Sequencing, High Performance Liquid Chromatography, Functional Assay, In Vitro, In Vivo

    12) Product Images from "2?-O Methylation of Internal Adenosine by Flavivirus NS5 Methyltransferase"

    Article Title: 2?-O Methylation of Internal Adenosine by Flavivirus NS5 Methyltransferase

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1002642

    Effects of internal methylation on flavivirus RNA translation and replication. (A) Replicon analysis. Top panel depicts the procedures to prepare replicon RNAs with and without internal adenosine methylations. Bottom panel shows the effects of internal Am modification on viral RNA translation and synthesis. Both DENV-1 and WNV luciferase replicons were used in the analysis. Specifically, equal amounts (2 µg) of replicon RNAs with and without internal Am modifications were electroporated into BHK-21 cells. The transfected cells were assayed for luciferase activities at indicated time points. For each time point, relative luciferase activities were compared between the replicons with internal Am and the replicon without internal Am (set at 100%). Average results and standard deviations from three experiments are presented. (B) RT-PCR analysis. The transfected cells described in (A) were extracted for total cellular RNA at indicated time points. Equal amounts of total cellular RNA (3 µg) were subjected to RT-PCR quantification using primers targeting viral NS5 gene. actin, a host housekeeping gene, was included as a control. The RT-PCR products were analyzed on a 1% agarose gel. One of the three representative experimental results is presented. (C) Effects of internal Am modification on the replication of genome-length RNA. DENV-1 genome-length RNAs with or without internal Am modifications were prepared as depicted in (A). Equal amounts of RNAs with or without internal Am modifications were transfected into BHK-21 cells, and compared for their specific infectivities and virus yields at indicated time points post transfection. (D) Effect of 2′- O -methylation on viral polymerase activity. An RNA elongation assay was used to compare the RdRp activities between RNA templates with and without 2′- O -methyladenosine. RNA sequences of primer/template are shown (left panel). Incorporation of 3 H-UTP in to the biotinylated RNA primer in the presence of DENV-4 NS5 was measured (right panel). Average results and standard deviations from three independent experiments are shown.
    Figure Legend Snippet: Effects of internal methylation on flavivirus RNA translation and replication. (A) Replicon analysis. Top panel depicts the procedures to prepare replicon RNAs with and without internal adenosine methylations. Bottom panel shows the effects of internal Am modification on viral RNA translation and synthesis. Both DENV-1 and WNV luciferase replicons were used in the analysis. Specifically, equal amounts (2 µg) of replicon RNAs with and without internal Am modifications were electroporated into BHK-21 cells. The transfected cells were assayed for luciferase activities at indicated time points. For each time point, relative luciferase activities were compared between the replicons with internal Am and the replicon without internal Am (set at 100%). Average results and standard deviations from three experiments are presented. (B) RT-PCR analysis. The transfected cells described in (A) were extracted for total cellular RNA at indicated time points. Equal amounts of total cellular RNA (3 µg) were subjected to RT-PCR quantification using primers targeting viral NS5 gene. actin, a host housekeeping gene, was included as a control. The RT-PCR products were analyzed on a 1% agarose gel. One of the three representative experimental results is presented. (C) Effects of internal Am modification on the replication of genome-length RNA. DENV-1 genome-length RNAs with or without internal Am modifications were prepared as depicted in (A). Equal amounts of RNAs with or without internal Am modifications were transfected into BHK-21 cells, and compared for their specific infectivities and virus yields at indicated time points post transfection. (D) Effect of 2′- O -methylation on viral polymerase activity. An RNA elongation assay was used to compare the RdRp activities between RNA templates with and without 2′- O -methyladenosine. RNA sequences of primer/template are shown (left panel). Incorporation of 3 H-UTP in to the biotinylated RNA primer in the presence of DENV-4 NS5 was measured (right panel). Average results and standard deviations from three independent experiments are shown.

    Techniques Used: Methylation, Modification, Luciferase, Transfection, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis, Activity Assay

    Optimal conditions for internal methylation for DENV-4 NS5 MTase. SPA-based methylation assays were performed using uncapped pppA-RNA substrate (representing the first 211 nt of DENV genome). The reaction mixtures were incubated for 1 h at room temperature. Optimal pH, temperature, NaCl concentration, MgCl 2 concentration, and MnCl 2 concentration were obtained by titrating individual parameter while keeping other parameters at the optimal levels. Average results and standard deviations were obtained from three independent experiments.
    Figure Legend Snippet: Optimal conditions for internal methylation for DENV-4 NS5 MTase. SPA-based methylation assays were performed using uncapped pppA-RNA substrate (representing the first 211 nt of DENV genome). The reaction mixtures were incubated for 1 h at room temperature. Optimal pH, temperature, NaCl concentration, MgCl 2 concentration, and MnCl 2 concentration were obtained by titrating individual parameter while keeping other parameters at the optimal levels. Average results and standard deviations were obtained from three independent experiments.

    Techniques Used: Methylation, Incubation, Concentration Assay

    Internal methylation of RNA by flavivirus NS5 and MTase domain. (A) The principle of scintillation proximity assay (SPA). CMP-biotinylated RNA was methylated by enzyme using [ 3 H-methyl]-SAM. The biotinylated RNA containing 3 H-methyl is captured by streptavidin-coated SPA scintillation beads, leading to a signal that can be measured using a MicroBeta counter. (B) SPA analysis of internal methylation of flaviviral RNAs. Uncapped pppA-RNAs, representing the 5′-terminal 190 nt of WNV genome or the 5′-terminal 211 nt of DENV genome, were methylated by indicated recombinant proteins. The combination of protein and pppA-RNA for each reaction is depicted. (C) SPA analysis of RNA cap methylations. GpppA-RNA or m 7 GpppA-RNA, representing the first 190 nt of WNV genome or the first 211 nt of DENV genome, was methylated using the indicated MTases. Average results and standard deviations from three independent experiments are shown.
    Figure Legend Snippet: Internal methylation of RNA by flavivirus NS5 and MTase domain. (A) The principle of scintillation proximity assay (SPA). CMP-biotinylated RNA was methylated by enzyme using [ 3 H-methyl]-SAM. The biotinylated RNA containing 3 H-methyl is captured by streptavidin-coated SPA scintillation beads, leading to a signal that can be measured using a MicroBeta counter. (B) SPA analysis of internal methylation of flaviviral RNAs. Uncapped pppA-RNAs, representing the 5′-terminal 190 nt of WNV genome or the 5′-terminal 211 nt of DENV genome, were methylated by indicated recombinant proteins. The combination of protein and pppA-RNA for each reaction is depicted. (C) SPA analysis of RNA cap methylations. GpppA-RNA or m 7 GpppA-RNA, representing the first 190 nt of WNV genome or the first 211 nt of DENV genome, was methylated using the indicated MTases. Average results and standard deviations from three independent experiments are shown.

    Techniques Used: Methylation, Scintillation Proximity Assay, Recombinant

    2′- O methylation of internal adenosine. (A) Incorporation of 3 H-methyl into polyA. Homopolymer RNAs (1 µg) were incubated with 2 µg of DENV-4 MTase in the presence of [ 3 H-methyl]-SAM. After the methylation reaction, the un-incorporated [ 3 H-methyl]-SAM was removed by RNeasy kit. The amount of 3 H-methyl incorporation was measured by a MicroBeta counting. (B) SPA-based methylation analysis of oligo (A) 12 , (Am) 12 , and (m 6 ,m 6 A) 12 . All three RNA oligos were 3′-end biotinylated to facilitate SPA analysis. Am indicates that the 2′-OH of adenosine is methylated. m 6 ,m 6 A indicates that the amino N 6 position of adenosine is double methylated. (C) SPA-based methylation analysis of DENV-1 RNA. pppA-RNAs, representing the 5′ 211 nt of DENV-1 genome, were in vitro transcribed using biotinylated-CTP plus unmodified ATP, 2′- O -methyladenosine triphosphate (AmTP), or N 6 methyl adenosine triphosphate (m 6 ATP). The transcription reactions generated pppA-RNA, ppp(Am)-RNA, and ppp(m 6 A)RNA, respectively. The RNAs were then subjected to SPA-based internal methylation analysis. Average results and standard deviations from three independent experiments are presented.
    Figure Legend Snippet: 2′- O methylation of internal adenosine. (A) Incorporation of 3 H-methyl into polyA. Homopolymer RNAs (1 µg) were incubated with 2 µg of DENV-4 MTase in the presence of [ 3 H-methyl]-SAM. After the methylation reaction, the un-incorporated [ 3 H-methyl]-SAM was removed by RNeasy kit. The amount of 3 H-methyl incorporation was measured by a MicroBeta counting. (B) SPA-based methylation analysis of oligo (A) 12 , (Am) 12 , and (m 6 ,m 6 A) 12 . All three RNA oligos were 3′-end biotinylated to facilitate SPA analysis. Am indicates that the 2′-OH of adenosine is methylated. m 6 ,m 6 A indicates that the amino N 6 position of adenosine is double methylated. (C) SPA-based methylation analysis of DENV-1 RNA. pppA-RNAs, representing the 5′ 211 nt of DENV-1 genome, were in vitro transcribed using biotinylated-CTP plus unmodified ATP, 2′- O -methyladenosine triphosphate (AmTP), or N 6 methyl adenosine triphosphate (m 6 ATP). The transcription reactions generated pppA-RNA, ppp(Am)-RNA, and ppp(m 6 A)RNA, respectively. The RNAs were then subjected to SPA-based internal methylation analysis. Average results and standard deviations from three independent experiments are presented.

    Techniques Used: Methylation, Incubation, In Vitro, Generated

    Mass spectrometric analysis of Am in MTase-treated polyA and in DENV genomic RNA. (A) Extracted ion chromatogram of ions with m/z 282.1187 from the LC-QTOF scan of putative Am in hydrolysates of DENV-4 MTase-treated polyA and of standard Am. (B,C) CID spectra of the parent ion m/z 282.1187 representing standard Am (B) and putative Am in hydrolysates of DENV-4 MTase treated polyA species (C). The inset shows the assignment of structures for the CID spectra. (D,E) LC-MS/MS quantification of Am in WT DENV-1 genomic RNA (D) and MTase E217A mutant DENV-1 genomic RNA (E); the solid and dashed lines represent technical replicates. The different retention time for Am in panel A (∼24.5 min) compared to panels D and E (∼4.4 min) is the result of different HPLC flow rates used for the two studies.
    Figure Legend Snippet: Mass spectrometric analysis of Am in MTase-treated polyA and in DENV genomic RNA. (A) Extracted ion chromatogram of ions with m/z 282.1187 from the LC-QTOF scan of putative Am in hydrolysates of DENV-4 MTase-treated polyA and of standard Am. (B,C) CID spectra of the parent ion m/z 282.1187 representing standard Am (B) and putative Am in hydrolysates of DENV-4 MTase treated polyA species (C). The inset shows the assignment of structures for the CID spectra. (D,E) LC-MS/MS quantification of Am in WT DENV-1 genomic RNA (D) and MTase E217A mutant DENV-1 genomic RNA (E); the solid and dashed lines represent technical replicates. The different retention time for Am in panel A (∼24.5 min) compared to panels D and E (∼4.4 min) is the result of different HPLC flow rates used for the two studies.

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Mutagenesis, High Performance Liquid Chromatography, Flow Cytometry

    Mutagenesis analysis of DENV-4 MTase. (A) Co-crystal structure of DENV MTase showing SAH (yellow stick) and GMP (pink stick). (B) Surface presentation of DENV MTase depicting mutated amino acids. Mutated residues in the K-D-K-E motif, SAM-binding pocket, RNA-binding site, and GMP-binding pocket are shown in yellow, blue, red, and green, respectively. The images were produced using DENV-2 MTase structure (PDB code: 1L9K) [14] and PyMOL. (C) Effects of mutations of DENV-4 MTase on internal methylation. Biotinylated pppA-RNA (representing the first 211 nt of DENV genomic RNA) was incubated with WT or various mutant MTases in the presence of [ 3 H-methyl]-SAM. The reactions were quantified for [ 3 H-methyl]-incorporation using SPA analysis. The methylation efficiencies of mutant MTases were compared with that of the WT MTase (set at 100%). Averages of three independent experiments are shown. Error bars indicate standard deviations.
    Figure Legend Snippet: Mutagenesis analysis of DENV-4 MTase. (A) Co-crystal structure of DENV MTase showing SAH (yellow stick) and GMP (pink stick). (B) Surface presentation of DENV MTase depicting mutated amino acids. Mutated residues in the K-D-K-E motif, SAM-binding pocket, RNA-binding site, and GMP-binding pocket are shown in yellow, blue, red, and green, respectively. The images were produced using DENV-2 MTase structure (PDB code: 1L9K) [14] and PyMOL. (C) Effects of mutations of DENV-4 MTase on internal methylation. Biotinylated pppA-RNA (representing the first 211 nt of DENV genomic RNA) was incubated with WT or various mutant MTases in the presence of [ 3 H-methyl]-SAM. The reactions were quantified for [ 3 H-methyl]-incorporation using SPA analysis. The methylation efficiencies of mutant MTases were compared with that of the WT MTase (set at 100%). Averages of three independent experiments are shown. Error bars indicate standard deviations.

    Techniques Used: Mutagenesis, Binding Assay, RNA Binding Assay, Produced, Methylation, Incubation

    13) Product Images from "Novel Keto-phospholipids Are Generated by Monocytes and Macrophages, Detected in Cystic Fibrosis, and Activate Peroxisome Proliferator-activated Receptor-? *"

    Article Title: Novel Keto-phospholipids Are Generated by Monocytes and Macrophages, Detected in Cystic Fibrosis, and Activate Peroxisome Proliferator-activated Receptor-? *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.405407

    Human monocytes generate four 15-KETE-PEs. Human monocytes were isolated cultured with IL-4 as described under “Experimental Procedures.” Cells were activated in Krebs buffer with 10 μ m A23187 for 15 min at 37 °C. Lipids were extracted and analyzed using reverse phase LC/MS/MS as described. A , precursor scan for [M − H] − 317.2 shows four major ions generated by activated human monocytes. Four prominent ions are circled. B–E , representative chromatograms and MS/MS spectra of lipids detected as parent → 317.2 for the four lipids compared with synthetic standards. Standards were made as described ( 12 ) and run under conditions identical to those used for human monocyte lipid extracts. MS/MS spectra were acquired in ion trap mode at the apex of elution for each lipid. cps , counts/s.
    Figure Legend Snippet: Human monocytes generate four 15-KETE-PEs. Human monocytes were isolated cultured with IL-4 as described under “Experimental Procedures.” Cells were activated in Krebs buffer with 10 μ m A23187 for 15 min at 37 °C. Lipids were extracted and analyzed using reverse phase LC/MS/MS as described. A , precursor scan for [M − H] − 317.2 shows four major ions generated by activated human monocytes. Four prominent ions are circled. B–E , representative chromatograms and MS/MS spectra of lipids detected as parent → 317.2 for the four lipids compared with synthetic standards. Standards were made as described ( 12 ) and run under conditions identical to those used for human monocyte lipid extracts. MS/MS spectra were acquired in ion trap mode at the apex of elution for each lipid. cps , counts/s.

    Techniques Used: Isolation, Cell Culture, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Generated

    Murine macrophages generate four 12-KETE-PEs. Murine peritoneal macrophages were isolated from WT mice (8–12 weeks) by lavage with ice-cold PBS. Cells were activated at 37 °C for 15 min with 10 μ m A23187, and then lipids were extracted and analyzed using LC/MS/MS as described under “Experimental Procedures.” A , precursor scan for [M − H] − 317.2 shows four major ions generated by murine macrophages. Four prominent ions are circled. B–E , representative chromatograms and MS/MS spectra of lipids detected as parent → 317.2 for the four lipids compared with synthetic standards. Standards were made as described ( 12 ) and run under conditions identical to those used for murine macrophage lipid extracts. MS/MS spectra were acquired in ion trap mode at the apex of elution for each lipid. cps , counts/s.
    Figure Legend Snippet: Murine macrophages generate four 12-KETE-PEs. Murine peritoneal macrophages were isolated from WT mice (8–12 weeks) by lavage with ice-cold PBS. Cells were activated at 37 °C for 15 min with 10 μ m A23187, and then lipids were extracted and analyzed using LC/MS/MS as described under “Experimental Procedures.” A , precursor scan for [M − H] − 317.2 shows four major ions generated by murine macrophages. Four prominent ions are circled. B–E , representative chromatograms and MS/MS spectra of lipids detected as parent → 317.2 for the four lipids compared with synthetic standards. Standards were made as described ( 12 ) and run under conditions identical to those used for murine macrophage lipid extracts. MS/MS spectra were acquired in ion trap mode at the apex of elution for each lipid. cps , counts/s.

    Techniques Used: Isolation, Mouse Assay, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Generated

    14) Product Images from "Differential proteomic analysis of synovial fluid from rheumatoid arthritis and osteoarthritis patients"

    Article Title: Differential proteomic analysis of synovial fluid from rheumatoid arthritis and osteoarthritis patients

    Journal: Clinical proteomics

    doi: 10.1186/1559-0275-11-1

    A schematic workflow illustrating the steps involved in the differential analysis of RA and OA synovial fluid proteome. Proteins from RA and OA synovial fluid were extracted and depleted to remove the 14 most abundant proteins using multiple affinity removal system, Human-14. The depleted protein from RA and OA were then digested with trypsin and labeled with iTRAQ reagents, 117 and 116 respectively. The labeled samples were pooled and subjected to fractionation using strong cation exchange chromatography. The fractions were then analyzed on a LTQ-Orbitrap Velos mass spectrometer. The MS/MS data obtained was searched against Human RefSeq 50 database using Sequest and Mascot search algorithms. Validation of the iTRAQ quantitation data was carried out using multiple reaction monitoring and Western blot.
    Figure Legend Snippet: A schematic workflow illustrating the steps involved in the differential analysis of RA and OA synovial fluid proteome. Proteins from RA and OA synovial fluid were extracted and depleted to remove the 14 most abundant proteins using multiple affinity removal system, Human-14. The depleted protein from RA and OA were then digested with trypsin and labeled with iTRAQ reagents, 117 and 116 respectively. The labeled samples were pooled and subjected to fractionation using strong cation exchange chromatography. The fractions were then analyzed on a LTQ-Orbitrap Velos mass spectrometer. The MS/MS data obtained was searched against Human RefSeq 50 database using Sequest and Mascot search algorithms. Validation of the iTRAQ quantitation data was carried out using multiple reaction monitoring and Western blot.

    Techniques Used: Labeling, Fractionation, Chromatography, Mass Spectrometry, Quantitation Assay, Western Blot

    15) Product Images from "The Role of Calpain-Myosin 9-Rab7b Pathway in Mediating the Expression of Toll-Like Receptor 4 in Platelets: A Novel Mechanism Involved in ?-Granules Trafficking"

    Article Title: The Role of Calpain-Myosin 9-Rab7b Pathway in Mediating the Expression of Toll-Like Receptor 4 in Platelets: A Novel Mechanism Involved in ?-Granules Trafficking

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0085833

    TLR4 interacts with myosin-9. (A) Identification of myosin-9 as a TLR4-interacting protein by co-IP and mass spectrometry. Washed platelet lysates were prepared for IP with mouse IgG- or anti-TLR4-conjugated agarose beads. The precipitated proteins were resolved by SDS-PAGE and revealed by Coomassie Blue staining. The stars indicated the protein bands that were pulled down with the anti-TLR4 antibody but not by mouse IgG. The stars indicated myosin-9 that was identified by nano-LC/MS/MS on an LCQ Deca XP Plus ion trap mass spectrometer.
    Figure Legend Snippet: TLR4 interacts with myosin-9. (A) Identification of myosin-9 as a TLR4-interacting protein by co-IP and mass spectrometry. Washed platelet lysates were prepared for IP with mouse IgG- or anti-TLR4-conjugated agarose beads. The precipitated proteins were resolved by SDS-PAGE and revealed by Coomassie Blue staining. The stars indicated the protein bands that were pulled down with the anti-TLR4 antibody but not by mouse IgG. The stars indicated myosin-9 that was identified by nano-LC/MS/MS on an LCQ Deca XP Plus ion trap mass spectrometer.

    Techniques Used: Co-Immunoprecipitation Assay, Mass Spectrometry, SDS Page, Staining, Liquid Chromatography with Mass Spectroscopy

    16) Product Images from "Obesity is associated with changes in oxysterol metabolism and levels in mice liver, hypothalamus, adipose tissue and plasma"

    Article Title: Obesity is associated with changes in oxysterol metabolism and levels in mice liver, hypothalamus, adipose tissue and plasma

    Journal: Scientific Reports

    doi: 10.1038/srep19694

    Plasmatic oxysterol levels during the development of diet-induced obesity. Oxysterol levels were quantified by HPLC-MS in mouse plasma of the diet-induced obesity model. At each time-point (i.e. 1; 2; 4; 6; 8 and 16 weeks) a control and a high-fat group were sacrificed. The data are reported as percentage of each respective control group (shown as a dotted line). Data are mean ± s.e.m. Student’s t-test between HFD group and the respective CTL group. *P
    Figure Legend Snippet: Plasmatic oxysterol levels during the development of diet-induced obesity. Oxysterol levels were quantified by HPLC-MS in mouse plasma of the diet-induced obesity model. At each time-point (i.e. 1; 2; 4; 6; 8 and 16 weeks) a control and a high-fat group were sacrificed. The data are reported as percentage of each respective control group (shown as a dotted line). Data are mean ± s.e.m. Student’s t-test between HFD group and the respective CTL group. *P

    Techniques Used: High Performance Liquid Chromatography, Mass Spectrometry, CTL Assay

    Hepatic oxysterol levels and expression of their metabolic enzymes during the development of diet-induced obesity. Schematic representation of the main metabolic steps involved in the synthesis and degradation of the oxysterols measured throughout the HFD study in the liver. The figure shows the variations in oxysterol levels and mRNA expression of their metabolic enzymes, compared to the respective control mice, at the different time-points throughout the study. At each time-point (i.e. 1; 2; 4; 6; 8 and 16 weeks) a control and a high-fat group were sacrificed. Oxysterol levels were quantified by HPLC-MS and mRNA enzyme expression was measured by qRT-PCR. Red color indicates an increase and blue color indicates a decrease of the HFD group compared to control group. Data (mean ± s.e.m) are reported in Table S2 . Student’s t-test between HFD group and the respective CTL group. *P
    Figure Legend Snippet: Hepatic oxysterol levels and expression of their metabolic enzymes during the development of diet-induced obesity. Schematic representation of the main metabolic steps involved in the synthesis and degradation of the oxysterols measured throughout the HFD study in the liver. The figure shows the variations in oxysterol levels and mRNA expression of their metabolic enzymes, compared to the respective control mice, at the different time-points throughout the study. At each time-point (i.e. 1; 2; 4; 6; 8 and 16 weeks) a control and a high-fat group were sacrificed. Oxysterol levels were quantified by HPLC-MS and mRNA enzyme expression was measured by qRT-PCR. Red color indicates an increase and blue color indicates a decrease of the HFD group compared to control group. Data (mean ± s.e.m) are reported in Table S2 . Student’s t-test between HFD group and the respective CTL group. *P

    Techniques Used: Expressing, Mouse Assay, High Performance Liquid Chromatography, Mass Spectrometry, Quantitative RT-PCR, CTL Assay

    Oxysterol levels in the liver, plasma and adipose tissue of the ob/ob genetic model of obesity. Oxysterol levels were quantified by HPLC-MS in ( a ) the liver, ( b ) the plasma and ( c ) the adipose tissue in the ob/ob model. The data are reported as percentage of the control group (ob/lean) (shown as a dotted line). Data are mean ± s.e.m.; student’s t-test between ob/ob group and the ob/lean group *P
    Figure Legend Snippet: Oxysterol levels in the liver, plasma and adipose tissue of the ob/ob genetic model of obesity. Oxysterol levels were quantified by HPLC-MS in ( a ) the liver, ( b ) the plasma and ( c ) the adipose tissue in the ob/ob model. The data are reported as percentage of the control group (ob/lean) (shown as a dotted line). Data are mean ± s.e.m.; student’s t-test between ob/ob group and the ob/lean group *P

    Techniques Used: High Performance Liquid Chromatography, Mass Spectrometry

    Adipose tissue oxysterol levels during the development of diet-induced obesity. Oxysterol levels were quantified by HPLC-MS in mouse subcutaneous adipose tissue of the diet-induced obesity model. At each time-point (i.e. 1; 2; 4; 6; 8 and 16 weeks) a control and a high-fat group were sacrificed. The data are reported as percentage of each respective control group (shown as a dotted line). Data are mean ± s.e.m. Student’s t-test between HFD group and the respective CTL group. *P
    Figure Legend Snippet: Adipose tissue oxysterol levels during the development of diet-induced obesity. Oxysterol levels were quantified by HPLC-MS in mouse subcutaneous adipose tissue of the diet-induced obesity model. At each time-point (i.e. 1; 2; 4; 6; 8 and 16 weeks) a control and a high-fat group were sacrificed. The data are reported as percentage of each respective control group (shown as a dotted line). Data are mean ± s.e.m. Student’s t-test between HFD group and the respective CTL group. *P

    Techniques Used: High Performance Liquid Chromatography, Mass Spectrometry, CTL Assay

    Hypothalamic oxysterol levels and expression of their metabolic enzymes during the development of diet-induced obesity. Schematic representation of the main metabolic steps involved in the synthesis and degradation of the oxysterols measured throughout the HFD study in the hypothalamus. The figure shows the variations in oxysterol levels and mRNA expression of their metabolic enzymes, compared to the respective control mice, at the different time-points throughout the study. At each time-point (i.e. 1; 2; 4; 6; 8 and 16 weeks) a normal diet (control) and a high-fat group were sacrificed. Oxysterol levels were quantified by HPLC-MS and mRNA enzyme expression was measured by qRT-PCR. Red color indicates an increase and blue color indicates a decrease of the HFD group compared to control group. Data (mean ± s.e.m) are reported in Table S1 . Student’s t-test between HFD group and the respective CTL group. *P
    Figure Legend Snippet: Hypothalamic oxysterol levels and expression of their metabolic enzymes during the development of diet-induced obesity. Schematic representation of the main metabolic steps involved in the synthesis and degradation of the oxysterols measured throughout the HFD study in the hypothalamus. The figure shows the variations in oxysterol levels and mRNA expression of their metabolic enzymes, compared to the respective control mice, at the different time-points throughout the study. At each time-point (i.e. 1; 2; 4; 6; 8 and 16 weeks) a normal diet (control) and a high-fat group were sacrificed. Oxysterol levels were quantified by HPLC-MS and mRNA enzyme expression was measured by qRT-PCR. Red color indicates an increase and blue color indicates a decrease of the HFD group compared to control group. Data (mean ± s.e.m) are reported in Table S1 . Student’s t-test between HFD group and the respective CTL group. *P

    Techniques Used: Expressing, Mouse Assay, High Performance Liquid Chromatography, Mass Spectrometry, Quantitative RT-PCR, CTL Assay

    17) Product Images from "LC–MS/MS Quantitation of Esophagus Disease Blood Serum Glycoproteins by Enrichment with Hydrazide Chemistry and Lectin Affinity Chromatography"

    Article Title: LC–MS/MS Quantitation of Esophagus Disease Blood Serum Glycoproteins by Enrichment with Hydrazide Chemistry and Lectin Affinity Chromatography

    Journal: Journal of Proteome Research

    doi: 10.1021/pr500570m

    Box and dot plots of normalized peak areas of glycopeptides determined by MRM LC–MS/MS analyses of LAC-enriched samples and glycosylation sites of HC-enriched samples. These are peptides and glycopeptides that have demonstrated a statistically significant differences in expressions between DF versus EAC with p value
    Figure Legend Snippet: Box and dot plots of normalized peak areas of glycopeptides determined by MRM LC–MS/MS analyses of LAC-enriched samples and glycosylation sites of HC-enriched samples. These are peptides and glycopeptides that have demonstrated a statistically significant differences in expressions between DF versus EAC with p value

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

    Spectral counts quantitation of LAC-enriched glycoproteins (A) and HC-enriched glycoproteins (B) by LC–ESI–MS/MS that were evaluated as significant differentiated ones between DF and HGD and between DF and EAC with p value
    Figure Legend Snippet: Spectral counts quantitation of LAC-enriched glycoproteins (A) and HC-enriched glycoproteins (B) by LC–ESI–MS/MS that were evaluated as significant differentiated ones between DF and HGD and between DF and EAC with p value

    Techniques Used: Quantitation Assay, Mass Spectrometry

    Box and dot plots of normalized peak areas of glycopeptides determined by MRM LC–MS/MS analyses of LAC-enriched samples and glycosylation sites of HC-enriched samples. These are peptides and glycopeptides that have demonstrated a statistically significant difference between DF versus EAC and DF versus HGD with p value
    Figure Legend Snippet: Box and dot plots of normalized peak areas of glycopeptides determined by MRM LC–MS/MS analyses of LAC-enriched samples and glycosylation sites of HC-enriched samples. These are peptides and glycopeptides that have demonstrated a statistically significant difference between DF versus EAC and DF versus HGD with p value

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

    Principal component analysis (PCA) scores plot for LC–ESI–MS/MS results of LAC- (A) and HC-enriched (B) samples from human blood serum associated with DF subjects ( N = 15, green), HGD ( N = 12 for LAC enrichment and N = 11 for HC enrichment, blue), and EAC ( N = 15, red).
    Figure Legend Snippet: Principal component analysis (PCA) scores plot for LC–ESI–MS/MS results of LAC- (A) and HC-enriched (B) samples from human blood serum associated with DF subjects ( N = 15, green), HGD ( N = 12 for LAC enrichment and N = 11 for HC enrichment, blue), and EAC ( N = 15, red).

    Techniques Used: Mass Spectrometry

    Box and dot plots of normalized peak areas of glycopeptides determined by MRM LC–MS/MS analyses of LAC-enriched samples and glycosylation sites of HC-enriched samples. These are peptides and glycopeptides that have demonstrated a statistically significant differences in expressions between DF versus HGD with p value
    Figure Legend Snippet: Box and dot plots of normalized peak areas of glycopeptides determined by MRM LC–MS/MS analyses of LAC-enriched samples and glycosylation sites of HC-enriched samples. These are peptides and glycopeptides that have demonstrated a statistically significant differences in expressions between DF versus HGD with p value

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

    18) Product Images from "tRNA-mediated codon-biased translation in mycobacterial hypoxic persistence"

    Article Title: tRNA-mediated codon-biased translation in mycobacterial hypoxic persistence

    Journal: Nature Communications

    doi: 10.1038/ncomms13302

    Dynamics of tRNA modifications as BCG enter and exit hypoxic non-replicating persistence. ( a ) Composite extracted ion chromatogram of 40 modified ribonucleosides in BCG tRNA. Full names, structures and LC-MS/MS parameters can be found in Supplementary Data 1 . ( b ) Hierarchical clustering analysis of changes in the relative levels of BCG tRNA modification induced by hypoxia (H) on day 0 (Log), 4, 6, 9, 14 and 18, and re-aeration (R) on day 19 (R1), 21 (R3) and 24 (R6) (time course in Supplementary Fig. 1 ). Hierarchical clustering was performed on mean-centred data ( n =6) and visualized as a heat map of log 2 fold-changes relative to Log cultures with colour intensities subjected to standardization by RNA modification: Relative quantification of tRNA modifications can be found in Supplementary Data 2 . Modified ribonucleosides ho 5 U, mo5U, cmo 5 U and mcmo 5 U relevant to the discussion in the text are highlighted in blue.
    Figure Legend Snippet: Dynamics of tRNA modifications as BCG enter and exit hypoxic non-replicating persistence. ( a ) Composite extracted ion chromatogram of 40 modified ribonucleosides in BCG tRNA. Full names, structures and LC-MS/MS parameters can be found in Supplementary Data 1 . ( b ) Hierarchical clustering analysis of changes in the relative levels of BCG tRNA modification induced by hypoxia (H) on day 0 (Log), 4, 6, 9, 14 and 18, and re-aeration (R) on day 19 (R1), 21 (R3) and 24 (R6) (time course in Supplementary Fig. 1 ). Hierarchical clustering was performed on mean-centred data ( n =6) and visualized as a heat map of log 2 fold-changes relative to Log cultures with colour intensities subjected to standardization by RNA modification: Relative quantification of tRNA modifications can be found in Supplementary Data 2 . Modified ribonucleosides ho 5 U, mo5U, cmo 5 U and mcmo 5 U relevant to the discussion in the text are highlighted in blue.

    Techniques Used: Modification, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

    The choice between codons Thr ACG and Thr ACC influences protein up- or downregulation in the BCG response to hypoxia. ( a , b ) Principal component analysis was performed with fold-change data for the 965 most quantifiable proteins (loadings, b ) across the hypoxia time course (scores, a ). Clustering of sample eigenvectors (Log■, H4·, H6▲, H9⧫, H14▼, H18*, R3○ and R6□) in the scores plot ( a ) and protein variables (Blue filled circle) in the loadings plot ( b ) is highlighted using data eclipses, with the clusters reflecting both the growth phenotypes (acronyms defined in Supplementary Fig. 1a ) and the tRNA modification clustering in the heat map in Fig. 1b . Seventy-two per cent of observed variance can be explained by three principal components ( n =3, PC-1: 37%, PC-2: 24%, PC-3: 11%). ( c , d ) Partial least squares regression analysis of significantly up- (Orange filled square) or down- (Blue filled circle) regulated proteins and their codon usages (Red filled circle) at H4 visualized by scores ( c ), and X,Y correlation loadings representing codon usage (X) against extent of protein up- or downregulation (Y) ( d ). The proteins were selected blindly for PLS analysis based on statistical significance ( P
    Figure Legend Snippet: The choice between codons Thr ACG and Thr ACC influences protein up- or downregulation in the BCG response to hypoxia. ( a , b ) Principal component analysis was performed with fold-change data for the 965 most quantifiable proteins (loadings, b ) across the hypoxia time course (scores, a ). Clustering of sample eigenvectors (Log■, H4·, H6▲, H9⧫, H14▼, H18*, R3○ and R6□) in the scores plot ( a ) and protein variables (Blue filled circle) in the loadings plot ( b ) is highlighted using data eclipses, with the clusters reflecting both the growth phenotypes (acronyms defined in Supplementary Fig. 1a ) and the tRNA modification clustering in the heat map in Fig. 1b . Seventy-two per cent of observed variance can be explained by three principal components ( n =3, PC-1: 37%, PC-2: 24%, PC-3: 11%). ( c , d ) Partial least squares regression analysis of significantly up- (Orange filled square) or down- (Blue filled circle) regulated proteins and their codon usages (Red filled circle) at H4 visualized by scores ( c ), and X,Y correlation loadings representing codon usage (X) against extent of protein up- or downregulation (Y) ( d ). The proteins were selected blindly for PLS analysis based on statistical significance ( P

    Techniques Used: Modification

    Proposed mechanism by which dynamic changes in the tRNA pool regulates selective translation of codon-biased transcripts and mycobacterial non-replicating persistence. Under normoxic conditions, translational selection is determined by the tRNA pool wherein highly expressed genes use a subset of optimal codons in accordance with their respective major isoacceptor tRNA levels (such as the codon ACC for Thr and its cognate tRNA Thr GGU in BCG). Conversely, genes using less abundant or rare synonymous codons are expressed to a lesser extent. For instance, tRNA Thr mo5UGU can read the codons ACG, ACA and ACU, diluting available tRNA Thr UGU isoacceptors. Exposure to hypoxia alters the tRNA pool by both affecting both tRNA copy numbers and their modification status. Decreases in specific isoacceptors such as tRNA Thr GGU and tRNA Thr CGU funnel translation towards tRNA Thr UGU decoding. Concurrent alternation of wobble mo 5 U to cmo 5 U shifts translational selection towards ACG-biased codons. The tRNA pool reverts upon re-aeration.
    Figure Legend Snippet: Proposed mechanism by which dynamic changes in the tRNA pool regulates selective translation of codon-biased transcripts and mycobacterial non-replicating persistence. Under normoxic conditions, translational selection is determined by the tRNA pool wherein highly expressed genes use a subset of optimal codons in accordance with their respective major isoacceptor tRNA levels (such as the codon ACC for Thr and its cognate tRNA Thr GGU in BCG). Conversely, genes using less abundant or rare synonymous codons are expressed to a lesser extent. For instance, tRNA Thr mo5UGU can read the codons ACG, ACA and ACU, diluting available tRNA Thr UGU isoacceptors. Exposure to hypoxia alters the tRNA pool by both affecting both tRNA copy numbers and their modification status. Decreases in specific isoacceptors such as tRNA Thr GGU and tRNA Thr CGU funnel translation towards tRNA Thr UGU decoding. Concurrent alternation of wobble mo 5 U to cmo 5 U shifts translational selection towards ACG-biased codons. The tRNA pool reverts upon re-aeration.

    Techniques Used: Selection, Modification

    19) Product Images from "Label-Free Proteomics Assisted by Affinity Enrichment for Elucidating the Chemical Reactivity of the Liver Mitochondrial Proteome toward Adduction by the Lipid Electrophile 4-hydroxy-2-nonenal (HNE)"

    Article Title: Label-Free Proteomics Assisted by Affinity Enrichment for Elucidating the Chemical Reactivity of the Liver Mitochondrial Proteome toward Adduction by the Lipid Electrophile 4-hydroxy-2-nonenal (HNE)

    Journal: Frontiers in Chemistry

    doi: 10.3389/fchem.2016.00002

    Heatmap visualization of quantitative values of the 182 proteins enriched at the protein level . Left: heatmap of the 182 proteins identified and quantified over all six HNE exposure groups; Right: Zoomed-in region of the heatmap focusing on the most abundantly detected and identified putative HNE protein adducts. After affinity capture, samples were trypsin-digested and analyzed using LC-MS. Protein quantification was based on the peak intensity of the 3 most intense peptides. A total of 182 proteins were quantified. From top to bottom the 182 identified proteins are listed and each row represents a protein and its corresponding abundance. From left to right, HNE concentrations that were used for the in vitro exposure experiments of the mitochondrial protein samples. The color in each cell represents protein abundance obtained from the “Hi3” peptide intensity approach: red is more abundant and dark green is less abundant. Black indicates missing values.
    Figure Legend Snippet: Heatmap visualization of quantitative values of the 182 proteins enriched at the protein level . Left: heatmap of the 182 proteins identified and quantified over all six HNE exposure groups; Right: Zoomed-in region of the heatmap focusing on the most abundantly detected and identified putative HNE protein adducts. After affinity capture, samples were trypsin-digested and analyzed using LC-MS. Protein quantification was based on the peak intensity of the 3 most intense peptides. A total of 182 proteins were quantified. From top to bottom the 182 identified proteins are listed and each row represents a protein and its corresponding abundance. From left to right, HNE concentrations that were used for the in vitro exposure experiments of the mitochondrial protein samples. The color in each cell represents protein abundance obtained from the “Hi3” peptide intensity approach: red is more abundant and dark green is less abundant. Black indicates missing values.

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, In Vitro

    20) Product Images from "ERAP1-ERAP2 dimers trim MHC I-bound precursor peptides; implications for understanding peptide editing"

    Article Title: ERAP1-ERAP2 dimers trim MHC I-bound precursor peptides; implications for understanding peptide editing

    Journal: Scientific Reports

    doi: 10.1038/srep28902

    N-terminal trimming of free and HLA-B*0801-bound (RA) 3 ALRSRYWAI by ERAP1/2. ( a ) Free (RA) 3 ALRSRYWAI 15mer was incubated with ERAP1/2 at 37 °C. An aliquot was taken from the mixture after 1 hour 20 minutes and analyzed by MALDI-TOF MS. ( b ) HLA-B*0801-bound (RA) 3 ALRSRYWAI 15mer was incubated with ERAP1/2 at 37 °C. Aliquots were taken after 2, 6, and 10 hours and analyzed by MALDI-TOF MS. Initially, the enzyme:substrate ratio was as identical as possible in ( a , b ), but additional ERAP1/2 was added in ( b ) after 2 and 6 hours. The starting precursor peptides and their fragments are identified. See also Supplementary Fig. 1 for (RA) 2 ALRSRYWAI 13mer, and Supplementary Fig. 2 and 3 for (RA) n AAKKKYKL series.
    Figure Legend Snippet: N-terminal trimming of free and HLA-B*0801-bound (RA) 3 ALRSRYWAI by ERAP1/2. ( a ) Free (RA) 3 ALRSRYWAI 15mer was incubated with ERAP1/2 at 37 °C. An aliquot was taken from the mixture after 1 hour 20 minutes and analyzed by MALDI-TOF MS. ( b ) HLA-B*0801-bound (RA) 3 ALRSRYWAI 15mer was incubated with ERAP1/2 at 37 °C. Aliquots were taken after 2, 6, and 10 hours and analyzed by MALDI-TOF MS. Initially, the enzyme:substrate ratio was as identical as possible in ( a , b ), but additional ERAP1/2 was added in ( b ) after 2 and 6 hours. The starting precursor peptides and their fragments are identified. See also Supplementary Fig. 1 for (RA) 2 ALRSRYWAI 13mer, and Supplementary Fig. 2 and 3 for (RA) n AAKKKYKL series.

    Techniques Used: Incubation, Mass Spectrometry

    Characterization of HLA-B*0801/precursor complexes. ( a ) MALDI-TOF MS analysis of HLA-B*0801/(RA) 3 ALRSRYWAI and HLA-B*0801/(RA) 3 AAKKKYKL complexes shows peaks corresponding to (RA) 3 ALRSRYWAI 15mer ( m/z = 1817) and (RA) 3 AAKKKYKL 14mer ( m/z = 1631) ligands. ( b ) Ni-NTA agarose beads were used in the capture of Ad4 E3-19K(His) 6 (lane 1), HLA-B*0801/ALRSRYWAI (lane 2), HLA-B*0801/(His) 6 ALRSRYWAI (lane 3), HLA-B*0801/AAKKKYKL (lane 4), and HLA-B*0801/(His) 6 AAKKKYKL (lane 5). The supernatants of the pelleted, washed, and boiled beads were loaded on SDS-PAGE gel (15%).
    Figure Legend Snippet: Characterization of HLA-B*0801/precursor complexes. ( a ) MALDI-TOF MS analysis of HLA-B*0801/(RA) 3 ALRSRYWAI and HLA-B*0801/(RA) 3 AAKKKYKL complexes shows peaks corresponding to (RA) 3 ALRSRYWAI 15mer ( m/z = 1817) and (RA) 3 AAKKKYKL 14mer ( m/z = 1631) ligands. ( b ) Ni-NTA agarose beads were used in the capture of Ad4 E3-19K(His) 6 (lane 1), HLA-B*0801/ALRSRYWAI (lane 2), HLA-B*0801/(His) 6 ALRSRYWAI (lane 3), HLA-B*0801/AAKKKYKL (lane 4), and HLA-B*0801/(His) 6 AAKKKYKL (lane 5). The supernatants of the pelleted, washed, and boiled beads were loaded on SDS-PAGE gel (15%).

    Techniques Used: Mass Spectrometry, SDS Page

    21) Product Images from "Identification of lipopeptides in Bacillus megaterium by two-step ultrafiltration and LC–ESI–MS/MS"

    Article Title: Identification of lipopeptides in Bacillus megaterium by two-step ultrafiltration and LC–ESI–MS/MS

    Journal: AMB Express

    doi: 10.1186/s13568-016-0252-6

    Basic structures of representative members and diversity within the three lipopeptide families. a Basic structures of surfactin. b Basic structures of iturin. c Basic structures of fengycin A. d Basic structures of fengycin B
    Figure Legend Snippet: Basic structures of representative members and diversity within the three lipopeptide families. a Basic structures of surfactin. b Basic structures of iturin. c Basic structures of fengycin A. d Basic structures of fengycin B

    Techniques Used:

    22) Product Images from "Quantitative in vivo Analyses Reveal Calcium-dependent Phosphorylation Sites and Identifies a Novel Component of the Toxoplasma Invasion Motor Complex"

    Article Title: Quantitative in vivo Analyses Reveal Calcium-dependent Phosphorylation Sites and Identifies a Novel Component of the Toxoplasma Invasion Motor Complex

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1002222

    Quantification of calcium-dependent regulation of phosphorylation sites of Toxoplasma invasion motor complex components. A ) Work flow to identify individual phosphorylation sites and quantitatively assess their responsiveness to calcium signals using a SILAC-based proteomics approach. A 1∶1 mixture of Triton X-100 lysates from “Heavy” (H; Arg4/Lys8)-labeled ethanol-stimulated tachyzoites or
    Figure Legend Snippet: Quantification of calcium-dependent regulation of phosphorylation sites of Toxoplasma invasion motor complex components. A ) Work flow to identify individual phosphorylation sites and quantitatively assess their responsiveness to calcium signals using a SILAC-based proteomics approach. A 1∶1 mixture of Triton X-100 lysates from “Heavy” (H; Arg4/Lys8)-labeled ethanol-stimulated tachyzoites or "Light" (L; Arg0/Lys0)-labeled non-stimulated parasites was generated, and a TiO 2 -enriched phosphopeptide sample of H/L-labeled Toxoplasma invasion motor complexes was prepared and analysed by LC-MS/MS on an LTQ-Orbitrap instrument. Mascot and MaxQuant search engines facilitated subsequent manual identification, phosphosite localization and quantification of proteins or peptides as detailed in materials and mathods. B ) Sypro Ruby-stained SDS-PAGE separation of the relative amounts of light (lane 1) or heavy (lane 2) Triton X-100 whole protein extracts are shown. Intact tachyzoite invasion motor complexes comprising the five major components MyoA, GAP50, GAP45 and MLC1 were precipitated from a 1∶1 H/L mixture by GAP45-specific immuno-affinity chromatography (lane 3).

