Structured Review

Source BioScience plc cdna
Cdna, supplied by Source BioScience plc, used in various techniques. Bioz Stars score: 92/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cdna/product/Source BioScience plc
Average 92 stars, based on 23 article reviews
Price from $9.99 to $1999.99
cdna - by Bioz Stars, 2020-08
92/100 stars

Images

Related Articles

Clone Assay:

Article Title: Congenital myasthenic syndromes due to mutations in ALG2 and ALG14
Article Snippet: .. Analysis of ALG14 and ALG2 expression by western blot IMAGE clones containing complementary DNA for ALG14 (clone number 3689162) and ALG2 (clone number 4698763) were purchased from Source Bioscience Lifesciences and were subcloned into mammalian expression vector pcDNA3.1-hygro (Invitrogen). .. Mutations were introduced into the respective sequences by site-directed mutagenesis using the Quikchange® kit from Stratagene and the full sequence confirmed by Sanger sequencing.

Article Title: Alternative UNC13D Promoter Encodes a Functional Munc13-4 Isoform Predominantly Expressed in Lymphocytes and Platelets
Article Snippet: .. Plasmids, Antibodies and Reagents The coding sequence corresponding to the conventional UNC13D transcript was PCR-amplified from a cDNA clone (IMAGE clone 5951944, Source Bioscience) using primers 5′-ATGCGCTAGCACCATGGCGACACTCCTCTCC-CATCCG-3′ and 5′-GCATCTCGAGCTACGGTGCCGGCCGCAAGGCATG-3′ and cloned into the pMax vector (Lonza). .. From this construct a fragment was excised with Nhe I/Sda I and replaced with a synthetic gBlock fragment (IDT) corresponding to the alternative exon 1 sequence in EST clone CR983520 to generate an expression construct for the alternative exon 1 transcript.

Article Title: A simple method for the determination of reduction potentials in heme proteins
Article Snippet: .. Cloning of human NPAS2 and human CLOCK PAS domains A construct of human NPAS2 (hNPAS2) corresponding to the PAS-A domain (amino acids 78–240) was prepared from a cDNA clone (Image clone # 5248433 from Source BioScience) and cloned into an Escherichia coli expression vector (pLEICS-07) which contains an N-terminal 6xHis-tag, an S-tag and a TEV protease cleavage site upstream of the hNPAS2 PAS-A domain. .. A construct of human CLOCK (hCLOCK) corresponding to the PAS-A domain (amino acids 106–265) was cloned into an E. coli expression vector separately (pLEICS-03), which contained an N-terminal 6xHis-tag and a TEV protease cleavage site upstream of the hCLOCK PAS-A domain, using cDNA clone (Origene).

Amplification:

Article Title: Trypanosoma brucei Thymidine Kinase Is Tandem Protein Consisting of Two Homologous Parts, Which Together Enable Efficient Substrate Binding *
Article Snippet: .. The human TK1 ORF was amplified from a cDNA clone (IMAGE 2905608, Source Bioscience) and subcloned into a pETZ2-1a plasmid to create the expression vector pETZ-hTK1. .. The sequences of all T. brucei and human TK constructs were verified from both directions.

Article Title: Identification of novel targets for host-directed therapeutics against intracellular Staphylococcus aureus
Article Snippet: .. TRAM2 was amplified from the cDNA Clone IRATp970H1249D (SourceBioscience) with primers TAGCTAAAGCTTGCCACCATGGCTTTCCGCAGGAGG and GCCCTTGCTCACCATGGGAGACTTGAGTTT, whereas mCherry was amplified from P12-MMP-mCherry-LC3 with AAACTCAAGTCTCCCATGGTGAGCAAGGGC and TAGCTAGCGGCCGCTTTACTTGTACAGCTCGTCCAT, and subjected to fusion PCR. .. The DNA amplicon was verified by sequencing, digested with HindIII/NotI, and cloned into P12-MMP to create P12-MMP-TRAM2-mCherry.

Construct:

Article Title: A simple method for the determination of reduction potentials in heme proteins
Article Snippet: .. Cloning of human NPAS2 and human CLOCK PAS domains A construct of human NPAS2 (hNPAS2) corresponding to the PAS-A domain (amino acids 78–240) was prepared from a cDNA clone (Image clone # 5248433 from Source BioScience) and cloned into an Escherichia coli expression vector (pLEICS-07) which contains an N-terminal 6xHis-tag, an S-tag and a TEV protease cleavage site upstream of the hNPAS2 PAS-A domain. .. A construct of human CLOCK (hCLOCK) corresponding to the PAS-A domain (amino acids 106–265) was cloned into an E. coli expression vector separately (pLEICS-03), which contained an N-terminal 6xHis-tag and a TEV protease cleavage site upstream of the hCLOCK PAS-A domain, using cDNA clone (Origene).

