Structured Review

Bio-Rad cdna transcripts
Effect of diet-reversal on CIDE-A expression . Mice were weaned onto the indicated diet for 33 weeks. The mice were then switched to the indicated diets for an additional 14 weeks. RNA was isolated from frozen liver as described. Real Time <t>RT-PCR</t> was performed on the <t>cDNA</t> transcripts using CIDE-A forward and reverse primers. Housekeeping genes, ACTG (actin gamma cytoplasmic) and GADPH (glyceraldehyde-III phosphate dehydrogenase), were utilized for normalization as described. Relative expression levels were calculated using normalization factors derived from geNorm analysis of ACTG and GADPH using the delta-delta CT method. CIDE-A expression levels in control mice fed standard chow for the entire feeding period (SC-SC) were given a value of 1.0. Changes in CIDE-A expression due to diet were expressed relative to the control mice. N = 4 (for each group). SC, standard chow; HF, high-fat diet.
Cdna Transcripts, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cdna transcripts/product/Bio-Rad
Average 90 stars, based on 4 article reviews
Price from $9.99 to $1999.99
cdna transcripts - by Bioz Stars, 2020-07
90/100 stars

Images

1) Product Images from "CIDE-A is expressed in liver of old mice and in type 2 diabetic mouse liver exhibiting steatosis"

Article Title: CIDE-A is expressed in liver of old mice and in type 2 diabetic mouse liver exhibiting steatosis

Journal: Comparative Hepatology

doi: 10.1186/1476-5926-6-4

Effect of diet-reversal on CIDE-A expression . Mice were weaned onto the indicated diet for 33 weeks. The mice were then switched to the indicated diets for an additional 14 weeks. RNA was isolated from frozen liver as described. Real Time RT-PCR was performed on the cDNA transcripts using CIDE-A forward and reverse primers. Housekeeping genes, ACTG (actin gamma cytoplasmic) and GADPH (glyceraldehyde-III phosphate dehydrogenase), were utilized for normalization as described. Relative expression levels were calculated using normalization factors derived from geNorm analysis of ACTG and GADPH using the delta-delta CT method. CIDE-A expression levels in control mice fed standard chow for the entire feeding period (SC-SC) were given a value of 1.0. Changes in CIDE-A expression due to diet were expressed relative to the control mice. N = 4 (for each group). SC, standard chow; HF, high-fat diet.
Figure Legend Snippet: Effect of diet-reversal on CIDE-A expression . Mice were weaned onto the indicated diet for 33 weeks. The mice were then switched to the indicated diets for an additional 14 weeks. RNA was isolated from frozen liver as described. Real Time RT-PCR was performed on the cDNA transcripts using CIDE-A forward and reverse primers. Housekeeping genes, ACTG (actin gamma cytoplasmic) and GADPH (glyceraldehyde-III phosphate dehydrogenase), were utilized for normalization as described. Relative expression levels were calculated using normalization factors derived from geNorm analysis of ACTG and GADPH using the delta-delta CT method. CIDE-A expression levels in control mice fed standard chow for the entire feeding period (SC-SC) were given a value of 1.0. Changes in CIDE-A expression due to diet were expressed relative to the control mice. N = 4 (for each group). SC, standard chow; HF, high-fat diet.

Techniques Used: Expressing, Mouse Assay, Isolation, Quantitative RT-PCR, Derivative Assay