    Techniques Used: Flow Cytometry, Labeling, Generated, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Staining, SDS Page, Affinity Chromatography

    23) Product Images from "Function of the CysD domain of the gel-forming MUC2 mucin"

    Article Title: Function of the CysD domain of the gel-forming MUC2 mucin

    Journal: Biochemical Journal

    doi: 10.1042/BJ20102066

    LC-ESI MS/MS analysis of the CysD peptide with a C-mannosylation motif A CysD-IgG-containing band from a non-reduced SDS gel was excised, in-gel digested with Asp-N and analysed by LC-ESI MS/MS. CID-fragmentation spectra of the CysD peptide DLSSPCVPLCNWTGWL in ( A ) with an intact disulfide bridge and in ( B ) after reduction with TCEP-HCl. Both fragmentation spectra showed the absence of C-mannosylation on the first tryptophan residue of the WXXW peptide motif.
    Figure Legend Snippet: LC-ESI MS/MS analysis of the CysD peptide with a C-mannosylation motif A CysD-IgG-containing band from a non-reduced SDS gel was excised, in-gel digested with Asp-N and analysed by LC-ESI MS/MS. CID-fragmentation spectra of the CysD peptide DLSSPCVPLCNWTGWL in ( A ) with an intact disulfide bridge and in ( B ) after reduction with TCEP-HCl. Both fragmentation spectra showed the absence of C-mannosylation on the first tryptophan residue of the WXXW peptide motif.

    Techniques Used: Mass Spectrometry, SDS-Gel

    24) Product Images from "Homeodomain-Interacting Protein Kinase 1 Modulates Daxx Localization, Phosphorylation, and Transcriptional Activity"

    Article Title: Homeodomain-Interacting Protein Kinase 1 Modulates Daxx Localization, Phosphorylation, and Transcriptional Activity

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.23.3.950-960.2003

    HIPK1 interacts with Daxx in vivo and in vitro. (A) Endogenous HIPK1 was immunoprecipitated (IP) with anti-HIPK1 or a control antibody from 293 cell nuclear lysates. The immunoprecipitates were Western blotted, and the blots were probed with anti-HIPK1 antibody (upper panel) or anti-Daxx antibody (lower panel). (B) Daxx was immunoprecipitated with anti-Daxx antibody from 293 cells expressing an empty vector (pβ), pCAGGS/Daxx (Daxx), pβ/HIPK1 (HIPK1), or pCAGGS/Daxx and pβ/HIPK1 together (Daxx/HIPK1). Daxx immunoprecipitates were Western blotted, and the blots were probed with anti-HIPK1 antibody. (C) 35 S-radiolabeled HIPK1 and MEK1 proteins (left panel, autoradiogram) were incubated with GST or Daxx-GST fusion proteins (center panel, colloidal blue-stained gel), and the pulled-down protein aggregates were evaluated by SDS-PAGE (right panel, autoradiogram). Numbers indicate the relative migration of protein molecular size standards (in kilodaltons).
    Figure Legend Snippet: HIPK1 interacts with Daxx in vivo and in vitro. (A) Endogenous HIPK1 was immunoprecipitated (IP) with anti-HIPK1 or a control antibody from 293 cell nuclear lysates. The immunoprecipitates were Western blotted, and the blots were probed with anti-HIPK1 antibody (upper panel) or anti-Daxx antibody (lower panel). (B) Daxx was immunoprecipitated with anti-Daxx antibody from 293 cells expressing an empty vector (pβ), pCAGGS/Daxx (Daxx), pβ/HIPK1 (HIPK1), or pCAGGS/Daxx and pβ/HIPK1 together (Daxx/HIPK1). Daxx immunoprecipitates were Western blotted, and the blots were probed with anti-HIPK1 antibody. (C) 35 S-radiolabeled HIPK1 and MEK1 proteins (left panel, autoradiogram) were incubated with GST or Daxx-GST fusion proteins (center panel, colloidal blue-stained gel), and the pulled-down protein aggregates were evaluated by SDS-PAGE (right panel, autoradiogram). Numbers indicate the relative migration of protein molecular size standards (in kilodaltons).

    Techniques Used: In Vivo, In Vitro, Immunoprecipitation, Western Blot, Expressing, Plasmid Preparation, Incubation, Staining, SDS Page, Migration

    25) Product Images from "TSLP Signaling Network Revealed by SILAC-Based Phosphoproteomics *"

    Article Title: TSLP Signaling Network Revealed by SILAC-Based Phosphoproteomics *

    Journal: Molecular & Cellular Proteomics : MCP

    doi: 10.1074/mcp.M112.017764

    Overlap of phosphopeptides and phosphosites identified from antiphosphotyrosine- and TiO 2 -based phosphopeptides enrichment methods. A–C , Overlap of identified ( A ) phosphoserine (pSer)-, ( B ) phosphothreonine (pThr)- and ( C ) phosphotyrosine (pTyr)-containing peptides from antiphosphotyrosine- and TiO2-based phosphopeptides enrichment methods; D–F , Overlap of identified ( D ) pSer ( B ) pThr and ( C ) pTyr sites from anti-phosphotyrosine- and TiO2-based phosphopeptides enrichment methods.
    Figure Legend Snippet: Overlap of phosphopeptides and phosphosites identified from antiphosphotyrosine- and TiO 2 -based phosphopeptides enrichment methods. A–C , Overlap of identified ( A ) phosphoserine (pSer)-, ( B ) phosphothreonine (pThr)- and ( C ) phosphotyrosine (pTyr)-containing peptides from antiphosphotyrosine- and TiO2-based phosphopeptides enrichment methods; D–F , Overlap of identified ( D ) pSer ( B ) pThr and ( C ) pTyr sites from anti-phosphotyrosine- and TiO2-based phosphopeptides enrichment methods.

    Techniques Used:

    26) Product Images from "Mitochondria targeting of non-peroxidizable triphenylphosphonium conjugated oleic acid protects mouse embryonic cells against apoptosis: Role of cardiolipin remodeling"

    Article Title: Mitochondria targeting of non-peroxidizable triphenylphosphonium conjugated oleic acid protects mouse embryonic cells against apoptosis: Role of cardiolipin remodeling

    Journal: Febs Letters

    doi: 10.1016/j.febslet.2011.12.016

    LC/MS analysis of TPP- C18:1 and its hydrolysis product, TPP, in mitochondria of MEC
    Figure Legend Snippet: LC/MS analysis of TPP- C18:1 and its hydrolysis product, TPP, in mitochondria of MEC

    Techniques Used: Liquid Chromatography with Mass Spectroscopy

    27) Product Images from "Multiple Functions of Glutamate Uptake via Meningococcal GltT-GltM l-Glutamate ABC Transporter in Neisseria meningitidis Internalization into Human Brain Microvascular Endothelial Cells"

    Article Title: Multiple Functions of Glutamate Uptake via Meningococcal GltT-GltM l-Glutamate ABC Transporter in Neisseria meningitidis Internalization into Human Brain Microvascular Endothelial Cells

    Journal: Infection and Immunity

    doi: 10.1128/IAI.00654-15

    The Δ gltT Δ gltM invasion defect was observed only under physiological glutamate conditions and only at higher MOIs. Shown are adherence (A), internalization (B), and the internalization/adhesion ratio (percent internalized) (C) of N. meningitidis wild-type (HT1125) and Δ gltT Δ gltM (HT1414) strains in AM, AM(−S), and AM(−S, −G) with 500 μM glutamate [AM(−S, +Glu)] at MOIs of 5, 50, and 500. Internalized bacteria were determined as bacteria recovered after gentamicin treatment. Each value is the mean and standard deviation of the mean (CFU per 10 4 cells) from the results of at least four experiments. The open and solid bars indicate the numbers of HT1125 and HT1414 bacteria, respectively. Statistical analyses were performed with a two-tailed Student t test; *, P
    Figure Legend Snippet: The Δ gltT Δ gltM invasion defect was observed only under physiological glutamate conditions and only at higher MOIs. Shown are adherence (A), internalization (B), and the internalization/adhesion ratio (percent internalized) (C) of N. meningitidis wild-type (HT1125) and Δ gltT Δ gltM (HT1414) strains in AM, AM(−S), and AM(−S, −G) with 500 μM glutamate [AM(−S, +Glu)] at MOIs of 5, 50, and 500. Internalized bacteria were determined as bacteria recovered after gentamicin treatment. Each value is the mean and standard deviation of the mean (CFU per 10 4 cells) from the results of at least four experiments. The open and solid bars indicate the numbers of HT1125 and HT1414 bacteria, respectively. Statistical analyses were performed with a two-tailed Student t test; *, P

    Techniques Used: Standard Deviation, Two Tailed Test

    Percent survival of intracellular bacteria after killing of extracellular bacteria with gentamicin. (Top) Protocol to monitor the number of intracellular bacteria after a 2-hour infection. Gen, gentamicin. The detailed procedures are described in Materials and Methods. (Bottom) Percent survival of intracellular bacteria in HBMEC. The percent survival was calculated as follows: (CFU at indicated time/CFU at removal of gentamicin) × 100. The symbols indicate the survival percentages of the HT1125, HT1414, and HT1876 N. meningitidis strains. The error bars represent the standard deviations of the means from the results of at least five experiments. Statistical analyses were performed with a two-tailed Student t test; *, P
    Figure Legend Snippet: Percent survival of intracellular bacteria after killing of extracellular bacteria with gentamicin. (Top) Protocol to monitor the number of intracellular bacteria after a 2-hour infection. Gen, gentamicin. The detailed procedures are described in Materials and Methods. (Bottom) Percent survival of intracellular bacteria in HBMEC. The percent survival was calculated as follows: (CFU at indicated time/CFU at removal of gentamicin) × 100. The symbols indicate the survival percentages of the HT1125, HT1414, and HT1876 N. meningitidis strains. The error bars represent the standard deviations of the means from the results of at least five experiments. Statistical analyses were performed with a two-tailed Student t test; *, P

    Techniques Used: Infection, Two Tailed Test

    Glutathione production contributes to meningococcal survival in HBMEC. Shown are adherence (A and D), internalization (B and E), and the internalization/adhesion ratio (percent internalized) (C and F) of wild-type (HT1125), Δ gltT Δ gltM (HT1414), and Δ gshB (HT1876) N. meningitidis strains in HBMEC examined in AM (A to C) or AM(−S) (D to F). The numbers of bacteria were measured as CFU. Internalized bacteria were determined as bacteria recovered after gentamicin treatment. Each value is the mean and standard deviation of the mean (CFU per 10 4 cells) from the results of at least four experiments. The open, solid, and gray bars indicate the numbers of HT1125, HT1414, and HT1876 bacteria, respectively. Statistical analyses were performed with a two-tailed Student t test; N.S., nonsignificant; *, P
    Figure Legend Snippet: Glutathione production contributes to meningococcal survival in HBMEC. Shown are adherence (A and D), internalization (B and E), and the internalization/adhesion ratio (percent internalized) (C and F) of wild-type (HT1125), Δ gltT Δ gltM (HT1414), and Δ gshB (HT1876) N. meningitidis strains in HBMEC examined in AM (A to C) or AM(−S) (D to F). The numbers of bacteria were measured as CFU. Internalized bacteria were determined as bacteria recovered after gentamicin treatment. Each value is the mean and standard deviation of the mean (CFU per 10 4 cells) from the results of at least four experiments. The open, solid, and gray bars indicate the numbers of HT1125, HT1414, and HT1876 bacteria, respectively. Statistical analyses were performed with a two-tailed Student t test; N.S., nonsignificant; *, P

    Techniques Used: Standard Deviation, Two Tailed Test

    28) Product Images from "A genomics-led approach to deciphering the mechanism of thiotetronate antibiotic biosynthesis genomics-led approach to deciphering the mechanism of thiotetronate antibiotic biosynthesis †Electronic supplementary information (ESI) available: Fig. S1–S21; Tables S1–S5, full experimental details and procedures. See DOI: 10.1039/c5sc03059eClick here for additional data file."

    Article Title: A genomics-led approach to deciphering the mechanism of thiotetronate antibiotic biosynthesis genomics-led approach to deciphering the mechanism of thiotetronate antibiotic biosynthesis †Electronic supplementary information (ESI) available: Fig. S1–S21; Tables S1–S5, full experimental details and procedures. See DOI: 10.1039/c5sc03059eClick here for additional data file.

    Journal: Chemical Science

    doi: 10.1039/c5sc03059e

    HPLC-UV, LC-ESI-HRMS and MS–MS analysis of P450 deletion mutants from both Tü 3010 and thiolactomycin (TLM) biosynthetic pathways. (A) HPLC trace profiles (UV 238 nm ) of extracts from S. thiolactonus wild-type strain NRRL 15439 and mutants ΔstuD1 and ΔstuD2, the Lentzea sp. wild-type strain ATCC31319 and ΔtlmD1 mutant. Separation was achieved as described in the materials and methods section. Production of Tü 3010 (retention time 8.39 min) was abolished in both P450 ( stuD1 and stuD2 ) mutants, although the ΔstuD2 mutant produced a new UV-absorbing peak (retention time 10.93 min). Thiolactomycin (retention time 27.14 min) production was lost, with no obvious new UV-absorbing peak, upon disruption of tlmD1 . (B) Further LC-ESI-HRMS analysis of the ΔstuD2 intermediate by selective ion monitoring confirmed it as thiotetromycin ( 2 ) (Fig. S20 † ). Asterisk denotes not detected.
    Figure Legend Snippet: HPLC-UV, LC-ESI-HRMS and MS–MS analysis of P450 deletion mutants from both Tü 3010 and thiolactomycin (TLM) biosynthetic pathways. (A) HPLC trace profiles (UV 238 nm ) of extracts from S. thiolactonus wild-type strain NRRL 15439 and mutants ΔstuD1 and ΔstuD2, the Lentzea sp. wild-type strain ATCC31319 and ΔtlmD1 mutant. Separation was achieved as described in the materials and methods section. Production of Tü 3010 (retention time 8.39 min) was abolished in both P450 ( stuD1 and stuD2 ) mutants, although the ΔstuD2 mutant produced a new UV-absorbing peak (retention time 10.93 min). Thiolactomycin (retention time 27.14 min) production was lost, with no obvious new UV-absorbing peak, upon disruption of tlmD1 . (B) Further LC-ESI-HRMS analysis of the ΔstuD2 intermediate by selective ion monitoring confirmed it as thiotetromycin ( 2 ) (Fig. S20 † ). Asterisk denotes not detected.

    Techniques Used: High Performance Liquid Chromatography, Mass Spectrometry, Mutagenesis, Produced

    29) Product Images from "CYP3A4 Mediates Growth of Estrogen Receptor-positive Breast Cancer Cells in Part by Inducing Nuclear Translocation of Phospho-Stat3 through Biosynthesis of (?)-14,15-Epoxyeicosatrienoic Acid (EET) *"

    Article Title: CYP3A4 Mediates Growth of Estrogen Receptor-positive Breast Cancer Cells in Part by Inducing Nuclear Translocation of Phospho-Stat3 through Biosynthesis of (?)-14,15-Epoxyeicosatrienoic Acid (EET) *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M110.198515

    CYP3A4 synthesizes EETs in vitro and in the MCF7 line. Insect microsomes expressing human CYP3A4 and control insect microsomes lacking CYP3A4 expression were incubated with AA in the presence and absence of NADPH for 30 min, and the reaction products were monitored by LC-ESI/SIM/MS. A, left panels , chromatograms of the CYP3A4 reaction products in the presence and absence of NADPH are shown. Peaks are normalized to the highest peak in each chromatogram, and peak areas are therefore not directly comparable between profiles. The profile of control insect microsomes incubated with AA exhibited negligible levels of EET products (data not shown). Synthetic EET and HETE chromatography standards were used to determine the retention time for each eicosanoid, permitting product identification ( bottom chromatogram ). A, right panel , turnover numbers for CYP3A4-mediated synthesis of EETs and HETEs from AA was determined by quantitative LC-ESI/MRM/MS. The results presented are mean ± S.D. of measurements performed in triplicate. B , CYP3A4 synthesizes EETs from AA with regio- and stereoselective bias. Microsomal recombinant human CYP3A4-mediated AA metabolism products were monitored by chiral LC-ECAPCI/MRM/MS. The enantiomeric bias observed indicates that the EET production is enzymatic. The results represent mean ± S.D. of measurements in triplicate. C , CYP3A4 siRNA reduces endogenous synthesis of EETs in the MCF7 line. EETs were quantified in CYP3A4 siRNA-treated MCF7 cells by LC-ESI/MRM/MS. A representative chromatogram and corresponding parent to product ion transitions monitored are presented ( left panel ). The results represent the mean ± S.D. of independent three experiments (*, p
    Figure Legend Snippet: CYP3A4 synthesizes EETs in vitro and in the MCF7 line. Insect microsomes expressing human CYP3A4 and control insect microsomes lacking CYP3A4 expression were incubated with AA in the presence and absence of NADPH for 30 min, and the reaction products were monitored by LC-ESI/SIM/MS. A, left panels , chromatograms of the CYP3A4 reaction products in the presence and absence of NADPH are shown. Peaks are normalized to the highest peak in each chromatogram, and peak areas are therefore not directly comparable between profiles. The profile of control insect microsomes incubated with AA exhibited negligible levels of EET products (data not shown). Synthetic EET and HETE chromatography standards were used to determine the retention time for each eicosanoid, permitting product identification ( bottom chromatogram ). A, right panel , turnover numbers for CYP3A4-mediated synthesis of EETs and HETEs from AA was determined by quantitative LC-ESI/MRM/MS. The results presented are mean ± S.D. of measurements performed in triplicate. B , CYP3A4 synthesizes EETs from AA with regio- and stereoselective bias. Microsomal recombinant human CYP3A4-mediated AA metabolism products were monitored by chiral LC-ECAPCI/MRM/MS. The enantiomeric bias observed indicates that the EET production is enzymatic. The results represent mean ± S.D. of measurements in triplicate. C , CYP3A4 siRNA reduces endogenous synthesis of EETs in the MCF7 line. EETs were quantified in CYP3A4 siRNA-treated MCF7 cells by LC-ESI/MRM/MS. A representative chromatogram and corresponding parent to product ion transitions monitored are presented ( left panel ). The results represent the mean ± S.D. of independent three experiments (*, p

    Techniques Used: In Vitro, Expressing, Incubation, Mass Spectrometry, Chromatography, Recombinant

    30) Product Images from "JMJD1A is a signal-sensing scaffold that regulates acute chromatin dynamics via SWI/SNF association for thermogenesis"

    Article Title: JMJD1A is a signal-sensing scaffold that regulates acute chromatin dynamics via SWI/SNF association for thermogenesis

    Journal: Nature Communications

    doi: 10.1038/ncomms8052

    Phosphorylation of JMJD1A at S265 is crucial for β-adrenergic-induced gene transcriptions. ( a ) ISO-induced Adrb1 and Ucp1 mRNA levels in iBAT sh s stably expressing WT- or S265A-hJMJD1A or empty vector were measured by RT-qPCR. The mRNA values are depicted relative to mRNA in iBAT sh s transduced with empty vector on day 8 of differentiation before ISO treatment (0 h), which are arbitrarily defined as 1. ( b ) Adrb1 and Ucp1 mRNA levels in WT or serine to alanine mutants (S264A, S265A, S341A or, 3SA) JMJD1A expressing iBAT sh s measured by RT-qPCR after 1 h ISO treatment (top panel). 3SA represents all three mutations of S264A, S265A and S341A. Data were presented as fold change relative to WT-hJMJD1A-iBAT sh s after normalized to cyclophilin. Immunoblot (IB) analysis for WT and various mutant JMJD1A proteins and Oil Red O (ORO) staining (bottom panel). ( c ) Schematic representation of the domain architecture of hJMJD1A. Phosphorylation site at S265 and Fe(II) binding site at H1120 are shown. ( d ) Comparable ISO-induced gene expressions of Adrb1 and Ucp1 in WT and demethylase dead JMJD1A mutants expressing iBAT sh s. RT-qPCR was performed to quantify mRNA levels of Adrb1 and Ucp1 genes in WT-, H1120Y- or H1120F-hJMJD1A- iBAT sh s treated with ISO for 1 h (top panel). Data were presented as fold change relative to WT-hJMJD1A-iBAT sh s. IB analysis and ORO in the indicated iBATs (bottom panel). Data are presented as mean±s.e.m. of three technical replicates ( a , b , d ) (error bars are too tiny to see in some figures). Uncropped images of the blots ( b , d ) are shown in Supplementary Fig. 11 .
    Figure Legend Snippet: Phosphorylation of JMJD1A at S265 is crucial for β-adrenergic-induced gene transcriptions. ( a ) ISO-induced Adrb1 and Ucp1 mRNA levels in iBAT sh s stably expressing WT- or S265A-hJMJD1A or empty vector were measured by RT-qPCR. The mRNA values are depicted relative to mRNA in iBAT sh s transduced with empty vector on day 8 of differentiation before ISO treatment (0 h), which are arbitrarily defined as 1. ( b ) Adrb1 and Ucp1 mRNA levels in WT or serine to alanine mutants (S264A, S265A, S341A or, 3SA) JMJD1A expressing iBAT sh s measured by RT-qPCR after 1 h ISO treatment (top panel). 3SA represents all three mutations of S264A, S265A and S341A. Data were presented as fold change relative to WT-hJMJD1A-iBAT sh s after normalized to cyclophilin. Immunoblot (IB) analysis for WT and various mutant JMJD1A proteins and Oil Red O (ORO) staining (bottom panel). ( c ) Schematic representation of the domain architecture of hJMJD1A. Phosphorylation site at S265 and Fe(II) binding site at H1120 are shown. ( d ) Comparable ISO-induced gene expressions of Adrb1 and Ucp1 in WT and demethylase dead JMJD1A mutants expressing iBAT sh s. RT-qPCR was performed to quantify mRNA levels of Adrb1 and Ucp1 genes in WT-, H1120Y- or H1120F-hJMJD1A- iBAT sh s treated with ISO for 1 h (top panel). Data were presented as fold change relative to WT-hJMJD1A-iBAT sh s. IB analysis and ORO in the indicated iBATs (bottom panel). Data are presented as mean±s.e.m. of three technical replicates ( a , b , d ) (error bars are too tiny to see in some figures). Uncropped images of the blots ( b , d ) are shown in Supplementary Fig. 11 .

    Techniques Used: Stable Transfection, Expressing, Plasmid Preparation, Quantitative RT-PCR, Transduction, Mutagenesis, Staining, Binding Assay

    P-S265-JMJD1A induces enhancer–promoter interaction in response to β-adrenergic signalling in brown adipose tissue of mice in vivo . ( a , b ) Immunoblot (IB) analyses for P-JMJD1A proteins in the brown adipose tissue from 14-week-old C57BL/6J mice treated with ISO (10 mg kg −1 , by subcutaneous (s.c.) injection) for 4 h ( a ) or 12-week-old C57BL/6J mice placed at 25 or 4 °C for 6 h ( b ). Whole-cell extracts from brown adipose tissue were subjected to immunoprecipitation (IP) followed by IB analysis. ( c – e ) Dynamic changes in higher-order chromatin conformation of the Adrb1 locus in brown adipose tissue of ISO-induced and cold-exposed mice. 3C-qPCR analysis was performed with the anchor point fixed near the Adrb1 gene in brown adipose tissue of Jmjd1a+/+ mice injected with ISO (10 mg kg −1 , by s.c. injection) for 4 h ( c ) or exposed to 28 or 4 °C for 6 h ( d ), or Jmjd1a+/+ and Jmjd1a−/− mice exposed to 28 or 4 °C for 6 h ( e ) as described in Fig. 6a–d . Error bars represent±s.e.m. of three independent experiments. Student's t -test was performed for comparisons in c and d , and analysis of variance were performed followed by Tukey's post hoc comparison in e . * P
    Figure Legend Snippet: P-S265-JMJD1A induces enhancer–promoter interaction in response to β-adrenergic signalling in brown adipose tissue of mice in vivo . ( a , b ) Immunoblot (IB) analyses for P-JMJD1A proteins in the brown adipose tissue from 14-week-old C57BL/6J mice treated with ISO (10 mg kg −1 , by subcutaneous (s.c.) injection) for 4 h ( a ) or 12-week-old C57BL/6J mice placed at 25 or 4 °C for 6 h ( b ). Whole-cell extracts from brown adipose tissue were subjected to immunoprecipitation (IP) followed by IB analysis. ( c – e ) Dynamic changes in higher-order chromatin conformation of the Adrb1 locus in brown adipose tissue of ISO-induced and cold-exposed mice. 3C-qPCR analysis was performed with the anchor point fixed near the Adrb1 gene in brown adipose tissue of Jmjd1a+/+ mice injected with ISO (10 mg kg −1 , by s.c. injection) for 4 h ( c ) or exposed to 28 or 4 °C for 6 h ( d ), or Jmjd1a+/+ and Jmjd1a−/− mice exposed to 28 or 4 °C for 6 h ( e ) as described in Fig. 6a–d . Error bars represent±s.e.m. of three independent experiments. Student's t -test was performed for comparisons in c and d , and analysis of variance were performed followed by Tukey's post hoc comparison in e . * P

    Techniques Used: Mouse Assay, In Vivo, Injection, Immunoprecipitation, Real-time Polymerase Chain Reaction

    JMJD1A is phosphorylated at serine 265 by PKA. ( a ) Post-translational modifications of JMJD1A identified by mass spectrometry. JMJD1A protein in ISO-treated HeLa cells were immunoprecipitated with anti-hJMJD1A antibody (IgG-F0026), separated by SDS–PAGE gel, stained with SYPRO Ruby and then subjected to in-gel digestion for mass spectrometry (left panel). MS/MS spectrum of the P-JMJD1A fragment from K263 to K274, m/z =672.312 ( Z =2) is shown in the right panel. ( b ) The PKA consensus site is conserved in various species. ( c ) In vitro PKA kinase assay. WT, S264, S265A or S264A/S265A mutated JMJD1A (a.a. 1–300) recombinant GST-fusion proteins were PKA-treated and subjected to Phos-tag SDS–PAGE followed by immunoblot (IB) analysis with anti-GST antibody. ( d ) ISO-induced JMJD1A phosphorylation at S265. Whole-cell lysates from WT- or S265A-hJMJD1A expressing iBAT sh s (day 8) treated with ISO (10 μM for 1 h) were subjected to immunoprecipitation (IP) using anti-mJMJD1A (IgG-F0618) followed by IB analysis with anti-P-S265-JMJD1A. ( e ) IB analysis showing PKA-mediated phosphorylation of native JMJD1A at S265. iBATs (day 8) were pretreated with PKA inhibitor H89 (20 μM) for 20 min and then treated with ISO (10 μM) for 1 h. Whole-cell lysates were subjected to IP using anti-mJMJD1A (IgG-F0618) and IB analysis with anti-P-S265-JMJD1A. Uncropped images of the blots ( c – e ) are shown in Supplementary Fig. 11 .
    Figure Legend Snippet: JMJD1A is phosphorylated at serine 265 by PKA. ( a ) Post-translational modifications of JMJD1A identified by mass spectrometry. JMJD1A protein in ISO-treated HeLa cells were immunoprecipitated with anti-hJMJD1A antibody (IgG-F0026), separated by SDS–PAGE gel, stained with SYPRO Ruby and then subjected to in-gel digestion for mass spectrometry (left panel). MS/MS spectrum of the P-JMJD1A fragment from K263 to K274, m/z =672.312 ( Z =2) is shown in the right panel. ( b ) The PKA consensus site is conserved in various species. ( c ) In vitro PKA kinase assay. WT, S264, S265A or S264A/S265A mutated JMJD1A (a.a. 1–300) recombinant GST-fusion proteins were PKA-treated and subjected to Phos-tag SDS–PAGE followed by immunoblot (IB) analysis with anti-GST antibody. ( d ) ISO-induced JMJD1A phosphorylation at S265. Whole-cell lysates from WT- or S265A-hJMJD1A expressing iBAT sh s (day 8) treated with ISO (10 μM for 1 h) were subjected to immunoprecipitation (IP) using anti-mJMJD1A (IgG-F0618) followed by IB analysis with anti-P-S265-JMJD1A. ( e ) IB analysis showing PKA-mediated phosphorylation of native JMJD1A at S265. iBATs (day 8) were pretreated with PKA inhibitor H89 (20 μM) for 20 min and then treated with ISO (10 μM) for 1 h. Whole-cell lysates were subjected to IP using anti-mJMJD1A (IgG-F0618) and IB analysis with anti-P-S265-JMJD1A. Uncropped images of the blots ( c – e ) are shown in Supplementary Fig. 11 .

    Techniques Used: Mass Spectrometry, Immunoprecipitation, SDS Page, Staining, In Vitro, Kinase Assay, Recombinant, Expressing

    Co-localization of JMJD1A–SWI/SNF-PPARγ across Adrb1 and Ucp1 genomic regions. ( a ) ChIP-seq profiles for H3K4me3, H3K27ac, BRG1, ARID1A, PPARγ and JMJD1A and formaldehyde-assisted isolation of regulatory element (FAIRE)-seq open chromatin profile on Adrb1 and Ucp1 genomic regions. iBATs (day 8) were treated with 1 μM ISO or vehicle for 2 h and subjected to ChIP-seq or FAIRE-seq analysis. Light pink shadows highlight the enhancers from H3K27ac ChIP-seq data. JMJD1A, SWI/SNF components (ARID1A and BRG1) and PPARγ co-localized at distal enhances of Adrb1 and Ucp1. Scale bars, 5 kb. ( b – h ) ChIP–qPCR of ISO-induced binding of JMJD1A ( b ), ARID1A ( c ), BRG1 ( d ), PPARγ ( e ), H3ac ( f ), H3K27ac ( g ), C/EPBα ( h ), C/EBPβ ( h ) or C/EBPδ ( h ) on enhancers each of Adrb1 and Ucp1 . Vertical axis represents % input. The experiments in b – h were performed at least three times and the representative one is shown. Error bars represent mean±s.e.m. of three technical replicates.
    Figure Legend Snippet: Co-localization of JMJD1A–SWI/SNF-PPARγ across Adrb1 and Ucp1 genomic regions. ( a ) ChIP-seq profiles for H3K4me3, H3K27ac, BRG1, ARID1A, PPARγ and JMJD1A and formaldehyde-assisted isolation of regulatory element (FAIRE)-seq open chromatin profile on Adrb1 and Ucp1 genomic regions. iBATs (day 8) were treated with 1 μM ISO or vehicle for 2 h and subjected to ChIP-seq or FAIRE-seq analysis. Light pink shadows highlight the enhancers from H3K27ac ChIP-seq data. JMJD1A, SWI/SNF components (ARID1A and BRG1) and PPARγ co-localized at distal enhances of Adrb1 and Ucp1. Scale bars, 5 kb. ( b – h ) ChIP–qPCR of ISO-induced binding of JMJD1A ( b ), ARID1A ( c ), BRG1 ( d ), PPARγ ( e ), H3ac ( f ), H3K27ac ( g ), C/EPBα ( h ), C/EBPβ ( h ) or C/EBPδ ( h ) on enhancers each of Adrb1 and Ucp1 . Vertical axis represents % input. The experiments in b – h were performed at least three times and the representative one is shown. Error bars represent mean±s.e.m. of three technical replicates.

    Techniques Used: Chromatin Immunoprecipitation, Isolation, Real-time Polymerase Chain Reaction, Binding Assay

    Phosphorylation of JMJD1A triggers the interaction with SWI/SNF and PPARγ. ( a , b ) JMJD1A-associated proteins were immunoprecipitated with anti-mJMJD1A antibody (IgG-F0231) from 3T3-L1 cells treated with ISO (10 μM for 1 h), separated by SDS–PAGE gel, stained with SYPRO Ruby and then subjected to in-gel digestion for mass spectrometry ( a , top panel). Identified proteins were shown in b and Supplementary Fig. 4a . P-JMJD1A protein was demonstrated by immunoblot (IB) analysis using anti-phospho-S265-JMJD1A antibody ( a , bottom panel). ( c ) Nuclear extracts from either WT- or S265A-hJMJD1A-iBAT sh s were treated with either ISO (10 μM for 1 h) or vehicle and subjected to immunoprecipitation (IP) with anti-V5 antibody and followed by IB analysis with anti-BRG1, anti-ARID1A or anti-BAF60b. ( d ) ISO-dependent JMJD1A association with PPARγ via ARID1A, BRG1 and BAF60b. WT-hJMJD1A-iBAT sh s were subjected to IP with anti-V5 and followed by IB with anti-PPARγ antibody (IgG-A3409). ( e , f ) S265 phosphorylation is crucial for JMJD1A binding to PPARγ. WT or S265A-hJMJD1A-iBAT sh s were pre-cultured in 0.1% bovine serum albumin containing DMEM for 6 h then treated with ISO (10 μM for 1 h) or vehicle and nuclear extracts from each cells were subjected IP with anti-V5 antibody followed by IB with anti-PPARγ antibody ( e ). The same extracts were also subjected IP with anti-PPARγ antibody followed by IB with either anti-V5 antibody or anti-P-S265-JMJD1A antibody ( f ). ( g , h ) JMJD1A and SWI/SNF complex interaction was functionally linked to gene expressions. Adrb1 and Ucp1 mRNA levels were quantified by RT-qPCR in WT-hJMJD1A-iBAT sh s transfected with control short interfering RNA (siRNA) or two independent siRNAs specifically targeting Arid1a , Brg1 or Baf60b under either ISO-plus (1 μM for 1 h) or minus condition. Data were presented as fold change relative to control siRNA transfected cells under ISO-minus condition. Error bars represent mean±s.e.m. of three technical replicates. The experiments were performed at least three times and the most representative one is shown. ( i ) Schematic drawing of JMJD1A–SWI/SNF–PPARγ complex. P-JMJD1A at S265 induces forming a complex with SWI/SNF chromatin remodeler and TF PPARγ recruited to PPRE ( Fig. 1b ). PPRE, PPAR-responsive element. Uncropped images of the blots ( a , c – f ) are shown in Supplementary Figs 11 and 12 .
    Figure Legend Snippet: Phosphorylation of JMJD1A triggers the interaction with SWI/SNF and PPARγ. ( a , b ) JMJD1A-associated proteins were immunoprecipitated with anti-mJMJD1A antibody (IgG-F0231) from 3T3-L1 cells treated with ISO (10 μM for 1 h), separated by SDS–PAGE gel, stained with SYPRO Ruby and then subjected to in-gel digestion for mass spectrometry ( a , top panel). Identified proteins were shown in b and Supplementary Fig. 4a . P-JMJD1A protein was demonstrated by immunoblot (IB) analysis using anti-phospho-S265-JMJD1A antibody ( a , bottom panel). ( c ) Nuclear extracts from either WT- or S265A-hJMJD1A-iBAT sh s were treated with either ISO (10 μM for 1 h) or vehicle and subjected to immunoprecipitation (IP) with anti-V5 antibody and followed by IB analysis with anti-BRG1, anti-ARID1A or anti-BAF60b. ( d ) ISO-dependent JMJD1A association with PPARγ via ARID1A, BRG1 and BAF60b. WT-hJMJD1A-iBAT sh s were subjected to IP with anti-V5 and followed by IB with anti-PPARγ antibody (IgG-A3409). ( e , f ) S265 phosphorylation is crucial for JMJD1A binding to PPARγ. WT or S265A-hJMJD1A-iBAT sh s were pre-cultured in 0.1% bovine serum albumin containing DMEM for 6 h then treated with ISO (10 μM for 1 h) or vehicle and nuclear extracts from each cells were subjected IP with anti-V5 antibody followed by IB with anti-PPARγ antibody ( e ). The same extracts were also subjected IP with anti-PPARγ antibody followed by IB with either anti-V5 antibody or anti-P-S265-JMJD1A antibody ( f ). ( g , h ) JMJD1A and SWI/SNF complex interaction was functionally linked to gene expressions. Adrb1 and Ucp1 mRNA levels were quantified by RT-qPCR in WT-hJMJD1A-iBAT sh s transfected with control short interfering RNA (siRNA) or two independent siRNAs specifically targeting Arid1a , Brg1 or Baf60b under either ISO-plus (1 μM for 1 h) or minus condition. Data were presented as fold change relative to control siRNA transfected cells under ISO-minus condition. Error bars represent mean±s.e.m. of three technical replicates. The experiments were performed at least three times and the most representative one is shown. ( i ) Schematic drawing of JMJD1A–SWI/SNF–PPARγ complex. P-JMJD1A at S265 induces forming a complex with SWI/SNF chromatin remodeler and TF PPARγ recruited to PPRE ( Fig. 1b ). PPRE, PPAR-responsive element. Uncropped images of the blots ( a , c – f ) are shown in Supplementary Figs 11 and 12 .

    Techniques Used: Immunoprecipitation, SDS Page, Staining, Mass Spectrometry, Binding Assay, Cell Culture, Quantitative RT-PCR, Transfection, Small Interfering RNA

    P-JMJD1A mediates PKA-induced enhancer–promoter interaction at the Adrb1 locus. ( a – d ) 3C-qPCR analysis of the interaction frequency of the restriction fragments with the anchor point fixed near the Adrb1 gene. The grey shadows in a highlight the regions containing E1 and E2 enhancer elements and anchor point. Crosslinked chromatin samples were prepared from differentiated iBATs (day 8) treated with 1 μM ISO or vehicle for 1 h ( a ), treated with 1 μM ISO for the indicated time periods ( b ), from WT- and S265A-hJMJD1A iBAT sh s treated with 20 μM FSK or vehicle for 20 min ( c ) or from differentiated iBATs transfected with control or two independent Brg1 siRNA treated with 20 μM FSK or vehicle for 20 min ( d ). Time course of ISO-induced JMJD1A phosphorylation was determined by immunoprecipitation (IP) followed by immunoblot (IB) analysis ( b , bottom panel). Uncropped images of the blots are shown in Supplementary Fig. 13 . Error bars represent±s.e.m. of three independent experiments. Student's t -test was performed for comparisons in a and analysis of variance were performed followed by Tukey's post hoc comparison in b – d . * P
    Figure Legend Snippet: P-JMJD1A mediates PKA-induced enhancer–promoter interaction at the Adrb1 locus. ( a – d ) 3C-qPCR analysis of the interaction frequency of the restriction fragments with the anchor point fixed near the Adrb1 gene. The grey shadows in a highlight the regions containing E1 and E2 enhancer elements and anchor point. Crosslinked chromatin samples were prepared from differentiated iBATs (day 8) treated with 1 μM ISO or vehicle for 1 h ( a ), treated with 1 μM ISO for the indicated time periods ( b ), from WT- and S265A-hJMJD1A iBAT sh s treated with 20 μM FSK or vehicle for 20 min ( c ) or from differentiated iBATs transfected with control or two independent Brg1 siRNA treated with 20 μM FSK or vehicle for 20 min ( d ). Time course of ISO-induced JMJD1A phosphorylation was determined by immunoprecipitation (IP) followed by immunoblot (IB) analysis ( b , bottom panel). Uncropped images of the blots are shown in Supplementary Fig. 13 . Error bars represent±s.e.m. of three independent experiments. Student's t -test was performed for comparisons in a and analysis of variance were performed followed by Tukey's post hoc comparison in b – d . * P

    Techniques Used: Real-time Polymerase Chain Reaction, Transfection, Immunoprecipitation

    β-Adrenergic-dependent genomic localization of JMJD1A. ( a ) Genome-wide distribution of JMJD1A binding sites in ISO (1 μM for 2 h) treated iBATs. Ups, upstream; dws, downstream; ISO, isoproterenol. ( b ) Table depicting TF binding motifs enriched at constituent enhancers within JMJD1A binding regions relative to genomic background and associated Z -scores. ( c , d ) JMJD1A ChIP-seq and transcriptional microarray analysis performed in iBATs at day 8 of differentiation (day 8). Heatmap represents top 10,000 high SICER scored JMJD1A binding sites under ISO-plus condition (1 μM for 2 h). Colour intensity represents Z -score of JMJD1A binding sites under ISO-minus versus those under ISO-plus condition. The higher the (red/yellow) contrast it becomes, the higher ISO-induced JMJD1A recruitment to the given binding sites relative to ISO-minus. For reference, a colour intensity scale is included ( c , left panel). Venn diagram showing the top 2,000 sites annotated ISO-induced JMJD1A binding and the number of ISO-induced genes > 2 0.8 -fold by ISO (1 μM for 1 h; c , right panel). The overlapping genes were listed in d . ( e ) Genome browser shots showing the ISO-induced JMJD1A recruitments on selected genomic regions analysed by ChIP-seq in iBATs (day 8) treated with ISO (1 μM) or vehicle for 2 h (left panel). mRNA levels of Adrb1 and Ucp1 in iBATs (day 8) after ISO (1 μM) treatment at the indicated time points. Data were presented as fold change relative to 0 h (mean±s.e.m.) of three technical replicates (error bars are too tiny to see; right panel).
    Figure Legend Snippet: β-Adrenergic-dependent genomic localization of JMJD1A. ( a ) Genome-wide distribution of JMJD1A binding sites in ISO (1 μM for 2 h) treated iBATs. Ups, upstream; dws, downstream; ISO, isoproterenol. ( b ) Table depicting TF binding motifs enriched at constituent enhancers within JMJD1A binding regions relative to genomic background and associated Z -scores. ( c , d ) JMJD1A ChIP-seq and transcriptional microarray analysis performed in iBATs at day 8 of differentiation (day 8). Heatmap represents top 10,000 high SICER scored JMJD1A binding sites under ISO-plus condition (1 μM for 2 h). Colour intensity represents Z -score of JMJD1A binding sites under ISO-minus versus those under ISO-plus condition. The higher the (red/yellow) contrast it becomes, the higher ISO-induced JMJD1A recruitment to the given binding sites relative to ISO-minus. For reference, a colour intensity scale is included ( c , left panel). Venn diagram showing the top 2,000 sites annotated ISO-induced JMJD1A binding and the number of ISO-induced genes > 2 0.8 -fold by ISO (1 μM for 1 h; c , right panel). The overlapping genes were listed in d . ( e ) Genome browser shots showing the ISO-induced JMJD1A recruitments on selected genomic regions analysed by ChIP-seq in iBATs (day 8) treated with ISO (1 μM) or vehicle for 2 h (left panel). mRNA levels of Adrb1 and Ucp1 in iBATs (day 8) after ISO (1 μM) treatment at the indicated time points. Data were presented as fold change relative to 0 h (mean±s.e.m.) of three technical replicates (error bars are too tiny to see; right panel).