Article Title: Characterization of homologous sphingosine-1-phosphate lyase isoforms in the bacterial pathogen Burkholderia pseudomallei [S]
Article Snippet: .. A commercially available cDNA clone (Source BioScience, product code IRAUp969B0810D in plasmid pOTB7) was used to construct an expression clone of the full-length FALDH protein (isoform 1); however, in our hands, this initial construct was insoluble (data not shown). .. A sequence alignment between human FALDH and rat ALDH3A1, which lacks a hydrophobic C-terminal transmembrane (TM) region, guided the preparation of a second truncated clone (supplemental Fig. S5).

Produced:

Article Title: Early intrinsic hyperexcitability does not contribute to motoneuron degeneration in amyotrophic lateral sclerosis
Article Snippet: .. Chondrolectin probes (Genebank number NM_139134.3) were produced from commercial cDNA (Source BioScience, Nottingham, UK), using T3 RNA polymerase in the presence of digoxigenin-11-UTP (Roche Diagnostics, Basel, Switzerland). .. Slices were washed with PBT (PBS supplemented with 0.1% Tween-20, Sigma–Aldrich) followed by treatment with 0.5% Triton X-100.

Sequencing:

Article Title: Alternative UNC13D Promoter Encodes a Functional Munc13-4 Isoform Predominantly Expressed in Lymphocytes and Platelets
Article Snippet: .. Plasmids, Antibodies and Reagents The coding sequence corresponding to the conventional UNC13D transcript was PCR-amplified from a cDNA clone (IMAGE clone 5951944, Source Bioscience) using primers 5′-ATGCGCTAGCACCATGGCGACACTCCTCTCC-CATCCG-3′ and 5′-GCATCTCGAGCTACGGTGCCGGCCGCAAGGCATG-3′ and cloned into the pMax vector (Lonza). .. From this construct a fragment was excised with Nhe I/Sda I and replaced with a synthetic gBlock fragment (IDT) corresponding to the alternative exon 1 sequence in EST clone CR983520 to generate an expression construct for the alternative exon 1 transcript.

Expressing:

Article Title: Trypanosoma brucei Thymidine Kinase Is Tandem Protein Consisting of Two Homologous Parts, Which Together Enable Efficient Substrate Binding *
Article Snippet: .. The human TK1 ORF was amplified from a cDNA clone (IMAGE 2905608, Source Bioscience) and subcloned into a pETZ2-1a plasmid to create the expression vector pETZ-hTK1. .. The sequences of all T. brucei and human TK constructs were verified from both directions.

Article Title: Congenital myasthenic syndromes due to mutations in ALG2 and ALG14
Article Snippet: .. Analysis of ALG14 and ALG2 expression by western blot IMAGE clones containing complementary DNA for ALG14 (clone number 3689162) and ALG2 (clone number 4698763) were purchased from Source Bioscience Lifesciences and were subcloned into mammalian expression vector pcDNA3.1-hygro (Invitrogen). .. Mutations were introduced into the respective sequences by site-directed mutagenesis using the Quikchange® kit from Stratagene and the full sequence confirmed by Sanger sequencing.

Article Title: A simple method for the determination of reduction potentials in heme proteins
Article Snippet: .. Cloning of human NPAS2 and human CLOCK PAS domains A construct of human NPAS2 (hNPAS2) corresponding to the PAS-A domain (amino acids 78–240) was prepared from a cDNA clone (Image clone # 5248433 from Source BioScience) and cloned into an Escherichia coli expression vector (pLEICS-07) which contains an N-terminal 6xHis-tag, an S-tag and a TEV protease cleavage site upstream of the hNPAS2 PAS-A domain. .. A construct of human CLOCK (hCLOCK) corresponding to the PAS-A domain (amino acids 106–265) was cloned into an E. coli expression vector separately (pLEICS-03), which contained an N-terminal 6xHis-tag and a TEV protease cleavage site upstream of the hCLOCK PAS-A domain, using cDNA clone (Origene).

Article Title: Characterization of homologous sphingosine-1-phosphate lyase isoforms in the bacterial pathogen Burkholderia pseudomallei [S]
Article Snippet: .. A commercially available cDNA clone (Source BioScience, product code IRAUp969B0810D in plasmid pOTB7) was used to construct an expression clone of the full-length FALDH protein (isoform 1); however, in our hands, this initial construct was insoluble (data not shown). .. A sequence alignment between human FALDH and rat ALDH3A1, which lacks a hydrophobic C-terminal transmembrane (TM) region, guided the preparation of a second truncated clone (supplemental Fig. S5).