CIDE-A Northern and Immunoblot analyses . A) Northern analysis of RNA extracted from normal (C) and type 2 diabetic (D) liver and heart tissue. Total RNA (10 μg) from the appropriate tissues was resolved by denaturing agarose gel electrophoresis, transferred to positively charged nylon membrane, hybridized with the [α- 32 P]dCTP-labeled mouse CIDE-A cDNA and exposed to Bio-Max MR film. Ethidium bromide stain of RNA (10 μg/lane) prior to transfer to nylon membrane. The values represent the level of CIDE-A gene expression for the individual tissue as determined by DNA microarray analysis (ND: not determined). The approximated size (1.3 kb) of the CIDE-A mRNA is noted on the right. B) Immunoblot demonstrating increased CIDE-A protein levels in type 2 diabetic mouse liver. Sixty μg of liver and heart extract was electrophoresed on a 12.5% SDS-polyacrylamide gel and the resolved proteins transferred to a nitrocellulose membrane. The membrane was immunoblotted using a rabbit anti-mouse CIDE-A polyclonal antibody and a goat anti-rabbit IgG polyclonal antibody conjugated to horseradish peroxidase. Arrow indicates mouse CIDE-A. The values represent the level of CIDE-A gene expression for the individual tissue as determined by DNA microarray analysis (ND: not determined).
Figure Legend Snippet: CIDE-A Northern and Immunoblot analyses . A) Northern analysis of RNA extracted from normal (C) and type 2 diabetic (D) liver and heart tissue. Total RNA (10 μg) from the appropriate tissues was resolved by denaturing agarose gel electrophoresis, transferred to positively charged nylon membrane, hybridized with the [α- 32 P]dCTP-labeled mouse CIDE-A cDNA and exposed to Bio-Max MR film. Ethidium bromide stain of RNA (10 μg/lane) prior to transfer to nylon membrane. The values represent the level of CIDE-A gene expression for the individual tissue as determined by DNA microarray analysis (ND: not determined). The approximated size (1.3 kb) of the CIDE-A mRNA is noted on the right. B) Immunoblot demonstrating increased CIDE-A protein levels in type 2 diabetic mouse liver. Sixty μg of liver and heart extract was electrophoresed on a 12.5% SDS-polyacrylamide gel and the resolved proteins transferred to a nitrocellulose membrane. The membrane was immunoblotted using a rabbit anti-mouse CIDE-A polyclonal antibody and a goat anti-rabbit IgG polyclonal antibody conjugated to horseradish peroxidase. Arrow indicates mouse CIDE-A. The values represent the level of CIDE-A gene expression for the individual tissue as determined by DNA microarray analysis (ND: not determined).

Techniques Used: Northern Blot, Agarose Gel Electrophoresis, Labeling, Staining, Expressing, Microarray

2) Product Images from "Brain-Derived Neurotrophin and TrkB in Head and Neck Squamous Cell Carcinoma"

Article Title: Brain-Derived Neurotrophin and TrkB in Head and Neck Squamous Cell Carcinoma

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms20020272

mRNA expression of brain-derived neurotrophic factor (BDNF) and NTRK2, protein synthesis of NTRK2 in head and neck squamous cell carcinoma (HNSCC) ( A , B ): In situ hybridization of antisense ( A ) and sense ( B ) riboprobe for BDNF (blue) in larynx SCC, cell nuclei counterstained in nuclear fast red. The antisense probe shows intensive purple—blue reactive areas, while the tissue reacted with the sense probe is slightly purple—blue stained. ( C ): In situ hybridization of antisense BDNF riboprobe and ( D ): immunohistochemistry of TrkB (brown) in tumor cell nests of oral SCC. A and B and C and D are sequential sections. ( E ): PCR detection of BDNF (519 base pairs, bps), NTRK2 (full protein coding area, 2528 bps) normalized to loading control ACTB (534 bps, not shown, normalized values represented as column bars) gene expression in cDNA samples of control UPPP normal mucosa, immunohistochemically (IHC) TrkB-positive and TrkB-negative HNSCC. BDNF is expressed in both normal and malignant tissue, NTRK2 is not present in normal mucosa, but if positive TrkB IHC staining was detected, the NTRK2 gene expression was also confirmed by PCR, while TrkB-negative IHC was also negative in RT-PCR. ( A – D ) images were taken by the TissueFaxs system, bars: 200 µm: ( A , B ); 100 µm: ( C , D ). Bands densitometry was done using Azurespot 14.2.
Figure Legend Snippet: mRNA expression of brain-derived neurotrophic factor (BDNF) and NTRK2, protein synthesis of NTRK2 in head and neck squamous cell carcinoma (HNSCC) ( A , B ): In situ hybridization of antisense ( A ) and sense ( B ) riboprobe for BDNF (blue) in larynx SCC, cell nuclei counterstained in nuclear fast red. The antisense probe shows intensive purple—blue reactive areas, while the tissue reacted with the sense probe is slightly purple—blue stained. ( C ): In situ hybridization of antisense BDNF riboprobe and ( D ): immunohistochemistry of TrkB (brown) in tumor cell nests of oral SCC. A and B and C and D are sequential sections. ( E ): PCR detection of BDNF (519 base pairs, bps), NTRK2 (full protein coding area, 2528 bps) normalized to loading control ACTB (534 bps, not shown, normalized values represented as column bars) gene expression in cDNA samples of control UPPP normal mucosa, immunohistochemically (IHC) TrkB-positive and TrkB-negative HNSCC. BDNF is expressed in both normal and malignant tissue, NTRK2 is not present in normal mucosa, but if positive TrkB IHC staining was detected, the NTRK2 gene expression was also confirmed by PCR, while TrkB-negative IHC was also negative in RT-PCR. ( A – D ) images were taken by the TissueFaxs system, bars: 200 µm: ( A , B ); 100 µm: ( C , D ). Bands densitometry was done using Azurespot 14.2.