    Techniques Used: Genome Wide, Binding Assay, Chromatin Immunoprecipitation, Microarray

    31) Product Images from "Identification of 3-Sulfinopropionyl Coenzyme A (CoA) Desulfinases within the Acyl-CoA Dehydrogenase Superfamily"

    Article Title: Identification of 3-Sulfinopropionyl Coenzyme A (CoA) Desulfinases within the Acyl-CoA Dehydrogenase Superfamily

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.01265-13

    Typical mass spectra of butyryl-CoA and butenoyl-CoA. A sample of the dehydrogenase assay mixture with Acd B4 was subjected to HPLC-ESI-MS analysis to verify the presence of the substrate CoA thioester and the formation of the expected dehydrogenated CoA
    Figure Legend Snippet: Typical mass spectra of butyryl-CoA and butenoyl-CoA. A sample of the dehydrogenase assay mixture with Acd B4 was subjected to HPLC-ESI-MS analysis to verify the presence of the substrate CoA thioester and the formation of the expected dehydrogenated CoA

    Techniques Used: Dehydrogenase Assay, High Performance Liquid Chromatography, Mass Spectrometry

    32) Product Images from "A chloroquine-induced macrophage-preconditioning strategy for improved nanodelivery"

    Article Title: A chloroquine-induced macrophage-preconditioning strategy for improved nanodelivery

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-14221-2

    Chloroquine-induced changes in Kupffer cells. ( a ) Microscopy images of chloroquine-induced vacuole formation in live cells. Cells were pretreated with 100 μM of chloroquine. Lysotracker, green. Scale bar, 50 μm (upper), 10 μm (lower). ( b ) Western blot analysis of phosphatidylinositol-binding clathrin assembly protein (PICALM), α-adaptin, and clathrin heavy chain expression in cells. β-actin was used as a loading control. ( c ) Densitometric analysis of western blot results. Results represent the ratio between the protein of interest and β-actin (mean ± s.d. of three samples), and are normalized to control cells. Statistics by Student’s t -test. *** P
    Figure Legend Snippet: Chloroquine-induced changes in Kupffer cells. ( a ) Microscopy images of chloroquine-induced vacuole formation in live cells. Cells were pretreated with 100 μM of chloroquine. Lysotracker, green. Scale bar, 50 μm (upper), 10 μm (lower). ( b ) Western blot analysis of phosphatidylinositol-binding clathrin assembly protein (PICALM), α-adaptin, and clathrin heavy chain expression in cells. β-actin was used as a loading control. ( c ) Densitometric analysis of western blot results. Results represent the ratio between the protein of interest and β-actin (mean ± s.d. of three samples), and are normalized to control cells. Statistics by Student’s t -test. *** P

    Techniques Used: Microscopy, Western Blot, Binding Assay, Expressing

    Effect of chloroquine on nanoparticle uptake in macrophages. ( a ) Viability of Raw 264.7, J774A.1, and Kupffer cells in response to chloroquine and nanoparticles. The left side of the dashed line indicates drug concentrations used in the nanoparticle uptake study. ( b ) Suppression of nanoparticle uptake upon exposure to chloroquine in Raw 264.7, J774A.1, and Kupffer cells. Values are normalized to those of control cells. Data is presented as mean ± s.d. of triplicates. Statistics by Student’s t -test. * P
    Figure Legend Snippet: Effect of chloroquine on nanoparticle uptake in macrophages. ( a ) Viability of Raw 264.7, J774A.1, and Kupffer cells in response to chloroquine and nanoparticles. The left side of the dashed line indicates drug concentrations used in the nanoparticle uptake study. ( b ) Suppression of nanoparticle uptake upon exposure to chloroquine in Raw 264.7, J774A.1, and Kupffer cells. Values are normalized to those of control cells. Data is presented as mean ± s.d. of triplicates. Statistics by Student’s t -test. * P

    Techniques Used:

    Effect of chloroquine on nanoparticle uptake in cancer cells. ( a ) Comparison of liposome (non-pegylated) uptake in macrophages (Raw 264.7, J774A.1, and Kupffer cells) and cancer cells (MDA-MB-231 breast cancer cells, MIA PaCa-2 pancreatic cancer cells, H358 lung cancer cells). ( b ) Viability of cancer cells in response to chloroquine and liposomes (6 h). ( c ) Effect of chloroquine on liposome uptake in MDA-MB-231 cells (6 h). Values are normalized to those of control cells. Data is presented as mean ± s.d. of triplicates. Statistics by Student’s t -test. ** P
    Figure Legend Snippet: Effect of chloroquine on nanoparticle uptake in cancer cells. ( a ) Comparison of liposome (non-pegylated) uptake in macrophages (Raw 264.7, J774A.1, and Kupffer cells) and cancer cells (MDA-MB-231 breast cancer cells, MIA PaCa-2 pancreatic cancer cells, H358 lung cancer cells). ( b ) Viability of cancer cells in response to chloroquine and liposomes (6 h). ( c ) Effect of chloroquine on liposome uptake in MDA-MB-231 cells (6 h). Values are normalized to those of control cells. Data is presented as mean ± s.d. of triplicates. Statistics by Student’s t -test. ** P

    Techniques Used: Multiple Displacement Amplification

    Effect of chloroquine on the biodistribution of liposomes. ( a ) Immunofluorescence staining of macrophages in the liver. Athymic nude mice were treated with clodronate liposomes (clodrolip; 50 mg/kg clodronate i.v.) or chloroquine (60 mg/kg/day i.p. for 7 days). DAPI, blue; macrophages (F4/80), green. Scale bar, 50 μm. ( b ) Accumulation of intravenously injected fluorescent liposomes in the plasma, liver, and spleen. The blood was collected and the liver and spleen were harvested 15 min, 3 h, 6 h, or 24 h post-injection of liposomes. ( c,d,e ) Effect of Kupffer cell depletion (clodrolip; 50 mg/kg clodronate) and chloroquine pretreatment (60 mg/kg/day for 7 days) on the biodistribution of fluorescent liposomes. The blood was collected and the organs were harvested 6 h post-injection of liposomes. (c) Detected signal in the plasma, liver, and spleen. ( d ) Plasma/liver and plasma/spleen accumulation ratio of liposomes (g tissue). ( e ) Accumulation of fluorescent liposomes in MDA-MB-231 orthotopic breast cancer tumors. Data is presented as mean ± s.d. ( n = 5). Statistics by Student’s t -test. * P
    Figure Legend Snippet: Effect of chloroquine on the biodistribution of liposomes. ( a ) Immunofluorescence staining of macrophages in the liver. Athymic nude mice were treated with clodronate liposomes (clodrolip; 50 mg/kg clodronate i.v.) or chloroquine (60 mg/kg/day i.p. for 7 days). DAPI, blue; macrophages (F4/80), green. Scale bar, 50 μm. ( b ) Accumulation of intravenously injected fluorescent liposomes in the plasma, liver, and spleen. The blood was collected and the liver and spleen were harvested 15 min, 3 h, 6 h, or 24 h post-injection of liposomes. ( c,d,e ) Effect of Kupffer cell depletion (clodrolip; 50 mg/kg clodronate) and chloroquine pretreatment (60 mg/kg/day for 7 days) on the biodistribution of fluorescent liposomes. The blood was collected and the organs were harvested 6 h post-injection of liposomes. (c) Detected signal in the plasma, liver, and spleen. ( d ) Plasma/liver and plasma/spleen accumulation ratio of liposomes (g tissue). ( e ) Accumulation of fluorescent liposomes in MDA-MB-231 orthotopic breast cancer tumors. Data is presented as mean ± s.d. ( n = 5). Statistics by Student’s t -test. * P

    Techniques Used: Immunofluorescence, Staining, Mouse Assay, Injection, Multiple Displacement Amplification

    Nanoparticle characterization and uptake in macrophages. ( a ) Characterization of nanoparticles. ( b ) Schematic illustration of the various pathways of nanoparticle uptake in macrophages. Inhibitors of specific pathways are shown. Cytochalasin D was used as a broad-spectrum inhibitor of actin-dependent uptake. ( c ) Nanoparticle uptake in macrophages. Suppression of nanoparticle uptake upon exposure to cytochalasin D (bar graph ‘+’) in Raw 264.7, J774A.1, and Kupffer cells. Values are normalized to those of control cells. Data is presented as mean ± s.d. of triplicates. Statistics by Student’s t -test. * P
    Figure Legend Snippet: Nanoparticle characterization and uptake in macrophages. ( a ) Characterization of nanoparticles. ( b ) Schematic illustration of the various pathways of nanoparticle uptake in macrophages. Inhibitors of specific pathways are shown. Cytochalasin D was used as a broad-spectrum inhibitor of actin-dependent uptake. ( c ) Nanoparticle uptake in macrophages. Suppression of nanoparticle uptake upon exposure to cytochalasin D (bar graph ‘+’) in Raw 264.7, J774A.1, and Kupffer cells. Values are normalized to those of control cells. Data is presented as mean ± s.d. of triplicates. Statistics by Student’s t -test. * P

    Techniques Used:

    33) Product Images from "SMYD3-mediated lysine methylation in the PH domain is critical for activation of AKT1"

    Article Title: SMYD3-mediated lysine methylation in the PH domain is critical for activation of AKT1

    Journal: Oncotarget

    doi: 10.18632/oncotarget.11898

    Overexpression of SMYD3 enhances the AKT pathway A, C. 293T cells (A) and HeLa cells (C) were transfected with Mock vector or SMYD3 expression vector (pcDNA3.1-SMYD3) together with wild-type FLAG-AKT1 expression vector (FLAG-AKT1-WT). After 48 hours of incubation, cells were treated with 100 ng/ml of EGF for 5 min, and then lysed with CelLytic™ M mammalian cell lysis/extraction reagent containing a protease inhibitor cocktail and a phosphatase cocktail. The samples were immunoblotted with anti-K14 monomethylated AKT1, anti-phospho AKT (Thr 308), anti-phospho mTOR (Ser 2448), anti-mTOR, anti-SMYD3 and anti-FLAG (internal control) antibodies. B, D. X-ray films examined in (A) and (C) were scanned with GS-800™ calibrated densitometer (Bio-Rad), and the intensity of monomethylated AKT1 (K14), phospho AKT (Thr 308) and phospho mTOR (Ser 2448) in 293T cells (B) and HeLa cells (D) was normalized by each total protein level.
    Figure Legend Snippet: Overexpression of SMYD3 enhances the AKT pathway A, C. 293T cells (A) and HeLa cells (C) were transfected with Mock vector or SMYD3 expression vector (pcDNA3.1-SMYD3) together with wild-type FLAG-AKT1 expression vector (FLAG-AKT1-WT). After 48 hours of incubation, cells were treated with 100 ng/ml of EGF for 5 min, and then lysed with CelLytic™ M mammalian cell lysis/extraction reagent containing a protease inhibitor cocktail and a phosphatase cocktail. The samples were immunoblotted with anti-K14 monomethylated AKT1, anti-phospho AKT (Thr 308), anti-phospho mTOR (Ser 2448), anti-mTOR, anti-SMYD3 and anti-FLAG (internal control) antibodies. B, D. X-ray films examined in (A) and (C) were scanned with GS-800™ calibrated densitometer (Bio-Rad), and the intensity of monomethylated AKT1 (K14), phospho AKT (Thr 308) and phospho mTOR (Ser 2448) in 293T cells (B) and HeLa cells (D) was normalized by each total protein level.

    Techniques Used: Over Expression, Transfection, Plasmid Preparation, Expressing, Incubation, Lysis, Protease Inhibitor

    SMYD3-mediated lysine 14 methylation is critical for AKT1 activation A. 293T cells were transfected with FLAG-tagged wild-type AKT1 (AKT1-WT) or mutant-type AKT1 (AKT1-K14A, AKT1-K30A, AKT1-K39A, AKT1-K14A/K30A, AKT1-K14A/K39A, AKT1-K30A/K39A or AKT1-K14A/K30A/K39A) in the presence of a wild-type SMYD3 expression vector (pcDNA-SMYD3.1-WT). After 48 hours of incubation, cells were treated with 100 ng/ml of EGF, and then lysed with CelLytic™ M mammalian cell lysis/extraction reagent containing a protease inhibitor cocktail and a phosphatase cocktail, followed by immunoprecipitation using anti-FLAG ® M2 affinity gel. Immunoprecipitates were immunoblotted with anti-phospho AKT (Thr 308) and anti-FLAG (internal control) antibodies. B. The three-dimensional coordinate data for AKT1 were derived from the Protein Data Bank (entry code, 4EJN) [ 59 ]. PH domain, activation loop, kinase domain and ATP binding site are described. C. Lysine 14 methylation can conformationally affect threonine 308. Lys 14 is hydrogen-bounding to Glu 17. The distance between the side-chain amino nitrogen atom (Nζ) of Lys 14 and the side-chain carboxyl oxygen atom (Oε2) of Glu 17 is 3.17 Å. Glu 17 is in van der Waals contact with the activation loop (Thr 291 – Glu 314), on which Thr 308 is located. The distance between their closest atoms (the backbone carboxyl oxygen atom of Glu 17 and the side-chain β carbon atom of Phe 309) is 3.35 Å. A part of the activation loop (Asp 302 – Met 306) is missing in the crystal structure. The drawing was created using Molecular Operating Environment (MOE), 2014.09 (Chemical Computing Group Inc., Canada). D. The distance between Lys 14, Lys 30 or Lys 39 in the PH domain and activation loop is described.
    Figure Legend Snippet: SMYD3-mediated lysine 14 methylation is critical for AKT1 activation A. 293T cells were transfected with FLAG-tagged wild-type AKT1 (AKT1-WT) or mutant-type AKT1 (AKT1-K14A, AKT1-K30A, AKT1-K39A, AKT1-K14A/K30A, AKT1-K14A/K39A, AKT1-K30A/K39A or AKT1-K14A/K30A/K39A) in the presence of a wild-type SMYD3 expression vector (pcDNA-SMYD3.1-WT). After 48 hours of incubation, cells were treated with 100 ng/ml of EGF, and then lysed with CelLytic™ M mammalian cell lysis/extraction reagent containing a protease inhibitor cocktail and a phosphatase cocktail, followed by immunoprecipitation using anti-FLAG ® M2 affinity gel. Immunoprecipitates were immunoblotted with anti-phospho AKT (Thr 308) and anti-FLAG (internal control) antibodies. B. The three-dimensional coordinate data for AKT1 were derived from the Protein Data Bank (entry code, 4EJN) [ 59 ]. PH domain, activation loop, kinase domain and ATP binding site are described. C. Lysine 14 methylation can conformationally affect threonine 308. Lys 14 is hydrogen-bounding to Glu 17. The distance between the side-chain amino nitrogen atom (Nζ) of Lys 14 and the side-chain carboxyl oxygen atom (Oε2) of Glu 17 is 3.17 Å. Glu 17 is in van der Waals contact with the activation loop (Thr 291 – Glu 314), on which Thr 308 is located. The distance between their closest atoms (the backbone carboxyl oxygen atom of Glu 17 and the side-chain β carbon atom of Phe 309) is 3.35 Å. A part of the activation loop (Asp 302 – Met 306) is missing in the crystal structure. The drawing was created using Molecular Operating Environment (MOE), 2014.09 (Chemical Computing Group Inc., Canada). D. The distance between Lys 14, Lys 30 or Lys 39 in the PH domain and activation loop is described.

    Techniques Used: Methylation, Activation Assay, Transfection, Mutagenesis, Expressing, Plasmid Preparation, Incubation, Lysis, Protease Inhibitor, Immunoprecipitation, Derivative Assay, Binding Assay

    Validation of methylation on AKT1 at lysine 14 by specific antibody A. The enzyme-linked immunosorbent assay of the anti-monomethyl AKT1 (Lys 14) antibody. A rabbit was immunized with synthetic peptides, including Lys 14 monomethylation, and the affinity purification was carried out against the methylated synthetic peptides. The original serum (S) and the flow through (FT) show equal reactivity against the carrier protein. The purified antibody (PA) shows a stronger reactivity against the methylated peptide than the serum (S). B. Testing of specific antibody (SA) and non-specific antibody (NS) against the unmodified peptide by enzyme-linked immunosorbent assay. C. Validation of the anti-K14 monomethylated AKT1 antibody. Recombinant AKT1 protein or BSA and S-adenosyl-L-methionine were incubated in the presence or absence of recombinant SMYD3, and the reaction products were analyzed by SDS-PAGE, followed by western blot analysis using the anti-K14 monomethylated AKT1 antibody. The nitrocellulose membrane was stained with MemCode™ Reversible Stain Kit after western blot analysis. D. 293T cells were co-transfected with Mock, FLAG-AKT1-WT, FLAG-AKT1-K14A or FLAG-AKT1-K14R together with a wild-type SMYD3 expression vector (pcDNA3.1-SMYD3-WT) or an enzyme-inactive SMYD3 expression (pcDNA3.1-SMYD3-ΔEEL). After 48 hours of incubation, cells were treated with 100 ng/ml of EGF for 5 min, and then lysed with CelLytic™ M mammalian cell lysis/extraction reagent containing a protease inhibitor cocktail and a phosphatase cocktail. The samples were immunoblotted with anti-K14 monomethylated AKT1, anti-phospho AKT (Thr 308) and anti-FLAG antibodies after immunoprecipitating with anti-FLAG ® M2 affinity gel.
    Figure Legend Snippet: Validation of methylation on AKT1 at lysine 14 by specific antibody A. The enzyme-linked immunosorbent assay of the anti-monomethyl AKT1 (Lys 14) antibody. A rabbit was immunized with synthetic peptides, including Lys 14 monomethylation, and the affinity purification was carried out against the methylated synthetic peptides. The original serum (S) and the flow through (FT) show equal reactivity against the carrier protein. The purified antibody (PA) shows a stronger reactivity against the methylated peptide than the serum (S). B. Testing of specific antibody (SA) and non-specific antibody (NS) against the unmodified peptide by enzyme-linked immunosorbent assay. C. Validation of the anti-K14 monomethylated AKT1 antibody. Recombinant AKT1 protein or BSA and S-adenosyl-L-methionine were incubated in the presence or absence of recombinant SMYD3, and the reaction products were analyzed by SDS-PAGE, followed by western blot analysis using the anti-K14 monomethylated AKT1 antibody. The nitrocellulose membrane was stained with MemCode™ Reversible Stain Kit after western blot analysis. D. 293T cells were co-transfected with Mock, FLAG-AKT1-WT, FLAG-AKT1-K14A or FLAG-AKT1-K14R together with a wild-type SMYD3 expression vector (pcDNA3.1-SMYD3-WT) or an enzyme-inactive SMYD3 expression (pcDNA3.1-SMYD3-ΔEEL). After 48 hours of incubation, cells were treated with 100 ng/ml of EGF for 5 min, and then lysed with CelLytic™ M mammalian cell lysis/extraction reagent containing a protease inhibitor cocktail and a phosphatase cocktail. The samples were immunoblotted with anti-K14 monomethylated AKT1, anti-phospho AKT (Thr 308) and anti-FLAG antibodies after immunoprecipitating with anti-FLAG ® M2 affinity gel.

    Techniques Used: Methylation, Enzyme-linked Immunosorbent Assay, Affinity Purification, Flow Cytometry, Purification, Peptide ELISA, Recombinant, Incubation, SDS Page, Western Blot, Staining, Transfection, Expressing, Plasmid Preparation, Lysis, Protease Inhibitor

    Knockdown and enzyme inhibitory of SMYD3 attenuate AKT1 activity A, C. Effects of SMYD3 knockdown on the AKT pathway in SW480 cells (A) and MDA-MB-231 cells (C). Cells were transfected with one control siRNA (siEGFP) or two SMYD3 siRNAs (#1 and #2), and after 72 hours of incubation, cells were treated with 100 ng/ml of EGF (SW480) or 100 ng/ml of NRG1 (MDA-MB-231). Then cells were lysed with CelLytic™ M mammalian cell lysis/extraction reagent containing a protease inhibitor cocktail and a phosphatase cocktail, followed by SDS-PAGE. Western blot analysis was performed using anti-SMYD3, anti-K14 monomethylated AKT1, anti-phospho AKT1 (Thr 308), anti-AKT1, anti-phospho mTOR (Ser 2448), anti-mTOR and anti-α-Tubulin (internal control) antibodies. B, D. X-ray films were scanned with GS-800™ calibrated densitometer (Bio-Rad). The intensity of phosphorylated AKT (Thr 308) and phosphorylated mTOR (Ser 2448) levels in SW480 cells (B) and MDA-MB-231 cells (D) was normalized by each total protein level. E, G. Effects of BCI-121 treatment on the AKT1 activity. SW480 cells (E) and MDA-MB-231 cells (G) were treated with 0, 10 or 50 μM of BCI-121. After 72 hours of incubation, cells were treated with 100 ng/ml of EGF (SW480) or 100 ng/ml of NRG1 (MDA-MB-231), and then lysed with CelLytic™ M mammalian cell lysis/extraction reagent containing a protease inhibitor cocktail and a phosphatase cocktail. Cell extracts were immunoblotted with anti-K14 monomethylated AKT1, anti-phospho AKT (Thr 308), anti-AKT and anti-α-Tubulin (internal control) antibodies. F, H. X-ray films were scanned with GS-800™ calibrated densitometer (Bio-Rad). The intensity of methylated AKT1 (Lys 14) and phosphorylated AKT1 (Thr 308) levels in SW480 cells (F) and MDA-MB-231 cells (H) was normalized by each total protein level.
    Figure Legend Snippet: Knockdown and enzyme inhibitory of SMYD3 attenuate AKT1 activity A, C. Effects of SMYD3 knockdown on the AKT pathway in SW480 cells (A) and MDA-MB-231 cells (C). Cells were transfected with one control siRNA (siEGFP) or two SMYD3 siRNAs (#1 and #2), and after 72 hours of incubation, cells were treated with 100 ng/ml of EGF (SW480) or 100 ng/ml of NRG1 (MDA-MB-231). Then cells were lysed with CelLytic™ M mammalian cell lysis/extraction reagent containing a protease inhibitor cocktail and a phosphatase cocktail, followed by SDS-PAGE. Western blot analysis was performed using anti-SMYD3, anti-K14 monomethylated AKT1, anti-phospho AKT1 (Thr 308), anti-AKT1, anti-phospho mTOR (Ser 2448), anti-mTOR and anti-α-Tubulin (internal control) antibodies. B, D. X-ray films were scanned with GS-800™ calibrated densitometer (Bio-Rad). The intensity of phosphorylated AKT (Thr 308) and phosphorylated mTOR (Ser 2448) levels in SW480 cells (B) and MDA-MB-231 cells (D) was normalized by each total protein level. E, G. Effects of BCI-121 treatment on the AKT1 activity. SW480 cells (E) and MDA-MB-231 cells (G) were treated with 0, 10 or 50 μM of BCI-121. After 72 hours of incubation, cells were treated with 100 ng/ml of EGF (SW480) or 100 ng/ml of NRG1 (MDA-MB-231), and then lysed with CelLytic™ M mammalian cell lysis/extraction reagent containing a protease inhibitor cocktail and a phosphatase cocktail. Cell extracts were immunoblotted with anti-K14 monomethylated AKT1, anti-phospho AKT (Thr 308), anti-AKT and anti-α-Tubulin (internal control) antibodies. F, H. X-ray films were scanned with GS-800™ calibrated densitometer (Bio-Rad). The intensity of methylated AKT1 (Lys 14) and phosphorylated AKT1 (Thr 308) levels in SW480 cells (F) and MDA-MB-231 cells (H) was normalized by each total protein level.

    Techniques Used: Activity Assay, Multiple Displacement Amplification, Transfection, Incubation, Lysis, Protease Inhibitor, SDS Page, Western Blot, Methylation

    Methylation of AKT1 at lysine 14 promotes plasma membrane recruitment and proliferation of cancer cells A-B. HeLa cells were transfected with HA-tagged wild-type AKT1 (HA-AKT1-WT) (A) or K14A-substituted AKT1 (HA-AKT1-K14A) (B) in the presence of a SMYD3 expression vector (pcDNA3.1-SMYD3). After 48 hours of incubation, cells were trypsinized and re-seeded in 4-well chamber glass slides in a medium without FBS. After 24 hours of incubation, cells were treated with 100 ng/ml of EGF for 5 min, and then fixed with 4% paraformaldehyde. Fixed cells were stained with an anti-HA antibody (Alexa Fluor ® 488 [green]), Alexa Fluor ® 594 conjugated Wheat Germ Agglutinin (WGA) [red] and 4',6'-diamidine-2'-phenylindole dihydrochloride (DAPI [blue]). Scale bar, 10 μm. C. HeLa cells were transfected with HA-tagged wild-type AKT1 (HA-AKT1-WT) or K14A-substituted AKT1 (HA-AKT1-K14A) together with a SMYD3 expression vector (pcDNA3.1-SMYD3). After 48 hours of incubation, cells were treated with 100 ng/ml of EGF for 5 min, and then plasma membrane proteins were extracted using the Mem-PER™ plus membrane protein extraction kit (Thermo Fisher Scientific). Extracted proteins were bloated with an anti-FLAG antibody (Sigma-Aldrich), and an anti-Na, K-ATPase antibody was used as an internal control. D. Cell growth assays of SW480 cells expressing wild-type AKT1 or K14A substituted AKT1. Relative cell amount was measured by cell counting kit 8 (CCK8): results are the mean ±SD of three independent experiments. P values were calculated using Student's t -test (**, P
    Figure Legend Snippet: Methylation of AKT1 at lysine 14 promotes plasma membrane recruitment and proliferation of cancer cells A-B. HeLa cells were transfected with HA-tagged wild-type AKT1 (HA-AKT1-WT) (A) or K14A-substituted AKT1 (HA-AKT1-K14A) (B) in the presence of a SMYD3 expression vector (pcDNA3.1-SMYD3). After 48 hours of incubation, cells were trypsinized and re-seeded in 4-well chamber glass slides in a medium without FBS. After 24 hours of incubation, cells were treated with 100 ng/ml of EGF for 5 min, and then fixed with 4% paraformaldehyde. Fixed cells were stained with an anti-HA antibody (Alexa Fluor ® 488 [green]), Alexa Fluor ® 594 conjugated Wheat Germ Agglutinin (WGA) [red] and 4',6'-diamidine-2'-phenylindole dihydrochloride (DAPI [blue]). Scale bar, 10 μm. C. HeLa cells were transfected with HA-tagged wild-type AKT1 (HA-AKT1-WT) or K14A-substituted AKT1 (HA-AKT1-K14A) together with a SMYD3 expression vector (pcDNA3.1-SMYD3). After 48 hours of incubation, cells were treated with 100 ng/ml of EGF for 5 min, and then plasma membrane proteins were extracted using the Mem-PER™ plus membrane protein extraction kit (Thermo Fisher Scientific). Extracted proteins were bloated with an anti-FLAG antibody (Sigma-Aldrich), and an anti-Na, K-ATPase antibody was used as an internal control. D. Cell growth assays of SW480 cells expressing wild-type AKT1 or K14A substituted AKT1. Relative cell amount was measured by cell counting kit 8 (CCK8): results are the mean ±SD of three independent experiments. P values were calculated using Student's t -test (**, P

    Techniques Used: Methylation, Transfection, Expressing, Plasmid Preparation, Incubation, Staining, Whole Genome Amplification, Protein Extraction, Cell Counting

    SMYD3 methylates AKT1 in vitro A. Recombinant AKT1 protein was incubated with different concentration of SMYD3 in the presence of S-adenosyl-L-[methyl- 3 H]-methionine, and methylation signal was detected by autoradiography (upper panel). Amounts of loading proteins were evaluated by staining with MemCode™ Reversible Protein Stain (lower panel). The concentration of SMYD3 is 11.5 μM. B. The LC-MS/MS spectrum corresponding to the monomethylated AKT1 9-15 peptide. AKT1 recombinant protein was incubated with SMYD3 and S-adenosyl-L-methionine, followed by separation by SDS-PAGE. An excised AKT1 band from the gel was digested with trypsin and subjected to LC-MS/MS analysis. The methylation site was determined by MASCOT search. The 14 Da increase of the Lys 14 residue was observed. C. The theoretical values of MS/MS fragments ions of the Lys 14 monomethylated AKT1 9-15 peptides are summarized in the table. The abbreviations of fragment ion types were indicated by the MASCOT program ( http://www.matrixscience.com/help/fragmentation_help.html ). The observed ions in Figure 1B were indicated in red letters. D. The biotin-conjugated AKT1 10-44 peptide was incubated with SMYD3 in the presence of S-adenosyl-L-[methyl- 3 H]-methionine, and methylation signal was detected by autoradiography. Amounts of loading proteins were evaluated by staining with MemCode™ Reversible Protein Stain. E. Amino acid sequence alignment of AKT1. Lys 14 is highlighted in red and conserved among various species. Glu 17, which forms an ionic interaction with Lys 14, is shown covering a red hatched rectangle.
    Figure Legend Snippet: SMYD3 methylates AKT1 in vitro A. Recombinant AKT1 protein was incubated with different concentration of SMYD3 in the presence of S-adenosyl-L-[methyl- 3 H]-methionine, and methylation signal was detected by autoradiography (upper panel). Amounts of loading proteins were evaluated by staining with MemCode™ Reversible Protein Stain (lower panel). The concentration of SMYD3 is 11.5 μM. B. The LC-MS/MS spectrum corresponding to the monomethylated AKT1 9-15 peptide. AKT1 recombinant protein was incubated with SMYD3 and S-adenosyl-L-methionine, followed by separation by SDS-PAGE. An excised AKT1 band from the gel was digested with trypsin and subjected to LC-MS/MS analysis. The methylation site was determined by MASCOT search. The 14 Da increase of the Lys 14 residue was observed. C. The theoretical values of MS/MS fragments ions of the Lys 14 monomethylated AKT1 9-15 peptides are summarized in the table. The abbreviations of fragment ion types were indicated by the MASCOT program ( http://www.matrixscience.com/help/fragmentation_help.html ). The observed ions in Figure 1B were indicated in red letters. D. The biotin-conjugated AKT1 10-44 peptide was incubated with SMYD3 in the presence of S-adenosyl-L-[methyl- 3 H]-methionine, and methylation signal was detected by autoradiography. Amounts of loading proteins were evaluated by staining with MemCode™ Reversible Protein Stain. E. Amino acid sequence alignment of AKT1. Lys 14 is highlighted in red and conserved among various species. Glu 17, which forms an ionic interaction with Lys 14, is shown covering a red hatched rectangle.

    Techniques Used: In Vitro, Recombinant, Incubation, Concentration Assay, Methylation, Autoradiography, Staining, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, SDS Page, Sequencing

    34) Product Images from "NprR-NprX Quorum-Sensing System Regulates the Algicidal Activity of Bacillus sp. Strain S51107 against Bloom-Forming Cyanobacterium Microcystis aeruginosa"

    Article Title: NprR-NprX Quorum-Sensing System Regulates the Algicidal Activity of Bacillus sp. Strain S51107 against Bloom-Forming Cyanobacterium Microcystis aeruginosa

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2017.01968

    Agar plate assay and MS/MS analysis of the NprX peptide. (A) Paper disk diffusion assay of NprX peptide extracted by a Waters Sep Pak C18 cartridge by using the reporter strain Bacillus thuringiensis 407 Cry - ( nprA′Z ΔRX [pHT304-R]). The left plate is an extract of BEP medium (control), and the right plate is an extract of the culture supernatant from strain S51107. (B) MS/MS spectra fragmentation of the SKPDIVG synthetic heptapeptide (standard substance). (C) MS/MS spectra fragmentation of NprX peptide extracts from strain S51107 culture. (D) Theoretical fragmentation of the SKPDIVG peptide.
    Figure Legend Snippet: Agar plate assay and MS/MS analysis of the NprX peptide. (A) Paper disk diffusion assay of NprX peptide extracted by a Waters Sep Pak C18 cartridge by using the reporter strain Bacillus thuringiensis 407 Cry - ( nprA′Z ΔRX [pHT304-R]). The left plate is an extract of BEP medium (control), and the right plate is an extract of the culture supernatant from strain S51107. (B) MS/MS spectra fragmentation of the SKPDIVG synthetic heptapeptide (standard substance). (C) MS/MS spectra fragmentation of NprX peptide extracts from strain S51107 culture. (D) Theoretical fragmentation of the SKPDIVG peptide.

    Techniques Used: Mass Spectrometry, Diffusion-based Assay

    TEM observations of the degradation process of M. aeruginosa treated with Bacillus sp. strain S51107. (A) Normal cell; (B) damaged cell wall; (C) ruptured cell wall and membrane; (D) distorted and broken cell. CW, cell wall; CM, cell membrane; Th, thylakoids; Ld, lipid droplets; Cg, cyanophycin granules; Pg, polyphosphate granules; BC, bacterial cells; MA, M. aeruginosa . The arrows in (B) show damaged (up) and intact (down) cell walls. The arrows in (C) indicate the partly ruptured M. aeruginosa cell.
    Figure Legend Snippet: TEM observations of the degradation process of M. aeruginosa treated with Bacillus sp. strain S51107. (A) Normal cell; (B) damaged cell wall; (C) ruptured cell wall and membrane; (D) distorted and broken cell. CW, cell wall; CM, cell membrane; Th, thylakoids; Ld, lipid droplets; Cg, cyanophycin granules; Pg, polyphosphate granules; BC, bacterial cells; MA, M. aeruginosa . The arrows in (B) show damaged (up) and intact (down) cell walls. The arrows in (C) indicate the partly ruptured M. aeruginosa cell.

    Techniques Used: Transmission Electron Microscopy

    Algicidal effects of silica gel chromatography fractions on cyanobacterial-lawn and high performance liquid chromatography (HPLC) separation of the algicidal fractions S2 and S5. (A–C) indicate the cyanobacterial-lawn results of algicidal fraction S2, S5 and control (other fractions), respectively. HPLC was performed on a Zorbax ® Bonus-RP column (4.6 mm × 250 mm, 5 μm). The fraction S2 was eluted with a linear gradient of MeOH/H 2 O from 5 to 47% (vol/vol) for 60 min at a flow rate of 1.0 ml/min, yielding pure S51107-A (retention time = 47.5–49.0 min) (D) . The fraction S5 was purified with MeOH/H 2 O from 10 to 60% for 40 min yielded pure S51107-B (retention time = 22.6–23.2 min) (E) . The arrows denote the algicidal effect of fraction on the cyanobacterial-lawn.
    Figure Legend Snippet: Algicidal effects of silica gel chromatography fractions on cyanobacterial-lawn and high performance liquid chromatography (HPLC) separation of the algicidal fractions S2 and S5. (A–C) indicate the cyanobacterial-lawn results of algicidal fraction S2, S5 and control (other fractions), respectively. HPLC was performed on a Zorbax ® Bonus-RP column (4.6 mm × 250 mm, 5 μm). The fraction S2 was eluted with a linear gradient of MeOH/H 2 O from 5 to 47% (vol/vol) for 60 min at a flow rate of 1.0 ml/min, yielding pure S51107-A (retention time = 47.5–49.0 min) (D) . The fraction S5 was purified with MeOH/H 2 O from 10 to 60% for 40 min yielded pure S51107-B (retention time = 22.6–23.2 min) (E) . The arrows denote the algicidal effect of fraction on the cyanobacterial-lawn.

    Techniques Used: Chromatography, High Performance Liquid Chromatography, Flow Cytometry, Purification

    Dynamics of the cell densities of M. aeruginosa 9110 (A) and the algicidal strains (B) and the concentration of dissolved organic carbon (DOC) (C) during the algicidal process of Bacillus sp. strain S51107 and its mutants against M. aeruginosa 9110. The data are shown as the averages of three independent experiments (error bars are the SD from the mean values). The values of group B marked with ∗ were significantly different ( P
    Figure Legend Snippet: Dynamics of the cell densities of M. aeruginosa 9110 (A) and the algicidal strains (B) and the concentration of dissolved organic carbon (DOC) (C) during the algicidal process of Bacillus sp. strain S51107 and its mutants against M. aeruginosa 9110. The data are shown as the averages of three independent experiments (error bars are the SD from the mean values). The values of group B marked with ∗ were significantly different ( P

    Techniques Used: Concentration Assay

    Algicidal activities of different treatments of Bacillus sp. strain S51107 cultures against Microcystis aeruginosa 9110 after 6 days of inoculation. The data are the averages of three independent experiments (error bars are the SD from mean values). Different letters indicate statistically significant differences ( P
    Figure Legend Snippet: Algicidal activities of different treatments of Bacillus sp. strain S51107 cultures against Microcystis aeruginosa 9110 after 6 days of inoculation. The data are the averages of three independent experiments (error bars are the SD from mean values). Different letters indicate statistically significant differences ( P

    Techniques Used:

    35) Product Images from "Bis(monoacylglycero)phosphate lipids in the retinal pigment epithelium implicate lysosomal/endosomal dysfunction in a model of Stargardt disease and human retinas"

    Article Title: Bis(monoacylglycero)phosphate lipids in the retinal pigment epithelium implicate lysosomal/endosomal dysfunction in a model of Stargardt disease and human retinas

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-17402-1

    LC-MS data from Abca4 −/− Folch extracted retina homogenate with corresponding structures. ( a ) Extracted ion chromatogram displaying the retention time of m/z 865.50. ( b ) Full scan orbitrap MS spectrum in negative ion mode from peak displayed in ( a ) showing m/z 865.50 as the base peak. ( c ) MS/MS mass spectrum in negative ion mode from the mass selected [M-H] − ion at m/z 865.50. ( d ) MS/MS mass spectrum in positive ion mode from the mass selected [M + Li] + adduct at m/z 873.5.
    Figure Legend Snippet: LC-MS data from Abca4 −/− Folch extracted retina homogenate with corresponding structures. ( a ) Extracted ion chromatogram displaying the retention time of m/z 865.50. ( b ) Full scan orbitrap MS spectrum in negative ion mode from peak displayed in ( a ) showing m/z 865.50 as the base peak. ( c ) MS/MS mass spectrum in negative ion mode from the mass selected [M-H] − ion at m/z 865.50. ( d ) MS/MS mass spectrum in positive ion mode from the mass selected [M + Li] + adduct at m/z 873.5.

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

    36) Product Images from "Characterization of human enterovirus71 virus-like particles used for vaccine antigens"

    Article Title: Characterization of human enterovirus71 virus-like particles used for vaccine antigens

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0181182

    Confirmation of amino acid sequence of EV71 VLPs. Amino acid sequence of VP0 (a), VP1 (b) and VP3 (c) of EV71 VLPs (A), as determined by translation of the corresponding DNA sequences. Peptides are shown that have been obtained by digestion with trypsin (blue), chymotrypsin (green) or endoproteinase Glu-C (red) and identified by LC-MS/MS. The N-terminal sequences are marked in orange and the C-terminal sequences in purple. (B) N-glycosylation site at VP1 residue N 176 of EV71 VLPs. Monoisotopic mass of neutral peptide Mr (calc): 1777.8887; fixed modifications: Carbamidomethyl (C) (applied to specified residues or termini only); variable modifications: N10: deamidated (NQ); ions score: 57 Expect: 2.1e-006; matches: 21/162 fragment ions using 39 of the most intense peaks. Electrospray MS/MS spectra were assigned to the EV71 VLPs primary sequence using the Mascot 2.1.0 (Matrix Science, London, UK) software, and an in-house protein sequence database was established.
    Figure Legend Snippet: Confirmation of amino acid sequence of EV71 VLPs. Amino acid sequence of VP0 (a), VP1 (b) and VP3 (c) of EV71 VLPs (A), as determined by translation of the corresponding DNA sequences. Peptides are shown that have been obtained by digestion with trypsin (blue), chymotrypsin (green) or endoproteinase Glu-C (red) and identified by LC-MS/MS. The N-terminal sequences are marked in orange and the C-terminal sequences in purple. (B) N-glycosylation site at VP1 residue N 176 of EV71 VLPs. Monoisotopic mass of neutral peptide Mr (calc): 1777.8887; fixed modifications: Carbamidomethyl (C) (applied to specified residues or termini only); variable modifications: N10: deamidated (NQ); ions score: 57 Expect: 2.1e-006; matches: 21/162 fragment ions using 39 of the most intense peaks. Electrospray MS/MS spectra were assigned to the EV71 VLPs primary sequence using the Mascot 2.1.0 (Matrix Science, London, UK) software, and an in-house protein sequence database was established.

    Techniques Used: Sequencing, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Software

    37) Product Images from "Infection-stage adjusted dose of beta-lactams for parsimonious and efficient antibiotic treatments: A Pasteurella multocida experimental pneumonia in mice"

    Article Title: Infection-stage adjusted dose of beta-lactams for parsimonious and efficient antibiotic treatments: A Pasteurella multocida experimental pneumonia in mice

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0182863

    Amoxicillin and cefquinome pharmacokinetics in mice. Observed (○) and predicted (-) plasma antibiotic concentrations versus time in mice (n = 3 at each time point) after a single subcutaneous administration. A) Amoxicillin, 50 mg/kg. B) Cefquinome, 5 mg/kg. Cefquinome concentrations were below the LOQ for one mouse at 4 h, 2 mice at 6, 8 and 24 h and 3 mice at 12 h.
    Figure Legend Snippet: Amoxicillin and cefquinome pharmacokinetics in mice. Observed (○) and predicted (-) plasma antibiotic concentrations versus time in mice (n = 3 at each time point) after a single subcutaneous administration. A) Amoxicillin, 50 mg/kg. B) Cefquinome, 5 mg/kg. Cefquinome concentrations were below the LOQ for one mouse at 4 h, 2 mice at 6, 8 and 24 h and 3 mice at 12 h.

    Techniques Used: Mouse Assay

    Time-course of the administered treatments. Mice were infected at Day 0 and were treated or not with amoxicillin or cefquinome depending on the treatment phase (control, pre-patent or patent treatment) and on the group. Mice were sacrificed seven days after the challenge or the beginning of treatment (triangle). Arrows represent the administrations of amoxicillin or cefquinome (each treatment corresponded to 4 daily administrations). The administered doses depended on the treatment phase (control, pre-patent or patent treatment) and on the group. The star indicates that at least one clinical symptom was observed and that the mouse was considered as sick.
    Figure Legend Snippet: Time-course of the administered treatments. Mice were infected at Day 0 and were treated or not with amoxicillin or cefquinome depending on the treatment phase (control, pre-patent or patent treatment) and on the group. Mice were sacrificed seven days after the challenge or the beginning of treatment (triangle). Arrows represent the administrations of amoxicillin or cefquinome (each treatment corresponded to 4 daily administrations). The administered doses depended on the treatment phase (control, pre-patent or patent treatment) and on the group. The star indicates that at least one clinical symptom was observed and that the mouse was considered as sick.

    Techniques Used: Mouse Assay, Infection

    Clinical and microbiological cure rates with amoxicillin. Clinical (dark bars) and microbiological (light bars) cure rates of mice after no treatment (grey/black), early (green) or late (red) treatments with different doses of amoxicillin (2.5, 5, 25, or 50 mg/kg). Rates were calculated for all the mice of the group in control and early treatments (as all the mice in a given group were subjected to the same protocol) whereas cure rates for the late treatments were only calculated from the 60 to 70% of mice treated with amoxicillin NA: not assessed.
    Figure Legend Snippet: Clinical and microbiological cure rates with amoxicillin. Clinical (dark bars) and microbiological (light bars) cure rates of mice after no treatment (grey/black), early (green) or late (red) treatments with different doses of amoxicillin (2.5, 5, 25, or 50 mg/kg). Rates were calculated for all the mice of the group in control and early treatments (as all the mice in a given group were subjected to the same protocol) whereas cure rates for the late treatments were only calculated from the 60 to 70% of mice treated with amoxicillin NA: not assessed.

    Techniques Used: Mouse Assay

    38) Product Images from "Chagas disease vector blood meal sources identified by protein mass spectrometry"

    Article Title: Chagas disease vector blood meal sources identified by protein mass spectrometry

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0189647

    Proteomics-based, LC-MS/MS distinguishes unique but nearly identical peptides. (A) Representative SDS-PAGE results of mouse blood samples and of four T . dimidiata insect vectors. (B) MS1 spectra of two doubly-charged peptide ions differing by a single amino acid- YFDSFGDLSSASAIMGN A K and YFDSFGDLSSASAIMGN P K, identified in mouse blood control sample 2308. Mass to charge ratios for these peptides differ only by the difference between the variable amino acid (alanine or proline). The two peptides also elute at slightly different times. (C) Low energy collision-induced dissociation fragmentation (MS2) mass spectra of the aforementioned peptide ions allow determination of the peptide sequence. Peaks are labelled as per convention with b-type fragment ions (those derived from the amino terminus) and y-type fragment ions derived from the carboxyl-terminus. Given the variable amino acid is the penultimate carboxyl-terminal amino acid, y2 and higher y-type ions differ by the mass variability between alanine and proline (e.g. y11), while almost all b-type ions (e.g. b14) show equal m/z measurements. Expected and observed masses for identified fragment ions can be found in S1 and S2 Tables.
    Figure Legend Snippet: Proteomics-based, LC-MS/MS distinguishes unique but nearly identical peptides. (A) Representative SDS-PAGE results of mouse blood samples and of four T . dimidiata insect vectors. (B) MS1 spectra of two doubly-charged peptide ions differing by a single amino acid- YFDSFGDLSSASAIMGN A K and YFDSFGDLSSASAIMGN P K, identified in mouse blood control sample 2308. Mass to charge ratios for these peptides differ only by the difference between the variable amino acid (alanine or proline). The two peptides also elute at slightly different times. (C) Low energy collision-induced dissociation fragmentation (MS2) mass spectra of the aforementioned peptide ions allow determination of the peptide sequence. Peaks are labelled as per convention with b-type fragment ions (those derived from the amino terminus) and y-type fragment ions derived from the carboxyl-terminus. Given the variable amino acid is the penultimate carboxyl-terminal amino acid, y2 and higher y-type ions differ by the mass variability between alanine and proline (e.g. y11), while almost all b-type ions (e.g. b14) show equal m/z measurements. Expected and observed masses for identified fragment ions can be found in S1 and S2 Tables.

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, SDS Page, Sequencing, Derivative Assay

    39) Product Images from "Membrane Vesicles Released by a hypervesiculating Escherichia coli Nissle 1917 tolR Mutant Are Highly Heterogeneous and Show Reduced Capacity for Epithelial Cell Interaction and Entry"

    Article Title: Membrane Vesicles Released by a hypervesiculating Escherichia coli Nissle 1917 tolR Mutant Are Highly Heterogeneous and Show Reduced Capacity for Epithelial Cell Interaction and Entry

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0169186

    Protein profile and immunoblotting of LPS of MVs isolated from EcN and EcN tolR strains. (A) Comparison of the protein profile of MVs from EcN and EcN tolR . Isolated vesicles (10 μg protein) were separated in a 10%-SDS-PAGE gel and stained with Sypro ® Ruby Protein Gel Stain. Molecular size markers are indicated. Seven protein bands (labelled by numbers) were excised from the gel and analyzed by LC-MS/MS (data from these analyses are provided in S1 Table ). (B) The name of the protein with the highest score is indicated for each band. (C) Western blot analysis of LPS in MVs isolated from EcN and EcN tolR strains. MV samples (0.1μg protein) were separated in a 15%-SDS-PAGE gel and analysed with specific anti- E . coli LPS antibodies. Representative SDS-PAGE and blots from three independent experiments are shown.
    Figure Legend Snippet: Protein profile and immunoblotting of LPS of MVs isolated from EcN and EcN tolR strains. (A) Comparison of the protein profile of MVs from EcN and EcN tolR . Isolated vesicles (10 μg protein) were separated in a 10%-SDS-PAGE gel and stained with Sypro ® Ruby Protein Gel Stain. Molecular size markers are indicated. Seven protein bands (labelled by numbers) were excised from the gel and analyzed by LC-MS/MS (data from these analyses are provided in S1 Table ). (B) The name of the protein with the highest score is indicated for each band. (C) Western blot analysis of LPS in MVs isolated from EcN and EcN tolR strains. MV samples (0.1μg protein) were separated in a 15%-SDS-PAGE gel and analysed with specific anti- E . coli LPS antibodies. Representative SDS-PAGE and blots from three independent experiments are shown.