Polymerase Chain Reaction:

Article Title: Alternative UNC13D Promoter Encodes a Functional Munc13-4 Isoform Predominantly Expressed in Lymphocytes and Platelets
Article Snippet: .. Plasmids, Antibodies and Reagents The coding sequence corresponding to the conventional UNC13D transcript was PCR-amplified from a cDNA clone (IMAGE clone 5951944, Source Bioscience) using primers 5′-ATGCGCTAGCACCATGGCGACACTCCTCTCC-CATCCG-3′ and 5′-GCATCTCGAGCTACGGTGCCGGCCGCAAGGCATG-3′ and cloned into the pMax vector (Lonza). .. From this construct a fragment was excised with Nhe I/Sda I and replaced with a synthetic gBlock fragment (IDT) corresponding to the alternative exon 1 sequence in EST clone CR983520 to generate an expression construct for the alternative exon 1 transcript.

Article Title: Identification of novel targets for host-directed therapeutics against intracellular Staphylococcus aureus
Article Snippet: .. TRAM2 was amplified from the cDNA Clone IRATp970H1249D (SourceBioscience) with primers TAGCTAAAGCTTGCCACCATGGCTTTCCGCAGGAGG and GCCCTTGCTCACCATGGGAGACTTGAGTTT, whereas mCherry was amplified from P12-MMP-mCherry-LC3 with AAACTCAAGTCTCCCATGGTGAGCAAGGGC and TAGCTAGCGGCCGCTTTACTTGTACAGCTCGTCCAT, and subjected to fusion PCR. .. The DNA amplicon was verified by sequencing, digested with HindIII/NotI, and cloned into P12-MMP to create P12-MMP-TRAM2-mCherry.

Western Blot:

Article Title: Congenital myasthenic syndromes due to mutations in ALG2 and ALG14
Article Snippet: .. Analysis of ALG14 and ALG2 expression by western blot IMAGE clones containing complementary DNA for ALG14 (clone number 3689162) and ALG2 (clone number 4698763) were purchased from Source Bioscience Lifesciences and were subcloned into mammalian expression vector pcDNA3.1-hygro (Invitrogen). .. Mutations were introduced into the respective sequences by site-directed mutagenesis using the Quikchange® kit from Stratagene and the full sequence confirmed by Sanger sequencing.

In Situ Hybridization:

Article Title: IL-6 Stimulates Intestinal Epithelial Proliferation and Repair after Injury
Article Snippet: .. In situ Hybridization IL-6 RNA probe was established by reverse transcription of cDNA (for mouse IL-6: IMAGE ID 8861788, Source BioScience, Nottingham, United Kingdom; for human IL-6: IMAGE ID 3884652, Thermo Scientific. .. Waltham, MA) using digoxigenin-labeled ribonucleotides (Roche, Indianapolis, IN).

Plasmid Preparation:

Article Title: Trypanosoma brucei Thymidine Kinase Is Tandem Protein Consisting of Two Homologous Parts, Which Together Enable Efficient Substrate Binding *
Article Snippet: .. The human TK1 ORF was amplified from a cDNA clone (IMAGE 2905608, Source Bioscience) and subcloned into a pETZ2-1a plasmid to create the expression vector pETZ-hTK1. .. The sequences of all T. brucei and human TK constructs were verified from both directions.

Article Title: Congenital myasthenic syndromes due to mutations in ALG2 and ALG14
Article Snippet: .. Analysis of ALG14 and ALG2 expression by western blot IMAGE clones containing complementary DNA for ALG14 (clone number 3689162) and ALG2 (clone number 4698763) were purchased from Source Bioscience Lifesciences and were subcloned into mammalian expression vector pcDNA3.1-hygro (Invitrogen). .. Mutations were introduced into the respective sequences by site-directed mutagenesis using the Quikchange® kit from Stratagene and the full sequence confirmed by Sanger sequencing.

Article Title: Alternative UNC13D Promoter Encodes a Functional Munc13-4 Isoform Predominantly Expressed in Lymphocytes and Platelets
Article Snippet: .. Plasmids, Antibodies and Reagents The coding sequence corresponding to the conventional UNC13D transcript was PCR-amplified from a cDNA clone (IMAGE clone 5951944, Source Bioscience) using primers 5′-ATGCGCTAGCACCATGGCGACACTCCTCTCC-CATCCG-3′ and 5′-GCATCTCGAGCTACGGTGCCGGCCGCAAGGCATG-3′ and cloned into the pMax vector (Lonza). .. From this construct a fragment was excised with Nhe I/Sda I and replaced with a synthetic gBlock fragment (IDT) corresponding to the alternative exon 1 sequence in EST clone CR983520 to generate an expression construct for the alternative exon 1 transcript.

Article Title: A simple method for the determination of reduction potentials in heme proteins
Article Snippet: .. Cloning of human NPAS2 and human CLOCK PAS domains A construct of human NPAS2 (hNPAS2) corresponding to the PAS-A domain (amino acids 78–240) was prepared from a cDNA clone (Image clone # 5248433 from Source BioScience) and cloned into an Escherichia coli expression vector (pLEICS-07) which contains an N-terminal 6xHis-tag, an S-tag and a TEV protease cleavage site upstream of the hNPAS2 PAS-A domain. .. A construct of human CLOCK (hCLOCK) corresponding to the PAS-A domain (amino acids 106–265) was cloned into an E. coli expression vector separately (pLEICS-03), which contained an N-terminal 6xHis-tag and a TEV protease cleavage site upstream of the hCLOCK PAS-A domain, using cDNA clone (Origene).