Techniques Used: Expressing, Derivative Assay, In Situ Hybridization, Staining, Immunohistochemistry, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction

Related Articles

Real-time Polymerase Chain Reaction:

Article Title: The chromatin-binding protein Smyd1 restricts adult mammalian heart growth
Article Snippet: .. Total RNA was transcribed using SuperScript First-Strand Synthesis system for RT-PCR (Invitrogen) according to the manufacturer's protocol to produce cDNA. cDNA transcripts were amplified on the iCycler iQ real-time PCR detection system with iQ SYBR Green Supermix (Bio-Rad). .. Expression levels were analyzed using the iQ5 Optical Systems software v2.0 and normalized against GAPDH by subtracting the mean cycle number for each experimental group from the mean cycle number for GAPDH from the same group.

Article Title: Quantitative Analysis of the Chromatin Proteome in Disease Reveals Remodeling Principles and Identifies High Mobility Group Protein B2 as a Regulator of Hypertrophic Growth *
Article Snippet: .. Total RNA was transcribed using SuperScript first strand synthesis system for RT - PCR (Invitrogen) according to the manufacturer's protocol to produce cDNA. cDNA transcripts were amplified on the iCycler iQ real time PCR detection system with iQ SYBR Green Supermix (Bio-Rad). .. Expression levels were analyzed using the iQ5 Optical Systems software v2.0 and normalized against GAPDH by subtracting the mean cycle number for each experimental group from the mean cycle number for GAPDH from the same group.

Article Title: Epithelial-mesenchymal crosstalk induces radioresistance in HNSCC cells
Article Snippet: .. Real time quantitative PCR (qPCR) of cDNA transcripts was performed in a MyiQ™ cycler using iTaq™ Universal SYBR™ Green Supermix (BIO-RAD Laboratories, Inc., USA). ..

Amplification:

Article Title: The chromatin-binding protein Smyd1 restricts adult mammalian heart growth
Article Snippet: .. Total RNA was transcribed using SuperScript First-Strand Synthesis system for RT-PCR (Invitrogen) according to the manufacturer's protocol to produce cDNA. cDNA transcripts were amplified on the iCycler iQ real-time PCR detection system with iQ SYBR Green Supermix (Bio-Rad). .. Expression levels were analyzed using the iQ5 Optical Systems software v2.0 and normalized against GAPDH by subtracting the mean cycle number for each experimental group from the mean cycle number for GAPDH from the same group.

Article Title: Genotype I of Japanese Encephalitis Virus Virus-like Particles Elicit Sterilizing Immunity against Genotype I and III Viral Challenge in Swine
Article Snippet: .. Then, the cDNA transcripts were mixed with JEV 3′UTR primers (5′-TGGGTTAMCAAAGCCGTTGA-3′ and 5′-ACATACTTCGGCGCTCTGTG-3′) or actin primers (5′-TCCTGTGGCATCCACGAAACT-3′ and 5′-GAAGCATTTGCGGTGGACGAT-3′) and the iQ SYBR Green Supermix (Bio-Rad) and amplified for 40 cycles at 95 °C for 10 sec, 65 °C for 30 sec, and 72 °C for 30 sec in the Bio-Rad CFX connect machine (Bio-Rad). .. Viral RNA quantity was calculated using a full-length cDNA plasmid as the copy-number standard, normalized with actin mRNA by using the Bio-Rad CFX Manager v3.1 (Bio-Rad), and expressed as the copy number per milliliter or per gram.