    Techniques Used: Isolation, SDS Page, Staining, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Western Blot

    40) Product Images from "Crosstalk among the proteome, lysine phosphorylation, and acetylation in romidepsin-treated colon cancer cells"

    Article Title: Crosstalk among the proteome, lysine phosphorylation, and acetylation in romidepsin-treated colon cancer cells

    Journal: Oncotarget

    doi: 10.18632/oncotarget.10840

    Changes in the proteome profile following FK228 treatment between HCT-8 and HCT-116 cells Quantitative lysine-acetylome and global-phosphorylation analyses were performed in HCT-8 and HCT-116 cells using SILAC and affinity enrichment, followed by high-resolution LC-MS/MS analysis. Total and differentially modified proteins and regulation patterns were identified. ( A ) Differentially regulated protein groups between the two cell lines. ( B ) Differential regulation patterns between the two cell lines.
    Figure Legend Snippet: Changes in the proteome profile following FK228 treatment between HCT-8 and HCT-116 cells Quantitative lysine-acetylome and global-phosphorylation analyses were performed in HCT-8 and HCT-116 cells using SILAC and affinity enrichment, followed by high-resolution LC-MS/MS analysis. Total and differentially modified proteins and regulation patterns were identified. ( A ) Differentially regulated protein groups between the two cell lines. ( B ) Differential regulation patterns between the two cell lines.

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Modification

    Phosphorylation profile changes following FK228 treatment of HCT-8 and HCT-116 cells SILAC, affinity enrichment, and high-resolution LC-MS/MS analysis was used for quantitative phosphoproteomics analysis of HCT-8 and HCT-116 cells following FK228 treatment. Total and differentially phosphorylated sites and phosphorylated proteins were assessed. ( A ) Sites exhibiting differential phosphorylation patterns in the two cell lines. ( B ) Differentially phosphorylated proteins between the two cell lines.
    Figure Legend Snippet: Phosphorylation profile changes following FK228 treatment of HCT-8 and HCT-116 cells SILAC, affinity enrichment, and high-resolution LC-MS/MS analysis was used for quantitative phosphoproteomics analysis of HCT-8 and HCT-116 cells following FK228 treatment. Total and differentially phosphorylated sites and phosphorylated proteins were assessed. ( A ) Sites exhibiting differential phosphorylation patterns in the two cell lines. ( B ) Differentially phosphorylated proteins between the two cell lines.

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

    41) Product Images from "Regulation and Molecular Basis of Environmental Muropeptide Uptake and Utilization in Fastidious Oral Anaerobe Tannerella forsythia"

    Article Title: Regulation and Molecular Basis of Environmental Muropeptide Uptake and Utilization in Fastidious Oral Anaerobe Tannerella forsythia

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2017.00648

    Analysis of AmpG and MurNAc utilization operon. RT-PCR analysis with (A) primer sets spanning adjacent genes (fragments a-j). Tanf_08345, xanthane lyase; Tanf_08350 ( gtf ), glycosyltransferase; Tanf_08355 ( gtf ), glycosyltransferase; Tanf_08360 ( lytB ), amidase enhancer precursor; Tanf_08365 ( ampG ), muropeptide permease; Tanf_08370 ( ybbC ), conserved hypothetical protein. (B) PCR products were separated on a 1% agarose gel. RNA samples with no reverse transcription reaction as template controls were run in lanes 1, genomic DNA as template in lanes 2, and cDNA as template for each primer set in lanes 3. MW; DNA ladder. (C) DNA sequence showing transcriptional start site determine by 5′RACE.
    Figure Legend Snippet: Analysis of AmpG and MurNAc utilization operon. RT-PCR analysis with (A) primer sets spanning adjacent genes (fragments a-j). Tanf_08345, xanthane lyase; Tanf_08350 ( gtf ), glycosyltransferase; Tanf_08355 ( gtf ), glycosyltransferase; Tanf_08360 ( lytB ), amidase enhancer precursor; Tanf_08365 ( ampG ), muropeptide permease; Tanf_08370 ( ybbC ), conserved hypothetical protein. (B) PCR products were separated on a 1% agarose gel. RNA samples with no reverse transcription reaction as template controls were run in lanes 1, genomic DNA as template in lanes 2, and cDNA as template for each primer set in lanes 3. MW; DNA ladder. (C) DNA sequence showing transcriptional start site determine by 5′RACE.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Sequencing

    42) Product Images from "An Alternative Strategy for Pan-acetyl-lysine Antibody Generation"

    Article Title: An Alternative Strategy for Pan-acetyl-lysine Antibody Generation

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0162528

    Strategy for pan-acetyl-lysine antibody generation and application in acetylome studies. To generate pan-acetyl-lysine (acK) antibody, a random acK peptide library conjugated to ovalbumin was used as an antigen to immunize rabbits. Raised antibodies were tested for specificity with ELISA and dot blot, and those that passed quality control were used to pull down acK peptides from HEK293 cell lysate for analysis by LC-MS/MS. A commercial pan-acK antibody was used for comparison.
    Figure Legend Snippet: Strategy for pan-acetyl-lysine antibody generation and application in acetylome studies. To generate pan-acetyl-lysine (acK) antibody, a random acK peptide library conjugated to ovalbumin was used as an antigen to immunize rabbits. Raised antibodies were tested for specificity with ELISA and dot blot, and those that passed quality control were used to pull down acK peptides from HEK293 cell lysate for analysis by LC-MS/MS. A commercial pan-acK antibody was used for comparison.

    Techniques Used: Enzyme-linked Immunosorbent Assay, Dot Blot, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

    Identification of acetylated peptides by LC-MS/MS and their consensus sequence motif. Overlap of identified acetylated proteins (A) and peptides (B) from HEK293 cells using commercial pan-acK antibody or SICS pan-acK antibodies. (C and D) Peptide sequence motif and heat map of amino acids flanking the acetyl-lysine ( P
    Figure Legend Snippet: Identification of acetylated peptides by LC-MS/MS and their consensus sequence motif. Overlap of identified acetylated proteins (A) and peptides (B) from HEK293 cells using commercial pan-acK antibody or SICS pan-acK antibodies. (C and D) Peptide sequence motif and heat map of amino acids flanking the acetyl-lysine ( P

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Sequencing

    43) Product Images from "LC-MS-MS quantitative analysis reveals the association between FTO and DNA methylation"

    Article Title: LC-MS-MS quantitative analysis reveals the association between FTO and DNA methylation

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0175849

    Characterization of several kinds of nucleoside modification in DNA and RNA. (a) Proposed oxidative demethylation of m6A to N6-hydroxymethyladenosine (hm6A) and N6-formyladenosine (f6A) in RNA by FTO and oxidation of 5mdC to 5hmdC and 5-formylcytosine (5fC) in DNA by TET2. (b) Coomassie staining and western blot of His-tagged full-length human FTO proteins purified from BL21(DE3)-PlysS E . coli . (c) Base ion mass transitions for LC-MS-MS analysis of A, m6A, dC, 5mdC and 5hmdC standard. The MRM transitions were monitored as follows: 267.9 to 136.1 (A); 282.1 to 150.1 (m6A); 228.0 to 112.0 (dC); 258.0 to 142.0 (5hmdC); 242.1 to 126.1 (5mdC). (d) LC-MS-MS standards curves of A, m6A, dC, 5mdC and 5hmdC.
    Figure Legend Snippet: Characterization of several kinds of nucleoside modification in DNA and RNA. (a) Proposed oxidative demethylation of m6A to N6-hydroxymethyladenosine (hm6A) and N6-formyladenosine (f6A) in RNA by FTO and oxidation of 5mdC to 5hmdC and 5-formylcytosine (5fC) in DNA by TET2. (b) Coomassie staining and western blot of His-tagged full-length human FTO proteins purified from BL21(DE3)-PlysS E . coli . (c) Base ion mass transitions for LC-MS-MS analysis of A, m6A, dC, 5mdC and 5hmdC standard. The MRM transitions were monitored as follows: 267.9 to 136.1 (A); 282.1 to 150.1 (m6A); 228.0 to 112.0 (dC); 258.0 to 142.0 (5hmdC); 242.1 to 126.1 (5mdC). (d) LC-MS-MS standards curves of A, m6A, dC, 5mdC and 5hmdC.

    Techniques Used: Modification, Staining, Western Blot, Purification, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

    LC-MS-MS assay measures the demethylation activity of FTO in vitro. (a) (left) LC-MS-MS profiles of nucleosides derived from enzymatic hydrolysis of RNA samples containing m6A upon treatment with the FTO protein. The upper LC-MS-MS profile shows nucleoside A and m6A standards. (Right) Quantitation of m6A in vitro reaction system of FTO and synthetic RNA substrates. (b) (left) LC-MS-MS profiles of nucleosides derived from enzymatic hydrolysis of DNA samples containing 5mdC upon treatment with the FTO proteins. The upper LC-MS-MS profile shows nucleoside 5hmdC, dC and 5mdC standards. (Right) Quantitation of 5mdC in vitro reaction system of FTO and synthetic DNA. (c) FTO catalyzes the demethylation of m6A in a dose- and time-dependent manner. (d) FTO shows no obvious converting 5mdC to 5hmdC in DNA with the increase of the dose of FTO and reaction time. *p
    Figure Legend Snippet: LC-MS-MS assay measures the demethylation activity of FTO in vitro. (a) (left) LC-MS-MS profiles of nucleosides derived from enzymatic hydrolysis of RNA samples containing m6A upon treatment with the FTO protein. The upper LC-MS-MS profile shows nucleoside A and m6A standards. (Right) Quantitation of m6A in vitro reaction system of FTO and synthetic RNA substrates. (b) (left) LC-MS-MS profiles of nucleosides derived from enzymatic hydrolysis of DNA samples containing 5mdC upon treatment with the FTO proteins. The upper LC-MS-MS profile shows nucleoside 5hmdC, dC and 5mdC standards. (Right) Quantitation of 5mdC in vitro reaction system of FTO and synthetic DNA. (c) FTO catalyzes the demethylation of m6A in a dose- and time-dependent manner. (d) FTO shows no obvious converting 5mdC to 5hmdC in DNA with the increase of the dose of FTO and reaction time. *p

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Activity Assay, In Vitro, Derivative Assay, Quantitation Assay

    Immunofluorescence and LC-MS-MS experiments measure the demethylation activity of FTO in vivo. (a) Immunofluorescence analysis of 5hmdC level generated from 5mdC in FTO or TET2 overexpressed Hela cells. Cells were stained with anti-5hmdC antibody (green), showed that 5hmdC signal is obvious in the TET2 overpexpressed cells, instead of TET2 mutant or FTO gene transfected cells. Nuclei are stained by DAPI. Scale bar: 0–50 μm. (b) LC-MS-MS quantification analysis showed percentage of m6A/A in mRNA and total RNA isolated from control and FTO overexpressed cells. (c) LC-MS-MS quantification analysis showed percentage of 5hmdC/dC, 5hmdC/5mdC in DNA isolated from control, FTO and TET2 overexpressed cells. *p
    Figure Legend Snippet: Immunofluorescence and LC-MS-MS experiments measure the demethylation activity of FTO in vivo. (a) Immunofluorescence analysis of 5hmdC level generated from 5mdC in FTO or TET2 overexpressed Hela cells. Cells were stained with anti-5hmdC antibody (green), showed that 5hmdC signal is obvious in the TET2 overpexpressed cells, instead of TET2 mutant or FTO gene transfected cells. Nuclei are stained by DAPI. Scale bar: 0–50 μm. (b) LC-MS-MS quantification analysis showed percentage of m6A/A in mRNA and total RNA isolated from control and FTO overexpressed cells. (c) LC-MS-MS quantification analysis showed percentage of 5hmdC/dC, 5hmdC/5mdC in DNA isolated from control, FTO and TET2 overexpressed cells. *p

    Techniques Used: Immunofluorescence, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Activity Assay, In Vivo, Generated, Staining, Mutagenesis, Transfection, Isolation

    44) Product Images from "A Helicobacter pylori Homolog of Eukaryotic Flotillin Is Involved in Cholesterol Accumulation, Epithelial Cell Responses and Host Colonization"

    Article Title: A Helicobacter pylori Homolog of Eukaryotic Flotillin Is Involved in Cholesterol Accumulation, Epithelial Cell Responses and Host Colonization

    Journal: Frontiers in Cellular and Infection Microbiology

    doi: 10.3389/fcimb.2017.00219

    HP0248 is enriched in the DRM fractions of H. pylori cell membranes. (A) Whole cell lysates of H. pylori 251 WT, Δ FLOT , or FLOT ( FLOT +) bacteria were analyzed by Western blotting. Full length HP0248 protein (molecular weight, c . 40 kDa) was detected in WT and FLOT ( FLOT +) preparations, but not in those of the Δ FLOT strain. A non-specific protein band was also present in all three preparations. (B) Western Blot of H. pylori 251 WT whole cell lysate (lane 1), inner membrane (lane 2), outer membrane (lane 3) and cytoplasmic (lane 4) fractions. UreA was used as a loading control. (C) Coomassie-stained SDS-PAGE gel showing the total protein profiles of DRM (lane 1) and DSM (lane 2) preparations of H. pylori 251 WT. Molecular weight markers are shown. (D) Western blot of DRM (lane 1) and DSM (lane 2) preparations from H. pylori 251 WT, Δ FLOT , or FLOT ( FLOT +) bacteria. (E) Densitometric analysis of HP0248 in DRM and DSM fractions from H. pylori 251 WT, Δ FLOT , and FLOT ( FLOT +) bacteria. The relative amount of HP0248 in each fraction (mean ± SEM from three independent experiments) is expressed relative to that in the WT DRM fraction. Data were analyzed using the one-way ANOVA. ** P
    Figure Legend Snippet: HP0248 is enriched in the DRM fractions of H. pylori cell membranes. (A) Whole cell lysates of H. pylori 251 WT, Δ FLOT , or FLOT ( FLOT +) bacteria were analyzed by Western blotting. Full length HP0248 protein (molecular weight, c . 40 kDa) was detected in WT and FLOT ( FLOT +) preparations, but not in those of the Δ FLOT strain. A non-specific protein band was also present in all three preparations. (B) Western Blot of H. pylori 251 WT whole cell lysate (lane 1), inner membrane (lane 2), outer membrane (lane 3) and cytoplasmic (lane 4) fractions. UreA was used as a loading control. (C) Coomassie-stained SDS-PAGE gel showing the total protein profiles of DRM (lane 1) and DSM (lane 2) preparations of H. pylori 251 WT. Molecular weight markers are shown. (D) Western blot of DRM (lane 1) and DSM (lane 2) preparations from H. pylori 251 WT, Δ FLOT , or FLOT ( FLOT +) bacteria. (E) Densitometric analysis of HP0248 in DRM and DSM fractions from H. pylori 251 WT, Δ FLOT , and FLOT ( FLOT +) bacteria. The relative amount of HP0248 in each fraction (mean ± SEM from three independent experiments) is expressed relative to that in the WT DRM fraction. Data were analyzed using the one-way ANOVA. ** P

    Techniques Used: Western Blot, Molecular Weight, Staining, SDS Page

    45) Product Images from "Formation and determination of the oxidation products of 5-methylcytosine in RNA and determination of the oxidation products of 5-methylcytosine in RNA †Electronic supplementary information (ESI) available. See DOI: 10.1039/c6sc01589a"

    Article Title: Formation and determination of the oxidation products of 5-methylcytosine in RNA and determination of the oxidation products of 5-methylcytosine in RNA †Electronic supplementary information (ESI) available. See DOI: 10.1039/c6sc01589a

    Journal: Chemical Science

    doi: 10.1039/c6sc01589a

    Confirmation of the cytosine modifications in the RNA of mammals using high-resolution mass spectrometry. (A) Product-ion spectra of BDEPE labeled 5-mC standard (left) and 5-mC from the RNA of human CRC tissue. (B) Product-ion spectra of BDEPE labeled 5-hmC standard (left) and 5-hmC from the RNA of human CRC tissue. (C) Product-ion spectra of BDEPE labeled 5-foC standard (left) and 5-foC from the RNA of human CRC tissue. (D) Product-ion spectra of BDEPE labeled 5-caC standard (left) and 5-caC from the RNA of human CRC tissue.
    Figure Legend Snippet: Confirmation of the cytosine modifications in the RNA of mammals using high-resolution mass spectrometry. (A) Product-ion spectra of BDEPE labeled 5-mC standard (left) and 5-mC from the RNA of human CRC tissue. (B) Product-ion spectra of BDEPE labeled 5-hmC standard (left) and 5-hmC from the RNA of human CRC tissue. (C) Product-ion spectra of BDEPE labeled 5-foC standard (left) and 5-foC from the RNA of human CRC tissue. (D) Product-ion spectra of BDEPE labeled 5-caC standard (left) and 5-caC from the RNA of human CRC tissue.

    Techniques Used: Mass Spectrometry, Labeling

    Quantification and statistical analysis of 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D) in the mRNA of human HCC tissues and tumor adjacent normal tissues.
    Figure Legend Snippet: Quantification and statistical analysis of 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D) in the mRNA of human HCC tissues and tumor adjacent normal tissues.

    Techniques Used:

    Determination of 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D) in different RNA species from mouse liver tissue. 10 μg total RNA and 1 μg other RNA species were used for quantification.
    Figure Legend Snippet: Determination of 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D) in different RNA species from mouse liver tissue. 10 μg total RNA and 1 μg other RNA species were used for quantification.

    Techniques Used:

    Quantification and statistical analysis of 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D) in the total RNA of human CRC tissues and tumor adjacent normal tissues (left panel) or in the total RNA of human HCC tissues and tumor adjacent normal tissues (right panel).
    Figure Legend Snippet: Quantification and statistical analysis of 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D) in the total RNA of human CRC tissues and tumor adjacent normal tissues (left panel) or in the total RNA of human HCC tissues and tumor adjacent normal tissues (right panel).

    Techniques Used:

    Product ions spectra of BDEPE labeled 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D).
    Figure Legend Snippet: Product ions spectra of BDEPE labeled 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D).

    Techniques Used: Labeling

    Determination of 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D) in the RNA of mammals using BDEPE labeling coupled with LC-ESI-MS/MS analysis. Extracted ion chromatograms of the BDEPE labeled standards, BDEPE labeled cytosine modifications in the RNA from human CRC tissue, mouse liver tissue and 293T cells are shown in each panel.
    Figure Legend Snippet: Determination of 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D) in the RNA of mammals using BDEPE labeling coupled with LC-ESI-MS/MS analysis. Extracted ion chromatograms of the BDEPE labeled standards, BDEPE labeled cytosine modifications in the RNA from human CRC tissue, mouse liver tissue and 293T cells are shown in each panel.

    Techniques Used: Labeling, Mass Spectrometry

    Extracted ion chromatograms of 5-mC, 5-hmC, 5-foC, and 5-caC before (A) and after (B) labeling using BDEPE under the optimized conditions. The amount of 5-mC, 5-hmC, 5-foC, and 5-caC were 200 fmol.
    Figure Legend Snippet: Extracted ion chromatograms of 5-mC, 5-hmC, 5-foC, and 5-caC before (A) and after (B) labeling using BDEPE under the optimized conditions. The amount of 5-mC, 5-hmC, 5-foC, and 5-caC were 200 fmol.

    Techniques Used: Labeling

    46) Product Images from "Formation and determination of the oxidation products of 5-methylcytosine in RNA Formation and determination of the oxidation products of 5-methylcytosine in RNA †Electronic supplementary information (ESI) available. See DOI: 10.1039/c6sc01589a"

    Article Title: Formation and determination of the oxidation products of 5-methylcytosine in RNA Formation and determination of the oxidation products of 5-methylcytosine in RNA †Electronic supplementary information (ESI) available. See DOI: 10.1039/c6sc01589a

    Journal: Chemical Science

    doi: 10.1039/c6sc01589a

    Confirmation of the cytosine modifications in the RNA of mammals using high-resolution mass spectrometry. (A) Product-ion spectra of BDEPE labeled 5-mC standard (left) and 5-mC from the RNA of human CRC tissue. (B) Product-ion spectra of BDEPE labeled 5-hmC standard (left) and 5-hmC from the RNA of human CRC tissue. (C) Product-ion spectra of BDEPE labeled 5-foC standard (left) and 5-foC from the RNA of human CRC tissue. (D) Product-ion spectra of BDEPE labeled 5-caC standard (left) and 5-caC from the RNA of human CRC tissue.
    Figure Legend Snippet: Confirmation of the cytosine modifications in the RNA of mammals using high-resolution mass spectrometry. (A) Product-ion spectra of BDEPE labeled 5-mC standard (left) and 5-mC from the RNA of human CRC tissue. (B) Product-ion spectra of BDEPE labeled 5-hmC standard (left) and 5-hmC from the RNA of human CRC tissue. (C) Product-ion spectra of BDEPE labeled 5-foC standard (left) and 5-foC from the RNA of human CRC tissue. (D) Product-ion spectra of BDEPE labeled 5-caC standard (left) and 5-caC from the RNA of human CRC tissue.

    Techniques Used: Mass Spectrometry, Labeling

    Quantification and statistical analysis of 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D) in the mRNA of human HCC tissues and tumor adjacent normal tissues.
    Figure Legend Snippet: Quantification and statistical analysis of 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D) in the mRNA of human HCC tissues and tumor adjacent normal tissues.

    Techniques Used:

    Determination of 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D) in different RNA species from mouse liver tissue. 10 μg total RNA and 1 μg other RNA species were used for quantification.
    Figure Legend Snippet: Determination of 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D) in different RNA species from mouse liver tissue. 10 μg total RNA and 1 μg other RNA species were used for quantification.

    Techniques Used:

    Quantification and statistical analysis of 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D) in the total RNA of human CRC tissues and tumor adjacent normal tissues (left panel) or in the total RNA of human HCC tissues and tumor adjacent normal tissues (right panel).
    Figure Legend Snippet: Quantification and statistical analysis of 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D) in the total RNA of human CRC tissues and tumor adjacent normal tissues (left panel) or in the total RNA of human HCC tissues and tumor adjacent normal tissues (right panel).

    Techniques Used:

    Product ions spectra of BDEPE labeled 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D).
    Figure Legend Snippet: Product ions spectra of BDEPE labeled 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D).

    Techniques Used: Labeling

    Determination of 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D) in the RNA of mammals using BDEPE labeling coupled with LC-ESI-MS/MS analysis. Extracted ion chromatograms of the BDEPE labeled standards, BDEPE labeled cytosine modifications in the RNA from human CRC tissue, mouse liver tissue and 293T cells are shown in each panel.
    Figure Legend Snippet: Determination of 5-mC (A), 5-hmC (B), 5-foC (C), and 5-caC (D) in the RNA of mammals using BDEPE labeling coupled with LC-ESI-MS/MS analysis. Extracted ion chromatograms of the BDEPE labeled standards, BDEPE labeled cytosine modifications in the RNA from human CRC tissue, mouse liver tissue and 293T cells are shown in each panel.

    Techniques Used: Labeling, Mass Spectrometry

    Extracted ion chromatograms of 5-mC, 5-hmC, 5-foC, and 5-caC before (A) and after (B) labeling using BDEPE under the optimized conditions. The amount of 5-mC, 5-hmC, 5-foC, and 5-caC were 200 fmol.
    Figure Legend Snippet: Extracted ion chromatograms of 5-mC, 5-hmC, 5-foC, and 5-caC before (A) and after (B) labeling using BDEPE under the optimized conditions. The amount of 5-mC, 5-hmC, 5-foC, and 5-caC were 200 fmol.

    Techniques Used: Labeling

    47) Product Images from "Quantitative phosphoproteomic analysis reveals reciprocal activation of receptor tyrosine kinases between cancer epithelial cells and stromal fibroblasts"

    Article Title: Quantitative phosphoproteomic analysis reveals reciprocal activation of receptor tyrosine kinases between cancer epithelial cells and stromal fibroblasts

    Journal: Clinical Proteomics

    doi: 10.1186/s12014-018-9197-x

    Phosphotyrosine profiling of cancer epithelial cells and interacting CAFs. a , b Density scatter plot of log 2 transformed phosphopeptide intensity ratios (82T-co-cultured vs. 82T (A) and MDA-MB-231-co-cultured vs. MDA-MB-231) from two SILAC biological experiments. c Pie chart showing the composition of pTyr and pSer/Thr peptides identified in the phosphoproteomic analysis. d Venn diagram showing overlap of phosphopeptides identified in MDA-MB-231 and 82T cells. e , f Gene ontology analysis of phosphoproteins in cancer epithelium and CAFs. e Cellular component; f molecular functions
    Figure Legend Snippet: Phosphotyrosine profiling of cancer epithelial cells and interacting CAFs. a , b Density scatter plot of log 2 transformed phosphopeptide intensity ratios (82T-co-cultured vs. 82T (A) and MDA-MB-231-co-cultured vs. MDA-MB-231) from two SILAC biological experiments. c Pie chart showing the composition of pTyr and pSer/Thr peptides identified in the phosphoproteomic analysis. d Venn diagram showing overlap of phosphopeptides identified in MDA-MB-231 and 82T cells. e , f Gene ontology analysis of phosphoproteins in cancer epithelium and CAFs. e Cellular component; f molecular functions

    Techniques Used: Transformation Assay, Cell Culture, Multiple Displacement Amplification

    48) Product Images from "Identification of an analgesic lipopeptide produced by the probiotic Escherichia coli strain Nissle 1917"

    Article Title: Identification of an analgesic lipopeptide produced by the probiotic Escherichia coli strain Nissle 1917

    Journal: Nature Communications

    doi: 10.1038/s41467-017-01403-9

    Characterization of C12-Asparagine-aminobutyric acid by LC-HRMS. a EIC of a lipidic extract of EcNwt (up) and EcNΔclbA pellet (down) for m / z 398.2664. No signal was detected in the mutated strain. b Natural isotopic distribution of the deprotonated molecule displayed by the high-resolution mass spectrum zoom obtained for the peak eluted 15.33 min in both TIC (top) at 12.96 min in the probiotic strain EIC (top) and natural isotopic pattern calculated with the formula [(C 20 H 37 N 3 O 5 )-H] − . Analogous natural isotopic patterns and similar m / z ratios measured and simulated for the monoisotopic [( 12 C 20 1 H 37 14 N 3 16 O 5 )-H] − ion and for the [( 13 C n C 20-n 1 H 37 14 N 3 16 O 5 )-H] − ] − (with n = 1 and 2) ions (within an accuracy of 1.8 ppm). Same isotopic profile and a mass accuracy of 1.8 ppm were obtained. c Product ion spectrum acquired via HCD (NCE = 35%) of the carboxylate anion [M-H] − ( m / z 398) generated in electrospray from the LC peak eluted at 12.96 min. d Upper panel: chromatogram obtained for the four synthesized standards: C12-Asn-γ-aminobutyric acid (C12Asn-GABA OH ), C12Asn-( S )AABA OH and C12Asn-( R )AABA OH , C12-Asn-α-aminobutyric acid (C12Asn-BABA OH ) and C12-Asn-α-aminobutyric acid (C12Asn-AABA OH ) (two diastereoisomers are detected which present similar HCD spectrum with NCE = 35%); lower panel: Chromatogram obtained for the lipid extract of EcNwt pellet
    Figure Legend Snippet: Characterization of C12-Asparagine-aminobutyric acid by LC-HRMS. a EIC of a lipidic extract of EcNwt (up) and EcNΔclbA pellet (down) for m / z 398.2664. No signal was detected in the mutated strain. b Natural isotopic distribution of the deprotonated molecule displayed by the high-resolution mass spectrum zoom obtained for the peak eluted 15.33 min in both TIC (top) at 12.96 min in the probiotic strain EIC (top) and natural isotopic pattern calculated with the formula [(C 20 H 37 N 3 O 5 )-H] − . Analogous natural isotopic patterns and similar m / z ratios measured and simulated for the monoisotopic [( 12 C 20 1 H 37 14 N 3 16 O 5 )-H] − ion and for the [( 13 C n C 20-n 1 H 37 14 N 3 16 O 5 )-H] − ] − (with n = 1 and 2) ions (within an accuracy of 1.8 ppm). Same isotopic profile and a mass accuracy of 1.8 ppm were obtained. c Product ion spectrum acquired via HCD (NCE = 35%) of the carboxylate anion [M-H] − ( m / z 398) generated in electrospray from the LC peak eluted at 12.96 min. d Upper panel: chromatogram obtained for the four synthesized standards: C12-Asn-γ-aminobutyric acid (C12Asn-GABA OH ), C12Asn-( S )AABA OH and C12Asn-( R )AABA OH , C12-Asn-α-aminobutyric acid (C12Asn-BABA OH ) and C12-Asn-α-aminobutyric acid (C12Asn-AABA OH ) (two diastereoisomers are detected which present similar HCD spectrum with NCE = 35%); lower panel: Chromatogram obtained for the lipid extract of EcNwt pellet

    Techniques Used: Generated, Synthesized

    49) Product Images from "Quantitative Proteomics of the 2016 WHO Neisseria gonorrhoeae Reference Strains Surveys Vaccine Candidates and Antimicrobial Resistance Determinants"

    Article Title: Quantitative Proteomics of the 2016 WHO Neisseria gonorrhoeae Reference Strains Surveys Vaccine Candidates and Antimicrobial Resistance Determinants

    Journal: Molecular & Cellular Proteomics : MCP

    doi: 10.1074/mcp.RA118.001125

    Experimental paradigm of quantitative proteomic profiling of the N. gonorrhoeae 2016 WHO reference strains and the FA6140 strain. All gonococci were cultured concurrently in liquid medium until reaching mid-logarithmic growth. Bacterial cells were harvested, lysed, and subjected to subcellular fractionation to separate the crude cell envelope (CE) and cytoplasmic (C) proteomes. CE proteins were enriched using a sodium carbonate wash and ultracentrifugation. The obtained CE and C protein samples (100 μg) were denatured, reduced, alkylated, trypsinized, and the peptides from each strain were labeled using 10-plex and 6-plex Tandem mass tag (TMT) reagents, as indicated. Finally, samples were pooled, fractionated by strong cation exchange, and analyzed by liquid chromatography electrospray ionization mass spectrometry. Experiments were performed in biological duplicates.
    Figure Legend Snippet: Experimental paradigm of quantitative proteomic profiling of the N. gonorrhoeae 2016 WHO reference strains and the FA6140 strain. All gonococci were cultured concurrently in liquid medium until reaching mid-logarithmic growth. Bacterial cells were harvested, lysed, and subjected to subcellular fractionation to separate the crude cell envelope (CE) and cytoplasmic (C) proteomes. CE proteins were enriched using a sodium carbonate wash and ultracentrifugation. The obtained CE and C protein samples (100 μg) were denatured, reduced, alkylated, trypsinized, and the peptides from each strain were labeled using 10-plex and 6-plex Tandem mass tag (TMT) reagents, as indicated. Finally, samples were pooled, fractionated by strong cation exchange, and analyzed by liquid chromatography electrospray ionization mass spectrometry. Experiments were performed in biological duplicates.

    Techniques Used: Cell Culture, Fractionation, Labeling, Liquid Chromatography, Mass Spectrometry

    50) Product Images from "FAMIN Is a Multifunctional Purine Enzyme Enabling the Purine Nucleotide Cycle"

    Article Title: FAMIN Is a Multifunctional Purine Enzyme Enabling the Purine Nucleotide Cycle

    Journal: Cell

    doi: 10.1016/j.cell.2019.12.017

    FAMIN Variants Impact on Central Purine Routing (A) IMP levels in control and FAMIN -silenced HepG2 cells 24 h after transfection (n = 3). (B) Inosine and hypoxanthine levels in control and FAMIN -silenced HepG2 cells 48 h after transfection (n = 6). (C and D) Adenine, adenosine, (C) and ATP levels (D) in Famin p.254I , Famin p.254V , and Famin p.284R M1 macrophages (n = 12). (E) Metabolic fate of [ 13 C 10 15 N 5 ] adenosine after a 3-h pulse of M1 macrophages (n = 6; mean). Schematic representation of central purine metabolism. Adenosine deamination into inosine releases 15 N as ammonia, generating a [ 13 C 10 15 N 4 ] isotopomer (brown). Phosphorolytic cleavage of inosine into hypoxanthine and [ 13 C 5 ] R1P, yielding the [ 13 C 5 15 N 4 ] isotopomer (blue). Adenosine conversion to AMP without loss of label (purple). Phosphorolytic cleavage of fully labeled MTA generates [ 13 C 5 15 N 5 ] adenine (green) and [ 13 C 5 ] 5′-methylthioribose-1-phosphate. Fractions of differently labeled states (averaged across Famin p.254I , Famin p.254V , and Famin p.284R genotypes) depicted as pie charts. ADA, adenosine deaminase; ADK, adenosine kinase; APRT, adenine phosphoribosyl transferase; HPRT, hypoxanthine-guanine phosphoribosyl transferase; MTAP, MTA phosphorylase; PNP, purine nucleoside phosphorlyase. (F–H) Fraction of guanosine (F), guanine (G), or GTP (H) labeled as the indicated isotopomer in M1 macrophages after a [ 13 C 1 15 N 2 ] guanosine pulse (n = 6). (I) Metabolite levels (gray dots) in Famin p.254I versus Famin p.284R M1 macrophages depicted as volcano plot. False discovery rate (FDR)-controlled LC-MS features (black dots), select metabolites in red (n = 6). (J) Immunoblots (IBs) with indicated antibodies in M1 macrophages (n = 3). Data represented as mean ± SEM. ∗ p
    Figure Legend Snippet: FAMIN Variants Impact on Central Purine Routing (A) IMP levels in control and FAMIN -silenced HepG2 cells 24 h after transfection (n = 3). (B) Inosine and hypoxanthine levels in control and FAMIN -silenced HepG2 cells 48 h after transfection (n = 6). (C and D) Adenine, adenosine, (C) and ATP levels (D) in Famin p.254I , Famin p.254V , and Famin p.284R M1 macrophages (n = 12). (E) Metabolic fate of [ 13 C 10 15 N 5 ] adenosine after a 3-h pulse of M1 macrophages (n = 6; mean). Schematic representation of central purine metabolism. Adenosine deamination into inosine releases 15 N as ammonia, generating a [ 13 C 10 15 N 4 ] isotopomer (brown). Phosphorolytic cleavage of inosine into hypoxanthine and [ 13 C 5 ] R1P, yielding the [ 13 C 5 15 N 4 ] isotopomer (blue). Adenosine conversion to AMP without loss of label (purple). Phosphorolytic cleavage of fully labeled MTA generates [ 13 C 5 15 N 5 ] adenine (green) and [ 13 C 5 ] 5′-methylthioribose-1-phosphate. Fractions of differently labeled states (averaged across Famin p.254I , Famin p.254V , and Famin p.284R genotypes) depicted as pie charts. ADA, adenosine deaminase; ADK, adenosine kinase; APRT, adenine phosphoribosyl transferase; HPRT, hypoxanthine-guanine phosphoribosyl transferase; MTAP, MTA phosphorylase; PNP, purine nucleoside phosphorlyase. (F–H) Fraction of guanosine (F), guanine (G), or GTP (H) labeled as the indicated isotopomer in M1 macrophages after a [ 13 C 1 15 N 2 ] guanosine pulse (n = 6). (I) Metabolite levels (gray dots) in Famin p.254I versus Famin p.284R M1 macrophages depicted as volcano plot. False discovery rate (FDR)-controlled LC-MS features (black dots), select metabolites in red (n = 6). (J) Immunoblots (IBs) with indicated antibodies in M1 macrophages (n = 3). Data represented as mean ± SEM. ∗ p

    Techniques Used: Transfection, Labeling, Liquid Chromatography with Mass Spectroscopy, Western Blot

    FAMIN Metabolizes Purine Nucleosides, Related to Figure 1 (A) Coomassie SDS-PAGE of recombinant human FAMIN 254I and FAMIN 254V following Strep-Tactin affinity purification. Lanes indicate ladder (L), FAMIN 254I or FAMIN 254V transfected HEK293T lysate input, column flow-through and concentrated protein eluate. (B) Left, size exclusion chromatogram of affinity purified FAMIN that has undergone TEV-cleavage to remove Strep-tag. Blue trace corresponds to A280 (protein) and purple trace to A260 (DNA) signal. Fractions C6-C8 were collected, concentrated, and subjected to Coomassie SDS-PAGE. Inset depicts entire chromatogram. Right, Coomassie SDS-PAGE of fractions obtained from size exclusion chromatography. Lanes indicate ladder (L) and fractions B12, C5, C6, C7, C8 and C9, corresponding to the size exclusion chromatogram, and the concentrated protein from fractions C6-C8. (C) Differential scanning fluorimetry (DSF) of recombinant human FAMIN. (D) Cell proliferation of HepG2 cells silenced for FAMIN (si FAMIN ) or transfected with scrambled siRNA (siCtrl) as measured by CyQUANT assay (n = 12). (E) Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) of HepG2 cells 48 h after transfection with FAMIN or control siRNA. Basal OCR measurement was followed by sequential treatment (dotted vertical lines) with oligomycin A (Oligo), FCCP, and rotenone plus antimycin A (Rot + ant). Basal ECAR measurement was followed by sequential treatment with oligomycin (Oligo) and 2-deoxyglucose (2-DG) (n = 3). (F) Representative mass spectra and extracted chromatograms for putative FAMIN-catalyzed metabolites and corresponding standards for inosine, hypoxanthine and guanine. (G) Guanosine and guanine levels following incubation of HepG2 cell aqueous extract with 10 μg recombinant FAMIN 254I in 100 μL PBS. (n = 3). (H) Left, Representative extracted chromatograms for FAMIN-catalyzed compound ‘f’ and corresponding standards for ribose-1-phosphate, ribose-5-phosphate, ribulose-5-phosphate and xylulose-5-phosphate. All measurements performed using a BEH amide HILIC column and TSQ Quantiva triple quadrupole. Right, Ratio of selected reaction monitoring (SRM) daughter ions with nominal m/z values of 79 and 97. (I) Inosine, guanosine, cytidine, uridine and ATP levels following incubation of 0.1, 1.0, 10.0 or 100.0 μg of recombinant FAMIN 254I with the complete metabolomic library (aqueous phase of methanol:chloroform extract of FAMIN -silenced HepG2 cells) in 100 μL PBS (n = 3). (J) LC-MS peaks putatively identified as adenine, hypoxanthine, inosine, or ribose-1-phosphate with nominal m/z values of 136, 137, 269 and 229, respectively, were selectively targeted and fragmented using a higher-energy collision dissociation (HCD) collision voltage of 25 eV to give the fragments shown. Data are represented as mean ± SEM or representative of at least 3 independent experiments. ∗ p
    Figure Legend Snippet: FAMIN Metabolizes Purine Nucleosides, Related to Figure 1 (A) Coomassie SDS-PAGE of recombinant human FAMIN 254I and FAMIN 254V following Strep-Tactin affinity purification. Lanes indicate ladder (L), FAMIN 254I or FAMIN 254V transfected HEK293T lysate input, column flow-through and concentrated protein eluate. (B) Left, size exclusion chromatogram of affinity purified FAMIN that has undergone TEV-cleavage to remove Strep-tag. Blue trace corresponds to A280 (protein) and purple trace to A260 (DNA) signal. Fractions C6-C8 were collected, concentrated, and subjected to Coomassie SDS-PAGE. Inset depicts entire chromatogram. Right, Coomassie SDS-PAGE of fractions obtained from size exclusion chromatography. Lanes indicate ladder (L) and fractions B12, C5, C6, C7, C8 and C9, corresponding to the size exclusion chromatogram, and the concentrated protein from fractions C6-C8. (C) Differential scanning fluorimetry (DSF) of recombinant human FAMIN. (D) Cell proliferation of HepG2 cells silenced for FAMIN (si FAMIN ) or transfected with scrambled siRNA (siCtrl) as measured by CyQUANT assay (n = 12). (E) Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) of HepG2 cells 48 h after transfection with FAMIN or control siRNA. Basal OCR measurement was followed by sequential treatment (dotted vertical lines) with oligomycin A (Oligo), FCCP, and rotenone plus antimycin A (Rot + ant). Basal ECAR measurement was followed by sequential treatment with oligomycin (Oligo) and 2-deoxyglucose (2-DG) (n = 3). (F) Representative mass spectra and extracted chromatograms for putative FAMIN-catalyzed metabolites and corresponding standards for inosine, hypoxanthine and guanine. (G) Guanosine and guanine levels following incubation of HepG2 cell aqueous extract with 10 μg recombinant FAMIN 254I in 100 μL PBS. (n = 3). (H) Left, Representative extracted chromatograms for FAMIN-catalyzed compound ‘f’ and corresponding standards for ribose-1-phosphate, ribose-5-phosphate, ribulose-5-phosphate and xylulose-5-phosphate. All measurements performed using a BEH amide HILIC column and TSQ Quantiva triple quadrupole. Right, Ratio of selected reaction monitoring (SRM) daughter ions with nominal m/z values of 79 and 97. (I) Inosine, guanosine, cytidine, uridine and ATP levels following incubation of 0.1, 1.0, 10.0 or 100.0 μg of recombinant FAMIN 254I with the complete metabolomic library (aqueous phase of methanol:chloroform extract of FAMIN -silenced HepG2 cells) in 100 μL PBS (n = 3). (J) LC-MS peaks putatively identified as adenine, hypoxanthine, inosine, or ribose-1-phosphate with nominal m/z values of 136, 137, 269 and 229, respectively, were selectively targeted and fragmented using a higher-energy collision dissociation (HCD) collision voltage of 25 eV to give the fragments shown. Data are represented as mean ± SEM or representative of at least 3 independent experiments. ∗ p

    Techniques Used: SDS Page, Recombinant, Affinity Purification, Transfection, Strep-tag, Size-exclusion Chromatography, CyQUANT Assay, Incubation, Hydrophilic Interaction Liquid Chromatography, Liquid Chromatography with Mass Spectroscopy

    51) Product Images from "FAMIN Is a Multifunctional Purine Enzyme Enabling the Purine Nucleotide Cycle"

    Article Title: FAMIN Is a Multifunctional Purine Enzyme Enabling the Purine Nucleotide Cycle

    Journal: Cell

    doi: 10.1016/j.cell.2019.12.017

    Characterization of FAMIN Enzymatic Activity, Related to Figure 2 (A) Inosine, hypoxanthine and ribose-1-phosphate levels following incubation of 10 μg recombinant FAMIN 254I or equimolar cholesterol oxidase with 10 μM adenosine for 1 h in 100 μL PBS (n = 3). (B) Adenine, inosine and ribose-1-phosphate levels following incubation of 10 μg recombinant Strep-tagged FAMIN 254I or appropriate controls, including heat-denatured recombinant Strep-tagged FAMIN 254I , with 10 μM adenosine for 1 h in 100 μL PBS or HEPES buffer (n = 3). (C and D) Left, FAMIN-catalyzed enzymatic reactions. Right, levels of guanine or hypoxanthine and ribose-1-phosphate in reactions containing 100 μM guanosine or inosine and recombinant FAMIN 254I or buffer control in 100 μL after 1 h at 37°C (n = 3). (E–I) FAMIN-catalyzed enzymatic reaction with (F) adenine, (G) 2′-deoxyinosine, (H) hypoxanthine and (I) deoxyribose-1-phosphate levels following incubation of 10 μg recombinant Strep-tagged FAMIN 254I or buffer control with 10 μM 2′deoxyadenosine for 1 h in 100 μL PBS (n = 3). (J and K) Adenine (J) and deoxyribose-1-phosphate (K) levels following incubation of 10 μg recombinant Strep-tagged FAMIN 254I or buffer control with 10 μM 5′deoxyadenosine (5′dA) for 1 h in 100 μl PBS (n = 3). (L) MTA levels following incubation of 0.1, 1.0, 10.0 or 100.0 μg of recombinant FAMIN 254I with the complete metabolomic library (aqueous phase of methanol:chloroform extract of FAMIN -silenced HepG2 cells) in 100 μl PBS (n = 3). (M) Phylogenetic tree of FAMIN orthologs using human FAMIN protein sequence as the search input. (N) EC 3.5.4.4 (Adenosine deaminase), EC 2.4.2.1 (purine nucleoside phosphorylase) and EC 2.4.2.28 (MTA phosphorylase) activities of E. coli expressed recombinant full-length FAMIN and FAMIN Δ176 as measured by inosine, hypoxanthine and adenine production following incubation of protein with 10 μM adenosine, inosine and MTA, respectively, in PBS. Data are represented as mean ± SEM. ∗ p
    Figure Legend Snippet: Characterization of FAMIN Enzymatic Activity, Related to Figure 2 (A) Inosine, hypoxanthine and ribose-1-phosphate levels following incubation of 10 μg recombinant FAMIN 254I or equimolar cholesterol oxidase with 10 μM adenosine for 1 h in 100 μL PBS (n = 3). (B) Adenine, inosine and ribose-1-phosphate levels following incubation of 10 μg recombinant Strep-tagged FAMIN 254I or appropriate controls, including heat-denatured recombinant Strep-tagged FAMIN 254I , with 10 μM adenosine for 1 h in 100 μL PBS or HEPES buffer (n = 3). (C and D) Left, FAMIN-catalyzed enzymatic reactions. Right, levels of guanine or hypoxanthine and ribose-1-phosphate in reactions containing 100 μM guanosine or inosine and recombinant FAMIN 254I or buffer control in 100 μL after 1 h at 37°C (n = 3). (E–I) FAMIN-catalyzed enzymatic reaction with (F) adenine, (G) 2′-deoxyinosine, (H) hypoxanthine and (I) deoxyribose-1-phosphate levels following incubation of 10 μg recombinant Strep-tagged FAMIN 254I or buffer control with 10 μM 2′deoxyadenosine for 1 h in 100 μL PBS (n = 3). (J and K) Adenine (J) and deoxyribose-1-phosphate (K) levels following incubation of 10 μg recombinant Strep-tagged FAMIN 254I or buffer control with 10 μM 5′deoxyadenosine (5′dA) for 1 h in 100 μl PBS (n = 3). (L) MTA levels following incubation of 0.1, 1.0, 10.0 or 100.0 μg of recombinant FAMIN 254I with the complete metabolomic library (aqueous phase of methanol:chloroform extract of FAMIN -silenced HepG2 cells) in 100 μl PBS (n = 3). (M) Phylogenetic tree of FAMIN orthologs using human FAMIN protein sequence as the search input. (N) EC 3.5.4.4 (Adenosine deaminase), EC 2.4.2.1 (purine nucleoside phosphorylase) and EC 2.4.2.28 (MTA phosphorylase) activities of E. coli expressed recombinant full-length FAMIN and FAMIN Δ176 as measured by inosine, hypoxanthine and adenine production following incubation of protein with 10 μM adenosine, inosine and MTA, respectively, in PBS. Data are represented as mean ± SEM. ∗ p