Article Title: Characterization of homologous sphingosine-1-phosphate lyase isoforms in the bacterial pathogen Burkholderia pseudomallei [S]
Article Snippet: .. A commercially available cDNA clone (Source BioScience, product code IRAUp969B0810D in plasmid pOTB7) was used to construct an expression clone of the full-length FALDH protein (isoform 1); however, in our hands, this initial construct was insoluble (data not shown). .. A sequence alignment between human FALDH and rat ALDH3A1, which lacks a hydrophobic C-terminal transmembrane (TM) region, guided the preparation of a second truncated clone (supplemental Fig. S5).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Source BioScience plc β arrestin2 cdnas
    eBRET dose-response data indicating proximity between <t>β-arrestin2</t> and OX 2 , or OX 2 mutants Δ406 or Δ406-Δ427, at 20 and 120 min post-agonist stimulation. pEC 50 values were as follows: 7.34 ± 0.11 (OX 2 ), 6.91 ± 0.05 (Δ406), 6.64 ± 0.14 (Δ406-Δ427) at 20 min; 7.11 ± 0.10 (OX 2 ), 6.79 ± 0.08 (Δ406), 6.42 ± 0.43 (Δ406-Δ427) at 120 min. Maximal BRET efficacy values are as follows: 0.91 ± 0.07 (OX 2 ), 0.85 ± 0.04 (Δ406), 0.40 ± 0.02 (Δ406-Δ427) at 20 min; 0.85 ± 0.06 (OX 2 ), 0.61 ± 0.01 (Δ406), 0.21 ± 0.03 (Δ406-Δ427) at 120 min. Data are presented as mean ± SEM of three independent experiments. * P
    β Arrestin2 Cdnas, supplied by Source BioScience plc, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/β arrestin2 cdnas/product/Source BioScience plc
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    β arrestin2 cdnas - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    92
    Source BioScience plc fgf11 cdna
    Expression and localisation of other FHFs mRNA in the inner ear. ( a ) Detection of <t>FGF11,</t> FGF13, and FGF14 mRNA expression by RT-PCR in cochleae of WT and FGF12-KO mice. β-actin positive controls are shown. (−) indicates reaction products without <t>cDNA</t> as a negative control. These gel images are cropped, and full-length images are presented in Supplementary Information 3 . ( b ) Detection of FGF11, FGF13, and FGF14 mRNA expression by RT-PCR in vestibular ganglia of WT and FGF12-KO mice. ( c , d ) FGF11 mRNA localisation in the WT mouse inner ear by in situ hybridisation. ( e , f ) In situ hybridisation images on the WT mouse inner ear using the sense probe as a negative control. ( g , h ) FGF11 mRNA localisation in the FGF12-KO mouse inner ear by in situ hybridisation. ( i , j ) In situ hybridisation images of the FGF12-KO mouse inner ear using the sense probe as a negative control. Black triangles indicate spiral ganglions, and black arrows indicate vestibular ganglions in ( c – j ). Scale bar: 50 µm.
    Fgf11 Cdna, supplied by Source BioScience plc, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fgf11 cdna/product/Source BioScience plc
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    fgf11 cdna - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    85
    Source BioScience plc mouse cdna cnx
    Expression of GlyT2 following <t>CNX</t> knockdown/overexpression. (A) COS7 cells were co-transfected with 0.5 µg of GlyT2 <t>cDNA</t> in pCDNA3 and the indicated amount of control (HPRT) or CNX siRNA. At 48 h post-transfection, the cells were analyzed in Western blots (upper panel) or assayed for glycine transport (open bars, left graph). The specific CNX d-siRNA reduced CNX protein levels by 62% (0.2 µg) and 85% (0.4 µg), respectively, as compared with endogenous levels. Control d-siRNA increased total GlyT2 levels by 10% and 15%, respectively. Right graph: ratio of mature (100 kDa) to immature (75 kDa) band at the different amounts of CNX siRNA transfected. The bands were detected with GlyT2 antibodies against N- or C-terminal epitopes ( Fig. S1 ). (B) COS7 cells were co-transfected with 0.5 µg of GlyT2 cDNA together with a CNX cDNA at the indicated mass ratio (CNX:GlyT2). At 48 h post-transfection the cells were biotinylated (T = total transporter; N = non-biotinylated transporter; B = biotinylated transporter, 3-fold the protein amount in T or N) or glycine transport was assayed (open bars, left histogram). Solid bars in the left histogram represent total GlyT2 normalized to tubulin immunoreactivity. Verification of CNX overexpression by densitometry revealed the following increases at increasing mass ratios: 0∶1, 1-fold (endogenous CNX); 0.5∶1, 1.8-fold; 4∶1, 2.4-fold; 8∶1, 9.3-fold; 10∶1, 12.9-fold. Right graph: the ratio of the mature (100 kDa) to immature (75 kDa) protein decreased with the amount of CNX expressed. Bars represent the S.E.M (n = 6). *p
    Mouse Cdna Cnx, supplied by Source BioScience plc, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse cdna cnx/product/Source BioScience plc
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mouse cdna cnx - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    91
    Source BioScience plc transgenic cell lines human lyve 1 cdna
    sLYVE-1 is shedded from macrophages by metalloproteinases (A) Western blot and Coomassie brilliant blue staining of U937 <t>LYVE-1</t> cell lysates and supernatant (SN) after immunoprecipitation with a LYVE-1 antibody. (B) The <t>transgenic</t> cell line U937 LYVE-1 was stimulated for 24 h with shedding inducer 4-aminophenylmercuric acetate (APMA) and the inhibitors GM6001, MMP9/13 inhibitor and TAPI-1 (50 μM each), DMSO was added as a control. LYVE-1 was detected in total protein lysates and in the cell culture supernatant by western blot. (C) Quantification of sLYVE-1 by ELISA following treatment with different shedding modulators as indicated (n=3). Results are depicted as mean values with SEM.
    Transgenic Cell Lines Human Lyve 1 Cdna, supplied by Source BioScience plc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transgenic cell lines human lyve 1 cdna/product/Source BioScience plc
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    transgenic cell lines human lyve 1 cdna - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    Image Search Results