Article Title: Quantitative Analysis of the Chromatin Proteome in Disease Reveals Remodeling Principles and Identifies High Mobility Group Protein B2 as a Regulator of Hypertrophic Growth *
Article Snippet: .. Total RNA was transcribed using SuperScript first strand synthesis system for RT - PCR (Invitrogen) according to the manufacturer's protocol to produce cDNA. cDNA transcripts were amplified on the iCycler iQ real time PCR detection system with iQ SYBR Green Supermix (Bio-Rad). .. Expression levels were analyzed using the iQ5 Optical Systems software v2.0 and normalized against GAPDH by subtracting the mean cycle number for each experimental group from the mean cycle number for GAPDH from the same group.

Isolation:

Article Title: CIDE-A is expressed in liver of old mice and in type 2 diabetic mouse liver exhibiting steatosis
Article Snippet: .. Real-time RT-PCR RNA was isolated from frozen liver as described above. cDNA transcripts were created using iScript cDNA Synthesis Kit (Cat# 170-8891, Bio-Rad Laboratories, Hercules, CA). .. Real Time RT-PCR was performed on the Bio-Rad iCycler iQ Real Time PCR Detection System (Cat# 170-8740, Bio-Rad Laboratories) using IQ SYBR Green Supermix (Cat# 170-8882).

Size-exclusion Chromatography:

Article Title: Genotype I of Japanese Encephalitis Virus Virus-like Particles Elicit Sterilizing Immunity against Genotype I and III Viral Challenge in Swine
Article Snippet: .. Then, the cDNA transcripts were mixed with JEV 3′UTR primers (5′-TGGGTTAMCAAAGCCGTTGA-3′ and 5′-ACATACTTCGGCGCTCTGTG-3′) or actin primers (5′-TCCTGTGGCATCCACGAAACT-3′ and 5′-GAAGCATTTGCGGTGGACGAT-3′) and the iQ SYBR Green Supermix (Bio-Rad) and amplified for 40 cycles at 95 °C for 10 sec, 65 °C for 30 sec, and 72 °C for 30 sec in the Bio-Rad CFX connect machine (Bio-Rad). .. Viral RNA quantity was calculated using a full-length cDNA plasmid as the copy-number standard, normalized with actin mRNA by using the Bio-Rad CFX Manager v3.1 (Bio-Rad), and expressed as the copy number per milliliter or per gram.

Quantitative RT-PCR:

Article Title: CIDE-A is expressed in liver of old mice and in type 2 diabetic mouse liver exhibiting steatosis
Article Snippet: .. Real-time RT-PCR RNA was isolated from frozen liver as described above. cDNA transcripts were created using iScript cDNA Synthesis Kit (Cat# 170-8891, Bio-Rad Laboratories, Hercules, CA). .. Real Time RT-PCR was performed on the Bio-Rad iCycler iQ Real Time PCR Detection System (Cat# 170-8740, Bio-Rad Laboratories) using IQ SYBR Green Supermix (Cat# 170-8882).

SYBR Green Assay:

Article Title: The chromatin-binding protein Smyd1 restricts adult mammalian heart growth
Article Snippet: .. Total RNA was transcribed using SuperScript First-Strand Synthesis system for RT-PCR (Invitrogen) according to the manufacturer's protocol to produce cDNA. cDNA transcripts were amplified on the iCycler iQ real-time PCR detection system with iQ SYBR Green Supermix (Bio-Rad). .. Expression levels were analyzed using the iQ5 Optical Systems software v2.0 and normalized against GAPDH by subtracting the mean cycle number for each experimental group from the mean cycle number for GAPDH from the same group.

Article Title: Genotype I of Japanese Encephalitis Virus Virus-like Particles Elicit Sterilizing Immunity against Genotype I and III Viral Challenge in Swine
Article Snippet: .. Then, the cDNA transcripts were mixed with JEV 3′UTR primers (5′-TGGGTTAMCAAAGCCGTTGA-3′ and 5′-ACATACTTCGGCGCTCTGTG-3′) or actin primers (5′-TCCTGTGGCATCCACGAAACT-3′ and 5′-GAAGCATTTGCGGTGGACGAT-3′) and the iQ SYBR Green Supermix (Bio-Rad) and amplified for 40 cycles at 95 °C for 10 sec, 65 °C for 30 sec, and 72 °C for 30 sec in the Bio-Rad CFX connect machine (Bio-Rad). .. Viral RNA quantity was calculated using a full-length cDNA plasmid as the copy-number standard, normalized with actin mRNA by using the Bio-Rad CFX Manager v3.1 (Bio-Rad), and expressed as the copy number per milliliter or per gram.