    Techniques Used: Activity Assay, Incubation, Recombinant, Sequencing

    FAMIN Metabolizes Purine Nucleosides, Related to Figure 1 (A) Coomassie SDS-PAGE of recombinant human FAMIN 254I and FAMIN 254V following Strep-Tactin affinity purification. Lanes indicate ladder (L), FAMIN 254I or FAMIN 254V transfected HEK293T lysate input, column flow-through and concentrated protein eluate. (B) Left, size exclusion chromatogram of affinity purified FAMIN that has undergone TEV-cleavage to remove Strep-tag. Blue trace corresponds to A280 (protein) and purple trace to A260 (DNA) signal. Fractions C6-C8 were collected, concentrated, and subjected to Coomassie SDS-PAGE. Inset depicts entire chromatogram. Right, Coomassie SDS-PAGE of fractions obtained from size exclusion chromatography. Lanes indicate ladder (L) and fractions B12, C5, C6, C7, C8 and C9, corresponding to the size exclusion chromatogram, and the concentrated protein from fractions C6-C8. (C) Differential scanning fluorimetry (DSF) of recombinant human FAMIN. (D) Cell proliferation of HepG2 cells silenced for FAMIN (si FAMIN ) or transfected with scrambled siRNA (siCtrl) as measured by CyQUANT assay (n = 12). (E) Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) of HepG2 cells 48 h after transfection with FAMIN or control siRNA. Basal OCR measurement was followed by sequential treatment (dotted vertical lines) with oligomycin A (Oligo), FCCP, and rotenone plus antimycin A (Rot + ant). Basal ECAR measurement was followed by sequential treatment with oligomycin (Oligo) and 2-deoxyglucose (2-DG) (n = 3). (F) Representative mass spectra and extracted chromatograms for putative FAMIN-catalyzed metabolites and corresponding standards for inosine, hypoxanthine and guanine. (G) Guanosine and guanine levels following incubation of HepG2 cell aqueous extract with 10 μg recombinant FAMIN 254I in 100 μL PBS. (n = 3). (H) Left, Representative extracted chromatograms for FAMIN-catalyzed compound ‘f’ and corresponding standards for ribose-1-phosphate, ribose-5-phosphate, ribulose-5-phosphate and xylulose-5-phosphate. All measurements performed using a BEH amide HILIC column and TSQ Quantiva triple quadrupole. Right, Ratio of selected reaction monitoring (SRM) daughter ions with nominal m/z values of 79 and 97. (I) Inosine, guanosine, cytidine, uridine and ATP levels following incubation of 0.1, 1.0, 10.0 or 100.0 μg of recombinant FAMIN 254I with the complete metabolomic library (aqueous phase of methanol:chloroform extract of FAMIN -silenced HepG2 cells) in 100 μL PBS (n = 3). (J) LC-MS peaks putatively identified as adenine, hypoxanthine, inosine, or ribose-1-phosphate with nominal m/z values of 136, 137, 269 and 229, respectively, were selectively targeted and fragmented using a higher-energy collision dissociation (HCD) collision voltage of 25 eV to give the fragments shown. Data are represented as mean ± SEM or representative of at least 3 independent experiments. ∗ p
    Figure Legend Snippet: FAMIN Metabolizes Purine Nucleosides, Related to Figure 1 (A) Coomassie SDS-PAGE of recombinant human FAMIN 254I and FAMIN 254V following Strep-Tactin affinity purification. Lanes indicate ladder (L), FAMIN 254I or FAMIN 254V transfected HEK293T lysate input, column flow-through and concentrated protein eluate. (B) Left, size exclusion chromatogram of affinity purified FAMIN that has undergone TEV-cleavage to remove Strep-tag. Blue trace corresponds to A280 (protein) and purple trace to A260 (DNA) signal. Fractions C6-C8 were collected, concentrated, and subjected to Coomassie SDS-PAGE. Inset depicts entire chromatogram. Right, Coomassie SDS-PAGE of fractions obtained from size exclusion chromatography. Lanes indicate ladder (L) and fractions B12, C5, C6, C7, C8 and C9, corresponding to the size exclusion chromatogram, and the concentrated protein from fractions C6-C8. (C) Differential scanning fluorimetry (DSF) of recombinant human FAMIN. (D) Cell proliferation of HepG2 cells silenced for FAMIN (si FAMIN ) or transfected with scrambled siRNA (siCtrl) as measured by CyQUANT assay (n = 12). (E) Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) of HepG2 cells 48 h after transfection with FAMIN or control siRNA. Basal OCR measurement was followed by sequential treatment (dotted vertical lines) with oligomycin A (Oligo), FCCP, and rotenone plus antimycin A (Rot + ant). Basal ECAR measurement was followed by sequential treatment with oligomycin (Oligo) and 2-deoxyglucose (2-DG) (n = 3). (F) Representative mass spectra and extracted chromatograms for putative FAMIN-catalyzed metabolites and corresponding standards for inosine, hypoxanthine and guanine. (G) Guanosine and guanine levels following incubation of HepG2 cell aqueous extract with 10 μg recombinant FAMIN 254I in 100 μL PBS. (n = 3). (H) Left, Representative extracted chromatograms for FAMIN-catalyzed compound ‘f’ and corresponding standards for ribose-1-phosphate, ribose-5-phosphate, ribulose-5-phosphate and xylulose-5-phosphate. All measurements performed using a BEH amide HILIC column and TSQ Quantiva triple quadrupole. Right, Ratio of selected reaction monitoring (SRM) daughter ions with nominal m/z values of 79 and 97. (I) Inosine, guanosine, cytidine, uridine and ATP levels following incubation of 0.1, 1.0, 10.0 or 100.0 μg of recombinant FAMIN 254I with the complete metabolomic library (aqueous phase of methanol:chloroform extract of FAMIN -silenced HepG2 cells) in 100 μL PBS (n = 3). (J) LC-MS peaks putatively identified as adenine, hypoxanthine, inosine, or ribose-1-phosphate with nominal m/z values of 136, 137, 269 and 229, respectively, were selectively targeted and fragmented using a higher-energy collision dissociation (HCD) collision voltage of 25 eV to give the fragments shown. Data are represented as mean ± SEM or representative of at least 3 independent experiments. ∗ p

    Techniques Used: SDS Page, Recombinant, Affinity Purification, Transfection, Strep-tag, Size-exclusion Chromatography, CyQUANT Assay, Incubation, Hydrophilic Interaction Liquid Chromatography, Liquid Chromatography with Mass Spectroscopy

    FAMIN Is a Purine-Nucleoside-Metabolizing Enzyme (A) Metabolomic library of HepG2 cells after transfection with FAMIN siRNA. Representative total mass spectra (left) separated by molecular weight ( m/z ), chromatography retention time, and relative levels (right). (B) Change in relative metabolite levels in the library after incubation with recombinant FAMIN 254I or protein buffer control, depicted as volcano plot with unadjusted p values. Red dots, candidate substrates and products whose abundance decreased (a–c) or increased (d–f; n = 3 independent reactions). (C) Representative extracted chromatograms for candidate substrates (top) and products (bottom) by using normalized peak intensity for each given m/z value. (D) Representative mass spectra and extracted chromatograms for compound a and corresponding authentic standard. (E) Levels of adenosine, inosine, hypoxanthine, and ribose-1-phosphate (R1P) within the metabolomic library incubated with FAMIN 254I or protein buffer control (n = 3, mean ± SEM). (F) Levels of adenosine within the metabolomic library incubated with 0.1–100 μg of FAMIN 254I or protein buffer control (n = 3, mean ± SEM). Data representative of at least 3 independent experiments. ∗ p
    Figure Legend Snippet: FAMIN Is a Purine-Nucleoside-Metabolizing Enzyme (A) Metabolomic library of HepG2 cells after transfection with FAMIN siRNA. Representative total mass spectra (left) separated by molecular weight ( m/z ), chromatography retention time, and relative levels (right). (B) Change in relative metabolite levels in the library after incubation with recombinant FAMIN 254I or protein buffer control, depicted as volcano plot with unadjusted p values. Red dots, candidate substrates and products whose abundance decreased (a–c) or increased (d–f; n = 3 independent reactions). (C) Representative extracted chromatograms for candidate substrates (top) and products (bottom) by using normalized peak intensity for each given m/z value. (D) Representative mass spectra and extracted chromatograms for compound a and corresponding authentic standard. (E) Levels of adenosine, inosine, hypoxanthine, and ribose-1-phosphate (R1P) within the metabolomic library incubated with FAMIN 254I or protein buffer control (n = 3, mean ± SEM). (F) Levels of adenosine within the metabolomic library incubated with 0.1–100 μg of FAMIN 254I or protein buffer control (n = 3, mean ± SEM). Data representative of at least 3 independent experiments. ∗ p

    Techniques Used: Transfection, Molecular Weight, Chromatography, Incubation, Recombinant

    52) Product Images from "EGFR enhances the stemness and progression of oral cancer through inhibiting autophagic degradation of SOX2. EGFR enhances the stemness and progression of oral cancer through inhibiting autophagic degradation of SOX2"

    Article Title: EGFR enhances the stemness and progression of oral cancer through inhibiting autophagic degradation of SOX2. EGFR enhances the stemness and progression of oral cancer through inhibiting autophagic degradation of SOX2

    Journal: Cancer Medicine

    doi: 10.1002/cam4.2772

    The in vitro and in vivo antitumor effects of gefitinib against CAL‐27 cells were reversed by autophagy inhibition. A, CAL‐27 cells were treated with gefitinib (10 μmol/L) for 24 h, and cell proliferation activities were evaluated by EdU labeling. The images were captured with confocal microscopy. B, Cells were treated as described in (A), and cell invasion activities were evaluated through transwell assays. C, Representative micrographs and statistical data of oncosphere growth of CAL‐27 cells treated with gefitinib (10 μmol/L) are shown. D‐G, BALB/c nude mice were s.c. inoculated with CAL‐27 cells (1.5 × 10 5 ). The mice were treated with gefitinib (6.5 mg/kg/day) alone or together with 3‐MA (30 mg/kg/day) from day 7 after tumor inoculation. Data are shown from representative mice (n = 7 per group, D), as is the tumor growth curve (mean volume ± SEM) at the indicated time points (E). F, G, Tumors (F) and quantified tumor weights (G) are shown. Scale bar, 1.5 cm, n = 7 per group. H, The expression of EGFR and p‐EGFR was detected with an immunohistochemical staining assay. I, The expression of SOX2 was detected in cell lysates from CAL‐27 xenograft tumors. J, A schematic diagram illustrating the associations between EGFR and SOX2 and cancer stemness and autophagy is shown. Data are presented as the mean ± SEM. * P
    Figure Legend Snippet: The in vitro and in vivo antitumor effects of gefitinib against CAL‐27 cells were reversed by autophagy inhibition. A, CAL‐27 cells were treated with gefitinib (10 μmol/L) for 24 h, and cell proliferation activities were evaluated by EdU labeling. The images were captured with confocal microscopy. B, Cells were treated as described in (A), and cell invasion activities were evaluated through transwell assays. C, Representative micrographs and statistical data of oncosphere growth of CAL‐27 cells treated with gefitinib (10 μmol/L) are shown. D‐G, BALB/c nude mice were s.c. inoculated with CAL‐27 cells (1.5 × 10 5 ). The mice were treated with gefitinib (6.5 mg/kg/day) alone or together with 3‐MA (30 mg/kg/day) from day 7 after tumor inoculation. Data are shown from representative mice (n = 7 per group, D), as is the tumor growth curve (mean volume ± SEM) at the indicated time points (E). F, G, Tumors (F) and quantified tumor weights (G) are shown. Scale bar, 1.5 cm, n = 7 per group. H, The expression of EGFR and p‐EGFR was detected with an immunohistochemical staining assay. I, The expression of SOX2 was detected in cell lysates from CAL‐27 xenograft tumors. J, A schematic diagram illustrating the associations between EGFR and SOX2 and cancer stemness and autophagy is shown. Data are presented as the mean ± SEM. * P

    Techniques Used: In Vitro, In Vivo, Inhibition, Labeling, Confocal Microscopy, Mouse Assay, Expressing, Immunohistochemistry, Staining

    EGFR signal activation induces phosphorylation of SOX2 at Tyr277. A, CAL‐27 cells were treated with EGF (100 ng/mL) for 1 h. Before EGF stimulation, cells were pretreated with gefitinib (10 μmol/L) for 24 h with or without 3‐MA (10 μmol/L). Whole cell lysates were immunoprecipitated with an anti‐SOX2 antibody, and the indicated proteins were evaluated with immunoblotting. B, CAL‐27 cells were transfected with Beclin‐1 siRNA for 24 h and treated with EGF (100 ng/mL) for 1 h. Before EGF stimulation, cells were pretreated with gefitinib (10 μmol/L) for 24 h with or without 3‐MA (10 μmol/L). Whole cell lysates were immunoprecipitated with an anti‐SOX2 antibody, and the indicated proteins were evaluated with immunoblotting. C, CAL‐27 cells were treated with gefitinib (10 μmol/L) for 24 hours. Whole cell lysates were detected with the indicated antibodies. D, The tyrosine phosphorylation site of SOX2 was predicted using a group‐based prediction system. E, The tyrosine phosphorylation of SOX2 was detected using anti‐Myc precipitates from HEK293T cells transfected with Myc‐tagged wild‐type SOX2 or the SOX2 Y277A mutant
    Figure Legend Snippet: EGFR signal activation induces phosphorylation of SOX2 at Tyr277. A, CAL‐27 cells were treated with EGF (100 ng/mL) for 1 h. Before EGF stimulation, cells were pretreated with gefitinib (10 μmol/L) for 24 h with or without 3‐MA (10 μmol/L). Whole cell lysates were immunoprecipitated with an anti‐SOX2 antibody, and the indicated proteins were evaluated with immunoblotting. B, CAL‐27 cells were transfected with Beclin‐1 siRNA for 24 h and treated with EGF (100 ng/mL) for 1 h. Before EGF stimulation, cells were pretreated with gefitinib (10 μmol/L) for 24 h with or without 3‐MA (10 μmol/L). Whole cell lysates were immunoprecipitated with an anti‐SOX2 antibody, and the indicated proteins were evaluated with immunoblotting. C, CAL‐27 cells were treated with gefitinib (10 μmol/L) for 24 hours. Whole cell lysates were detected with the indicated antibodies. D, The tyrosine phosphorylation site of SOX2 was predicted using a group‐based prediction system. E, The tyrosine phosphorylation of SOX2 was detected using anti‐Myc precipitates from HEK293T cells transfected with Myc‐tagged wild‐type SOX2 or the SOX2 Y277A mutant

    Techniques Used: Activation Assay, Immunoprecipitation, Transfection, Mutagenesis

    EGFR activation reduces SOX2 ubiquitination and perturbs its association with p62. A, CAL‐27 cells were stimulated with EGF (100 ng/mL) for 1 h. Before EGF stimulation, cells were pretreated with gefitinib (10 μmol/L) for 24 h. Whole cell lysates were immunoprecipitated with an anti‐SOX2 antibody, and the ubiquitination of SOX2 was evaluated with immunoblotting. B, SCC‐15 cells were stimulated with EGF (100 ng/mL) for 1 h. Before EGF stimulation, cells were pretreated with gefitinib (10 μmol/L) for 24 h. Whole cell lysates were immunoprecipitated with an anti‐SOX2 antibody, and the ubiquitination of SOX2 was evaluated with immunoblotting. C, Cell lysates from CAL‐27 cells with or without 1 hour of EGF (100 ng/mL) treatment were immunoprecipitated with an anti‐p62 antibody and blotted with the indicated antibody. D, Cell lysates from SCC‐15 cells with or without 1 hour of EGF (100 ng/ml) treatment were immunoprecipitated with an anti‐p62 antibody and blotted with the indicated antibody. E, Cell lysates from HEK293T cells transfected with the indicated plasmids were precipitated with an anti‐DDK antibody and blotted with an anti‐Myc antibody
    Figure Legend Snippet: EGFR activation reduces SOX2 ubiquitination and perturbs its association with p62. A, CAL‐27 cells were stimulated with EGF (100 ng/mL) for 1 h. Before EGF stimulation, cells were pretreated with gefitinib (10 μmol/L) for 24 h. Whole cell lysates were immunoprecipitated with an anti‐SOX2 antibody, and the ubiquitination of SOX2 was evaluated with immunoblotting. B, SCC‐15 cells were stimulated with EGF (100 ng/mL) for 1 h. Before EGF stimulation, cells were pretreated with gefitinib (10 μmol/L) for 24 h. Whole cell lysates were immunoprecipitated with an anti‐SOX2 antibody, and the ubiquitination of SOX2 was evaluated with immunoblotting. C, Cell lysates from CAL‐27 cells with or without 1 hour of EGF (100 ng/mL) treatment were immunoprecipitated with an anti‐p62 antibody and blotted with the indicated antibody. D, Cell lysates from SCC‐15 cells with or without 1 hour of EGF (100 ng/ml) treatment were immunoprecipitated with an anti‐p62 antibody and blotted with the indicated antibody. E, Cell lysates from HEK293T cells transfected with the indicated plasmids were precipitated with an anti‐DDK antibody and blotted with an anti‐Myc antibody

    Techniques Used: Activation Assay, Immunoprecipitation, Transfection

    SOX2 is an interaction partner of EGFR, and its expression level is under the control of EGFR signaling. A, The association of EGFR mRNA with overall survival of HNSCC was verified in the Gene Expression Profiling Interactive Analysis (GEPIA) database. B, The mRNA expression of EGFR in human HNSCC tissues and adjacent normal tissues was analyzed using the GEPIA platform. C, CAL‐27 cells were treated with gefitinib (10 μmol/L) for 24 h; cell extracts were then prepared, and the indicated proteins were evaluated with immunoblotting. D, SCC‐15 cells were treated with gefitinib (10 μmol/L) for 24 h; cell extracts were then prepared, and the indicated proteins were evaluated with immunoblotting. E, The association between the mRNA expression of EGFR and SOX2 was verified in the GEPIA database. F, Whole cell lysates from CAL‐27 cells were immunoprecipitated with an anti‐EGFR antibody and resolved by SDS‐PAGE followed by Coomassie blue staining. The bands were extracted from the gel, and six unique peptides from SOX2 were identified by LC‐MS/MS analysis. G, Anti‐EGFR coprecipitates from CAL‐27 cells were analyzed with an anti‐SOX2 antibody to verify the interaction between EGFR and SOX2. Data are shown as representative immunoblots from three independent assays. * P
    Figure Legend Snippet: SOX2 is an interaction partner of EGFR, and its expression level is under the control of EGFR signaling. A, The association of EGFR mRNA with overall survival of HNSCC was verified in the Gene Expression Profiling Interactive Analysis (GEPIA) database. B, The mRNA expression of EGFR in human HNSCC tissues and adjacent normal tissues was analyzed using the GEPIA platform. C, CAL‐27 cells were treated with gefitinib (10 μmol/L) for 24 h; cell extracts were then prepared, and the indicated proteins were evaluated with immunoblotting. D, SCC‐15 cells were treated with gefitinib (10 μmol/L) for 24 h; cell extracts were then prepared, and the indicated proteins were evaluated with immunoblotting. E, The association between the mRNA expression of EGFR and SOX2 was verified in the GEPIA database. F, Whole cell lysates from CAL‐27 cells were immunoprecipitated with an anti‐EGFR antibody and resolved by SDS‐PAGE followed by Coomassie blue staining. The bands were extracted from the gel, and six unique peptides from SOX2 were identified by LC‐MS/MS analysis. G, Anti‐EGFR coprecipitates from CAL‐27 cells were analyzed with an anti‐SOX2 antibody to verify the interaction between EGFR and SOX2. Data are shown as representative immunoblots from three independent assays. * P

    Techniques Used: Expressing, Immunoprecipitation, SDS Page, Staining, Liquid Chromatography with Mass Spectroscopy, Western Blot

    Inhibition of EGFR decreases SOX2 stability. A, CAL‐27 cells were treated with gefitinib (10 μmol/L) for 24 h. Total RNA was extracted, and the mRNA encoding SOX2 and β‐actin was detected by qPCR using specific primers. Data are presented as the mean ± SEM of three independent assays in triplicate. B, Quantitative analyses of SOX2 protein stability in gefitinib‐treated CAL‐27 cells in the presence of the protein synthesis inhibitor cycloheximide (CHX) (10 μg/mL) for the indicated times are shown (n = 3). Actin was used as a loading control for western blotting. C, Quantitative analyses of SOX2 degradation in the presence of CHX (10 μg/mL) and MG132 are shown (n = 3). D, Quantitative analyses of SOX2 degradation in the presence of CHX (10 μg/mL) and bafilomycin are shown (n = 3). Actin was used as a loading control for western blotting. Statistical significance between two groups was determined by Student's t test
    Figure Legend Snippet: Inhibition of EGFR decreases SOX2 stability. A, CAL‐27 cells were treated with gefitinib (10 μmol/L) for 24 h. Total RNA was extracted, and the mRNA encoding SOX2 and β‐actin was detected by qPCR using specific primers. Data are presented as the mean ± SEM of three independent assays in triplicate. B, Quantitative analyses of SOX2 protein stability in gefitinib‐treated CAL‐27 cells in the presence of the protein synthesis inhibitor cycloheximide (CHX) (10 μg/mL) for the indicated times are shown (n = 3). Actin was used as a loading control for western blotting. C, Quantitative analyses of SOX2 degradation in the presence of CHX (10 μg/mL) and MG132 are shown (n = 3). D, Quantitative analyses of SOX2 degradation in the presence of CHX (10 μg/mL) and bafilomycin are shown (n = 3). Actin was used as a loading control for western blotting. Statistical significance between two groups was determined by Student's t test

    Techniques Used: Inhibition, Real-time Polymerase Chain Reaction, Western Blot

    53) Product Images from "Dihomo-γ-linolenic acid inhibits several key cellular processes associated with atherosclerosis"

    Article Title: Dihomo-γ-linolenic acid inhibits several key cellular processes associated with atherosclerosis

    Journal: Biochimica et Biophysica Acta. Molecular Basis of Disease

    doi: 10.1016/j.bbadis.2019.06.011

    PGE1, a key metabolite of DGLA, inhibits macrophage pro-inflammatory gene expression and chemokine-driven monocytic migration. (A), THP-1 macrophages were pre-incubated for 24 h with 100 μM DGLA (+) or vehicle (−) followed by a further 24 h stimulation with 250 U/ml IFN-γ (+) or its vehicle (−). Media was collected and lipids extracted for measurement using HPLC-MS. Graphs display concentration of PGE1 (ng/ml from 4 × 10 6 cells) from three independent experiments (mean ± SEM). (B), THP-1 macrophages were pre-incubated for 1 h with the indicated concentration of PGE1 (+) or DMSO vehicle (−). The cells were then treated for 3 h with 250 U/ml IFN-γ (+) or its vehicle (−). Total RNA was subjected to RT-qPCR using primers against MCP-1, ICAM-1 or GAPDH. The mRNA levels were calculated using the comparative Ct method and normalized to the housekeeping gene with values from cells pre-incubated with vehicle and then treated with IFN-γ given an arbitrary value of 1. Graphs display normalized gene expression (mean ± SEM) from three independent experiments. (C), migration assays were carried out with THP-1 monocytes incubated for 3 h with 10 μM PGE1 (+) or vehicle (−) using MCP-1 (20 ng/ml) as the chemoattractant. Cells incubated with vehicle in the absence MCP-1 were also included for comparative purposes. Monocyte migration was calculated by counting the number of cells that had migrated across a cell insert and expressed as a percentage of total input cells. Graph displays percentage migration (mean ± SEM), with MCP-1-driven migration in the presence of vehicle arbitrarily assigned as 100%. Statistical analysis was performed using a Kruskal-Wallis test with Dunn's post hoc test (A) or a One-way ANOVA with Tukey's post hoc analysis (B–C) (*, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001).
    Figure Legend Snippet: PGE1, a key metabolite of DGLA, inhibits macrophage pro-inflammatory gene expression and chemokine-driven monocytic migration. (A), THP-1 macrophages were pre-incubated for 24 h with 100 μM DGLA (+) or vehicle (−) followed by a further 24 h stimulation with 250 U/ml IFN-γ (+) or its vehicle (−). Media was collected and lipids extracted for measurement using HPLC-MS. Graphs display concentration of PGE1 (ng/ml from 4 × 10 6 cells) from three independent experiments (mean ± SEM). (B), THP-1 macrophages were pre-incubated for 1 h with the indicated concentration of PGE1 (+) or DMSO vehicle (−). The cells were then treated for 3 h with 250 U/ml IFN-γ (+) or its vehicle (−). Total RNA was subjected to RT-qPCR using primers against MCP-1, ICAM-1 or GAPDH. The mRNA levels were calculated using the comparative Ct method and normalized to the housekeeping gene with values from cells pre-incubated with vehicle and then treated with IFN-γ given an arbitrary value of 1. Graphs display normalized gene expression (mean ± SEM) from three independent experiments. (C), migration assays were carried out with THP-1 monocytes incubated for 3 h with 10 μM PGE1 (+) or vehicle (−) using MCP-1 (20 ng/ml) as the chemoattractant. Cells incubated with vehicle in the absence MCP-1 were also included for comparative purposes. Monocyte migration was calculated by counting the number of cells that had migrated across a cell insert and expressed as a percentage of total input cells. Graph displays percentage migration (mean ± SEM), with MCP-1-driven migration in the presence of vehicle arbitrarily assigned as 100%. Statistical analysis was performed using a Kruskal-Wallis test with Dunn's post hoc test (A) or a One-way ANOVA with Tukey's post hoc analysis (B–C) (*, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001).

    Techniques Used: Expressing, Migration, Incubation, High Performance Liquid Chromatography, Mass Spectrometry, Concentration Assay, Quantitative RT-PCR

    54) Product Images from "LipidBlast - in-silico tandem mass spectrometry database for lipid identification"

    Article Title: LipidBlast - in-silico tandem mass spectrometry database for lipid identification

    Journal: Nature methods

    doi: 10.1038/nmeth.2551

    Creation, validation and application of in-silico generated tandem mass spectra in LipidBlast (a) New lipid compound structures were created using combinatorial chemistry approaches. A scaffold of the lipid core structure and linker are connected to fatty acyls with different chain lengths and different degrees of unsaturation. (b) The reference tandem spectra (upper panel) are used to simulate the mass spectral fragmentations and ion abundances of the in-silico spectra (lower panel). The compound shown here is phosphatidylcholine PC(16:0/16:1) at precursor m/z =732.55 [M+H] + . (c) T andem mass spectra are obtained from LC-MS/MS or direct-infusion experiments. The MS/MS spectra are submitted to LipidBlast MS/MS search. An m/z precursor ion filter serves as first powerful filter and a subsequent product ion match creates a library hit score that is related to the level of confidence for the compound annotation.
    Figure Legend Snippet: Creation, validation and application of in-silico generated tandem mass spectra in LipidBlast (a) New lipid compound structures were created using combinatorial chemistry approaches. A scaffold of the lipid core structure and linker are connected to fatty acyls with different chain lengths and different degrees of unsaturation. (b) The reference tandem spectra (upper panel) are used to simulate the mass spectral fragmentations and ion abundances of the in-silico spectra (lower panel). The compound shown here is phosphatidylcholine PC(16:0/16:1) at precursor m/z =732.55 [M+H] + . (c) T andem mass spectra are obtained from LC-MS/MS or direct-infusion experiments. The MS/MS spectra are submitted to LipidBlast MS/MS search. An m/z precursor ion filter serves as first powerful filter and a subsequent product ion match creates a library hit score that is related to the level of confidence for the compound annotation.

    Techniques Used: In Silico, Generated, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

    55) Product Images from "Effects of metformin on hyperglycemia in an experimental model of tacrolimus- and sirolimus-induced diabetic rats"

    Article Title: Effects of metformin on hyperglycemia in an experimental model of tacrolimus- and sirolimus-induced diabetic rats

    Journal: The Korean Journal of Internal Medicine

    doi: 10.3904/kjim.2015.394

    Effects of metformin (MET) on pancreatic islet size in tacrolimus (TAC)- or sirolimus (SRL)-induced pancreatic islet injury. (A) Immunostaining for insulin showing pancreatic islet morphology and size in the experimental group. Note that irregular islet boundaries and vacuolization (arrowheads) in the TAC and SRL groups. (B) Quantitative analysis of insulin-positive areas in islets. Note the significantly reduced islet size in the TAC and TAC + MET groups but not in the SRL and SRL + MET groups. The results are expressed as the mean ± SE of nine individual animals. VH, vehicle group. a p
    Figure Legend Snippet: Effects of metformin (MET) on pancreatic islet size in tacrolimus (TAC)- or sirolimus (SRL)-induced pancreatic islet injury. (A) Immunostaining for insulin showing pancreatic islet morphology and size in the experimental group. Note that irregular islet boundaries and vacuolization (arrowheads) in the TAC and SRL groups. (B) Quantitative analysis of insulin-positive areas in islets. Note the significantly reduced islet size in the TAC and TAC + MET groups but not in the SRL and SRL + MET groups. The results are expressed as the mean ± SE of nine individual animals. VH, vehicle group. a p

    Techniques Used: Immunostaining

    Effects of metformin (MET) on the expression of adenosine monophosphate-activated protein kinase (AMPK) during treatment with tacrolimus (TAC) or sirolimus (SRL). Representative immunoblot of phosphorylated (p-AMPK) and total AMPK (t-AMPK) in primary cultured rat islets treated with TAC or SRL with or without MET. The results of quantitative analysis are expressed as a ratio of p-AMPK to t-AMPK. The density in the vehicle group (VH) was assigned a relative value of 100%. The results are expressed as the mean ± SE of at least three independent experiments. a p
    Figure Legend Snippet: Effects of metformin (MET) on the expression of adenosine monophosphate-activated protein kinase (AMPK) during treatment with tacrolimus (TAC) or sirolimus (SRL). Representative immunoblot of phosphorylated (p-AMPK) and total AMPK (t-AMPK) in primary cultured rat islets treated with TAC or SRL with or without MET. The results of quantitative analysis are expressed as a ratio of p-AMPK to t-AMPK. The density in the vehicle group (VH) was assigned a relative value of 100%. The results are expressed as the mean ± SE of at least three independent experiments. a p

    Techniques Used: Expressing, Cell Culture

    Experimental design for this study. After a low-salt diet for 1 week, animals were divided into five groups of nine rats each and were treated with vehicle group (VH), tacrolimus (TAC), sirolimus (SRL), or TAC or SRL plus metformin (MET). S.C., subcutaneous; P.O., oral gavage.
    Figure Legend Snippet: Experimental design for this study. After a low-salt diet for 1 week, animals were divided into five groups of nine rats each and were treated with vehicle group (VH), tacrolimus (TAC), sirolimus (SRL), or TAC or SRL plus metformin (MET). S.C., subcutaneous; P.O., oral gavage.

    Techniques Used:

    Effects of metformin (MET) on tacrolimus (TAC)- or sirolimus (SRL)-induced pancreatic islet dysfunction. (A) Intraperitoneal glucose tolerance test. (B) Area under the curve for glucose (AUCg). (C) Plasma insulin concentration. Note that the glucose and insulin concentrations were restored in the SRL + MET group compared with the SRL group but not in the TAC and TAC + MET groups. The results are expressed as the mean ± SE of nine individual animals. VH, vehicle group. a p
    Figure Legend Snippet: Effects of metformin (MET) on tacrolimus (TAC)- or sirolimus (SRL)-induced pancreatic islet dysfunction. (A) Intraperitoneal glucose tolerance test. (B) Area under the curve for glucose (AUCg). (C) Plasma insulin concentration. Note that the glucose and insulin concentrations were restored in the SRL + MET group compared with the SRL group but not in the TAC and TAC + MET groups. The results are expressed as the mean ± SE of nine individual animals. VH, vehicle group. a p

    Techniques Used: Concentration Assay

    Direct effects of metformin (MET) on insulin secretion by tacrolimus (TAC) or sirolimus (SRL) assessed by the glucose-stimulated insulin secretion (GSIS) test. Insulin release in response to glucose was significantly lower in the TAC and SRL groups compared with the vehicle group. Note that the GSIS was significantly increased by MET combined with SRL but not by TAC compared with the corresponding non-MET-treated group. The results are expressed as the mean ± SE of at least three independent experiments. a p
    Figure Legend Snippet: Direct effects of metformin (MET) on insulin secretion by tacrolimus (TAC) or sirolimus (SRL) assessed by the glucose-stimulated insulin secretion (GSIS) test. Insulin release in response to glucose was significantly lower in the TAC and SRL groups compared with the vehicle group. Note that the GSIS was significantly increased by MET combined with SRL but not by TAC compared with the corresponding non-MET-treated group. The results are expressed as the mean ± SE of at least three independent experiments. a p

    Techniques Used:

    56) Product Images from "A Novel LC System Embeds Analytes in Pre-formed Gradients for Rapid, Ultra-robust Proteomics *"

    Article Title: A Novel LC System Embeds Analytes in Pre-formed Gradients for Rapid, Ultra-robust Proteomics *

    Journal: Molecular & Cellular Proteomics : MCP

    doi: 10.1074/mcp.TIR118.000853

    Evosep One methods and chromatographic performance. A , Extracted peaks of synthetic peptides (colored) in a HeLa background (gray). The inset illustrates the extracted peak properties. B , For ease of use, five optimized methods have been pre-set to provide the best performance to time compromise. They are defined by the total number of samples that can be run per day rather than referring to the length of the gradient. The peak width and peak capacity values are averages on a HeLa digest with spiked in synthetic peptides (for details see supplemental Fig. S10–S14 ). C , Technical replicates of a digest of the UPS1 Proteomic Standard were injected 200 times with the 200 samples/day method. The number of identified proteins for each sample is shown as a bar graph in chronological order.
    Figure Legend Snippet: Evosep One methods and chromatographic performance. A , Extracted peaks of synthetic peptides (colored) in a HeLa background (gray). The inset illustrates the extracted peak properties. B , For ease of use, five optimized methods have been pre-set to provide the best performance to time compromise. They are defined by the total number of samples that can be run per day rather than referring to the length of the gradient. The peak width and peak capacity values are averages on a HeLa digest with spiked in synthetic peptides (for details see supplemental Fig. S10–S14 ). C , Technical replicates of a digest of the UPS1 Proteomic Standard were injected 200 times with the 200 samples/day method. The number of identified proteins for each sample is shown as a bar graph in chronological order.

    Techniques Used: Injection

    Rapid generation of mammalian cell line proteomes. A , Two scan modes for the acquisition of DIA data were devised and tested. B , Average number of precursors, identified peptides and protein groups for five HeLa measurements with 21 min gradients on the Evosep One. C , Number of proteins quantified with a coefficient of variation (CV) below 20 and 10%.
    Figure Legend Snippet: Rapid generation of mammalian cell line proteomes. A , Two scan modes for the acquisition of DIA data were devised and tested. B , Average number of precursors, identified peptides and protein groups for five HeLa measurements with 21 min gradients on the Evosep One. C , Number of proteins quantified with a coefficient of variation (CV) below 20 and 10%.

    Techniques Used:

    57) Product Images from "Aging Disrupts the Circadian Patterns of Protein Expression in the Murine Hippocampus"

    Article Title: Aging Disrupts the Circadian Patterns of Protein Expression in the Murine Hippocampus

    Journal: Frontiers in Aging Neuroscience

    doi: 10.3389/fnagi.2019.00368

    Aging disrupts the hippocampal circadian proteome. (A) Experimental design and workflow of the MS-based analysis of proteins extracted from hippocampal tissues of young (9–10 weeks old) and middle-aged (44–52 weeks old) C57BL/6J mice. Samples were collected every 4 h over 2 days, and proteins extracted from tissues of individual mice were digested with trypsin, fractionated, and analyzed by an Orbitrap Elite mass spectrometer. (B) Proteome coverage: Venn diagram displaying the number of proteins quantified in at least two biological replicates per time point in young or middle-aged mice and overlap between ages. (C) Circadian proteins detected in young or middle-aged mice using the Perseus periodicity algorithm (period = 23.6 h; q -value
    Figure Legend Snippet: Aging disrupts the hippocampal circadian proteome. (A) Experimental design and workflow of the MS-based analysis of proteins extracted from hippocampal tissues of young (9–10 weeks old) and middle-aged (44–52 weeks old) C57BL/6J mice. Samples were collected every 4 h over 2 days, and proteins extracted from tissues of individual mice were digested with trypsin, fractionated, and analyzed by an Orbitrap Elite mass spectrometer. (B) Proteome coverage: Venn diagram displaying the number of proteins quantified in at least two biological replicates per time point in young or middle-aged mice and overlap between ages. (C) Circadian proteins detected in young or middle-aged mice using the Perseus periodicity algorithm (period = 23.6 h; q -value

    Techniques Used: Mouse Assay, Mass Spectrometry

    58) Product Images from "S-Glutathionylated Serine Proteinase Inhibitors as Plasma Biomarkers in Assessing Response to Redox-Modulating Drugs"

    Article Title: S-Glutathionylated Serine Proteinase Inhibitors as Plasma Biomarkers in Assessing Response to Redox-Modulating Drugs

    Journal: Cancer research

    doi: 10.1158/0008-5472.CAN-11-4088

    S -glutathionylation of serpins A1 and A3 is time and dose dependent and impacts protein structure. Recombinant serpin A1 and A3 were treated with 1 mmol/L GSH and 40 µmol/L of PABA/NO for 0 to 30 minutes (A) or 0 to 100 µmol/L of PABA/NO
    Figure Legend Snippet: S -glutathionylation of serpins A1 and A3 is time and dose dependent and impacts protein structure. Recombinant serpin A1 and A3 were treated with 1 mmol/L GSH and 40 µmol/L of PABA/NO for 0 to 30 minutes (A) or 0 to 100 µmol/L of PABA/NO

    Techniques Used: Recombinant

    59) Product Images from "Dok-7 regulates neuromuscular synapse formation by recruiting Crk and Crk-L"

    Article Title: Dok-7 regulates neuromuscular synapse formation by recruiting Crk and Crk-L

    Journal: Genes & Development

    doi: 10.1101/gad.1977710

    Dok-7 Y396 and Y406 phosphopeptides bind to Crk-L and Crk in myotube lysates. ( A ) The amino acid sequences of the biotinylated Dok-7 phosphopeptides. ( B ) The Dok-7 biotin-pY406 phosphopeptide purified an ∼37-kDa doublet. The doublet failed to bind the nonphosphorylated biotin-Y406 peptide, and binding to the biotin-pY406 phosphopeptide was inhibited by addition of excess phosphopeptide. The ∼37-kDa doublet was identified as Crk-II and Crk-L by Q-TOF MS. ( C ) Western blots of myotube proteins isolated by binding to pY396 or pY406 phosphopeptides were probed with antibodies to Nck1/2, Crk-I, Crk-II, Crk-L, Abl, or Arg. Both phosphopeptides bound Crk-I, Crk-II, and Crk-L; in addition, the pY406 phosphopeptide bound Nck1/2. Neither phosphopeptide bound Abl or Arg. See also Supplemental Figure S2.
    Figure Legend Snippet: Dok-7 Y396 and Y406 phosphopeptides bind to Crk-L and Crk in myotube lysates. ( A ) The amino acid sequences of the biotinylated Dok-7 phosphopeptides. ( B ) The Dok-7 biotin-pY406 phosphopeptide purified an ∼37-kDa doublet. The doublet failed to bind the nonphosphorylated biotin-Y406 peptide, and binding to the biotin-pY406 phosphopeptide was inhibited by addition of excess phosphopeptide. The ∼37-kDa doublet was identified as Crk-II and Crk-L by Q-TOF MS. ( C ) Western blots of myotube proteins isolated by binding to pY396 or pY406 phosphopeptides were probed with antibodies to Nck1/2, Crk-I, Crk-II, Crk-L, Abl, or Arg. Both phosphopeptides bound Crk-I, Crk-II, and Crk-L; in addition, the pY406 phosphopeptide bound Nck1/2. Neither phosphopeptide bound Abl or Arg. See also Supplemental Figure S2.

    Techniques Used: Purification, Binding Assay, Mass Spectrometry, Western Blot, Isolation

    60) Product Images from "Protein Kinase G Phosphorylates Mosquito-Borne Flavivirus NS5 "

    Article Title: Protein Kinase G Phosphorylates Mosquito-Borne Flavivirus NS5

    Journal: Journal of Virology

    doi: 10.1128/JVI.00271-09

    MALDI-TOF analysis of in vitro-phosphorylated DENV NS5 generated by trypsin digestion and purified from E. coli . The six-His-tagged, purified full length of DENV NS5 (amino acid coordinate number G1-L901) was incubated in the presence of bovine lung PKG
    Figure Legend Snippet: MALDI-TOF analysis of in vitro-phosphorylated DENV NS5 generated by trypsin digestion and purified from E. coli . The six-His-tagged, purified full length of DENV NS5 (amino acid coordinate number G1-L901) was incubated in the presence of bovine lung PKG

    Techniques Used: In Vitro, Generated, Purification, Incubation

    Schematic of DENV NS5 phosphopeptides identified by MALDI-TOF analysis. Seven peptides were found to have a mass 80 Da greater than calculated when all residues were assumed to be unphosphorylated, and each lost 80 Da upon phosphatase treatment. The sequence
    Figure Legend Snippet: Schematic of DENV NS5 phosphopeptides identified by MALDI-TOF analysis. Seven peptides were found to have a mass 80 Da greater than calculated when all residues were assumed to be unphosphorylated, and each lost 80 Da upon phosphatase treatment. The sequence

    Techniques Used: Sequencing

    Mass spectrometric analysis of DENV NS5 peptides generated by trypsin digestion after expression in HEK293T cells. (A) MALDI-TOF spectra of a singly charged monoisotopic peak of the peptides. Double asterisks indicate the phosphorylated peptide corresponding
    Figure Legend Snippet: Mass spectrometric analysis of DENV NS5 peptides generated by trypsin digestion after expression in HEK293T cells. (A) MALDI-TOF spectra of a singly charged monoisotopic peak of the peptides. Double asterisks indicate the phosphorylated peptide corresponding

    Techniques Used: Generated, Expressing

    61) Product Images from "Desumoylation of the Endoplasmic Reticulum Membrane VAP Family Protein Scs2 by Ulp1 and SUMO Regulation of the Inositol Synthesis Pathway"

    Article Title: Desumoylation of the Endoplasmic Reticulum Membrane VAP Family Protein Scs2 by Ulp1 and SUMO Regulation of the Inositol Synthesis Pathway

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.05878-11

    Mutation of Scs2 lysine 180 abolishes Scs2 sumoylation. (A) Domain architecture of Scs2. MSP, major sperm protein domain; TM, transmembrane domain; V K KE, sumoylation consensus motif. (B) Mutating lysines 180 and 181 to arginines in the consensus motif blocks accumulation of sumoyla ted Scs2 in ulp1ts cells. ulp1ts scs2Δ mutant cells expressing pRS316-SCS2, pRS316-scs2-K180,181R, or an empty vector (-) were lysed, and extracts were analyzed by Western blotting. (C) The K180R single mutation, but not the K181R mutation, blocks Scs2 sumoylation. ulp1ts scs2Δ mutant cells bearing the YCplac33 vector, YCplac33-HA-SCS2, or the indicated lysine mutant alleles were lysed and assayed by immunoblotting.
    Figure Legend Snippet: Mutation of Scs2 lysine 180 abolishes Scs2 sumoylation. (A) Domain architecture of Scs2. MSP, major sperm protein domain; TM, transmembrane domain; V K KE, sumoylation consensus motif. (B) Mutating lysines 180 and 181 to arginines in the consensus motif blocks accumulation of sumoyla ted Scs2 in ulp1ts cells. ulp1ts scs2Δ mutant cells expressing pRS316-SCS2, pRS316-scs2-K180,181R, or an empty vector (-) were lysed, and extracts were analyzed by Western blotting. (C) The K180R single mutation, but not the K181R mutation, blocks Scs2 sumoylation. ulp1ts scs2Δ mutant cells bearing the YCplac33 vector, YCplac33-HA-SCS2, or the indicated lysine mutant alleles were lysed and assayed by immunoblotting.