    eBRET dose-response data indicating proximity between β-arrestin2 and OX 2 , or OX 2 mutants Δ406 or Δ406-Δ427, at 20 and 120 min post-agonist stimulation. pEC 50 values were as follows: 7.34 ± 0.11 (OX 2 ), 6.91 ± 0.05 (Δ406), 6.64 ± 0.14 (Δ406-Δ427) at 20 min; 7.11 ± 0.10 (OX 2 ), 6.79 ± 0.08 (Δ406), 6.42 ± 0.43 (Δ406-Δ427) at 120 min. Maximal BRET efficacy values are as follows: 0.91 ± 0.07 (OX 2 ), 0.85 ± 0.04 (Δ406), 0.40 ± 0.02 (Δ406-Δ427) at 20 min; 0.85 ± 0.06 (OX 2 ), 0.61 ± 0.01 (Δ406), 0.21 ± 0.03 (Δ406-Δ427) at 120 min. Data are presented as mean ± SEM of three independent experiments. * P

    Journal: British Journal of Pharmacology

    Article Title: Molecular determinants of orexin receptor-arrestinubiquitin complex formation

    doi: 10.1111/bph.12481

    Figure Lengend Snippet: eBRET dose-response data indicating proximity between β-arrestin2 and OX 2 , or OX 2 mutants Δ406 or Δ406-Δ427, at 20 and 120 min post-agonist stimulation. pEC 50 values were as follows: 7.34 ± 0.11 (OX 2 ), 6.91 ± 0.05 (Δ406), 6.64 ± 0.14 (Δ406-Δ427) at 20 min; 7.11 ± 0.10 (OX 2 ), 6.79 ± 0.08 (Δ406), 6.42 ± 0.43 (Δ406-Δ427) at 120 min. Maximal BRET efficacy values are as follows: 0.91 ± 0.07 (OX 2 ), 0.85 ± 0.04 (Δ406), 0.40 ± 0.02 (Δ406-Δ427) at 20 min; 0.85 ± 0.06 (OX 2 ), 0.61 ± 0.01 (Δ406), 0.21 ± 0.03 (Δ406-Δ427) at 120 min. Data are presented as mean ± SEM of three independent experiments. * P

    Article Snippet: Wild-type human OX2 receptor cDNA was kindly provided by M. Yanagisawa (Howard Hughes Medical Institute, Dallas, TX, USA; Accession No. NM_001526). β-arrestin1 and β-arrestin2 cDNAs were from RZPD GenomeCube, Berlin, Germany.

    Techniques: Bioluminescence Resonance Energy Transfer

    eBRET data comparing proximity between β-arrestin1 or 2 and OX 2 , OX 2 Δ399 or OX 2 Δ399-Δ406-Δ427 receptors, with or without the E402Q mutation. HEK293FT cells were transiently transfected with Venus-tagged OX 2 or mutant receptors and either Rluc8-tagged β-arrestin1 (A) or β-arrestin2 (B). The zero time point indicates when 0.6 μM orexin A was added. Data are presented as mean ± SEM of three independent experiments.