Article Title: Quantitative Analysis of the Chromatin Proteome in Disease Reveals Remodeling Principles and Identifies High Mobility Group Protein B2 as a Regulator of Hypertrophic Growth *
Article Snippet: .. Total RNA was transcribed using SuperScript first strand synthesis system for RT - PCR (Invitrogen) according to the manufacturer's protocol to produce cDNA. cDNA transcripts were amplified on the iCycler iQ real time PCR detection system with iQ SYBR Green Supermix (Bio-Rad). .. Expression levels were analyzed using the iQ5 Optical Systems software v2.0 and normalized against GAPDH by subtracting the mean cycle number for each experimental group from the mean cycle number for GAPDH from the same group.

Article Title: Epithelial-mesenchymal crosstalk induces radioresistance in HNSCC cells
Article Snippet: .. Real time quantitative PCR (qPCR) of cDNA transcripts was performed in a MyiQ™ cycler using iTaq™ Universal SYBR™ Green Supermix (BIO-RAD Laboratories, Inc., USA). ..

Polymerase Chain Reaction:

Article Title: Nerve Growth Factor (NGF)—Receptor Survival Axis in Head and Neck Squamous Cell Carcinoma
Article Snippet: .. PCR of cDNA transcripts was performed in a MyiQ™ cycler (BIO-RAD Laboratories, Inc., USA) using Go-Taq master mix (Promega, Madison, WI, USA) and the following forward: 5′-CAC ACT GAG GTG CAT AGC GT-3′ and reverse: 5′-TGA TGA CCG CTT GCT CCT GT-3′ primers for NGF, and forward: ACCCTGAAGTACCCCATCGA; reverse: TGTCACCTTCACCGTTCCAG for the housekeeping gene ACTB. ..

Article Title: Brain-Derived Neurotrophin and TrkB in Head and Neck Squamous Cell Carcinoma
Article Snippet: .. PCR of cDNA transcripts was performed in a MyiQTM cycler (BIO-RAD Laboratories, Inc.) using Go–Taq master mix (Promega, Madison, WI, USA) and the following forward: 5′-GGC TGA CAC TTT CGA ACA CA-3′ and reverse: 5′-CTT ATG AAT CGC CAG CCA AT-3′ primers for BDNF , and forward: 5′-CTA GGG ATG TCG TCC TGG ATA-3′; reverse: 5′-AGG GCC CTA GCC TAG AAT GTC-3′ for NTRK2 2528 base pairs, forward: 5′-ATC TCC AAC CTC AGA CCA CC-3′; reverse: 5′-CTT ACA TGG CAG CAT CAA CCA-3′ for NTRK2 620 base pairs, and forward: 5′-CCG AAA GTT GCC TTT TAT GGC T-3′; reverse: 5´-AGG TCT CAA ACA TGA TCT GGG T-3′ for the housekeeping gene ACTB . .. The primers were synthesized by InvitrogenTM (Darmstadt, Germany).

Reverse Transcription Polymerase Chain Reaction:

Article Title: The chromatin-binding protein Smyd1 restricts adult mammalian heart growth
Article Snippet: .. Total RNA was transcribed using SuperScript First-Strand Synthesis system for RT-PCR (Invitrogen) according to the manufacturer's protocol to produce cDNA. cDNA transcripts were amplified on the iCycler iQ real-time PCR detection system with iQ SYBR Green Supermix (Bio-Rad). .. Expression levels were analyzed using the iQ5 Optical Systems software v2.0 and normalized against GAPDH by subtracting the mean cycle number for each experimental group from the mean cycle number for GAPDH from the same group.

Article Title: Quantitative Analysis of the Chromatin Proteome in Disease Reveals Remodeling Principles and Identifies High Mobility Group Protein B2 as a Regulator of Hypertrophic Growth *
Article Snippet: .. Total RNA was transcribed using SuperScript first strand synthesis system for RT - PCR (Invitrogen) according to the manufacturer's protocol to produce cDNA. cDNA transcripts were amplified on the iCycler iQ real time PCR detection system with iQ SYBR Green Supermix (Bio-Rad). .. Expression levels were analyzed using the iQ5 Optical Systems software v2.0 and normalized against GAPDH by subtracting the mean cycle number for each experimental group from the mean cycle number for GAPDH from the same group.