    Techniques Used: Mutagenesis, Expressing, Plasmid Preparation, Western Blot

    62) Product Images from "Sequence-Based Analysis of Secondary-Metabolite Biosynthesis in Marine Actinobacteria ▿Sequence-Based Analysis of Secondary-Metabolite Biosynthesis in Marine Actinobacteria ▿ ‡"

    Article Title: Sequence-Based Analysis of Secondary-Metabolite Biosynthesis in Marine Actinobacteria ▿Sequence-Based Analysis of Secondary-Metabolite Biosynthesis in Marine Actinobacteria ▿ ‡

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.02852-09

    Tetronomycin and actinofuranone structure confirmation. (A and B) High-resolution mass (A) and structure (B) of tetronomycin (sodium salt); (C and D) high-resolution mass (C) and structure (D) of actinofuranone B. MW, molecular weight; MF, molecular formula;
    Figure Legend Snippet: Tetronomycin and actinofuranone structure confirmation. (A and B) High-resolution mass (A) and structure (B) of tetronomycin (sodium salt); (C and D) high-resolution mass (C) and structure (D) of actinofuranone B. MW, molecular weight; MF, molecular formula;

    Techniques Used: Molecular Weight

    63) Product Images from "A biochemical fluorometric method for assessing the oxidative properties of HDL [S]"

    Article Title: A biochemical fluorometric method for assessing the oxidative properties of HDL [S]

    Journal: Journal of Lipid Research

    doi: 10.1194/jlr.D018937

    Influence of method of HDL isolation on measurements of HDL oxidative activity. Influence of method of HDL isolation on DHR oxidation was assessed using 100 µl in a 384-well flat-bottom plate, and the rate of change in fluorescence was measured
    Figure Legend Snippet: Influence of method of HDL isolation on measurements of HDL oxidative activity. Influence of method of HDL isolation on DHR oxidation was assessed using 100 µl in a 384-well flat-bottom plate, and the rate of change in fluorescence was measured

    Techniques Used: Isolation, Activity Assay, Fluorescence

    Low inter-assay variability between measurements of HDL effects. Oxidation of DHR in the presence of six different samples of HDL was assessed as described in , using 2.5 µg (cholesterol) of added HDL. The data (means of quadruplicates)
    Figure Legend Snippet: Low inter-assay variability between measurements of HDL effects. Oxidation of DHR in the presence of six different samples of HDL was assessed as described in , using 2.5 µg (cholesterol) of added HDL. The data (means of quadruplicates)

    Techniques Used: Inter Assay

    Correlation of DHR method with previous cell-free method. Twenty samples (10 from healthy volunteers and 10 from patients with rheumatoid arthritis) of HDL isolated using precipitation with dextran sulfate were assessed for their ability to inhibit DHR
    Figure Legend Snippet: Correlation of DHR method with previous cell-free method. Twenty samples (10 from healthy volunteers and 10 from patients with rheumatoid arthritis) of HDL isolated using precipitation with dextran sulfate were assessed for their ability to inhibit DHR

    Techniques Used: Isolation

    Correlation of DHR method with cell-based method. Thirty samples of FPLC-purified HDL were assessed for their ability to inhibit DHR oxidation as shown in , and their HDL inflammatory index was determined in a cell-based assay as described in “Materials
    Figure Legend Snippet: Correlation of DHR method with cell-based method. Thirty samples of FPLC-purified HDL were assessed for their ability to inhibit DHR oxidation as shown in , and their HDL inflammatory index was determined in a cell-based assay as described in “Materials

    Techniques Used: Fast Protein Liquid Chromatography, Purification, Cell Based Assay

    The DHR assay can detect established effect of statins on functional properties of HDL in animal models of atherosclerosis. A: By using FPLC, HDL was isolated from three pooled plasma samples from LDLR −/− mice on Western diet (LDLR −/−
    Figure Legend Snippet: The DHR assay can detect established effect of statins on functional properties of HDL in animal models of atherosclerosis. A: By using FPLC, HDL was isolated from three pooled plasma samples from LDLR −/− mice on Western diet (LDLR −/−

    Techniques Used: Functional Assay, Fast Protein Liquid Chromatography, Isolation, Mouse Assay, Western Blot

    HDL from healthy donors significantly inhibits the oxidation of DHR compared with HDL from CAD patients, as determined by LC/MS/MS. HDL was isolated from the serum of healthy and CAD-patient donors by either sequential UC or FPLC. Control (non-CAD) and
    Figure Legend Snippet: HDL from healthy donors significantly inhibits the oxidation of DHR compared with HDL from CAD patients, as determined by LC/MS/MS. HDL was isolated from the serum of healthy and CAD-patient donors by either sequential UC or FPLC. Control (non-CAD) and

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Isolation, Fast Protein Liquid Chromatography

    Spontaneous oxidation of DHR and effect of added HDL. In a 96-well flat-bottom plate 50 µM DHR was added to each well alone or with 5 µg (cholesterol) of FPLC-purified HDL from a donor with anti-inflammatory HDL (aHDL) and from a donor
    Figure Legend Snippet: Spontaneous oxidation of DHR and effect of added HDL. In a 96-well flat-bottom plate 50 µM DHR was added to each well alone or with 5 µg (cholesterol) of FPLC-purified HDL from a donor with anti-inflammatory HDL (aHDL) and from a donor

    Techniques Used: Fast Protein Liquid Chromatography, Purification

    64) Product Images from "Phosphatidylcholine could protect the defect of zearalenone exposure on follicular development and oocyte maturation"

    Article Title: Phosphatidylcholine could protect the defect of zearalenone exposure on follicular development and oocyte maturation

    Journal: Aging (Albany NY)

    doi: 10.18632/aging.101660

    Metabolic profiles of granulosa cell (GC) media within or without ZEA-treatment. Utilizing the UPLC-QTOF detection method, total ion current diagrams vs. retention time of each group of GC media are shown ( A ), with Z1-Z10 mean 10 µM ZEA groups 1-10 and C1-C10 mean control groups 1-10 (0 µM ZEA). ( B ) Significantly different metabolites between the culture media with or without 10 µM ZEA treatment were marked in the cloud plot of mass to charge ratio (m/z) vs. retention time. Red point mean the ion of certain m/z showed decrease in ZEA groups compare with control groups. And green point in return, with the size of the point reflect the significance. Three-dimensional peak diagram of retention time, signal intensity, and m/z in blank control media ( C ), GC media without ZEA ( D ) or with ZEA treatment ( E ). ( F ) Principle component analysis (PCA) of the metabolic profiles among each sample between GC media without (red point) or with (cyan point) ZEA treatment.
    Figure Legend Snippet: Metabolic profiles of granulosa cell (GC) media within or without ZEA-treatment. Utilizing the UPLC-QTOF detection method, total ion current diagrams vs. retention time of each group of GC media are shown ( A ), with Z1-Z10 mean 10 µM ZEA groups 1-10 and C1-C10 mean control groups 1-10 (0 µM ZEA). ( B ) Significantly different metabolites between the culture media with or without 10 µM ZEA treatment were marked in the cloud plot of mass to charge ratio (m/z) vs. retention time. Red point mean the ion of certain m/z showed decrease in ZEA groups compare with control groups. And green point in return, with the size of the point reflect the significance. Three-dimensional peak diagram of retention time, signal intensity, and m/z in blank control media ( C ), GC media without ZEA ( D ) or with ZEA treatment ( E ). ( F ) Principle component analysis (PCA) of the metabolic profiles among each sample between GC media without (red point) or with (cyan point) ZEA treatment.

    Techniques Used:

    65) Product Images from "Munc13-Like skMLCK Variants Cannot Mimic the Unique Calmodulin Binding Mode of Munc13 as Evidenced by Chemical Cross-Linking and Mass Spectrometry"

    Article Title: Munc13-Like skMLCK Variants Cannot Mimic the Unique Calmodulin Binding Mode of Munc13 as Evidenced by Chemical Cross-Linking and Mass Spectrometry

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0075119

    Nano-HPLC/nano-ESI-LTQ-Orbitrap-MS/MS analysis of a cross-linked peptide mixture between CaM and skMLCK F19E/L31W peptide. The reaction was conducted at 1 2+ with a 50-fold molar excess of SBC (30 min, irradiation 8 J/cm 2 ,). (A) Mass spectrum (MS) obtained at an LC retention time of 59.94 min. The 4+ charged signal of a cross-linked product at m/z 635.077 is shown enlarged. (B) Fragment ion mass spectrum (CID-MS/MS). The cross-linked product comprises amino acids 91–106 of CaM (α-peptide in red) and amino acids 1–4 of skMLCK F19E/L31W (β-peptide in blue), in which Lys-94 of CaM is connected to Leu-1 of skMLCK F19E/L31W.
    Figure Legend Snippet: Nano-HPLC/nano-ESI-LTQ-Orbitrap-MS/MS analysis of a cross-linked peptide mixture between CaM and skMLCK F19E/L31W peptide. The reaction was conducted at 1 2+ with a 50-fold molar excess of SBC (30 min, irradiation 8 J/cm 2 ,). (A) Mass spectrum (MS) obtained at an LC retention time of 59.94 min. The 4+ charged signal of a cross-linked product at m/z 635.077 is shown enlarged. (B) Fragment ion mass spectrum (CID-MS/MS). The cross-linked product comprises amino acids 91–106 of CaM (α-peptide in red) and amino acids 1–4 of skMLCK F19E/L31W (β-peptide in blue), in which Lys-94 of CaM is connected to Leu-1 of skMLCK F19E/L31W.

    Techniques Used: High Performance Liquid Chromatography, Mass Spectrometry, Chick Chorioallantoic Membrane Assay, Irradiation

    Nano-HPLC/nano-ESI-LTQ-Orbitrap-MS/MS analysis of a cross-linked peptide mixture between CaM and skMLCK peptide. The reaction was conducted at 1 2+ with a 50-fold molar excess of BS 2 G for 60 min. (A) Mass spectrum (MS) obtained at an LC retention time of 70.42 min. The 4+ charged signal of a cross-linked product at m/z 783.398 is shown enlarged. (B) Fragment ion mass spectrum (CID-MS/MS). The cross-linked product comprises amino acids 14–30 of CaM (α-peptide in red) and amino acids 8–18 of skMLCK (β-peptide in blue), in which Lys-21 of CaM is connected to Lys-8 of skMLCK.
    Figure Legend Snippet: Nano-HPLC/nano-ESI-LTQ-Orbitrap-MS/MS analysis of a cross-linked peptide mixture between CaM and skMLCK peptide. The reaction was conducted at 1 2+ with a 50-fold molar excess of BS 2 G for 60 min. (A) Mass spectrum (MS) obtained at an LC retention time of 70.42 min. The 4+ charged signal of a cross-linked product at m/z 783.398 is shown enlarged. (B) Fragment ion mass spectrum (CID-MS/MS). The cross-linked product comprises amino acids 14–30 of CaM (α-peptide in red) and amino acids 8–18 of skMLCK (β-peptide in blue), in which Lys-21 of CaM is connected to Lys-8 of skMLCK.

    Techniques Used: High Performance Liquid Chromatography, Mass Spectrometry, Chick Chorioallantoic Membrane Assay

    66) Product Images from "Ebselen inhibits QSOX1 enzymatic activity and suppresses invasion of pancreatic and renal cancer cell lines"

    Article Title: Ebselen inhibits QSOX1 enzymatic activity and suppresses invasion of pancreatic and renal cancer cell lines

    Journal: Oncotarget

    doi:

    Ebselen binds covalently to rQSOX1 at cysteine residues A. Charge deconvoluted ESI-LC-MS spectra of rQSOX (top spectrum) in the absence of substrate, rQSOX1 treated with 5 μM ebselen (middle spectrum), and rQSOX1 treated with 5 μM ebselen in the presence of DTT substrate (bottom spectrum). The mass of an ebselen adduct is 274.18 Da. The left shaded column indicates the mass range of unmodified rQSOX1. Peak A is the mass of rQSOX1 without the N-terminal methionine and peak B is the mass of rQSOX1 with N-acetyl Met. The middle shaded column represents the mass of rQSOX1 with a single bound ebselen molecule with peaks labeled A+1Eb and B+1Eb. The right shaded column represents the mass of rQSOX1 with two ebselen adducts (A+2Eb and B+2Eb). B. QSOX1 pretreated with ebselen blocks the binding of fluoresceinated maleimide. A 5-fold molar excess of ebselen was added to 5 μg rQSOX1 prior to maleimide addition. UV imaging of SDS-PAGE gels show that maleimide binding to rQSOX1 is blocked by the addition of ebselen.
    Figure Legend Snippet: Ebselen binds covalently to rQSOX1 at cysteine residues A. Charge deconvoluted ESI-LC-MS spectra of rQSOX (top spectrum) in the absence of substrate, rQSOX1 treated with 5 μM ebselen (middle spectrum), and rQSOX1 treated with 5 μM ebselen in the presence of DTT substrate (bottom spectrum). The mass of an ebselen adduct is 274.18 Da. The left shaded column indicates the mass range of unmodified rQSOX1. Peak A is the mass of rQSOX1 without the N-terminal methionine and peak B is the mass of rQSOX1 with N-acetyl Met. The middle shaded column represents the mass of rQSOX1 with a single bound ebselen molecule with peaks labeled A+1Eb and B+1Eb. The right shaded column represents the mass of rQSOX1 with two ebselen adducts (A+2Eb and B+2Eb). B. QSOX1 pretreated with ebselen blocks the binding of fluoresceinated maleimide. A 5-fold molar excess of ebselen was added to 5 μg rQSOX1 prior to maleimide addition. UV imaging of SDS-PAGE gels show that maleimide binding to rQSOX1 is blocked by the addition of ebselen.

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Labeling, Binding Assay, Imaging, SDS Page

    67) Product Images from "Selective Proteomic Analysis of Antibiotic-Tolerant Cellular Subpopulations in Pseudomonas aeruginosa Biofilms"

    Article Title: Selective Proteomic Analysis of Antibiotic-Tolerant Cellular Subpopulations in Pseudomonas aeruginosa Biofilms

    Journal: mBio

    doi: 10.1128/mBio.01593-17

    Targeted proteomic analysis of a biofilm subpopulation. (A) Detection of mCherry fluorescence (green) in live biofilms was used to locate cells expressing the NLL-MetRS–mCherry fusion. Biofilms were counterstained with SYTO9 (magenta) immediately before imaging. (B) Following Anl treatment, BONCAT labeling in biofilms was visualized by treating fixed biofilms with DBCO-TAMRA (green). Biofilms were counterstained with SYTO9 (magenta). Colocalization of fluorescent signals is displayed in white. For panels A and B, cross-sections were reconstructed from confocal image stacks. (C) Proteins identified following BONCAT enrichment from P rpoS : nll-mc and P trc : nll-mc strains. (D) Quantification of relative protein abundances following enrichment from both strains. Ribosomal proteins are shown in orange. Proteins discussed in the text are indicated by gene name. The complete set of LFQ values, ratios, and adjusted P values is provided in Data Set S1 . (E) Spatial distribution of GFP expression (green) under control of the rpoS or algP promoters in live biofilms. Biofilms were counterstained with SYTO62 (magenta).
    Figure Legend Snippet: Targeted proteomic analysis of a biofilm subpopulation. (A) Detection of mCherry fluorescence (green) in live biofilms was used to locate cells expressing the NLL-MetRS–mCherry fusion. Biofilms were counterstained with SYTO9 (magenta) immediately before imaging. (B) Following Anl treatment, BONCAT labeling in biofilms was visualized by treating fixed biofilms with DBCO-TAMRA (green). Biofilms were counterstained with SYTO9 (magenta). Colocalization of fluorescent signals is displayed in white. For panels A and B, cross-sections were reconstructed from confocal image stacks. (C) Proteins identified following BONCAT enrichment from P rpoS : nll-mc and P trc : nll-mc strains. (D) Quantification of relative protein abundances following enrichment from both strains. Ribosomal proteins are shown in orange. Proteins discussed in the text are indicated by gene name. The complete set of LFQ values, ratios, and adjusted P values is provided in Data Set S1 . (E) Spatial distribution of GFP expression (green) under control of the rpoS or algP promoters in live biofilms. Biofilms were counterstained with SYTO62 (magenta).

    Techniques Used: Fluorescence, Expressing, Imaging, Labeling

    68) Product Images from "Heart-type fatty-acid-binding protein (FABP3) is a lysophosphatidic acid-binding protein in human coronary artery endothelial cells"

    Article Title: Heart-type fatty-acid-binding protein (FABP3) is a lysophosphatidic acid-binding protein in human coronary artery endothelial cells

    Journal: FEBS Open Bio

    doi: 10.1016/j.fob.2014.10.014

    Liquid chromatography–electrospray ionization-mass spectrometry (LC–ESI-MS) quantification of lysophosphatidic acid (LPA; 18:1) in the nuclear fraction of human coronary artery endothelial cells. (A) The nuclear and cytosolic extracts (20 μg each) were analyzed by western blotting using specific antibodies against histone-H3 (nuclear marker) and glyceraldehyde 3-phosphate dehydrogenase (cytoplasmic marker). (B) The samples were diluted to 1:1000 in methanol/water (95:5, v/v) containing 5 mM ammonium formate, and the amount of LPA (18:1) was measured by LC–MS/MS. LC–MS/MS was performed using a quadrupole–linear ion trap hybrid MS, 5500 QTRAP system. Data are expressed as the intensity; n = 3.
    Figure Legend Snippet: Liquid chromatography–electrospray ionization-mass spectrometry (LC–ESI-MS) quantification of lysophosphatidic acid (LPA; 18:1) in the nuclear fraction of human coronary artery endothelial cells. (A) The nuclear and cytosolic extracts (20 μg each) were analyzed by western blotting using specific antibodies against histone-H3 (nuclear marker) and glyceraldehyde 3-phosphate dehydrogenase (cytoplasmic marker). (B) The samples were diluted to 1:1000 in methanol/water (95:5, v/v) containing 5 mM ammonium formate, and the amount of LPA (18:1) was measured by LC–MS/MS. LC–MS/MS was performed using a quadrupole–linear ion trap hybrid MS, 5500 QTRAP system. Data are expressed as the intensity; n = 3.

    Techniques Used: Liquid Chromatography, Mass Spectrometry, Western Blot, Marker, Liquid Chromatography with Mass Spectroscopy

    69) Product Images from "A Double-Barrel Liquid Chromatography-Tandem Mass Spectrometry (LC-MS/MS) System to Quantify 96 Interactomes per Day *"

    Article Title: A Double-Barrel Liquid Chromatography-Tandem Mass Spectrometry (LC-MS/MS) System to Quantify 96 Interactomes per Day *

    Journal: Molecular & Cellular Proteomics : MCP

    doi: 10.1074/mcp.O115.049460

    Workflow of the high-throughput LC-MS/MS protein interaction analysis pipeline. Both culturing of yeast cells and affinity purification are performed in 96-well plate format, thus parallelizing sample preparation and minimizing handling errors. LC-MS/MS analysis of 96 pull-down samples in 1 day is achieved through a double-barrel chromatography setup and the increased sequencing speed of the Q Exactive HF mass spectrometer.
    Figure Legend Snippet: Workflow of the high-throughput LC-MS/MS protein interaction analysis pipeline. Both culturing of yeast cells and affinity purification are performed in 96-well plate format, thus parallelizing sample preparation and minimizing handling errors. LC-MS/MS analysis of 96 pull-down samples in 1 day is achieved through a double-barrel chromatography setup and the increased sequencing speed of the Q Exactive HF mass spectrometer.

    Techniques Used: High Throughput Screening Assay, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Affinity Purification, Sample Prep, Chromatography, Sequencing

    Double-barrel chromatography with 14 min gradients on three pull-downs. ( A ) Base-peak chromatogram of a biological triplicate RSC8 pull-down run on the double-barrel LC-MS/MS setup. Chromatography in all cases is very reproducible. ( B ) Comparison of RSC8, SPT7 and SWI3 pull-downs; all measured in triplicates. The matrix of 36 correlation plots reveals high correlations between MaxLFQ intensities within triplicates. ( C ) Zoom into SPT7_02 versus the SWI3_01 correlation plot. While most proteins were detected with very similar MaxLFQ intensities, the two outlier populations marked in orange (SPT7) and blue (SWI3) represent the different complex members of the distinct protein complexes.
    Figure Legend Snippet: Double-barrel chromatography with 14 min gradients on three pull-downs. ( A ) Base-peak chromatogram of a biological triplicate RSC8 pull-down run on the double-barrel LC-MS/MS setup. Chromatography in all cases is very reproducible. ( B ) Comparison of RSC8, SPT7 and SWI3 pull-downs; all measured in triplicates. The matrix of 36 correlation plots reveals high correlations between MaxLFQ intensities within triplicates. ( C ) Zoom into SPT7_02 versus the SWI3_01 correlation plot. While most proteins were detected with very similar MaxLFQ intensities, the two outlier populations marked in orange (SPT7) and blue (SWI3) represent the different complex members of the distinct protein complexes.

    Techniques Used: Chromatography, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

    70) Product Images from "Dysfunction of PLA2G6 and CYP2C44-associated network signals imminent carcinogenesis from chronic inflammation to hepatocellular carcinoma"

    Article Title: Dysfunction of PLA2G6 and CYP2C44-associated network signals imminent carcinogenesis from chronic inflammation to hepatocellular carcinoma

    Journal: Journal of Molecular Cell Biology

    doi: 10.1093/jmcb/mjx021

    Validation of DNB, DEPs, and DCEs by TMT proteomic data. ( A ) Comparison between label-free and TMT profiles. For xcxx and xxcx, c means ‘must be changed’ during 3−5 months or 5−7 months, and x means ‘not required to be changed’. ( B ) Density curves of PCC between label-free profile and TMT profile in WHV/c- myc transgenic mice (red), C57BL/6 control mice (blue), and both mice (black). ( C ) A heatmap shows the reproduced dynamic profiles with validated DNB, DEPs, and linked (second) nodes of DCE links (PCC > 0.8) in WHV/c- myc transgenic mice. More information of 136 nodes is listed in Supplementary Table S5 , and second nodes of the DCEs in Supplementary Figure S10 .
    Figure Legend Snippet: Validation of DNB, DEPs, and DCEs by TMT proteomic data. ( A ) Comparison between label-free and TMT profiles. For xcxx and xxcx, c means ‘must be changed’ during 3−5 months or 5−7 months, and x means ‘not required to be changed’. ( B ) Density curves of PCC between label-free profile and TMT profile in WHV/c- myc transgenic mice (red), C57BL/6 control mice (blue), and both mice (black). ( C ) A heatmap shows the reproduced dynamic profiles with validated DNB, DEPs, and linked (second) nodes of DCE links (PCC > 0.8) in WHV/c- myc transgenic mice. More information of 136 nodes is listed in Supplementary Table S5 , and second nodes of the DCEs in Supplementary Figure S10 .

    Techniques Used: Periodic Counter-current Chromatography, Transgenic Assay, Mouse Assay

    DNB analysis in the critical transition model identifies the critical period from inflammation to HCC based on proteomic data. ( A − C ) Schematic illustrations of DNB method. ( A ) DNB method can identify the pre-cancer state at the critical period, by observing dynamic signals of the corresponding molecules in the dominant group. ( B ) DNB as a network signals the emergence of the critical transition. When the system approaches the pre-cancer state, PCC of molecule-pairs in DNB or dominant group ( PCC i ) increase, while PCC between molecules in this group and others ( PCC o ) decrease. ( C ) When the system approaches the pre-cancer state, DNB members strongly fluctuate or have high SD near the critical transition, compared with other disease-associated molecules. ( D and E ) Results of DNB analysis based on label-free proteomic data of 50 samples. ( D ) This series of diagrams visually show the three key criteria of DNB over five different periods during disease progression. PCC id , PCC od , and SD d are similarly calculated as the definitions of PCC i , PCC o , and SD , after comparing with the corresponding controls. ( E ) This series of networks graphically demonstrate the dynamic changes in the network structure and concentration variations of the identified DNB and DNB-coexpressed proteins. Clearly, DNB members are strongly correlated and fluctuated at the 5th month, which are recognized as the signals of the critical state. SD d is the differential deviation defined as the ratio of SD between transgenic mice and control mice at the same time point. PCC d is the differential correlation defined as the difference in absolute PCCs between transgenic mice and control mice at the same time point.
    Figure Legend Snippet: DNB analysis in the critical transition model identifies the critical period from inflammation to HCC based on proteomic data. ( A − C ) Schematic illustrations of DNB method. ( A ) DNB method can identify the pre-cancer state at the critical period, by observing dynamic signals of the corresponding molecules in the dominant group. ( B ) DNB as a network signals the emergence of the critical transition. When the system approaches the pre-cancer state, PCC of molecule-pairs in DNB or dominant group ( PCC i ) increase, while PCC between molecules in this group and others ( PCC o ) decrease. ( C ) When the system approaches the pre-cancer state, DNB members strongly fluctuate or have high SD near the critical transition, compared with other disease-associated molecules. ( D and E ) Results of DNB analysis based on label-free proteomic data of 50 samples. ( D ) This series of diagrams visually show the three key criteria of DNB over five different periods during disease progression. PCC id , PCC od , and SD d are similarly calculated as the definitions of PCC i , PCC o , and SD , after comparing with the corresponding controls. ( E ) This series of networks graphically demonstrate the dynamic changes in the network structure and concentration variations of the identified DNB and DNB-coexpressed proteins. Clearly, DNB members are strongly correlated and fluctuated at the 5th month, which are recognized as the signals of the critical state. SD d is the differential deviation defined as the ratio of SD between transgenic mice and control mice at the same time point. PCC d is the differential correlation defined as the difference in absolute PCCs between transgenic mice and control mice at the same time point.

    Techniques Used: Periodic Counter-current Chromatography, Concentration Assay, Transgenic Assay, Mouse Assay

    71) Product Images from "Crosstalk between Epigenetic Modulations in Valproic Acid Deactivated Hepatic Stellate Cells: An Integrated Protein and miRNA Profiling Study"

    Article Title: Crosstalk between Epigenetic Modulations in Valproic Acid Deactivated Hepatic Stellate Cells: An Integrated Protein and miRNA Profiling Study

    Journal: International Journal of Biological Sciences

    doi: 10.7150/ijbs.28642

    Regulation of VPA on LX2 miRNA and protein expression (A) Heatmap representation of the deregulated proteins in 2.5mM VPA treated versus untreated LX2 cells. Only differentially expressed proteins pass Avg VPA/Control filtering (V/C ≥ 1.333) were included. Red: up-regulated; Green: down-regulated. (B) Heatmap representation of the deregulated miRNAs in 2.5mM VPA treated versus untreated LX2 cells. Only differentially expressed miRNAs passing fold change filtering (fold change ≥ 2.0) were included. (C) Comparison of expression levels of 6 miRNAs in VPA treated LX2 cells by microarray and qRT-PCR assay. The correlation coefficient r = 0.8772, P value (two-tail) = 0.0217. (D) Comparison of expression levels of 6 proteins and encoding genes in VPA treated LX2 cells by iTraq and qRT-PCR assay respectively. The correlation coefficient r = 0.8469, P value (two-tail) = 0.0334. (E) Relative renilla luciferase activity of psiCHECK-2/HMGA1MRE103a×3 or psiCHECK-2/HMGA1MRE195×3 in the presence of miR-103a mimic or miR-195 mimic in 293T cells, the 293T cells co-transfected with miR-neg served as control, normalized to firefly luciferase activity. *** P
    Figure Legend Snippet: Regulation of VPA on LX2 miRNA and protein expression (A) Heatmap representation of the deregulated proteins in 2.5mM VPA treated versus untreated LX2 cells. Only differentially expressed proteins pass Avg VPA/Control filtering (V/C ≥ 1.333) were included. Red: up-regulated; Green: down-regulated. (B) Heatmap representation of the deregulated miRNAs in 2.5mM VPA treated versus untreated LX2 cells. Only differentially expressed miRNAs passing fold change filtering (fold change ≥ 2.0) were included. (C) Comparison of expression levels of 6 miRNAs in VPA treated LX2 cells by microarray and qRT-PCR assay. The correlation coefficient r = 0.8772, P value (two-tail) = 0.0217. (D) Comparison of expression levels of 6 proteins and encoding genes in VPA treated LX2 cells by iTraq and qRT-PCR assay respectively. The correlation coefficient r = 0.8469, P value (two-tail) = 0.0334. (E) Relative renilla luciferase activity of psiCHECK-2/HMGA1MRE103a×3 or psiCHECK-2/HMGA1MRE195×3 in the presence of miR-103a mimic or miR-195 mimic in 293T cells, the 293T cells co-transfected with miR-neg served as control, normalized to firefly luciferase activity. *** P

    Techniques Used: Expressing, Microarray, Quantitative RT-PCR, Luciferase, Activity Assay, Transfection

    VPA regulated miRNA expression through increased histone acetylation. (A) VPA treatment increased the global protein acetylation of LX2 cells as detected by western blot using an antibody against pan acetyl-lysine, the band for histone was about 15KD. (B) The transfection condition for LX2 cells was optimized by Cy3 labeled siRNA transfection control (Cy3-siTC), and a minimal concentration of 50nM was used in the present study according to transfection efficiency, ×200. (C) The expression of HDAC2 or 3 mRNA in siHDAC2 or 3 transfected LX2 cells was detected by qRT-PCR. (D) Knockdown of HDAC2 and HDAC3 by siRNAs enhanced the acetylation of Histone H3, detected by western blot using an antibody against acetylated lysine (K) 27 of histone H3 (AcH3K27). (E, F) The expression of VPA-miRNAs (E) and mRNAs of VPA-protein-encoding genes (F) in siHDAC2 and 3 co-transfected LX2 cells was detected by qRT-PCR, all expressions were compared to untreated control or non-targeting siRNA negative control (siNC), *** P
    Figure Legend Snippet: VPA regulated miRNA expression through increased histone acetylation. (A) VPA treatment increased the global protein acetylation of LX2 cells as detected by western blot using an antibody against pan acetyl-lysine, the band for histone was about 15KD. (B) The transfection condition for LX2 cells was optimized by Cy3 labeled siRNA transfection control (Cy3-siTC), and a minimal concentration of 50nM was used in the present study according to transfection efficiency, ×200. (C) The expression of HDAC2 or 3 mRNA in siHDAC2 or 3 transfected LX2 cells was detected by qRT-PCR. (D) Knockdown of HDAC2 and HDAC3 by siRNAs enhanced the acetylation of Histone H3, detected by western blot using an antibody against acetylated lysine (K) 27 of histone H3 (AcH3K27). (E, F) The expression of VPA-miRNAs (E) and mRNAs of VPA-protein-encoding genes (F) in siHDAC2 and 3 co-transfected LX2 cells was detected by qRT-PCR, all expressions were compared to untreated control or non-targeting siRNA negative control (siNC), *** P

    Techniques Used: Expressing, Western Blot, Transfection, Labeling, Concentration Assay, Quantitative RT-PCR, Negative Control

    VPA inhibits the proliferation and migration of LX2 cells. (A) The mRNA and protein expression of α-SMA and collagen I in LX2 cells treated by 2.5mM VPA for 24h or 48h were detected by qRT-PCR and western blot respectively, (B) The effects of VPA on LX2 cells proliferation were examined by EDU incorporation analyses. (C) Migration assay for VPA pretreated LX2 cells, ×200. *** P
    Figure Legend Snippet: VPA inhibits the proliferation and migration of LX2 cells. (A) The mRNA and protein expression of α-SMA and collagen I in LX2 cells treated by 2.5mM VPA for 24h or 48h were detected by qRT-PCR and western blot respectively, (B) The effects of VPA on LX2 cells proliferation were examined by EDU incorporation analyses. (C) Migration assay for VPA pretreated LX2 cells, ×200. *** P

    Techniques Used: Migration, Expressing, Quantitative RT-PCR, Western Blot

    72) Product Images from "Novel 5-fluorouracil-resistant human esophageal squamous cell carcinoma cells with dihydropyrimidine dehydrogenase overexpression"

    Article Title: Novel 5-fluorouracil-resistant human esophageal squamous cell carcinoma cells with dihydropyrimidine dehydrogenase overexpression

    Journal: American Journal of Cancer Research

    doi:

    5-FU resistance of TE-5R cells. TE-5 and TE-5R cells were treated with the indicated concentrations of 5-FU for 72 h, and cell viability was assessed using the WST-1 assay. A viability of 100% was defined as the amount of absorption at 450 nm in untreated cells. The mean value ± S.D. of six replicate wells from a representative experiment is shown. Each experiment was repeated at least three times, and consistent results were obtained. IC 50 values of TE-5 and TE-5R cells were 3.6 ± 1.1 and 55.5 ± 10.1 μM, respectively. Note that TE-5R cells were 15.6-fold more resistant to 5-FU in comparison with parental TE-5 cells.
    Figure Legend Snippet: 5-FU resistance of TE-5R cells. TE-5 and TE-5R cells were treated with the indicated concentrations of 5-FU for 72 h, and cell viability was assessed using the WST-1 assay. A viability of 100% was defined as the amount of absorption at 450 nm in untreated cells. The mean value ± S.D. of six replicate wells from a representative experiment is shown. Each experiment was repeated at least three times, and consistent results were obtained. IC 50 values of TE-5 and TE-5R cells were 3.6 ± 1.1 and 55.5 ± 10.1 μM, respectively. Note that TE-5R cells were 15.6-fold more resistant to 5-FU in comparison with parental TE-5 cells.

    Techniques Used: WST-1 Assay

    Intracellular 5-FU and FUPA concentrations in TE-5 and TE-5R cells treated with 5-FU. TE-5 and TE-5R cells (5 × 10 5 cells) were seeded in 6-well plates, and then treated with 5-FU (10 μM) for 24 h. Cells were harvested, and levels of 5-FU and the FUPA concentration were measured with liquid chromatography-tandem mass spectrometry. A. Intracellular 5-FU concentrations in TE-5 and TE-5R cells treated with 5-FU. Intracellular 5-FU concentrations in TE-5R cells were significantly lower than those in TE-5 cells (n = 3). *** P
    Figure Legend Snippet: Intracellular 5-FU and FUPA concentrations in TE-5 and TE-5R cells treated with 5-FU. TE-5 and TE-5R cells (5 × 10 5 cells) were seeded in 6-well plates, and then treated with 5-FU (10 μM) for 24 h. Cells were harvested, and levels of 5-FU and the FUPA concentration were measured with liquid chromatography-tandem mass spectrometry. A. Intracellular 5-FU concentrations in TE-5 and TE-5R cells treated with 5-FU. Intracellular 5-FU concentrations in TE-5R cells were significantly lower than those in TE-5 cells (n = 3). *** P

    Techniques Used: Concentration Assay, Liquid Chromatography, Mass Spectrometry

    Amplification of  DPYD  gene and subsequent DPD expression in TE-5R cells. A. Chromosome 1 copy number alteration in aCGH analysis. The vertical axis indicates the log (base 2) ratio of DNA expression. TE-5R harbored specific regional amplification of the short arm of chromosome 1 around 1p2 including the  DPYD  gene (1p21.3). Note that  LPHN2  and  PALMD  genes are not located in the specific amplified regions. B. qPCR analysis using  LPHN2 ,  DPYD  and  PALMD  gene probes. The  DPYD  gene is amplified to produce 10 copies in DNA samples derived from TE-5R cells, but not non-cancerous human genomic DNA or parental TE-5 cells. On the other hand,  LPHN2  and  PALMD  genes are not amplified in any samples. C. DPD mRNA expression levels in TE-5 and TE-5R cells. qPCR revealed significantly increased DPD mRNA expression in TE-5R compared with TE-5 cells. ** P
    Figure Legend Snippet: Amplification of DPYD gene and subsequent DPD expression in TE-5R cells. A. Chromosome 1 copy number alteration in aCGH analysis. The vertical axis indicates the log (base 2) ratio of DNA expression. TE-5R harbored specific regional amplification of the short arm of chromosome 1 around 1p2 including the DPYD gene (1p21.3). Note that LPHN2 and PALMD genes are not located in the specific amplified regions. B. qPCR analysis using LPHN2 , DPYD and PALMD gene probes. The DPYD gene is amplified to produce 10 copies in DNA samples derived from TE-5R cells, but not non-cancerous human genomic DNA or parental TE-5 cells. On the other hand, LPHN2 and PALMD genes are not amplified in any samples. C. DPD mRNA expression levels in TE-5 and TE-5R cells. qPCR revealed significantly increased DPD mRNA expression in TE-5R compared with TE-5 cells. ** P

    Techniques Used: Amplification, Expressing, Real-time Polymerase Chain Reaction, Derivative Assay

    Effects of DPD inhibitor on TE-5R cells. A DPD inhibitor, gimeracil, was added to the culture medium with the indicated concentrations of 5-FU at a molar ratio of 1:0.2 (5-FU:gimeracil) for 24 h. (i.e., 2 μM gimeracil to 10 μM 5-FU). (A) Intracellular 5-FU concentrations in TE-5R cells in the presence or absence of gimeracil. Intracellular 5-FU concentrations in TE-5R cells treated with 5-FU and gimeracil were markedly higher than those treated with 5-FU alone. (n = 3). *** P
    Figure Legend Snippet: Effects of DPD inhibitor on TE-5R cells. A DPD inhibitor, gimeracil, was added to the culture medium with the indicated concentrations of 5-FU at a molar ratio of 1:0.2 (5-FU:gimeracil) for 24 h. (i.e., 2 μM gimeracil to 10 μM 5-FU). (A) Intracellular 5-FU concentrations in TE-5R cells in the presence or absence of gimeracil. Intracellular 5-FU concentrations in TE-5R cells treated with 5-FU and gimeracil were markedly higher than those treated with 5-FU alone. (n = 3). *** P

    Techniques Used:

    73) Product Images from "Potent Mechanism-Based Inactivation Of Cytochrome P450 2B4 By 9-Ethynylphenanthrene: Implications For Allosteric Modulation Of Cytochrome P450 Catalysis"

    Article Title: Potent Mechanism-Based Inactivation Of Cytochrome P450 2B4 By 9-Ethynylphenanthrene: Implications For Allosteric Modulation Of Cytochrome P450 Catalysis

    Journal: Biochemistry

    doi: 10.1021/bi301567z

    Analysis of the molecular mass of the 9EP-inactivated CYP2B4 using ESI-LC/MS. CYP2B4 (1 μM) was inactivated by 10 μM 9EP in 50 mM KPi buffer (pH 7.4) in the presence of 0.5 μM CPR, 3 μM cyt b5 and 1 mM NADPH at 30 °C
    Figure Legend Snippet: Analysis of the molecular mass of the 9EP-inactivated CYP2B4 using ESI-LC/MS. CYP2B4 (1 μM) was inactivated by 10 μM 9EP in 50 mM KPi buffer (pH 7.4) in the presence of 0.5 μM CPR, 3 μM cyt b5 and 1 mM NADPH at 30 °C

    Techniques Used: Liquid Chromatography with Mass Spectroscopy

    74) Product Images from "Serum biomarkers of Burkholderia mallei infection elucidated by proteomic imaging of skin and lung abscesses"

    Article Title: Serum biomarkers of Burkholderia mallei infection elucidated by proteomic imaging of skin and lung abscesses

    Journal: Clinical Proteomics

    doi: 10.1186/s12014-015-9079-4

    Overview of the proteomics strategy for biomarker discovery. Abscesses of infection were microscopically identified in thin-sectioned tissues (formalin-fixed, embedded in paraffin) by histology (H E stained) and localization of bacteria by specific antibody (IHC). The tissue sections were next examined by imaging mass spectrometry (IMS) to identify analyte masses that were localized to the selected regions of interest. Using laser-capture microdissection of select regions of the tissue sections identified by IMS and histology, a more extensive proteomic analysis could then be performed by a technique that combines the physical separation capabilities of liquid chromatography (LC) with the sensitive mass analysis capabilities of mass spectrometry (LC-MS/MS). Finally, the LC-MS/MS data was compared to masses observed by IMS for highest confidence in biomarker identification.
    Figure Legend Snippet: Overview of the proteomics strategy for biomarker discovery. Abscesses of infection were microscopically identified in thin-sectioned tissues (formalin-fixed, embedded in paraffin) by histology (H E stained) and localization of bacteria by specific antibody (IHC). The tissue sections were next examined by imaging mass spectrometry (IMS) to identify analyte masses that were localized to the selected regions of interest. Using laser-capture microdissection of select regions of the tissue sections identified by IMS and histology, a more extensive proteomic analysis could then be performed by a technique that combines the physical separation capabilities of liquid chromatography (LC) with the sensitive mass analysis capabilities of mass spectrometry (LC-MS/MS). Finally, the LC-MS/MS data was compared to masses observed by IMS for highest confidence in biomarker identification.

    Techniques Used: Biomarker Assay, Infection, Staining, Immunohistochemistry, Imaging, Mass Spectrometry, Laser Capture Microdissection, Liquid Chromatography, Liquid Chromatography with Mass Spectroscopy

    75) Product Images from "The Arabidopsis O-fucosyltransferase SPINDLY activates nuclear growth repressor DELLA"

    Article Title: The Arabidopsis O-fucosyltransferase SPINDLY activates nuclear growth repressor DELLA

    Journal: Nature chemical biology

    doi: 10.1038/nchembio.2320

    SPY and SEC compete with each other in reciprocal modifications of RGA ( a ) Immunoblots showing fixed amounts of SPY and increasing levels of SEC in tobacco extracts that were co-expressed with FLAG-RGA. The blots were probed with anti-SEC, anti-SPY or anti-FLAG antibodies. Tobacco agro-infiltrations used mixed agrobacterium cultures containing FLAG-RGA GKG and/or Myc-SPY, and/or Myc-SEC constructs (0.1× = OD 600 0.06; 0.3× = OD 600 0.2; 1× = OD 600 0.6). The reduction in FLAG-RGA mobility correlated with increasing amounts of co-expressed SEC, due to greater numbers of GlcNAcylated residues in FLAG-RGA. Full blot images are shown in Supplemetary Fig. 12 . ( b ) MS analysis shows that increasing expression of SEC results in elevated O -GlcNAcylation, but is inversely correlated with O -fucosylation levels in the RGA LSN peptide. Peptide abundances were calculated from MS 1 ion currents integrated across chromatographic elution of peptide. * MS data from Fig. 1d are included here for comparison.
    Figure Legend Snippet: SPY and SEC compete with each other in reciprocal modifications of RGA ( a ) Immunoblots showing fixed amounts of SPY and increasing levels of SEC in tobacco extracts that were co-expressed with FLAG-RGA. The blots were probed with anti-SEC, anti-SPY or anti-FLAG antibodies. Tobacco agro-infiltrations used mixed agrobacterium cultures containing FLAG-RGA GKG and/or Myc-SPY, and/or Myc-SEC constructs (0.1× = OD 600 0.06; 0.3× = OD 600 0.2; 1× = OD 600 0.6). The reduction in FLAG-RGA mobility correlated with increasing amounts of co-expressed SEC, due to greater numbers of GlcNAcylated residues in FLAG-RGA. Full blot images are shown in Supplemetary Fig. 12 . ( b ) MS analysis shows that increasing expression of SEC results in elevated O -GlcNAcylation, but is inversely correlated with O -fucosylation levels in the RGA LSN peptide. Peptide abundances were calculated from MS 1 ion currents integrated across chromatographic elution of peptide. * MS data from Fig. 1d are included here for comparison.