    Journal: British Journal of Pharmacology

    Article Title: Molecular determinants of orexin receptor-arrestinubiquitin complex formation

    doi: 10.1111/bph.12481

    Figure Lengend Snippet: eBRET data comparing proximity between β-arrestin1 or 2 and OX 2 , OX 2 Δ399 or OX 2 Δ399-Δ406-Δ427 receptors, with or without the E402Q mutation. HEK293FT cells were transiently transfected with Venus-tagged OX 2 or mutant receptors and either Rluc8-tagged β-arrestin1 (A) or β-arrestin2 (B). The zero time point indicates when 0.6 μM orexin A was added. Data are presented as mean ± SEM of three independent experiments.

    Article Snippet: Wild-type human OX2 receptor cDNA was kindly provided by M. Yanagisawa (Howard Hughes Medical Institute, Dallas, TX, USA; Accession No. NM_001526). β-arrestin1 and β-arrestin2 cDNAs were from RZPD GenomeCube, Berlin, Germany.

    Techniques: Mutagenesis, Transfection

    eBRET data indicating proximity between ubiquitin and β-arrestin2 in the presence of wild-type OX 1 , OX 2 or OX 2 mutant receptors. HEK293FT cells were transiently transfected with N-terminally Venus-tagged ubiquitin, C-terminally Rluc8-tagged β-arrestin2 and non-BRET-tagged OX 1 , OX 2 , OX 2 Δ406 or OX 2 Δ406-Δ427 receptors. The zero time point indicates when 0.6 μM orexin A was added. Data are presented as mean ± SEM of three independent experiments.

    Journal: British Journal of Pharmacology

    Article Title: Molecular determinants of orexin receptor-arrestinubiquitin complex formation

    doi: 10.1111/bph.12481

    Figure Lengend Snippet: eBRET data indicating proximity between ubiquitin and β-arrestin2 in the presence of wild-type OX 1 , OX 2 or OX 2 mutant receptors. HEK293FT cells were transiently transfected with N-terminally Venus-tagged ubiquitin, C-terminally Rluc8-tagged β-arrestin2 and non-BRET-tagged OX 1 , OX 2 , OX 2 Δ406 or OX 2 Δ406-Δ427 receptors. The zero time point indicates when 0.6 μM orexin A was added. Data are presented as mean ± SEM of three independent experiments.

    Article Snippet: Wild-type human OX2 receptor cDNA was kindly provided by M. Yanagisawa (Howard Hughes Medical Institute, Dallas, TX, USA; Accession No. NM_001526). β-arrestin1 and β-arrestin2 cDNAs were from RZPD GenomeCube, Berlin, Germany.

    Techniques: Mutagenesis, Transfection, Bioluminescence Resonance Energy Transfer

    eBRET data indicating proximity between OX 2 or OX 2 C-terminal tail mutant receptors with β-arrestin1 or 2. HEK293FT cells were transiently transfected with either C-terminally Venus-tagged (A-D), or Rluc8-tagged (E-H) OX 2 or each of the single (A, C, E, G) or double/triple (B, D, F, H) C-terminal OX 2 mutant receptors in the presence of either Rluc8-tagged β-arrestin1 (A, B) or β-arrestin2 (C, D), or Venus-tagged β-arrestin1 (E, F) or β-arrestin2 (G, H). The zero time point indicates the point at which 0.6 μM orexin A was added. Data are presented as mean ± SEM of three independent experiments.

    Journal: British Journal of Pharmacology

    Article Title: Molecular determinants of orexin receptor-arrestinubiquitin complex formation

    doi: 10.1111/bph.12481

    Figure Lengend Snippet: eBRET data indicating proximity between OX 2 or OX 2 C-terminal tail mutant receptors with β-arrestin1 or 2. HEK293FT cells were transiently transfected with either C-terminally Venus-tagged (A-D), or Rluc8-tagged (E-H) OX 2 or each of the single (A, C, E, G) or double/triple (B, D, F, H) C-terminal OX 2 mutant receptors in the presence of either Rluc8-tagged β-arrestin1 (A, B) or β-arrestin2 (C, D), or Venus-tagged β-arrestin1 (E, F) or β-arrestin2 (G, H). The zero time point indicates the point at which 0.6 μM orexin A was added. Data are presented as mean ± SEM of three independent experiments.

    Article Snippet: Wild-type human OX2 receptor cDNA was kindly provided by M. Yanagisawa (Howard Hughes Medical Institute, Dallas, TX, USA; Accession No. NM_001526). β-arrestin1 and β-arrestin2 cDNAs were from RZPD GenomeCube, Berlin, Germany.

    Techniques: Mutagenesis, Transfection

    eBRET kinetic data for OX 1 , OX 2 and OX 1 ctOX 2 receptors. HEK293FT cells transiently transfected with C-terminally Venus-tagged receptors and Rluc8-tagged β-arrestin1 (A) or β-arrestin2 (B), or C-terminally Rluc8-tagged receptors and Venus-tagged β-arrestin1 (C) or β-arrestin2 (D) were treated with 0.6 μM orexin A. Data are presented as mean ± SEM of three independent experiments.