Activated Clotting Time Assay:

Article Title: Nerve Growth Factor (NGF)—Receptor Survival Axis in Head and Neck Squamous Cell Carcinoma
Article Snippet: .. PCR of cDNA transcripts was performed in a MyiQ™ cycler (BIO-RAD Laboratories, Inc., USA) using Go-Taq master mix (Promega, Madison, WI, USA) and the following forward: 5′-CAC ACT GAG GTG CAT AGC GT-3′ and reverse: 5′-TGA TGA CCG CTT GCT CCT GT-3′ primers for NGF, and forward: ACCCTGAAGTACCCCATCGA; reverse: TGTCACCTTCACCGTTCCAG for the housekeeping gene ACTB. ..

Cellular Antioxidant Activity Assay:

Article Title: Brain-Derived Neurotrophin and TrkB in Head and Neck Squamous Cell Carcinoma
Article Snippet: .. PCR of cDNA transcripts was performed in a MyiQTM cycler (BIO-RAD Laboratories, Inc.) using Go–Taq master mix (Promega, Madison, WI, USA) and the following forward: 5′-GGC TGA CAC TTT CGA ACA CA-3′ and reverse: 5′-CTT ATG AAT CGC CAG CCA AT-3′ primers for BDNF , and forward: 5′-CTA GGG ATG TCG TCC TGG ATA-3′; reverse: 5′-AGG GCC CTA GCC TAG AAT GTC-3′ for NTRK2 2528 base pairs, forward: 5′-ATC TCC AAC CTC AGA CCA CC-3′; reverse: 5′-CTT ACA TGG CAG CAT CAA CCA-3′ for NTRK2 620 base pairs, and forward: 5′-CCG AAA GTT GCC TTT TAT GGC T-3′; reverse: 5´-AGG TCT CAA ACA TGA TCT GGG T-3′ for the housekeeping gene ACTB . .. The primers were synthesized by InvitrogenTM (Darmstadt, Germany).

Chloramphenicol Acetyltransferase Assay:

Article Title: Nerve Growth Factor (NGF)—Receptor Survival Axis in Head and Neck Squamous Cell Carcinoma
Article Snippet: .. PCR of cDNA transcripts was performed in a MyiQ™ cycler (BIO-RAD Laboratories, Inc., USA) using Go-Taq master mix (Promega, Madison, WI, USA) and the following forward: 5′-CAC ACT GAG GTG CAT AGC GT-3′ and reverse: 5′-TGA TGA CCG CTT GCT CCT GT-3′ primers for NGF, and forward: ACCCTGAAGTACCCCATCGA; reverse: TGTCACCTTCACCGTTCCAG for the housekeeping gene ACTB. ..