    Techniques Used: Size-exclusion Chromatography, Western Blot, Construct, Mass Spectrometry, Expressing

    O -fucosylation enhances RGA activity by promoting RGA binding to its interactors ( a ) In vitro pull-down assay. Recombinant GST, GST-BZR1, GST-PIF3 and GST-PIF4 bound to glutathione sepharose beads were used separately to pull-down FLAG-RGA from protein extracts from Arabidopsis in WT SPY or spy-8 background. Immunoblots containing input Arabidopsis extracts and pulled-down samples, and FLAG-RGA was detected using an anti-FLAG antibody. Full blot images are shown in Supplemetary Fig. 12 . Ponceau S-stained blots showed similar amounts of the GST/GST-fusion proteins were used in each pair of the pull-down assays ( Supplementary Fig. 8b ). ( b ) Relative binding of FLAG-RGA (from WT vs spy background) to GST-fusion proteins. The data are means ± SE (3 biological replicates). ** p
    Figure Legend Snippet: O -fucosylation enhances RGA activity by promoting RGA binding to its interactors ( a ) In vitro pull-down assay. Recombinant GST, GST-BZR1, GST-PIF3 and GST-PIF4 bound to glutathione sepharose beads were used separately to pull-down FLAG-RGA from protein extracts from Arabidopsis in WT SPY or spy-8 background. Immunoblots containing input Arabidopsis extracts and pulled-down samples, and FLAG-RGA was detected using an anti-FLAG antibody. Full blot images are shown in Supplemetary Fig. 12 . Ponceau S-stained blots showed similar amounts of the GST/GST-fusion proteins were used in each pair of the pull-down assays ( Supplementary Fig. 8b ). ( b ) Relative binding of FLAG-RGA (from WT vs spy background) to GST-fusion proteins. The data are means ± SE (3 biological replicates). ** p

    Techniques Used: Activity Assay, Binding Assay, In Vitro, Pull Down Assay, Recombinant, Western Blot, Staining

    RGA shows SPY-dependent O -fucosylation in planta ( a ) O -fucosylation sites in RGA. In RGA schematic (top), solid lines indicate two structurally disordered regions. The sequences of the DELLA domain and PolyS/T region are listed below the schematic. The LSN peptide was mono- O -fucosylated in FLAG-RGA from transgenic Arabidopsis. Additional O -fucosylation sites were identified using FLAG-RGA GKG from tobacco that was co-expressed with SPY. Boldface S/T indicates modification sites confirmed by MS/MS. Sequences shaded in gray contain one or more additional unmapped sites (see Supplementary Table 1 for detailed information). The boldface K in parenthesis indicates the extra Lys residue in RGA GKG . RGA pep1 and RGA pep2 are underlined. ( b ) LC-ETD-MS/MS analysis showed that O -fucosylation levels in the RGA LSN peptide were reduced in spy-8 compared to those in WT and sec-3 . ( c ) MS 1 spectra of the RGA LSN peptide from tobacco that expressed FLAG-RGA GKG alone (RGA), or co-expressed with SPY, spy-8 or SEC. Unmodified peptide, predicted m/z = 431.2130. Mono- O -fucosylated RGA peptide (predicted m/z = 467.7195) was only detected in RGA+SPY, whereas mono- O -GlcNAcylated peptide (predicted m/z = 481.9823) was only detected in RGA+SEC. ( d ) MS analysis showed that O -fucosylation levels in the RGA LSN peptide were dramatically increased only when co-expressed with SPY or 3TPR-SPY. Four biological replicates for WT SPY and SEC, and two biological replicates for mutant spy proteins were analyzed with similar results. Immunoblots showed similar ratios of SPY or mutant spy vs. FLAG-RGA GKG in tobacco protein extracts ( Supplementary Fig. 2 ).
    Figure Legend Snippet: RGA shows SPY-dependent O -fucosylation in planta ( a ) O -fucosylation sites in RGA. In RGA schematic (top), solid lines indicate two structurally disordered regions. The sequences of the DELLA domain and PolyS/T region are listed below the schematic. The LSN peptide was mono- O -fucosylated in FLAG-RGA from transgenic Arabidopsis. Additional O -fucosylation sites were identified using FLAG-RGA GKG from tobacco that was co-expressed with SPY. Boldface S/T indicates modification sites confirmed by MS/MS. Sequences shaded in gray contain one or more additional unmapped sites (see Supplementary Table 1 for detailed information). The boldface K in parenthesis indicates the extra Lys residue in RGA GKG . RGA pep1 and RGA pep2 are underlined. ( b ) LC-ETD-MS/MS analysis showed that O -fucosylation levels in the RGA LSN peptide were reduced in spy-8 compared to those in WT and sec-3 . ( c ) MS 1 spectra of the RGA LSN peptide from tobacco that expressed FLAG-RGA GKG alone (RGA), or co-expressed with SPY, spy-8 or SEC. Unmodified peptide, predicted m/z = 431.2130. Mono- O -fucosylated RGA peptide (predicted m/z = 467.7195) was only detected in RGA+SPY, whereas mono- O -GlcNAcylated peptide (predicted m/z = 481.9823) was only detected in RGA+SEC. ( d ) MS analysis showed that O -fucosylation levels in the RGA LSN peptide were dramatically increased only when co-expressed with SPY or 3TPR-SPY. Four biological replicates for WT SPY and SEC, and two biological replicates for mutant spy proteins were analyzed with similar results. Immunoblots showed similar ratios of SPY or mutant spy vs. FLAG-RGA GKG in tobacco protein extracts ( Supplementary Fig. 2 ).

    Techniques Used: Transgenic Assay, Modification, Mass Spectrometry, Size-exclusion Chromatography, Mutagenesis, Western Blot

    Related Articles

    Clone Assay:

    Article Title: Fibroblasts from bank voles inhabiting Chernobyl have increased resistance against oxidative and DNA stresses
    Article Snippet: CDNA was prepared from 0.5 μg of RNA using RevertAid H Minus First Strand cDNA Synthesis Kit (Thermofisher) with random primers as suggested by the manufacturer. .. For each gene the PCR product was cloned into pJet-plasmid as recommended by CloneJET PCR Cloning kit manual and used in qPCR to make a standard curve.

    Article Title: Alternative utrophin mRNAs contribute to phenotypic differences between dystrophin‐deficient mice and Duchenne muscular dystrophy
    Article Snippet: RNA ligase‐mediated (RLM) 5′ Rapid Amplification of cDNA Ends (5′RACE) RLM‐5′RACE (Ambion, Austin, USA) used 5 μg total decapped RNA from human (mix of 1.25 μg each of fetal heart/lung/thymus/skeletal muscle; Agilent, Santa Clara, USA) or mouse (mix of 2.5 μg each pooled whole embryo day 7 and 11; Clontech, Mountain View, USA). .. RNA ligase‐mediated (RLM) 5′ Rapid Amplification of cDNA Ends (5′RACE) RLM‐5′RACE (Ambion, Austin, USA) used 5 μg total decapped RNA from human (mix of 1.25 μg each of fetal heart/lung/thymus/skeletal muscle; Agilent, Santa Clara, USA) or mouse (mix of 2.5 μg each pooled whole embryo day 7 and 11; Clontech, Mountain View, USA).

    Amplification:

    Article Title: KDELR2 Competes with Measles Virus Envelope Proteins for Cellular Chaperones Reducing Their Chaperone-Mediated Cell Surface Transport
    Article Snippet: Isolated RNA was reverse transcribed in cDNA using the RevertAid first strand cDNA synthesis kit (Fermentas). .. Real time PCRs were performed using the 2X SYBR Green qPCR Master mix (Bimake, Houston, TX, USA ) and amplified on the LightCycler 2.0 real-time PCR system (Roche, Basel, Switzerland).

    Article Title: Elimination of p19ARF‐expressing cells protects against pulmonary emphysema in mice, et al. Elimination of p19ARF‐expressing cells protects against pulmonary emphysema in mice
    Article Snippet: 4.6 Real‐time PCR analysis The total RNA was isolated from lung tissues using the PureLink® RNA Mini kit (Thermo Fischer Scientific) and reverse‐transcribed using the PrimeScript RT reagent kit with a gDNA eraser (TAKARA BIO) according to the manufacturer's instructions. .. The following primers were utilized for the amplification of specific genes: ARF , 5′‐GCCGCACCGGAATCCT‐3′ (sense) and 5′‐TTGAGCAGAAGAGCTGCTACGT‐3′ (antisense); INK4a , 5′‐CCCAACGCCCCGAACT‐3′ (sense) and 5′‐GCAGAAGAGCTGCTACGTGAA‐3′ (antisense); IL‐1β , 5′‐GAATGCCACCTTTTGACAGTG‐3′ (sense) and 5′‐CTGGATGCTCTCATCAGGACA‐3′ (antisense); IL‐6 , 5′‐CAAGAAAGACAAAGCCAGAGTC‐3′ (sense) and 5′‐GAAATTGGGGTAGGAAGGAC‐3′ (antisense); MMP‐3 , 5′‐ACATGGAGACTTTGTCCCTTTTG‐3′ (sense) and 5′‐TTGGCTGAGTGGTAGAGTCCC‐3′ (antisense); MMP‐9 , 5′‐GCGTCGTGATCCCCACTTAC‐3′ (sense) and 5′‐CAGGCCGAATAGGAGCGTC‐3′ (antisense); MMP‐10 , 5′‐GAGCCACTAGCCATCCTGG‐3′ (sense) and 5′‐CTGAGCAAGATCCATGCTTGG‐3′ (antisense); MMP‐12 , 5′‐CTGCTCCCATGAATGACAGTG‐3′ (sense) and 5′‐AGTTGCTTCTAGCCAAAGAAC‐3′ (antisense); TIMP‐1 , 5′‐GCAACTCGGACCTGGTCATAA‐3′ (sense) and 5′‐CGGCCCGTGATGAGAAACT‐3′ (antisense); TIMP‐2 , 5′‐TCAGAGCCAAAGCAGTGAGC‐3′ (sense) and 5′‐GCCGTGTAGATAAACTCGATGTC‐3′ (antisense); GAPDH , 5′‐AATGGTGAAGGTCGGTGTG‐3′ (sense) and 5′‐GAAGATGGTGATGGGCTTCC‐3′ (antisense); DTR‐Luc (fusion), 5′‐TTTAGGTACCATAGGAGAGGAGG‐3′ (sense) and 5′‐CATCTTCCAGCGGATAGAATGGC‐3′ (antisense).

    Article Title: Circular RNA CpG island hypermethylation-associated silencing in human cancer
    Article Snippet: .. Back-splicing of the candidate circular RNAs Retro-transcribed cDNA corresponding to 50 ng of total RNA was amplified by PCR to confirm the expression of the candidate circRNAs in normal colon (Ambion, Thermo Fisher Scientific, Cat. # AM7986). ..

    Mass Spectrometry:

    Article Title: A Study into the ADP-Ribosylome of IFN-γ-Stimulated THP-1 Human Macrophage-like Cells Identifies ARTD8/PARP14 and ARTD9/PARP9 ADP-Ribosylation
    Article Snippet: .. LC–MS/MS Analysis All peptide samples were analyzed on an Orbitrap Fusion Lumos mass spectrometer fronted with an EASY-Spray Source, coupled to an Easy-nLC1000 HPLC pump (Thermo Fisher Scientific). .. The peptides were subjected to a dual column setup: an Acclaim PepMap RSLC C18 trap column, 75 μm × 20 mm (Thermo Fisher Scientific, Cat# 164261); and an EASY-Spray LC Column, 75 μm × 250 mm (Thermo Fisher Scientific, Cat# ES802).

    Quantitative RT-PCR:

    Article Title: CDK7 inhibitor suppresses tumor progression through blocking the cell cycle at the G2/M phase and inhibiting transcriptional activity in cervical cancer
    Article Snippet: .. RNA extraction and qRT-PCR The RNA was extracted using TRIZOL (Invitrogen) according to the manufacturer’s protocols. ..

    Article Title: Snakin-1 affects reactive oxygen species and ascorbic acid levels and hormone balance in potato
    Article Snippet: .. For qRT-PCR, RNA was treated with DNase (Invitrogen). .. Reverse transcription reactions were carried out with SuperScript III (Invitrogen) and random primers.

    Article Title: 25-Hydroxycholesterol and 27-hydroxycholesterol inhibit human rotavirus infection by sequestering viral particles into late endosomes
    Article Snippet: Briefly, extraction of total RNA from transfected or untransfected Caco2 cells was performed 72 h after transfection using TRIzol Reagent (Applied Biosystems, Monza, Italy). .. Quantitative RT-PCR was performed with 30 ng of cDNA using TaqMan Gene Expression Assay kits for OSBP and β-actin, TaqMan Fast Universal PCR Master Mix, and 7500 Fast Real-Time PCR System (Applied Biosystems).

    SYBR Green Assay:

    Article Title: Histone methylation regulates Hif‐1 signaling cascade in activation of hepatic stellate cells
    Article Snippet: Total RNA was isolated from LX‐2 cells by TRIzol Reagent, and 2 μg of RNA was reversely transcribed to cDNA with ReverTra Ace qPCR RT kit (K1622; Thermo, Carlsbad, CA, USA). .. Gene expression was quantified using FastStart Universal SYBR Green Master (Rox) (04913914001; Roche, Mannheim, Germany) on the real‐time PCR detection system (StepOnePlus™; ABI, Carlsbad, CA, USA).

    Article Title: CDK7 inhibitor suppresses tumor progression through blocking the cell cycle at the G2/M phase and inhibiting transcriptional activity in cervical cancer
    Article Snippet: RNA extraction and qRT-PCR The RNA was extracted using TRIZOL (Invitrogen) according to the manufacturer’s protocols. .. PCR was performed using QuantStudio™ Test Development Software (Life Technologies) through SYBR Green Ex TaqTM II (Takara).

    Article Title: KDELR2 Competes with Measles Virus Envelope Proteins for Cellular Chaperones Reducing Their Chaperone-Mediated Cell Surface Transport
    Article Snippet: Isolated RNA was reverse transcribed in cDNA using the RevertAid first strand cDNA synthesis kit (Fermentas). .. Real time PCRs were performed using the 2X SYBR Green qPCR Master mix (Bimake, Houston, TX, USA ) and amplified on the LightCycler 2.0 real-time PCR system (Roche, Basel, Switzerland).

    Article Title: Snakin-1 affects reactive oxygen species and ascorbic acid levels and hormone balance in potato
    Article Snippet: For qRT-PCR, RNA was treated with DNase (Invitrogen). .. All qRT-PCR were performed by an ABI PRISM 7500 (AppliedBiosystems) with SYBR Green master mix (Qiagen).

    Article Title: A role for long-chain acyl-CoA synthetase-4 (ACSL4) in diet-induced phospholipid remodeling and obesity-associated adipocyte dysfunction
    Article Snippet: .. RNA was quantified and checked for purity using the Nanodrop spectrophotometer (Nanodrop 1000, Wilmington, DE). cDNA was generated from equal amounts of RNA, and real-time quantitative PCR was performed using SYBR Green (Applied Biosystems 7300, Carlsbad, CA). ..

    Luciferase:

    Article Title: Functional sequestration of microRNA-122 from Hepatitis C Virus by circular RNA sponges
    Article Snippet: Paragraph title: MicroRNA binding site luciferase reporter assays ... Cells were harvested 2 days post-transfection, RNA was isolated using Trizol reagent (Thermo Fisher Scientific) and the RNeasy kit (Qiagen).

    Activity Assay:

    Article Title: Functional sequestration of microRNA-122 from Hepatitis C Virus by circular RNA sponges
    Article Snippet: The firefly luciferase activity was normalized to renilla luciferase activity and adjusted to LAPTM4A. .. Cells were harvested 2 days post-transfection, RNA was isolated using Trizol reagent (Thermo Fisher Scientific) and the RNeasy kit (Qiagen).

    Expressing:

    Article Title: Histone methylation regulates Hif‐1 signaling cascade in activation of hepatic stellate cells
    Article Snippet: Total RNA was isolated from LX‐2 cells by TRIzol Reagent, and 2 μg of RNA was reversely transcribed to cDNA with ReverTra Ace qPCR RT kit (K1622; Thermo, Carlsbad, CA, USA). .. Gene expression was quantified using FastStart Universal SYBR Green Master (Rox) (04913914001; Roche, Mannheim, Germany) on the real‐time PCR detection system (StepOnePlus™; ABI, Carlsbad, CA, USA).

    Article Title: Circular RNA CpG island hypermethylation-associated silencing in human cancer
    Article Snippet: .. Back-splicing of the candidate circular RNAs Retro-transcribed cDNA corresponding to 50 ng of total RNA was amplified by PCR to confirm the expression of the candidate circRNAs in normal colon (Ambion, Thermo Fisher Scientific, Cat. # AM7986). ..

    Article Title: 25-Hydroxycholesterol and 27-hydroxycholesterol inhibit human rotavirus infection by sequestering viral particles into late endosomes
    Article Snippet: Quantitative real-time reverse transcription (RT)-PCR The levels of siRNA-mediated silencing of OSBP or VAP-A expression were assessed by quantitative real-time reverse transcription (RT)-PCR. .. Briefly, extraction of total RNA from transfected or untransfected Caco2 cells was performed 72 h after transfection using TRIzol Reagent (Applied Biosystems, Monza, Italy).

    Article Title: Functional sequestration of microRNA-122 from Hepatitis C Virus by circular RNA sponges
    Article Snippet: After 16 h of expression, luciferase activity was measured using beetle juice and renilla juice (PJK) by a Centro LB 960 Microplate Luminometer (Berthold). .. Cells were harvested 2 days post-transfection, RNA was isolated using Trizol reagent (Thermo Fisher Scientific) and the RNeasy kit (Qiagen).

    High Performance Liquid Chromatography:

    Article Title: A Study into the ADP-Ribosylome of IFN-γ-Stimulated THP-1 Human Macrophage-like Cells Identifies ARTD8/PARP14 and ARTD9/PARP9 ADP-Ribosylation
    Article Snippet: .. LC–MS/MS Analysis All peptide samples were analyzed on an Orbitrap Fusion Lumos mass spectrometer fronted with an EASY-Spray Source, coupled to an Easy-nLC1000 HPLC pump (Thermo Fisher Scientific). .. The peptides were subjected to a dual column setup: an Acclaim PepMap RSLC C18 trap column, 75 μm × 20 mm (Thermo Fisher Scientific, Cat# 164261); and an EASY-Spray LC Column, 75 μm × 250 mm (Thermo Fisher Scientific, Cat# ES802).

    Transfection:

    Article Title: 25-Hydroxycholesterol and 27-hydroxycholesterol inhibit human rotavirus infection by sequestering viral particles into late endosomes
    Article Snippet: .. Briefly, extraction of total RNA from transfected or untransfected Caco2 cells was performed 72 h after transfection using TRIzol Reagent (Applied Biosystems, Monza, Italy). .. Concentration and purity of the extracted RNA were assessed by spectrophotometry (A260/A280).

    Article Title: Functional sequestration of microRNA-122 from Hepatitis C Virus by circular RNA sponges
    Article Snippet: For RT-PCR, HuH-7.5 cells were seeded on 6 cm dishes and transfected with 5 µg of the reporter plasmids. .. Cells were harvested 2 days post-transfection, RNA was isolated using Trizol reagent (Thermo Fisher Scientific) and the RNeasy kit (Qiagen).

    Sequencing:

    Article Title: Tomato DCL2b is required for the biosynthesis of 22-nt small RNAs, the resulting secondary siRNAs, and the host defense against ToMV
    Article Snippet: .. High-throughput sequencing of RNAs and sRNAs The total RNA samples were prepared from WT and DCL2b mutant adult leaves using TRIzol reagent (Invitrogen, USA). .. Paired-end mRNA libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) according to the manufacturer’s recommendations and were sequenced on an Illumina HiSeq 4000 platform; 150 bp reads were generated.

    Infection:

    Article Title: Complement Receptor C5aR1 Inhibition Reduces Pyroptosis in hDPP4-Transgenic Mice Infected with MERS-CoV
    Article Snippet: Isolation of RNA and Proteins THP-1 differentiated macrophages were lysed in TRIzol™ Reagent (Life Technologies, Carlsbad, CA, USA) at 24 h post-infection with MERS-CoV. .. Mice were euthanized by overdose inhalation of carbon dioxide at different time points after infection with MERS-CoV.

    Generated:

    Article Title: Tomato DCL2b is required for the biosynthesis of 22-nt small RNAs, the resulting secondary siRNAs, and the host defense against ToMV
    Article Snippet: High-throughput sequencing of RNAs and sRNAs The total RNA samples were prepared from WT and DCL2b mutant adult leaves using TRIzol reagent (Invitrogen, USA). .. Paired-end mRNA libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) according to the manufacturer’s recommendations and were sequenced on an Illumina HiSeq 4000 platform; 150 bp reads were generated.

    Article Title: A role for long-chain acyl-CoA synthetase-4 (ACSL4) in diet-induced phospholipid remodeling and obesity-associated adipocyte dysfunction
    Article Snippet: .. RNA was quantified and checked for purity using the Nanodrop spectrophotometer (Nanodrop 1000, Wilmington, DE). cDNA was generated from equal amounts of RNA, and real-time quantitative PCR was performed using SYBR Green (Applied Biosystems 7300, Carlsbad, CA). ..

    Polymerase Chain Reaction:

    Article Title: CDK7 inhibitor suppresses tumor progression through blocking the cell cycle at the G2/M phase and inhibiting transcriptional activity in cervical cancer
    Article Snippet: RNA extraction and qRT-PCR The RNA was extracted using TRIZOL (Invitrogen) according to the manufacturer’s protocols. .. PCR was performed using QuantStudio™ Test Development Software (Life Technologies) through SYBR Green Ex TaqTM II (Takara).

    Article Title: Fibroblasts from bank voles inhabiting Chernobyl have increased resistance against oxidative and DNA stresses
    Article Snippet: CDNA was prepared from 0.5 μg of RNA using RevertAid H Minus First Strand cDNA Synthesis Kit (Thermofisher) with random primers as suggested by the manufacturer. .. For each gene the PCR product was cloned into pJet-plasmid as recommended by CloneJET PCR Cloning kit manual and used in qPCR to make a standard curve.

    Article Title: Elimination of p19ARF‐expressing cells protects against pulmonary emphysema in mice, et al. Elimination of p19ARF‐expressing cells protects against pulmonary emphysema in mice
    Article Snippet: 4.6 Real‐time PCR analysis The total RNA was isolated from lung tissues using the PureLink® RNA Mini kit (Thermo Fischer Scientific) and reverse‐transcribed using the PrimeScript RT reagent kit with a gDNA eraser (TAKARA BIO) according to the manufacturer's instructions. .. PCR was performed on a Chromo4 PCR system (Bio‐Rad) using the KOD SYBR qPCR mix (TOYOBO).

    Article Title: Circular RNA CpG island hypermethylation-associated silencing in human cancer
    Article Snippet: .. Back-splicing of the candidate circular RNAs Retro-transcribed cDNA corresponding to 50 ng of total RNA was amplified by PCR to confirm the expression of the candidate circRNAs in normal colon (Ambion, Thermo Fisher Scientific, Cat. # AM7986). ..

    Article Title: Alternative utrophin mRNAs contribute to phenotypic differences between dystrophin‐deficient mice and Duchenne muscular dystrophy
    Article Snippet: RNA ligase‐mediated (RLM) 5′ Rapid Amplification of cDNA Ends (5′RACE) RLM‐5′RACE (Ambion, Austin, USA) used 5 μg total decapped RNA from human (mix of 1.25 μg each of fetal heart/lung/thymus/skeletal muscle; Agilent, Santa Clara, USA) or mouse (mix of 2.5 μg each pooled whole embryo day 7 and 11; Clontech, Mountain View, USA). .. Reverse primers within utrophin exon 6 were used for cDNA synthesis (500 ng template) with 5′‐outer adapter RACE primer for primary PCR (95 °C/1 min; 30 cycles 95 °C/45 s, 62 °C/45 s, 72 °C/1 min, final extension 72 °C/5 min).

    Article Title: 25-Hydroxycholesterol and 27-hydroxycholesterol inhibit human rotavirus infection by sequestering viral particles into late endosomes
    Article Snippet: Briefly, extraction of total RNA from transfected or untransfected Caco2 cells was performed 72 h after transfection using TRIzol Reagent (Applied Biosystems, Monza, Italy). .. Quantitative RT-PCR was performed with 30 ng of cDNA using TaqMan Gene Expression Assay kits for OSBP and β-actin, TaqMan Fast Universal PCR Master Mix, and 7500 Fast Real-Time PCR System (Applied Biosystems).

    Article Title: Functional sequestration of microRNA-122 from Hepatitis C Virus by circular RNA sponges
    Article Snippet: Cells were harvested 2 days post-transfection, RNA was isolated using Trizol reagent (Thermo Fisher Scientific) and the RNeasy kit (Qiagen). .. PCR was performed using specific primers for GAPDH mRNA (fwd: tgcaccaccaactgcttagc, rev: ggcatggactgtggtcatgag), renilla mRNA (fwd: aactggagcctgaggagttc, rev: tagctccctcgacaatagcg) and primers flanking the miRNA-122 binding site insertion in the firefly reporter 3′-UTR (fwd: ccaagaagggcggcaagat, rev: gccaactcagcttcctttcg).

    Binding Assay:

    Article Title: Functional sequestration of microRNA-122 from Hepatitis C Virus by circular RNA sponges
    Article Snippet: Paragraph title: MicroRNA binding site luciferase reporter assays ... Cells were harvested 2 days post-transfection, RNA was isolated using Trizol reagent (Thermo Fisher Scientific) and the RNeasy kit (Qiagen).

    Mutagenesis:

    Article Title: Tomato DCL2b is required for the biosynthesis of 22-nt small RNAs, the resulting secondary siRNAs, and the host defense against ToMV
    Article Snippet: .. High-throughput sequencing of RNAs and sRNAs The total RNA samples were prepared from WT and DCL2b mutant adult leaves using TRIzol reagent (Invitrogen, USA). .. Paired-end mRNA libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) according to the manufacturer’s recommendations and were sequenced on an Illumina HiSeq 4000 platform; 150 bp reads were generated.

    Isolation:

    Article Title: Histone methylation regulates Hif‐1 signaling cascade in activation of hepatic stellate cells
    Article Snippet: .. Total RNA was isolated from LX‐2 cells by TRIzol Reagent, and 2 μg of RNA was reversely transcribed to cDNA with ReverTra Ace qPCR RT kit (K1622; Thermo, Carlsbad, CA, USA). .. Gene expression was quantified using FastStart Universal SYBR Green Master (Rox) (04913914001; Roche, Mannheim, Germany) on the real‐time PCR detection system (StepOnePlus™; ABI, Carlsbad, CA, USA).

    Article Title: KDELR2 Competes with Measles Virus Envelope Proteins for Cellular Chaperones Reducing Their Chaperone-Mediated Cell Surface Transport
    Article Snippet: .. Isolated RNA was reverse transcribed in cDNA using the RevertAid first strand cDNA synthesis kit (Fermentas). ..

    Article Title: Complement Receptor C5aR1 Inhibition Reduces Pyroptosis in hDPP4-Transgenic Mice Infected with MERS-CoV
    Article Snippet: .. Isolation of RNA and Proteins THP-1 differentiated macrophages were lysed in TRIzol™ Reagent (Life Technologies, Carlsbad, CA, USA) at 24 h post-infection with MERS-CoV. .. Total RNA and proteins were isolated according to the reagent user guide.

    Article Title: Fibroblasts from bank voles inhabiting Chernobyl have increased resistance against oxidative and DNA stresses
    Article Snippet: Quantitative-PCR Total RNA was isolated with TRIzol® Reagent (Thermofisher) as suggested by the manufacturer. .. CDNA was prepared from 0.5 μg of RNA using RevertAid H Minus First Strand cDNA Synthesis Kit (Thermofisher) with random primers as suggested by the manufacturer.

    Article Title: Elimination of p19ARF‐expressing cells protects against pulmonary emphysema in mice, et al. Elimination of p19ARF‐expressing cells protects against pulmonary emphysema in mice
    Article Snippet: .. 4.6 Real‐time PCR analysis The total RNA was isolated from lung tissues using the PureLink® RNA Mini kit (Thermo Fischer Scientific) and reverse‐transcribed using the PrimeScript RT reagent kit with a gDNA eraser (TAKARA BIO) according to the manufacturer's instructions. .. PCR was performed on a Chromo4 PCR system (Bio‐Rad) using the KOD SYBR qPCR mix (TOYOBO).

    Article Title: Snakin-1 affects reactive oxygen species and ascorbic acid levels and hormone balance in potato
    Article Snippet: qRT-PCR RNA from young and fully expanded leaves was isolated using RNAquous kit (Ambion). .. For qRT-PCR, RNA was treated with DNase (Invitrogen).

    Article Title: Functional sequestration of microRNA-122 from Hepatitis C Virus by circular RNA sponges
    Article Snippet: .. Cells were harvested 2 days post-transfection, RNA was isolated using Trizol reagent (Thermo Fisher Scientific) and the RNeasy kit (Qiagen). .. To eliminate plasmid DNA contamination, samples were additionally treated with RQ1 DNase (Promega).

    Article Title: A role for long-chain acyl-CoA synthetase-4 (ACSL4) in diet-induced phospholipid remodeling and obesity-associated adipocyte dysfunction
    Article Snippet: 2.10 Real-time PCR Adipose tissue and liver RNA was extracted using Qiagen RNEasy Lipid Mini kits, and isolated adipocyte RNA was extracted using Qiagen RNEasy Plus Micro kit according to manufacturer's instructions. .. RNA was quantified and checked for purity using the Nanodrop spectrophotometer (Nanodrop 1000, Wilmington, DE). cDNA was generated from equal amounts of RNA, and real-time quantitative PCR was performed using SYBR Green (Applied Biosystems 7300, Carlsbad, CA).

    Mouse Assay:

    Article Title: Complement Receptor C5aR1 Inhibition Reduces Pyroptosis in hDPP4-Transgenic Mice Infected with MERS-CoV
    Article Snippet: Isolation of RNA and Proteins THP-1 differentiated macrophages were lysed in TRIzol™ Reagent (Life Technologies, Carlsbad, CA, USA) at 24 h post-infection with MERS-CoV. .. Mice were euthanized by overdose inhalation of carbon dioxide at different time points after infection with MERS-CoV.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: 25-Hydroxycholesterol and 27-hydroxycholesterol inhibit human rotavirus infection by sequestering viral particles into late endosomes
    Article Snippet: Paragraph title: Quantitative real-time reverse transcription (RT)-PCR ... Briefly, extraction of total RNA from transfected or untransfected Caco2 cells was performed 72 h after transfection using TRIzol Reagent (Applied Biosystems, Monza, Italy).

    Article Title: Functional sequestration of microRNA-122 from Hepatitis C Virus by circular RNA sponges
    Article Snippet: For RT-PCR, HuH-7.5 cells were seeded on 6 cm dishes and transfected with 5 µg of the reporter plasmids. .. Cells were harvested 2 days post-transfection, RNA was isolated using Trizol reagent (Thermo Fisher Scientific) and the RNeasy kit (Qiagen).

    Nested PCR:

    Article Title: Alternative utrophin mRNAs contribute to phenotypic differences between dystrophin‐deficient mice and Duchenne muscular dystrophy
    Article Snippet: RNA ligase‐mediated (RLM) 5′ Rapid Amplification of cDNA Ends (5′RACE) RLM‐5′RACE (Ambion, Austin, USA) used 5 μg total decapped RNA from human (mix of 1.25 μg each of fetal heart/lung/thymus/skeletal muscle; Agilent, Santa Clara, USA) or mouse (mix of 2.5 μg each pooled whole embryo day 7 and 11; Clontech, Mountain View, USA). .. Secondary nested PCR (1/10 input) used 26 cycles with utrophin exon 4 reverse and 5′RACE forward adapter primers.

    Purification:

    Article Title: Complement Receptor C5aR1 Inhibition Reduces Pyroptosis in hDPP4-Transgenic Mice Infected with MERS-CoV
    Article Snippet: Isolation of RNA and Proteins THP-1 differentiated macrophages were lysed in TRIzol™ Reagent (Life Technologies, Carlsbad, CA, USA) at 24 h post-infection with MERS-CoV. .. Lungs were harvested and total RNA was extracted and purified using an RNeasy Extraction Kit (Qiagen, Hilden, Germany).

    Article Title: Negative Cellular Effects of Urban Particulate Matter on Human Keratinocytes Are Mediated by P38 MAPK and NF-κB-dependent Expression of TRPV 1
    Article Snippet: .. Reverse Transcription HaCaT cells were grown in serum-free culture medium, with or without the indicated concentrations of UPM, for two days, and the total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and then purified using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. .. The purified RNA was then treated with DNase (Ambion, Austin, TX, USA) and analyzed using an Agilent Bioanalyzer (Agilent Technologies, Waldbronn, Germany) and a NanoDrop 8000 spectrophotometer (Thermo Scientific, Schwerte, Germany) to measure the RNA concentration, integrity, and purity.

    Plasmid Preparation:

    Article Title: Functional sequestration of microRNA-122 from Hepatitis C Virus by circular RNA sponges
    Article Snippet: Three wells of a 12-well dish of HuH-7.5 cells were transfected with 500 ng plasmid per well as replicates. .. Cells were harvested 2 days post-transfection, RNA was isolated using Trizol reagent (Thermo Fisher Scientific) and the RNeasy kit (Qiagen).

    Software:

    Article Title: CDK7 inhibitor suppresses tumor progression through blocking the cell cycle at the G2/M phase and inhibiting transcriptional activity in cervical cancer
    Article Snippet: RNA extraction and qRT-PCR The RNA was extracted using TRIZOL (Invitrogen) according to the manufacturer’s protocols. .. PCR was performed using QuantStudio™ Test Development Software (Life Technologies) through SYBR Green Ex TaqTM II (Takara).

    Article Title: Snakin-1 affects reactive oxygen species and ascorbic acid levels and hormone balance in potato
    Article Snippet: For qRT-PCR, RNA was treated with DNase (Invitrogen). .. Three biological and technical replicates for each gene were run and qRT-PCR data analyses and primer efficiencies were obtained with LinRegPCR software [ ].

    Real-time Polymerase Chain Reaction:

    Article Title: Histone methylation regulates Hif‐1 signaling cascade in activation of hepatic stellate cells
    Article Snippet: .. Total RNA was isolated from LX‐2 cells by TRIzol Reagent, and 2 μg of RNA was reversely transcribed to cDNA with ReverTra Ace qPCR RT kit (K1622; Thermo, Carlsbad, CA, USA). .. Gene expression was quantified using FastStart Universal SYBR Green Master (Rox) (04913914001; Roche, Mannheim, Germany) on the real‐time PCR detection system (StepOnePlus™; ABI, Carlsbad, CA, USA).

    Article Title: KDELR2 Competes with Measles Virus Envelope Proteins for Cellular Chaperones Reducing Their Chaperone-Mediated Cell Surface Transport
    Article Snippet: Paragraph title: 2.6. Real Time qPCR ... Isolated RNA was reverse transcribed in cDNA using the RevertAid first strand cDNA synthesis kit (Fermentas).

    Article Title: Fibroblasts from bank voles inhabiting Chernobyl have increased resistance against oxidative and DNA stresses
    Article Snippet: Paragraph title: Quantitative-PCR ... CDNA was prepared from 0.5 μg of RNA using RevertAid H Minus First Strand cDNA Synthesis Kit (Thermofisher) with random primers as suggested by the manufacturer.

    Article Title: Elimination of p19ARF‐expressing cells protects against pulmonary emphysema in mice, et al. Elimination of p19ARF‐expressing cells protects against pulmonary emphysema in mice
    Article Snippet: .. 4.6 Real‐time PCR analysis The total RNA was isolated from lung tissues using the PureLink® RNA Mini kit (Thermo Fischer Scientific) and reverse‐transcribed using the PrimeScript RT reagent kit with a gDNA eraser (TAKARA BIO) according to the manufacturer's instructions. .. PCR was performed on a Chromo4 PCR system (Bio‐Rad) using the KOD SYBR qPCR mix (TOYOBO).

    Article Title: 25-Hydroxycholesterol and 27-hydroxycholesterol inhibit human rotavirus infection by sequestering viral particles into late endosomes
    Article Snippet: Briefly, extraction of total RNA from transfected or untransfected Caco2 cells was performed 72 h after transfection using TRIzol Reagent (Applied Biosystems, Monza, Italy). .. Quantitative RT-PCR was performed with 30 ng of cDNA using TaqMan Gene Expression Assay kits for OSBP and β-actin, TaqMan Fast Universal PCR Master Mix, and 7500 Fast Real-Time PCR System (Applied Biosystems).

    Article Title: A role for long-chain acyl-CoA synthetase-4 (ACSL4) in diet-induced phospholipid remodeling and obesity-associated adipocyte dysfunction
    Article Snippet: .. RNA was quantified and checked for purity using the Nanodrop spectrophotometer (Nanodrop 1000, Wilmington, DE). cDNA was generated from equal amounts of RNA, and real-time quantitative PCR was performed using SYBR Green (Applied Biosystems 7300, Carlsbad, CA). ..

    RNA Extraction:

    Article Title: CDK7 inhibitor suppresses tumor progression through blocking the cell cycle at the G2/M phase and inhibiting transcriptional activity in cervical cancer
    Article Snippet: .. RNA extraction and qRT-PCR The RNA was extracted using TRIZOL (Invitrogen) according to the manufacturer’s protocols. ..

    Spectrophotometry:

    Article Title: Negative Cellular Effects of Urban Particulate Matter on Human Keratinocytes Are Mediated by P38 MAPK and NF-κB-dependent Expression of TRPV 1
    Article Snippet: Reverse Transcription HaCaT cells were grown in serum-free culture medium, with or without the indicated concentrations of UPM, for two days, and the total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and then purified using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. .. The purified RNA was then treated with DNase (Ambion, Austin, TX, USA) and analyzed using an Agilent Bioanalyzer (Agilent Technologies, Waldbronn, Germany) and a NanoDrop 8000 spectrophotometer (Thermo Scientific, Schwerte, Germany) to measure the RNA concentration, integrity, and purity.

    Article Title: 25-Hydroxycholesterol and 27-hydroxycholesterol inhibit human rotavirus infection by sequestering viral particles into late endosomes
    Article Snippet: Briefly, extraction of total RNA from transfected or untransfected Caco2 cells was performed 72 h after transfection using TRIzol Reagent (Applied Biosystems, Monza, Italy). .. Concentration and purity of the extracted RNA were assessed by spectrophotometry (A260/A280).

    Article Title: A role for long-chain acyl-CoA synthetase-4 (ACSL4) in diet-induced phospholipid remodeling and obesity-associated adipocyte dysfunction
    Article Snippet: .. RNA was quantified and checked for purity using the Nanodrop spectrophotometer (Nanodrop 1000, Wilmington, DE). cDNA was generated from equal amounts of RNA, and real-time quantitative PCR was performed using SYBR Green (Applied Biosystems 7300, Carlsbad, CA). ..

    Concentration Assay:

    Article Title: Negative Cellular Effects of Urban Particulate Matter on Human Keratinocytes Are Mediated by P38 MAPK and NF-κB-dependent Expression of TRPV 1
    Article Snippet: Reverse Transcription HaCaT cells were grown in serum-free culture medium, with or without the indicated concentrations of UPM, for two days, and the total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and then purified using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. .. The purified RNA was then treated with DNase (Ambion, Austin, TX, USA) and analyzed using an Agilent Bioanalyzer (Agilent Technologies, Waldbronn, Germany) and a NanoDrop 8000 spectrophotometer (Thermo Scientific, Schwerte, Germany) to measure the RNA concentration, integrity, and purity.

    Article Title: 25-Hydroxycholesterol and 27-hydroxycholesterol inhibit human rotavirus infection by sequestering viral particles into late endosomes
    Article Snippet: Briefly, extraction of total RNA from transfected or untransfected Caco2 cells was performed 72 h after transfection using TRIzol Reagent (Applied Biosystems, Monza, Italy). .. Concentration and purity of the extracted RNA were assessed by spectrophotometry (A260/A280).

    Rapid Amplification of cDNA Ends:

    Article Title: Alternative utrophin mRNAs contribute to phenotypic differences between dystrophin‐deficient mice and Duchenne muscular dystrophy
    Article Snippet: .. RNA ligase‐mediated (RLM) 5′ Rapid Amplification of cDNA Ends (5′RACE) RLM‐5′RACE (Ambion, Austin, USA) used 5 μg total decapped RNA from human (mix of 1.25 μg each of fetal heart/lung/thymus/skeletal muscle; Agilent, Santa Clara, USA) or mouse (mix of 2.5 μg each pooled whole embryo day 7 and 11; Clontech, Mountain View, USA). .. Reverse primers within utrophin exon 6 were used for cDNA synthesis (500 ng template) with 5′‐outer adapter RACE primer for primary PCR (95 °C/1 min; 30 cycles 95 °C/45 s, 62 °C/45 s, 72 °C/1 min, final extension 72 °C/5 min).

    High Throughput Screening Assay:

    Article Title: Tomato DCL2b is required for the biosynthesis of 22-nt small RNAs, the resulting secondary siRNAs, and the host defense against ToMV
    Article Snippet: .. High-throughput sequencing of RNAs and sRNAs The total RNA samples were prepared from WT and DCL2b mutant adult leaves using TRIzol reagent (Invitrogen, USA). .. Paired-end mRNA libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) according to the manufacturer’s recommendations and were sequenced on an Illumina HiSeq 4000 platform; 150 bp reads were generated.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Thermo Fisher dgat2 transcripts
    13 C-Oleate Tracing Reveals a Critical Buffering Role for TG-Resident Unsaturated FAs (A) Effect of SCDi on total TG abundances as measured by LC-MS. (B) Effect of oleate pre-loading with or without DGAT shRNA on subsequent A498 cell survival (by Annexin-PI) during serum limitation and SCD inhibition. (C) Schematic of the experimental workflow. <t>DGAT2</t> knockout cells were serum-starved for 24 hr and then loaded for 24 hr with 10 μM [U 13 C]-oleate (C18:1) ± DGAT1 inhibitor (T863, 2 μM). The medium was then replaced and the tracer removed, and cells were subjected to a 48-hr washout. (D) TG labeling patterns after 24-hr loading with [U 13 C]-oleate with or without DGATi, where numbers of mono-unsaturated FA (MUFA) and FA carbons are indicated. 1×, 2×, and 3× indicate whether TGs have one, two, or three oleates (includes [ 13 C 18 ]-20:1) conjugated to their glycerol backbones. (E) BODIPY and DAPI staining directly after [U 13 C]-oleate loading with or without DGATi. (F) Labeling patterns as assessed by incorporation of the 13 C label in 18:1 and 20:1 FAs in TG, DG, PC, and PE species. (G) Model of the metabolic mechanism by which TGs alleviate the saturation of certain lipid classes (e.g., PCs) under conditions of unsaturated lipid deprivation by releasing stored oleate. Data are means of triplicate wells confirmed in independent experiments (A, B, and D) or means of three independent experiments each conducted in triplicate (F); error bars represent SD. Statistical significance by t test or ANOVA, as appropriate. ∗ p
    Dgat2 Transcripts, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dgat2 transcripts/product/Thermo Fisher
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    dgat2 transcripts - by Bioz Stars, 2020-03
    94/100 stars
      Buy from Supplier

    99
    Thermo Fisher 293t cells
    Recombinant GST-Mo-MLV p12 does not associate with mitotic chromatin but is phosphorylated. (A) A representative immunoblot showing subcellular distribution of GST-p12. GST-tagged Mo-MLV p12_WT (lanes 1–3), p12_mut14 (lanes 4–6) and p12+ h CBS (lanes 7–9) were expressed in <t>293T</t> cells for ~40 h. Cells were then subjected to biochemical fractionation and equivalent amounts of fractions S2-cytosolic (lanes 1, 4 and 7), S3-soluble nuclear (lanes 2, 5 and 8) and P3-chromatin pellet (lanes 3, 6 and 9) were analysed by SDS-PAGE and immunoblotting with anti-p12, anti-HSP90 (cytosolic marker) and anti-H2B (chromatin marker) antibodies. (B) Representative confocal microscopy images showing GST-p12 localisation in HeLa cells stably transduced with constructs expressing GST-tagged Mo-MLV p12_WT, p12_mut14 or p12+ h CBS. Cells were stained for p12 (anti-p12, red) and DNA (DAPI, blue). White boxes indicate mitotic cells. (C) Representative silver-stained SDS-PAGE gel (left) and immunoblot (right) of GST-p12 complexes. 293T cells were transiently-transfected with expression constructs for GST-tagged Mo-MLV p12_WT (lane 2), p12_mut14 (lane 3) or p12+ h CBS (lane 4), or GST alone (lane 1). 24 h post-transfection, cells were treated with nocodazole overnight to arrest them in mitosis and then lysed. Cell lysates were normalised on total protein concentration and GST-p12 protein complexes were precipitated with glutathione-sepharose beads. Bead eluates were analysed by SDS-PAGE followed by silver-staining or immunoblotting with anti-H2A, anti-H2B, anti-H3 or anti-H4 antibodies. Bands corresponding to core histones in the silver-stained gel are starred. (D) Immunoblot showing DNA pull down assays. 293T cells were transiently-transfected with expression constructs for GST alone (top panel), GST-tagged Mo-MLV p12_WT (middle panel), or IN-HA (bottom panel) for ~40 h. DNA interacting proteins were precipitated from normalised cell lysates with cellulose beads coated with double stranded (lane 2) or single-stranded (lane 3) calf thymus DNA, and analysed by immunoblotting with anti-GST, anti-p12, or anti-IN antibodies, respectively. The arrows indicate full-length GST-p12 (~38 kDa) and IN-HA (~49 kDa) bands in the western blots. (E) GST-p12 phosphorylation. Normalised, mitotic cell lysates expressing GST-tagged Mo-MLV p12_WT (lane 3) or p12_S61A (lanes 1 and 2) were incubated with glutathione-sepharose beads. Bound proteins were separated by SDS-PAGE and the gel was sequentially stained with ProQ diamond (PQ, specifically stains phosphorylated proteins) and Sypro ruby (SR, stains all proteins) dyes. Prior to SDS-PAGE, one p12_S61A sample was treated with alkaline phosphatase (AP) for 1 h at 37°C. Band intensities were measured using a ChemiDoc imaging system and the bar chart shows PQ/SR ratios, plotted as mean ± SD of 3 technical replicates.
    293t Cells, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1577 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/293t cells/product/Thermo Fisher
    Average 99 stars, based on 1577 article reviews
    Price from $9.99 to $1999.99
    293t cells - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    82
    Thermo Fisher lc ms ms analysis all peptide
    GPS leads to the identification of ADP-ribosylated ARTDs/PARPs other than ARTD1/PARP1. (A) A comparison using Venn diagrams for ADPr peptides found in two replicates for full scan (400–1500 m / z ) and combined 4× GPS scans (GPS-1, 400–605; GPS-2, 595–805; GPS-3, 795–1005; GPS-4, 995–1200 m / z ). (B) A comparison of ADPr peptides found in control and IFN-γ-treated THP-1 cells for the full scan and combined 4× GPS scans. (C) Sequence motif <t>analysis</t> for ADPr acceptor amino acids (N, number of ADPr peptides used for the analysis). (D) A plot of the number of ADP-ribosylation sites per protein. (E) Comparison of ADPr <t>peptide</t> abundances between control and IFN-γ in each replicate; regression lines, 95% confidence interval, and standard error of estimate (SEE) are provided (red dots are outliers). (F) <t>MS/MS</t> spectra of an ARTD8/PARP14 ADPr peptide using PRM acquisitions. Black peaks were manually annotated. *, ADPr site. (G) A comparison of the number of proteins identified in the Af1521 elution (ADPr proteins) and input samples (backbone proteins) per replicate. (H) A comparison of the relative changes to ADPr peptides versus their backbone proteins in response to IFN-γ (IFN-γ/control).
    Lc Ms Ms Analysis All Peptide, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 82/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lc ms ms analysis all peptide/product/Thermo Fisher
    Average 82 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    lc ms ms analysis all peptide - by Bioz Stars, 2020-03
    82/100 stars
      Buy from Supplier

    89
    Thermo Fisher analysis hplc separations
    Multivariate statistical analysis of <t>HPLC–PDA–MS</t> non-targeted profiles. a Conventional PCA scores plot inclusive of quality assurance samples. b Conventional PCA scores plot with quality assurance samples excluded. c Conventional PCA loadings plot with quality assurance samples excluded (please refer to Table S1 and S2 for metabolites associated with unique reference numbers). d Multiblock hierarchical (H)PCA super-scores plot. e Multiblock hierarchical (H)PCA block-scores plots based upon daylength condition. Natural, 10 h, 10 h + 3 h, refer to the following daylength condition descriptions, (1) natural long summer day (LD), ca. 18 h (natural LD), (2) 10 h artificial short day (SD), and (3) 10 h SD + 3 h night interruption (SD + NI), respectively
    Analysis Hplc Separations, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/analysis hplc separations/product/Thermo Fisher
    Average 89 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    analysis hplc separations - by Bioz Stars, 2020-03
    89/100 stars
      Buy from Supplier

    Image Search Results


    13 C-Oleate Tracing Reveals a Critical Buffering Role for TG-Resident Unsaturated FAs (A) Effect of SCDi on total TG abundances as measured by LC-MS. (B) Effect of oleate pre-loading with or without DGAT shRNA on subsequent A498 cell survival (by Annexin-PI) during serum limitation and SCD inhibition. (C) Schematic of the experimental workflow. DGAT2 knockout cells were serum-starved for 24 hr and then loaded for 24 hr with 10 μM [U 13 C]-oleate (C18:1) ± DGAT1 inhibitor (T863, 2 μM). The medium was then replaced and the tracer removed, and cells were subjected to a 48-hr washout. (D) TG labeling patterns after 24-hr loading with [U 13 C]-oleate with or without DGATi, where numbers of mono-unsaturated FA (MUFA) and FA carbons are indicated. 1×, 2×, and 3× indicate whether TGs have one, two, or three oleates (includes [ 13 C 18 ]-20:1) conjugated to their glycerol backbones. (E) BODIPY and DAPI staining directly after [U 13 C]-oleate loading with or without DGATi. (F) Labeling patterns as assessed by incorporation of the 13 C label in 18:1 and 20:1 FAs in TG, DG, PC, and PE species. (G) Model of the metabolic mechanism by which TGs alleviate the saturation of certain lipid classes (e.g., PCs) under conditions of unsaturated lipid deprivation by releasing stored oleate. Data are means of triplicate wells confirmed in independent experiments (A, B, and D) or means of three independent experiments each conducted in triplicate (F); error bars represent SD. Statistical significance by t test or ANOVA, as appropriate. ∗ p

    Journal: Cell Reports

    Article Title: Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation

    doi: 10.1016/j.celrep.2018.08.015

    Figure Lengend Snippet: 13 C-Oleate Tracing Reveals a Critical Buffering Role for TG-Resident Unsaturated FAs (A) Effect of SCDi on total TG abundances as measured by LC-MS. (B) Effect of oleate pre-loading with or without DGAT shRNA on subsequent A498 cell survival (by Annexin-PI) during serum limitation and SCD inhibition. (C) Schematic of the experimental workflow. DGAT2 knockout cells were serum-starved for 24 hr and then loaded for 24 hr with 10 μM [U 13 C]-oleate (C18:1) ± DGAT1 inhibitor (T863, 2 μM). The medium was then replaced and the tracer removed, and cells were subjected to a 48-hr washout. (D) TG labeling patterns after 24-hr loading with [U 13 C]-oleate with or without DGATi, where numbers of mono-unsaturated FA (MUFA) and FA carbons are indicated. 1×, 2×, and 3× indicate whether TGs have one, two, or three oleates (includes [ 13 C 18 ]-20:1) conjugated to their glycerol backbones. (E) BODIPY and DAPI staining directly after [U 13 C]-oleate loading with or without DGATi. (F) Labeling patterns as assessed by incorporation of the 13 C label in 18:1 and 20:1 FAs in TG, DG, PC, and PE species. (G) Model of the metabolic mechanism by which TGs alleviate the saturation of certain lipid classes (e.g., PCs) under conditions of unsaturated lipid deprivation by releasing stored oleate. Data are means of triplicate wells confirmed in independent experiments (A, B, and D) or means of three independent experiments each conducted in triplicate (F); error bars represent SD. Statistical significance by t test or ANOVA, as appropriate. ∗ p

    Article Snippet: After selection with puromycin and G418, the knockdown of both DGAT1 and DGAT2 transcripts was confirmed by qRT-PCR (Taqman probes; ThermoFisher) DGAT2 knockout cell lines were generated by cloning sgRNA sequences 5′-TGTGCTCTACTTCACTTGGC-3′ and 5′-GTACATGAGGATGGCACTGC-3′ into the lentiviral vector lentiCrisprv2 (Addgene), generating lentivirus in HEK293T cells and transducing ccRCC cell lines with 25μl of un-concentrated supernatant.