    Journal: British Journal of Pharmacology

    Article Title: Molecular determinants of orexin receptor-arrestinubiquitin complex formation

    doi: 10.1111/bph.12481

    Figure Lengend Snippet: eBRET kinetic data for OX 1 , OX 2 and OX 1 ctOX 2 receptors. HEK293FT cells transiently transfected with C-terminally Venus-tagged receptors and Rluc8-tagged β-arrestin1 (A) or β-arrestin2 (B), or C-terminally Rluc8-tagged receptors and Venus-tagged β-arrestin1 (C) or β-arrestin2 (D) were treated with 0.6 μM orexin A. Data are presented as mean ± SEM of three independent experiments.

    Article Snippet: Wild-type human OX2 receptor cDNA was kindly provided by M. Yanagisawa (Howard Hughes Medical Institute, Dallas, TX, USA; Accession No. NM_001526). β-arrestin1 and β-arrestin2 cDNAs were from RZPD GenomeCube, Berlin, Germany.

    Techniques: Transfection

    Expression and localisation of other FHFs mRNA in the inner ear. ( a ) Detection of FGF11, FGF13, and FGF14 mRNA expression by RT-PCR in cochleae of WT and FGF12-KO mice. β-actin positive controls are shown. (−) indicates reaction products without cDNA as a negative control. These gel images are cropped, and full-length images are presented in Supplementary Information 3 . ( b ) Detection of FGF11, FGF13, and FGF14 mRNA expression by RT-PCR in vestibular ganglia of WT and FGF12-KO mice. ( c , d ) FGF11 mRNA localisation in the WT mouse inner ear by in situ hybridisation. ( e , f ) In situ hybridisation images on the WT mouse inner ear using the sense probe as a negative control. ( g , h ) FGF11 mRNA localisation in the FGF12-KO mouse inner ear by in situ hybridisation. ( i , j ) In situ hybridisation images of the FGF12-KO mouse inner ear using the sense probe as a negative control. Black triangles indicate spiral ganglions, and black arrows indicate vestibular ganglions in ( c – j ). Scale bar: 50 µm.

    Journal: Scientific Reports

    Article Title: Fibroblast growth factor 12 is expressed in spiral and vestibular ganglia and necessary for auditory and equilibrium function

    doi: 10.1038/s41598-018-28618-0

    Figure Lengend Snippet: Expression and localisation of other FHFs mRNA in the inner ear. ( a ) Detection of FGF11, FGF13, and FGF14 mRNA expression by RT-PCR in cochleae of WT and FGF12-KO mice. β-actin positive controls are shown. (−) indicates reaction products without cDNA as a negative control. These gel images are cropped, and full-length images are presented in Supplementary Information 3 . ( b ) Detection of FGF11, FGF13, and FGF14 mRNA expression by RT-PCR in vestibular ganglia of WT and FGF12-KO mice. ( c , d ) FGF11 mRNA localisation in the WT mouse inner ear by in situ hybridisation. ( e , f ) In situ hybridisation images on the WT mouse inner ear using the sense probe as a negative control. ( g , h ) FGF11 mRNA localisation in the FGF12-KO mouse inner ear by in situ hybridisation. ( i , j ) In situ hybridisation images of the FGF12-KO mouse inner ear using the sense probe as a negative control. Black triangles indicate spiral ganglions, and black arrows indicate vestibular ganglions in ( c – j ). Scale bar: 50 µm.

    Article Snippet: We purchased FGF11 cDNA (IMAGE clone 30101881; Source Bioscience), FGF13 cDNA (D130019P14; DNAform, Yokohama, Japan), and FGF14 cDNA (9630023C21; DNAform).

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Mouse Assay, Negative Control, In Situ, Hybridization

    Expression of GlyT2 following CNX knockdown/overexpression. (A) COS7 cells were co-transfected with 0.5 µg of GlyT2 cDNA in pCDNA3 and the indicated amount of control (HPRT) or CNX siRNA. At 48 h post-transfection, the cells were analyzed in Western blots (upper panel) or assayed for glycine transport (open bars, left graph). The specific CNX d-siRNA reduced CNX protein levels by 62% (0.2 µg) and 85% (0.4 µg), respectively, as compared with endogenous levels. Control d-siRNA increased total GlyT2 levels by 10% and 15%, respectively. Right graph: ratio of mature (100 kDa) to immature (75 kDa) band at the different amounts of CNX siRNA transfected. The bands were detected with GlyT2 antibodies against N- or C-terminal epitopes ( Fig. S1 ). (B) COS7 cells were co-transfected with 0.5 µg of GlyT2 cDNA together with a CNX cDNA at the indicated mass ratio (CNX:GlyT2). At 48 h post-transfection the cells were biotinylated (T = total transporter; N = non-biotinylated transporter; B = biotinylated transporter, 3-fold the protein amount in T or N) or glycine transport was assayed (open bars, left histogram). Solid bars in the left histogram represent total GlyT2 normalized to tubulin immunoreactivity. Verification of CNX overexpression by densitometry revealed the following increases at increasing mass ratios: 0∶1, 1-fold (endogenous CNX); 0.5∶1, 1.8-fold; 4∶1, 2.4-fold; 8∶1, 9.3-fold; 10∶1, 12.9-fold. Right graph: the ratio of the mature (100 kDa) to immature (75 kDa) protein decreased with the amount of CNX expressed. Bars represent the S.E.M (n = 6). *p