Article Title: Brain-Derived Neurotrophin and TrkB in Head and Neck Squamous Cell Carcinoma
Article Snippet: .. PCR of cDNA transcripts was performed in a MyiQTM cycler (BIO-RAD Laboratories, Inc.) using Go–Taq master mix (Promega, Madison, WI, USA) and the following forward: 5′-GGC TGA CAC TTT CGA ACA CA-3′ and reverse: 5′-CTT ATG AAT CGC CAG CCA AT-3′ primers for BDNF , and forward: 5′-CTA GGG ATG TCG TCC TGG ATA-3′; reverse: 5′-AGG GCC CTA GCC TAG AAT GTC-3′ for NTRK2 2528 base pairs, forward: 5′-ATC TCC AAC CTC AGA CCA CC-3′; reverse: 5′-CTT ACA TGG CAG CAT CAA CCA-3′ for NTRK2 620 base pairs, and forward: 5′-CCG AAA GTT GCC TTT TAT GGC T-3′; reverse: 5´-AGG TCT CAA ACA TGA TCT GGG T-3′ for the housekeeping gene ACTB . .. The primers were synthesized by InvitrogenTM (Darmstadt, Germany).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Bio-Rad cdna transcripts
    Effect of diet-reversal on CIDE-A expression . Mice were weaned onto the indicated diet for 33 weeks. The mice were then switched to the indicated diets for an additional 14 weeks. RNA was isolated from frozen liver as described. Real Time <t>RT-PCR</t> was performed on the <t>cDNA</t> transcripts using CIDE-A forward and reverse primers. Housekeeping genes, ACTG (actin gamma cytoplasmic) and GADPH (glyceraldehyde-III phosphate dehydrogenase), were utilized for normalization as described. Relative expression levels were calculated using normalization factors derived from geNorm analysis of ACTG and GADPH using the delta-delta CT method. CIDE-A expression levels in control mice fed standard chow for the entire feeding period (SC-SC) were given a value of 1.0. Changes in CIDE-A expression due to diet were expressed relative to the control mice. N = 4 (for each group). SC, standard chow; HF, high-fat diet.
    Cdna Transcripts, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna transcripts/product/Bio-Rad
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    cdna transcripts - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    88
    Bio-Rad semi quantitative rt pcr cdna
    Regulation of M. smegmatis adenylate cyclase genes under starvation conditions. Semi-quantitative <t>RT-PCR</t> was used to compare adenylate cyclase mRNA levels between late-log phase cultures incubated for 4 h in mycomedia (control) or PBS (starvation). (A) A representative depiction of PCR-amplified <t>cDNA</t> separated using agarose gel electrophoresis. (B) Quantification of control (black bars) and starvation (white bars) PCR products depicted in A. (C) Average of three different experiments represented as fold differences of starvation compared to control expression. ∗ indicates statistically significant difference between expression in control and starvation for an individual gene ( P
    Semi Quantitative Rt Pcr Cdna, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/semi quantitative rt pcr cdna/product/Bio-Rad
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    semi quantitative rt pcr cdna - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    86
    Bio-Rad ixofin3d
    RNA-mediated knockdown of <t>ixofin3D</t> expression results in decreased aggregation of Borrelia burgdorferi on the gut. A. Confocal microscopy of PFA-fixed guts from 72 h fed B. burgdorferi -infected nymphs injected with ds ixofin3D or ds gfp RNA. Nuclei, and spirochetes stained with propidium iodide (red), and anti- B. burgdorferi (N40) IgG (FITC-green) respectively. B . Mean pixel intensities of regions of interest in the FITC channel (representing anti- B. burgdorferi serum binding to spirochetes) of the confocal images obtained in A . Each data point represents one region of interest. C . Confocal microscopy of PFA-fixed salivary glands from 72 h fed B. burgdorferi -infected nymphs injected with ds ixofin3D or ds gfp RNA. Nuclei, and spirochetes stained with propidium iodide (red), and anti- B. burgdorferi (N40) IgG (FITC-green) respectively. In A and C magnification ×40. D . Spirochetes in each salivary gland pair counted manually. Each data point represents one salivary gland pair. E . Confocal microscopy of guts from 72 h fed B. burgdorferi -infected nymphs injected with ds ixofin3D or ds gfp RNA washed to remove unbound Borrelia , and PFA fixed prior to staining. Nuclei were stained with propidium iodide (red), and spirochetes with anti- B. burgdorferi (N40) IgG (FITC-green). Magnification ×40. F . qRT-PCR assessment of Borrelia burden in washed tick guts. Each data point in B represents a pool of 3 guts. G . Mean pixel intensities of regions of interest in the FITC channel (representing anti- B. burgdorferi serum binding) of the confocal images obtained in E . Each data point represents one region of interest. Error bars in B , D , F and G represent mean ± SEM. Mean values significantly different in a two-tailed non-parametric Mann-Whitney test indicated by one asterisk ( p
    Ixofin3d, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ixofin3d/product/Bio-Rad
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ixofin3d - by Bioz Stars, 2020-07
    86/100 stars
      Buy from Supplier