    Techniques: Liquid Chromatography with Mass Spectroscopy, shRNA, Inhibition, Knock-Out, Labeling, Staining

    DGAT Loss Reduces Tumor Growth and Alters Lipid Composition In Vivo (A) Diagram of fatty acid and lipid synthesis and the influence of O 2 and exogenous lipid. (B) Growth curves for A498 xenograft tumors with induced (doxycycline chow) and un-induced (control chow) DGAT1 and DGAT2 shRNAs (hereafter called DGAT shRNA). (C) Tumor weights after necropsy. (D) Immunohistochemistry for cleaved caspase-3 and Ki67 in xenograft tumors collected on day 5 of treatment, with accompanying quantification. (E) Total TG abundance derived from summing individual TG species abundance after liquid chromatography-mass spectrometry (LC-MS) quantification. (F) TG species binned according to the number of fully saturated FA chains present and the abundance of each category summed and displayed as a ratio of doxycycline-treated versus control groups. All results are means of n = 10 tumors (2 tumors per mouse) per arm; error bars represent ± SD (B, D, and F) or ± SEM (C). Statistical significance by t test or ANOVA, as appropriate; ∗ p

    Journal: Cell Reports

    Article Title: Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation

    doi: 10.1016/j.celrep.2018.08.015

    Figure Lengend Snippet: DGAT Loss Reduces Tumor Growth and Alters Lipid Composition In Vivo (A) Diagram of fatty acid and lipid synthesis and the influence of O 2 and exogenous lipid. (B) Growth curves for A498 xenograft tumors with induced (doxycycline chow) and un-induced (control chow) DGAT1 and DGAT2 shRNAs (hereafter called DGAT shRNA). (C) Tumor weights after necropsy. (D) Immunohistochemistry for cleaved caspase-3 and Ki67 in xenograft tumors collected on day 5 of treatment, with accompanying quantification. (E) Total TG abundance derived from summing individual TG species abundance after liquid chromatography-mass spectrometry (LC-MS) quantification. (F) TG species binned according to the number of fully saturated FA chains present and the abundance of each category summed and displayed as a ratio of doxycycline-treated versus control groups. All results are means of n = 10 tumors (2 tumors per mouse) per arm; error bars represent ± SD (B, D, and F) or ± SEM (C). Statistical significance by t test or ANOVA, as appropriate; ∗ p

    Article Snippet: After selection with puromycin and G418, the knockdown of both DGAT1 and DGAT2 transcripts was confirmed by qRT-PCR (Taqman probes; ThermoFisher) DGAT2 knockout cell lines were generated by cloning sgRNA sequences 5′-TGTGCTCTACTTCACTTGGC-3′ and 5′-GTACATGAGGATGGCACTGC-3′ into the lentiviral vector lentiCrisprv2 (Addgene), generating lentivirus in HEK293T cells and transducing ccRCC cell lines with 25μl of un-concentrated supernatant.

    Techniques: In Vivo, shRNA, Immunohistochemistry, Derivative Assay, Liquid Chromatography, Mass Spectrometry, Liquid Chromatography with Mass Spectroscopy

    TGs Promote Cell Viability in Low O 2 and Serum by Absorbing FA Saturation (A) Viability of A498 cells expressing inducible shRNA against DGAT1 and DGAT2 mRNAs ( DGAT shRNA), assessed after 72 hr under the indicated conditions (hypoxia = 0.5% O 2 ; serum deprivation = low serum, 0.5% fetal bovine serum [FBS]) by Annexin-propidium iodide (PI) flow cytometry assay. (B) Viability of cells expressing inducible DGAT shRNAs after 72 hr under the indicated conditions (SCDi, 1 μM CAY10566) by Annexin-PI assay using flow cytometry. (C) Volcano plot showing fold change and significance of alterations in the lipidome of A498 cells cultured in low (0.5%) versus high (5%) serum. Lipids with ≥ 1.5 fold change and p ≤ 0.05 are displayed in color to denote lipid class. (D) Changes in FA composition or saturation of TGs, calculated by aggregating TG abundances for species containing 0, 1, or 2+ SFA chains separately. Values are normalized to control conditions (5% serum). (E) Lipid class-specific saturation indices (defined by (palmitate + stearate) / oleate) for A498 cells cultured under hypoxic (0.5% O 2 ) versus normoxic conditions (both in low serum). (F) As (E) but with pharmacological SCD inhibition (1 μM CAY10566) instead of hypoxia. (G) Effect of serum deprivation and DGAT shRNA on total TG abundances. (H) Changes in FA makeup of TGs following DGAT knockdown; values were calculated by aggregating TG abundances for species containing 0, 1, or 2+ SFA chains separately. Values were normalized to the control condition (vehicle [Veh] treatment). (I) TG saturation indices for the indicated conditions. Values are relative to normoxic untreated cells. (J) As (G) but with pharmacological SCD inhibition (1 μM CAY10566). Values are relative to the untreated vehicle control. Data are means of 3 (A, B, and D–J) or 5 (C) replicate wells and were confirmed in independent experiments; error bars represent SD. Statistical significance by t test or ANOVA, as appropriate. ∗∗ p

    Journal: Cell Reports

    Article Title: Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation

    doi: 10.1016/j.celrep.2018.08.015

    Figure Lengend Snippet: TGs Promote Cell Viability in Low O 2 and Serum by Absorbing FA Saturation (A) Viability of A498 cells expressing inducible shRNA against DGAT1 and DGAT2 mRNAs ( DGAT shRNA), assessed after 72 hr under the indicated conditions (hypoxia = 0.5% O 2 ; serum deprivation = low serum, 0.5% fetal bovine serum [FBS]) by Annexin-propidium iodide (PI) flow cytometry assay. (B) Viability of cells expressing inducible DGAT shRNAs after 72 hr under the indicated conditions (SCDi, 1 μM CAY10566) by Annexin-PI assay using flow cytometry. (C) Volcano plot showing fold change and significance of alterations in the lipidome of A498 cells cultured in low (0.5%) versus high (5%) serum. Lipids with ≥ 1.5 fold change and p ≤ 0.05 are displayed in color to denote lipid class. (D) Changes in FA composition or saturation of TGs, calculated by aggregating TG abundances for species containing 0, 1, or 2+ SFA chains separately. Values are normalized to control conditions (5% serum). (E) Lipid class-specific saturation indices (defined by (palmitate + stearate) / oleate) for A498 cells cultured under hypoxic (0.5% O 2 ) versus normoxic conditions (both in low serum). (F) As (E) but with pharmacological SCD inhibition (1 μM CAY10566) instead of hypoxia. (G) Effect of serum deprivation and DGAT shRNA on total TG abundances. (H) Changes in FA makeup of TGs following DGAT knockdown; values were calculated by aggregating TG abundances for species containing 0, 1, or 2+ SFA chains separately. Values were normalized to the control condition (vehicle [Veh] treatment). (I) TG saturation indices for the indicated conditions. Values are relative to normoxic untreated cells. (J) As (G) but with pharmacological SCD inhibition (1 μM CAY10566). Values are relative to the untreated vehicle control. Data are means of 3 (A, B, and D–J) or 5 (C) replicate wells and were confirmed in independent experiments; error bars represent SD. Statistical significance by t test or ANOVA, as appropriate. ∗∗ p

    Article Snippet: After selection with puromycin and G418, the knockdown of both DGAT1 and DGAT2 transcripts was confirmed by qRT-PCR (Taqman probes; ThermoFisher) DGAT2 knockout cell lines were generated by cloning sgRNA sequences 5′-TGTGCTCTACTTCACTTGGC-3′ and 5′-GTACATGAGGATGGCACTGC-3′ into the lentiviral vector lentiCrisprv2 (Addgene), generating lentivirus in HEK293T cells and transducing ccRCC cell lines with 25μl of un-concentrated supernatant.

    Techniques: Expressing, shRNA, Flow Cytometry, Cytometry, Cell Culture, Inhibition

    Recombinant GST-Mo-MLV p12 does not associate with mitotic chromatin but is phosphorylated. (A) A representative immunoblot showing subcellular distribution of GST-p12. GST-tagged Mo-MLV p12_WT (lanes 1–3), p12_mut14 (lanes 4–6) and p12+ h CBS (lanes 7–9) were expressed in 293T cells for ~40 h. Cells were then subjected to biochemical fractionation and equivalent amounts of fractions S2-cytosolic (lanes 1, 4 and 7), S3-soluble nuclear (lanes 2, 5 and 8) and P3-chromatin pellet (lanes 3, 6 and 9) were analysed by SDS-PAGE and immunoblotting with anti-p12, anti-HSP90 (cytosolic marker) and anti-H2B (chromatin marker) antibodies. (B) Representative confocal microscopy images showing GST-p12 localisation in HeLa cells stably transduced with constructs expressing GST-tagged Mo-MLV p12_WT, p12_mut14 or p12+ h CBS. Cells were stained for p12 (anti-p12, red) and DNA (DAPI, blue). White boxes indicate mitotic cells. (C) Representative silver-stained SDS-PAGE gel (left) and immunoblot (right) of GST-p12 complexes. 293T cells were transiently-transfected with expression constructs for GST-tagged Mo-MLV p12_WT (lane 2), p12_mut14 (lane 3) or p12+ h CBS (lane 4), or GST alone (lane 1). 24 h post-transfection, cells were treated with nocodazole overnight to arrest them in mitosis and then lysed. Cell lysates were normalised on total protein concentration and GST-p12 protein complexes were precipitated with glutathione-sepharose beads. Bead eluates were analysed by SDS-PAGE followed by silver-staining or immunoblotting with anti-H2A, anti-H2B, anti-H3 or anti-H4 antibodies. Bands corresponding to core histones in the silver-stained gel are starred. (D) Immunoblot showing DNA pull down assays. 293T cells were transiently-transfected with expression constructs for GST alone (top panel), GST-tagged Mo-MLV p12_WT (middle panel), or IN-HA (bottom panel) for ~40 h. DNA interacting proteins were precipitated from normalised cell lysates with cellulose beads coated with double stranded (lane 2) or single-stranded (lane 3) calf thymus DNA, and analysed by immunoblotting with anti-GST, anti-p12, or anti-IN antibodies, respectively. The arrows indicate full-length GST-p12 (~38 kDa) and IN-HA (~49 kDa) bands in the western blots. (E) GST-p12 phosphorylation. Normalised, mitotic cell lysates expressing GST-tagged Mo-MLV p12_WT (lane 3) or p12_S61A (lanes 1 and 2) were incubated with glutathione-sepharose beads. Bound proteins were separated by SDS-PAGE and the gel was sequentially stained with ProQ diamond (PQ, specifically stains phosphorylated proteins) and Sypro ruby (SR, stains all proteins) dyes. Prior to SDS-PAGE, one p12_S61A sample was treated with alkaline phosphatase (AP) for 1 h at 37°C. Band intensities were measured using a ChemiDoc imaging system and the bar chart shows PQ/SR ratios, plotted as mean ± SD of 3 technical replicates.

    Journal: PLoS Pathogens

    Article Title: Murine leukemia virus p12 tethers the capsid-containing pre-integration complex to chromatin by binding directly to host nucleosomes in mitosis

    doi: 10.1371/journal.ppat.1007117

    Figure Lengend Snippet: Recombinant GST-Mo-MLV p12 does not associate with mitotic chromatin but is phosphorylated. (A) A representative immunoblot showing subcellular distribution of GST-p12. GST-tagged Mo-MLV p12_WT (lanes 1–3), p12_mut14 (lanes 4–6) and p12+ h CBS (lanes 7–9) were expressed in 293T cells for ~40 h. Cells were then subjected to biochemical fractionation and equivalent amounts of fractions S2-cytosolic (lanes 1, 4 and 7), S3-soluble nuclear (lanes 2, 5 and 8) and P3-chromatin pellet (lanes 3, 6 and 9) were analysed by SDS-PAGE and immunoblotting with anti-p12, anti-HSP90 (cytosolic marker) and anti-H2B (chromatin marker) antibodies. (B) Representative confocal microscopy images showing GST-p12 localisation in HeLa cells stably transduced with constructs expressing GST-tagged Mo-MLV p12_WT, p12_mut14 or p12+ h CBS. Cells were stained for p12 (anti-p12, red) and DNA (DAPI, blue). White boxes indicate mitotic cells. (C) Representative silver-stained SDS-PAGE gel (left) and immunoblot (right) of GST-p12 complexes. 293T cells were transiently-transfected with expression constructs for GST-tagged Mo-MLV p12_WT (lane 2), p12_mut14 (lane 3) or p12+ h CBS (lane 4), or GST alone (lane 1). 24 h post-transfection, cells were treated with nocodazole overnight to arrest them in mitosis and then lysed. Cell lysates were normalised on total protein concentration and GST-p12 protein complexes were precipitated with glutathione-sepharose beads. Bead eluates were analysed by SDS-PAGE followed by silver-staining or immunoblotting with anti-H2A, anti-H2B, anti-H3 or anti-H4 antibodies. Bands corresponding to core histones in the silver-stained gel are starred. (D) Immunoblot showing DNA pull down assays. 293T cells were transiently-transfected with expression constructs for GST alone (top panel), GST-tagged Mo-MLV p12_WT (middle panel), or IN-HA (bottom panel) for ~40 h. DNA interacting proteins were precipitated from normalised cell lysates with cellulose beads coated with double stranded (lane 2) or single-stranded (lane 3) calf thymus DNA, and analysed by immunoblotting with anti-GST, anti-p12, or anti-IN antibodies, respectively. The arrows indicate full-length GST-p12 (~38 kDa) and IN-HA (~49 kDa) bands in the western blots. (E) GST-p12 phosphorylation. Normalised, mitotic cell lysates expressing GST-tagged Mo-MLV p12_WT (lane 3) or p12_S61A (lanes 1 and 2) were incubated with glutathione-sepharose beads. Bound proteins were separated by SDS-PAGE and the gel was sequentially stained with ProQ diamond (PQ, specifically stains phosphorylated proteins) and Sypro ruby (SR, stains all proteins) dyes. Prior to SDS-PAGE, one p12_S61A sample was treated with alkaline phosphatase (AP) for 1 h at 37°C. Band intensities were measured using a ChemiDoc imaging system and the bar chart shows PQ/SR ratios, plotted as mean ± SD of 3 technical replicates.

    Article Snippet: Kinase inhibition GST-p12 proteins were expressed in 293T cells from pCAGGS/GST-derived plasmids by transient transfection using Turbofect (Thermo Fisher Scientific).

    Techniques: Recombinant, Fractionation, SDS Page, Marker, Confocal Microscopy, Stable Transfection, Transduction, Construct, Expressing, Staining, Transfection, Protein Concentration, Silver Staining, Western Blot, Incubation, Imaging

    GST-tagged Mo-MLV p12_M63I shows increased chromatin association and phosphorylation in mitosis. (A) A representative immunoblot showing subcellular distribution of GST-p12 mutants. GST-tagged GST-p12_M63I (lanes 1–3) or GST-p12+ h CBS (lanes 4–6) were expressed in 293T cells for ~40 h. Cells were then subjected to biochemical fractionation and equivalent amounts of fractions S2-cytosolic, S3-soluble nuclear and P3-chromatin pellet were analysed by SDS-PAGE and immunoblotting with anti-p12, anti-HSP90 (cytosolic marker) and anti-H2B (chromatin marker) antibodies. (B) Representative confocal microscopy images showing GST-p12 localisation in HeLa cells stably transduced with constructs expressing GST-p12_M63I and GST-p12+ h CBS. Cells were stained for p12 (anti-p12, green) and H2B (anti-H2B, red). Blue boxes indicate mitotic cells and red boxes show interphase cells. (C) Representative silver stained gel (top) and immunoblot (bottom) comparing the interaction of GST-p12_M63I and GST-p12+ h CBS with mitotic and interphase chromatin. 293T cells were transiently-transfected with expression constructs for GST-tagged Mo-MLV p12_WT, M63I or GST-p12+ h CBS for ~24 h before being treated overnight with either nocodazole (to arrest in mitosis) or aphidicolin (to block in interphase). GST-p12 protein complexes were precipitated from normalised cell lysates with glutathione-sepharose beads and analysed by SDS-PAGE followed by silver-staining or immunoblotting with anti-CLTC and anti-H2B antibodies. Bands corresponding to core histones in the silver-stained gel are starred. (D) Quantitation of H2B pulled-down with GST-p12 from mitotic versus interphase cell lysates. Median H2B band intensities from immunoblots in (C) were measured using a Li-cor Odyssey imaging system. The increase in H2B precipitation from mitotic cell lysates relative to interphase cell lysates are plotted in the bar chart (mean ± SEM, three biological replicates). (E) GST-p12 phosphorylation in mitosis and interphase. Normalised, interphase or mitotic 293T cell lysates expressing GST-tagged Mo-MLV p12_WT, M63I or S61A were incubated with glutathione-sepharose beads. Bound proteins were separated by SDS-PAGE and the gel was sequentially stained with ProQ diamond (PQ, specifically stains phosphorylated proteins) and Sypro ruby (SR, stains all proteins) dyes. Band intensities were measured using a ChemiDoc imaging system and the bar chart shows PQ/SR ratios, plotted as mean ± SD of 3 technical replicates.

    Journal: PLoS Pathogens

    Article Title: Murine leukemia virus p12 tethers the capsid-containing pre-integration complex to chromatin by binding directly to host nucleosomes in mitosis

    doi: 10.1371/journal.ppat.1007117

    Figure Lengend Snippet: GST-tagged Mo-MLV p12_M63I shows increased chromatin association and phosphorylation in mitosis. (A) A representative immunoblot showing subcellular distribution of GST-p12 mutants. GST-tagged GST-p12_M63I (lanes 1–3) or GST-p12+ h CBS (lanes 4–6) were expressed in 293T cells for ~40 h. Cells were then subjected to biochemical fractionation and equivalent amounts of fractions S2-cytosolic, S3-soluble nuclear and P3-chromatin pellet were analysed by SDS-PAGE and immunoblotting with anti-p12, anti-HSP90 (cytosolic marker) and anti-H2B (chromatin marker) antibodies. (B) Representative confocal microscopy images showing GST-p12 localisation in HeLa cells stably transduced with constructs expressing GST-p12_M63I and GST-p12+ h CBS. Cells were stained for p12 (anti-p12, green) and H2B (anti-H2B, red). Blue boxes indicate mitotic cells and red boxes show interphase cells. (C) Representative silver stained gel (top) and immunoblot (bottom) comparing the interaction of GST-p12_M63I and GST-p12+ h CBS with mitotic and interphase chromatin. 293T cells were transiently-transfected with expression constructs for GST-tagged Mo-MLV p12_WT, M63I or GST-p12+ h CBS for ~24 h before being treated overnight with either nocodazole (to arrest in mitosis) or aphidicolin (to block in interphase). GST-p12 protein complexes were precipitated from normalised cell lysates with glutathione-sepharose beads and analysed by SDS-PAGE followed by silver-staining or immunoblotting with anti-CLTC and anti-H2B antibodies. Bands corresponding to core histones in the silver-stained gel are starred. (D) Quantitation of H2B pulled-down with GST-p12 from mitotic versus interphase cell lysates. Median H2B band intensities from immunoblots in (C) were measured using a Li-cor Odyssey imaging system. The increase in H2B precipitation from mitotic cell lysates relative to interphase cell lysates are plotted in the bar chart (mean ± SEM, three biological replicates). (E) GST-p12 phosphorylation in mitosis and interphase. Normalised, interphase or mitotic 293T cell lysates expressing GST-tagged Mo-MLV p12_WT, M63I or S61A were incubated with glutathione-sepharose beads. Bound proteins were separated by SDS-PAGE and the gel was sequentially stained with ProQ diamond (PQ, specifically stains phosphorylated proteins) and Sypro ruby (SR, stains all proteins) dyes. Band intensities were measured using a ChemiDoc imaging system and the bar chart shows PQ/SR ratios, plotted as mean ± SD of 3 technical replicates.

    Article Snippet: Kinase inhibition GST-p12 proteins were expressed in 293T cells from pCAGGS/GST-derived plasmids by transient transfection using Turbofect (Thermo Fisher Scientific).

    Techniques: Fractionation, SDS Page, Marker, Confocal Microscopy, Stable Transfection, Transduction, Construct, Expressing, Staining, Transfection, Blocking Assay, Silver Staining, Quantitation Assay, Western Blot, Imaging, Incubation

    GST-Mo-MLV p12 recapitulates known interactions of the p12 region of Gag. Cellular proteins interacting with GST-p12 were identified using SILAC-MS. Two biological repeats (R1 and R2) were performed. (A) Schematic diagram of the SILAC-MS workflow. GST-protein complexes were isolated from normalised mitotic 293T cell lysates using glutathione-sepharose beads, pooled and subjected to LC-MS/MS analysis. (B) Identification of proteins enriched in the heavy-labelled GST-p12_WT (H) sample relative to light-labelled GST (L) sample. Log 2 (H/L) silac ratios of the set of MS hits (FDR

    Journal: PLoS Pathogens

    Article Title: Murine leukemia virus p12 tethers the capsid-containing pre-integration complex to chromatin by binding directly to host nucleosomes in mitosis

    doi: 10.1371/journal.ppat.1007117

    Figure Lengend Snippet: GST-Mo-MLV p12 recapitulates known interactions of the p12 region of Gag. Cellular proteins interacting with GST-p12 were identified using SILAC-MS. Two biological repeats (R1 and R2) were performed. (A) Schematic diagram of the SILAC-MS workflow. GST-protein complexes were isolated from normalised mitotic 293T cell lysates using glutathione-sepharose beads, pooled and subjected to LC-MS/MS analysis. (B) Identification of proteins enriched in the heavy-labelled GST-p12_WT (H) sample relative to light-labelled GST (L) sample. Log 2 (H/L) silac ratios of the set of MS hits (FDR

    Article Snippet: Kinase inhibition GST-p12 proteins were expressed in 293T cells from pCAGGS/GST-derived plasmids by transient transfection using Turbofect (Thermo Fisher Scientific).

    Techniques: Mass Spectrometry, Isolation, Liquid Chromatography with Mass Spectroscopy

    GST-p12_M63I interacts with the same chromatin-associated proteins as PFV CBS. Cellular proteins interacting with GST-p12_M63I were identified using SILAC-MS. Two biological repeats (R1 and R2) were performed. GST-p12_M63I and GST-p12_WT were transiently expressed in 293T cells cultured in light (R0/K0) or medium (R6/K4) SILAC media respectively. Cells were treated with nocodazole for mitotic enrichment and then lysed for glutathione-sepharose bead pull-down assays followed by MS. (A) Identification of proteins enriched in the light-labelled GST-p12_M63I (L) sample relative to medium-labelled GST-p12_WT (M) sample. Log 2 (L/M) silac ratios of the set of MS hits (FDR

    Journal: PLoS Pathogens

    Article Title: Murine leukemia virus p12 tethers the capsid-containing pre-integration complex to chromatin by binding directly to host nucleosomes in mitosis

    doi: 10.1371/journal.ppat.1007117

    Figure Lengend Snippet: GST-p12_M63I interacts with the same chromatin-associated proteins as PFV CBS. Cellular proteins interacting with GST-p12_M63I were identified using SILAC-MS. Two biological repeats (R1 and R2) were performed. GST-p12_M63I and GST-p12_WT were transiently expressed in 293T cells cultured in light (R0/K0) or medium (R6/K4) SILAC media respectively. Cells were treated with nocodazole for mitotic enrichment and then lysed for glutathione-sepharose bead pull-down assays followed by MS. (A) Identification of proteins enriched in the light-labelled GST-p12_M63I (L) sample relative to medium-labelled GST-p12_WT (M) sample. Log 2 (L/M) silac ratios of the set of MS hits (FDR

    Article Snippet: Kinase inhibition GST-p12 proteins were expressed in 293T cells from pCAGGS/GST-derived plasmids by transient transfection using Turbofect (Thermo Fisher Scientific).

    Techniques: Mass Spectrometry, Cell Culture

    GST-tagged Mo-MLV p12_M63I has a higher affinity for chromatin when phosphorylated. (A and B) The effect of kinase inhibitors on p12 phosphorylation (A) and chromatin association (B). 293T cells transiently-expressing GST-p12_M63I were treated overnight with nocodazole, followed by a kinase inhibitor (LiCl, roscovitine (Ros) or kenpaullone (Ken)) for 3.5 h in the presence of both nocodazole and MG132, before lysis. Normalised cell lysates were incubated with glutathione-sepharose beads, bound proteins were separated by SDS-PAGE and gels were analysed either by sequential staining with ProQ diamond (PQ) and Sypro ruby (SR) dyes (A), or by silver-staining and immunoblotting with anti-CLTC and anti-H2B antibodies. PQ/SR ratios (A) and median H2B band intensities (B) are plotted in the bar charts as mean ± SD, of three technical replicates. (C) Mitotic chromatin association of GST-p12_M63I, S61 double mutants. 293T cells transiently-expressing GST-p12_M63I +/- an S61 mutation (S61A, S61D or S61E), were treated overnight with nocodazole and analysed as in (B). (D) Infectivity of Mo-MLV VLPs carrying alterations in p12. HeLa cells were challenged with equivalent RT units of LacZ -encoding VLPs carrying Mo-MLV p12_WT or M63I, +/- S61 mutations (S61A, S61D or S61E), and infectivity was measured 72 h post-infection by detection of beta-galactosidase activity in a chemiluminescent reporter assay. The data are plotted as percentage of WT VLP infectivity (mean ± SEM of > 3 biological replicates).

    Journal: PLoS Pathogens

    Article Title: Murine leukemia virus p12 tethers the capsid-containing pre-integration complex to chromatin by binding directly to host nucleosomes in mitosis

    doi: 10.1371/journal.ppat.1007117

    Figure Lengend Snippet: GST-tagged Mo-MLV p12_M63I has a higher affinity for chromatin when phosphorylated. (A and B) The effect of kinase inhibitors on p12 phosphorylation (A) and chromatin association (B). 293T cells transiently-expressing GST-p12_M63I were treated overnight with nocodazole, followed by a kinase inhibitor (LiCl, roscovitine (Ros) or kenpaullone (Ken)) for 3.5 h in the presence of both nocodazole and MG132, before lysis. Normalised cell lysates were incubated with glutathione-sepharose beads, bound proteins were separated by SDS-PAGE and gels were analysed either by sequential staining with ProQ diamond (PQ) and Sypro ruby (SR) dyes (A), or by silver-staining and immunoblotting with anti-CLTC and anti-H2B antibodies. PQ/SR ratios (A) and median H2B band intensities (B) are plotted in the bar charts as mean ± SD, of three technical replicates. (C) Mitotic chromatin association of GST-p12_M63I, S61 double mutants. 293T cells transiently-expressing GST-p12_M63I +/- an S61 mutation (S61A, S61D or S61E), were treated overnight with nocodazole and analysed as in (B). (D) Infectivity of Mo-MLV VLPs carrying alterations in p12. HeLa cells were challenged with equivalent RT units of LacZ -encoding VLPs carrying Mo-MLV p12_WT or M63I, +/- S61 mutations (S61A, S61D or S61E), and infectivity was measured 72 h post-infection by detection of beta-galactosidase activity in a chemiluminescent reporter assay. The data are plotted as percentage of WT VLP infectivity (mean ± SEM of > 3 biological replicates).

    Article Snippet: Kinase inhibition GST-p12 proteins were expressed in 293T cells from pCAGGS/GST-derived plasmids by transient transfection using Turbofect (Thermo Fisher Scientific).

    Techniques: Expressing, Lysis, Incubation, SDS Page, Staining, Silver Staining, Mutagenesis, Infection, Activity Assay, Reporter Assay

    GST-Mo-MLV p12_M63I and other p12 orthologs associate with mitotic chromatin. (A) Representative silver stained gel (left) and immunoblot (right) showing binding of a panel of GST-p12 mutants to host proteins. 293T cells were transiently-transfected with expression constructs for GST-tagged Mo-MLV p12_WT (lane 1) and a panel of Mo-MLV p12 mutants: M63I (lane 2), G49R/E50K (lane 3), D25A/L-dom (carrying alanine substitutions of the PPPY motif as well as D25A, which disrupts clathrin binding, lane 4), p12 CTD only (lane 5) or GST-p12+ h CBS (positive control, lane 6) for ~24 h before being treated overnight with nocodazole. GST-p12 protein complexes were precipitated from normalised cell lysates with glutathione-sepharose beads and analysed by SDS-PAGE followed by silver-staining or immunoblotting with anti-CLTC, anti-WWP2, anti-H2A, anti-H2B, anti-H3 and anti-H4 antibodies. Bands corresponding to core histones in the silver-stained gel are starred. (B) Infectivity of Mo-MLV VLPs carrying alterations in p12. HeLa cells were challenged with equivalent RT units of LacZ -encoding VLPs carrying Mo-MLV p12_WT, M63I, G49R/E50K or p12+ h CBS +/- Mut14, and infectivity was measured 72 h post-infection by detection of beta-galactosidase activity in a chemiluminescent reporter assay. The data are plotted as percentage of WT VLP infectivity (mean ± SEM of > 3 biological replicates). (C) An alignment of p12 sequences from selected gammaretroviruses. The CTD region is shaded pink. The S61 and M63 residues of Mo-MLV p12 are highlighted in red and equivalent residues at position 63 and 64 are boxed. CTD peptide sequences used in subsequent BLI assays ( Fig 9 ) are in bold. (D and E) Representative silver stained gel (top) and immunoblot (bottom) showing interaction of a panel of GST-tagged p12 orthologues (D) and GST-tagged FeLV_p12 mutants I52M and A53V (E) to chromatin associated proteins. GST-pull down assays were performed as in (A). (E) The amount of histone H2B pulled-down with GST-p12 was quantified for each sample by estimating median band intensity of immunoblots using a Li-cor Odyssey imaging system and plotted in the bar chart as mean ± SD of 3 technical replicates.

    Journal: PLoS Pathogens

    Article Title: Murine leukemia virus p12 tethers the capsid-containing pre-integration complex to chromatin by binding directly to host nucleosomes in mitosis

    doi: 10.1371/journal.ppat.1007117

    Figure Lengend Snippet: GST-Mo-MLV p12_M63I and other p12 orthologs associate with mitotic chromatin. (A) Representative silver stained gel (left) and immunoblot (right) showing binding of a panel of GST-p12 mutants to host proteins. 293T cells were transiently-transfected with expression constructs for GST-tagged Mo-MLV p12_WT (lane 1) and a panel of Mo-MLV p12 mutants: M63I (lane 2), G49R/E50K (lane 3), D25A/L-dom (carrying alanine substitutions of the PPPY motif as well as D25A, which disrupts clathrin binding, lane 4), p12 CTD only (lane 5) or GST-p12+ h CBS (positive control, lane 6) for ~24 h before being treated overnight with nocodazole. GST-p12 protein complexes were precipitated from normalised cell lysates with glutathione-sepharose beads and analysed by SDS-PAGE followed by silver-staining or immunoblotting with anti-CLTC, anti-WWP2, anti-H2A, anti-H2B, anti-H3 and anti-H4 antibodies. Bands corresponding to core histones in the silver-stained gel are starred. (B) Infectivity of Mo-MLV VLPs carrying alterations in p12. HeLa cells were challenged with equivalent RT units of LacZ -encoding VLPs carrying Mo-MLV p12_WT, M63I, G49R/E50K or p12+ h CBS +/- Mut14, and infectivity was measured 72 h post-infection by detection of beta-galactosidase activity in a chemiluminescent reporter assay. The data are plotted as percentage of WT VLP infectivity (mean ± SEM of > 3 biological replicates). (C) An alignment of p12 sequences from selected gammaretroviruses. The CTD region is shaded pink. The S61 and M63 residues of Mo-MLV p12 are highlighted in red and equivalent residues at position 63 and 64 are boxed. CTD peptide sequences used in subsequent BLI assays ( Fig 9 ) are in bold. (D and E) Representative silver stained gel (top) and immunoblot (bottom) showing interaction of a panel of GST-tagged p12 orthologues (D) and GST-tagged FeLV_p12 mutants I52M and A53V (E) to chromatin associated proteins. GST-pull down assays were performed as in (A). (E) The amount of histone H2B pulled-down with GST-p12 was quantified for each sample by estimating median band intensity of immunoblots using a Li-cor Odyssey imaging system and plotted in the bar chart as mean ± SD of 3 technical replicates.

    Article Snippet: Kinase inhibition GST-p12 proteins were expressed in 293T cells from pCAGGS/GST-derived plasmids by transient transfection using Turbofect (Thermo Fisher Scientific).

    Techniques: Staining, Binding Assay, Transfection, Expressing, Construct, Positive Control, SDS Page, Silver Staining, Infection, Activity Assay, Reporter Assay, Western Blot, Imaging

    GPS leads to the identification of ADP-ribosylated ARTDs/PARPs other than ARTD1/PARP1. (A) A comparison using Venn diagrams for ADPr peptides found in two replicates for full scan (400–1500 m / z ) and combined 4× GPS scans (GPS-1, 400–605; GPS-2, 595–805; GPS-3, 795–1005; GPS-4, 995–1200 m / z ). (B) A comparison of ADPr peptides found in control and IFN-γ-treated THP-1 cells for the full scan and combined 4× GPS scans. (C) Sequence motif analysis for ADPr acceptor amino acids (N, number of ADPr peptides used for the analysis). (D) A plot of the number of ADP-ribosylation sites per protein. (E) Comparison of ADPr peptide abundances between control and IFN-γ in each replicate; regression lines, 95% confidence interval, and standard error of estimate (SEE) are provided (red dots are outliers). (F) MS/MS spectra of an ARTD8/PARP14 ADPr peptide using PRM acquisitions. Black peaks were manually annotated. *, ADPr site. (G) A comparison of the number of proteins identified in the Af1521 elution (ADPr proteins) and input samples (backbone proteins) per replicate. (H) A comparison of the relative changes to ADPr peptides versus their backbone proteins in response to IFN-γ (IFN-γ/control).

    Journal: Journal of Proteome Research

    Article Title: A Study into the ADP-Ribosylome of IFN-γ-Stimulated THP-1 Human Macrophage-like Cells Identifies ARTD8/PARP14 and ARTD9/PARP9 ADP-Ribosylation

    doi: 10.1021/acs.jproteome.8b00895

    Figure Lengend Snippet: GPS leads to the identification of ADP-ribosylated ARTDs/PARPs other than ARTD1/PARP1. (A) A comparison using Venn diagrams for ADPr peptides found in two replicates for full scan (400–1500 m / z ) and combined 4× GPS scans (GPS-1, 400–605; GPS-2, 595–805; GPS-3, 795–1005; GPS-4, 995–1200 m / z ). (B) A comparison of ADPr peptides found in control and IFN-γ-treated THP-1 cells for the full scan and combined 4× GPS scans. (C) Sequence motif analysis for ADPr acceptor amino acids (N, number of ADPr peptides used for the analysis). (D) A plot of the number of ADP-ribosylation sites per protein. (E) Comparison of ADPr peptide abundances between control and IFN-γ in each replicate; regression lines, 95% confidence interval, and standard error of estimate (SEE) are provided (red dots are outliers). (F) MS/MS spectra of an ARTD8/PARP14 ADPr peptide using PRM acquisitions. Black peaks were manually annotated. *, ADPr site. (G) A comparison of the number of proteins identified in the Af1521 elution (ADPr proteins) and input samples (backbone proteins) per replicate. (H) A comparison of the relative changes to ADPr peptides versus their backbone proteins in response to IFN-γ (IFN-γ/control).

    Article Snippet: LC–MS/MS Analysis All peptide samples were analyzed on an Orbitrap Fusion Lumos mass spectrometer fronted with an EASY-Spray Source, coupled to an Easy-nLC1000 HPLC pump (Thermo Fisher Scientific).

    Techniques: Sequencing, Mass Spectrometry

    Data processing of product ion triggered MS/MS spectra. (A) A schematic of SEQUEST-HT searches of triggered EThcD and HCD spectra using the second Af1521 replicate of IFN-γ-treated THP-1 cells. (B) Number of peptide-spectrum matches (PSMs) of assigned ADPr and unmodified peptides from the triggered spectra. (C–E) Distribution of isolation interference for product ion triggered or DDA PSMs. (F) Number of ADPr peptides with high confidence detected by either EThcD or HCD. (G) Venn diagrams comparing ADPr peptide identifications between EThcD and HCD for all ADPr peptides, and those with > 95% ADPr acceptor site probability.

    Journal: Journal of Proteome Research

    Article Title: A Study into the ADP-Ribosylome of IFN-γ-Stimulated THP-1 Human Macrophage-like Cells Identifies ARTD8/PARP14 and ARTD9/PARP9 ADP-Ribosylation

    doi: 10.1021/acs.jproteome.8b00895

    Figure Lengend Snippet: Data processing of product ion triggered MS/MS spectra. (A) A schematic of SEQUEST-HT searches of triggered EThcD and HCD spectra using the second Af1521 replicate of IFN-γ-treated THP-1 cells. (B) Number of peptide-spectrum matches (PSMs) of assigned ADPr and unmodified peptides from the triggered spectra. (C–E) Distribution of isolation interference for product ion triggered or DDA PSMs. (F) Number of ADPr peptides with high confidence detected by either EThcD or HCD. (G) Venn diagrams comparing ADPr peptide identifications between EThcD and HCD for all ADPr peptides, and those with > 95% ADPr acceptor site probability.

    Article Snippet: LC–MS/MS Analysis All peptide samples were analyzed on an Orbitrap Fusion Lumos mass spectrometer fronted with an EASY-Spray Source, coupled to an Easy-nLC1000 HPLC pump (Thermo Fisher Scientific).

    Techniques: Mass Spectrometry, Isolation

    Multivariate statistical analysis of HPLC–PDA–MS non-targeted profiles. a Conventional PCA scores plot inclusive of quality assurance samples. b Conventional PCA scores plot with quality assurance samples excluded. c Conventional PCA loadings plot with quality assurance samples excluded (please refer to Table S1 and S2 for metabolites associated with unique reference numbers). d Multiblock hierarchical (H)PCA super-scores plot. e Multiblock hierarchical (H)PCA block-scores plots based upon daylength condition. Natural, 10 h, 10 h + 3 h, refer to the following daylength condition descriptions, (1) natural long summer day (LD), ca. 18 h (natural LD), (2) 10 h artificial short day (SD), and (3) 10 h SD + 3 h night interruption (SD + NI), respectively

    Journal: Metabolomics

    Article Title: Application of HPLC–PDA–MS metabolite profiling to investigate the effect of growth temperature and day length on blackcurrant fruit

    doi: 10.1007/s11306-018-1462-5

    Figure Lengend Snippet: Multivariate statistical analysis of HPLC–PDA–MS non-targeted profiles. a Conventional PCA scores plot inclusive of quality assurance samples. b Conventional PCA scores plot with quality assurance samples excluded. c Conventional PCA loadings plot with quality assurance samples excluded (please refer to Table S1 and S2 for metabolites associated with unique reference numbers). d Multiblock hierarchical (H)PCA super-scores plot. e Multiblock hierarchical (H)PCA block-scores plots based upon daylength condition. Natural, 10 h, 10 h + 3 h, refer to the following daylength condition descriptions, (1) natural long summer day (LD), ca. 18 h (natural LD), (2) 10 h artificial short day (SD), and (3) 10 h SD + 3 h night interruption (SD + NI), respectively

    Article Snippet: Untargeted HPLC–PDA–MS analysis HPLC separations were performed with a Thermo Accela 600 HPLC system coupled with an Accela PDA detector (Thermo-Fisher Ltd. UK).

    Techniques: High Performance Liquid Chromatography, Mass Spectrometry, Blocking Assay