    Journal: PLoS ONE

    Article Title: Calnexin-Assisted Biogenesis of the Neuronal Glycine Transporter 2 (GlyT2)

    doi: 10.1371/journal.pone.0063230

    Figure Lengend Snippet: Expression of GlyT2 following CNX knockdown/overexpression. (A) COS7 cells were co-transfected with 0.5 µg of GlyT2 cDNA in pCDNA3 and the indicated amount of control (HPRT) or CNX siRNA. At 48 h post-transfection, the cells were analyzed in Western blots (upper panel) or assayed for glycine transport (open bars, left graph). The specific CNX d-siRNA reduced CNX protein levels by 62% (0.2 µg) and 85% (0.4 µg), respectively, as compared with endogenous levels. Control d-siRNA increased total GlyT2 levels by 10% and 15%, respectively. Right graph: ratio of mature (100 kDa) to immature (75 kDa) band at the different amounts of CNX siRNA transfected. The bands were detected with GlyT2 antibodies against N- or C-terminal epitopes ( Fig. S1 ). (B) COS7 cells were co-transfected with 0.5 µg of GlyT2 cDNA together with a CNX cDNA at the indicated mass ratio (CNX:GlyT2). At 48 h post-transfection the cells were biotinylated (T = total transporter; N = non-biotinylated transporter; B = biotinylated transporter, 3-fold the protein amount in T or N) or glycine transport was assayed (open bars, left histogram). Solid bars in the left histogram represent total GlyT2 normalized to tubulin immunoreactivity. Verification of CNX overexpression by densitometry revealed the following increases at increasing mass ratios: 0∶1, 1-fold (endogenous CNX); 0.5∶1, 1.8-fold; 4∶1, 2.4-fold; 8∶1, 9.3-fold; 10∶1, 12.9-fold. Right graph: the ratio of the mature (100 kDa) to immature (75 kDa) protein decreased with the amount of CNX expressed. Bars represent the S.E.M (n = 6). *p

    Article Snippet: Mouse cDNA CNX clone (IMAGE number 2582119) was purchased from Source Bioscience Lifesciences.

    Techniques: Expressing, Over Expression, Transfection, Western Blot

    sLYVE-1 is shedded from macrophages by metalloproteinases (A) Western blot and Coomassie brilliant blue staining of U937 LYVE-1 cell lysates and supernatant (SN) after immunoprecipitation with a LYVE-1 antibody. (B) The transgenic cell line U937 LYVE-1 was stimulated for 24 h with shedding inducer 4-aminophenylmercuric acetate (APMA) and the inhibitors GM6001, MMP9/13 inhibitor and TAPI-1 (50 μM each), DMSO was added as a control. LYVE-1 was detected in total protein lysates and in the cell culture supernatant by western blot. (C) Quantification of sLYVE-1 by ELISA following treatment with different shedding modulators as indicated (n=3). Results are depicted as mean values with SEM.

    Journal: Oncotarget

    Article Title: The shedded ectodomain of Lyve-1 expressed on M2-like tumor-associated macrophages inhibits melanoma cell proliferation

    doi: 10.18632/oncotarget.21771

    Figure Lengend Snippet: sLYVE-1 is shedded from macrophages by metalloproteinases (A) Western blot and Coomassie brilliant blue staining of U937 LYVE-1 cell lysates and supernatant (SN) after immunoprecipitation with a LYVE-1 antibody. (B) The transgenic cell line U937 LYVE-1 was stimulated for 24 h with shedding inducer 4-aminophenylmercuric acetate (APMA) and the inhibitors GM6001, MMP9/13 inhibitor and TAPI-1 (50 μM each), DMSO was added as a control. LYVE-1 was detected in total protein lysates and in the cell culture supernatant by western blot. (C) Quantification of sLYVE-1 by ELISA following treatment with different shedding modulators as indicated (n=3). Results are depicted as mean values with SEM.

    Article Snippet: Generation of transgenic cell lines Human LYVE-1 cDNA (clone IRAUp969G0386D, SourceBioscience) or murine LYVE-1 cDNA (clone IRAVp968E0743D, SourceBioscience) was amplified by PCR and cloned into a modified lentiviral expression system vector pHAGE [ ].

    Techniques: Western Blot, Staining, Immunoprecipitation, Transgenic Assay, Cell Culture, Enzyme-linked Immunosorbent Assay