    85
    Bio-Rad human tab1 cdna
    <t>TAB1</t> inhibits IL-2 and increases IL-10 production. (A) T-cell hybridoma 2B4 was transduced with retrovirus that contained the vector alone (Mock) or human TAB1 (TAB1), and stable cell lines were selected in the presence of G418 (500 μg/ml). RNA was prepared from each cell line and was subjected to RT-PCR analysis for TAB1 mRNA expression. PCR was performed for 18, 24, 30, and 36 cycles (as indicated by the triangles over the lanes). (B) p38α was immunoprecipitated with specific antibodies from lysates of Mock-2B4 cells (Mock) or TAB1-2B4 cells (TAB1) and was subjected to an in vitro kinase assay with ATF2 19-96 peptide as a substrate. The quantity of p38α was assessed by immunoblotting with anti-p38α antibody. (C) Mock-2B4 cells (Mock) and TAB1-2B4 cells (TAB1) were incubated with (SB) or without (Nil) SB203580 (10 μM) for 2 h, lysed, and subjected to immunoblotting with anti-phospho-p38 and anti-p38α antibodies. (D) Mock-2B4 cells (Mock) and TAB1-2B4 cells (TAB1) were cultured for 18 h in plates coated (TCR) or not coated (Nil) with anti-TCR MAb (10 μg/ml) and were subjected to RT-PCR analysis for IL-2, IL-10, and G3PDH mRNAs. (E) Mock-2B4 cells (Mock) and TAB1-2B4 cells (TAB1) were cultured with anti-TCR MAb (TCR) or with PMA (20 ng/ml) and ionomycin (Iono; 1 μM) for 24 h. The levels of IL-2 in the supernatants were determined by an ELISA. Error bars indicate standard deviations. (F) Jurkat cells were transiently transfected with pGL2B luciferase reporter constructs driven by the mouse IL-10 promoter (−1536 to +64), with vector pCMVF, which contained either no insert (Mock) or human TAB1 <t>cDNA</t> (TAB1), and with internal control phRL-TK. Cells were cultured with PMA (100 ng/ml) and ionomycin (2 μM) for 18 h, and luciferase activity was measured.
    Human Tab1 Cdna, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human tab1 cdna/product/Bio-Rad
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    human tab1 cdna - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    Image Search Results


    Effect of diet-reversal on CIDE-A expression . Mice were weaned onto the indicated diet for 33 weeks. The mice were then switched to the indicated diets for an additional 14 weeks. RNA was isolated from frozen liver as described. Real Time RT-PCR was performed on the cDNA transcripts using CIDE-A forward and reverse primers. Housekeeping genes, ACTG (actin gamma cytoplasmic) and GADPH (glyceraldehyde-III phosphate dehydrogenase), were utilized for normalization as described. Relative expression levels were calculated using normalization factors derived from geNorm analysis of ACTG and GADPH using the delta-delta CT method. CIDE-A expression levels in control mice fed standard chow for the entire feeding period (SC-SC) were given a value of 1.0. Changes in CIDE-A expression due to diet were expressed relative to the control mice. N = 4 (for each group). SC, standard chow; HF, high-fat diet.

    Journal: Comparative Hepatology

    Article Title: CIDE-A is expressed in liver of old mice and in type 2 diabetic mouse liver exhibiting steatosis

    doi: 10.1186/1476-5926-6-4

    Figure Lengend Snippet: Effect of diet-reversal on CIDE-A expression . Mice were weaned onto the indicated diet for 33 weeks. The mice were then switched to the indicated diets for an additional 14 weeks. RNA was isolated from frozen liver as described. Real Time RT-PCR was performed on the cDNA transcripts using CIDE-A forward and reverse primers. Housekeeping genes, ACTG (actin gamma cytoplasmic) and GADPH (glyceraldehyde-III phosphate dehydrogenase), were utilized for normalization as described. Relative expression levels were calculated using normalization factors derived from geNorm analysis of ACTG and GADPH using the delta-delta CT method. CIDE-A expression levels in control mice fed standard chow for the entire feeding period (SC-SC) were given a value of 1.0. Changes in CIDE-A expression due to diet were expressed relative to the control mice. N = 4 (for each group). SC, standard chow; HF, high-fat diet.

    Article Snippet: Real-time RT-PCR RNA was isolated from frozen liver as described above. cDNA transcripts were created using iScript cDNA Synthesis Kit (Cat# 170-8891, Bio-Rad Laboratories, Hercules, CA).

    Techniques: Expressing, Mouse Assay, Isolation, Quantitative RT-PCR, Derivative Assay

    CIDE-A Northern and Immunoblot analyses . A) Northern analysis of RNA extracted from normal (C) and type 2 diabetic (D) liver and heart tissue. Total RNA (10 μg) from the appropriate tissues was resolved by denaturing agarose gel electrophoresis, transferred to positively charged nylon membrane, hybridized with the [α- 32 P]dCTP-labeled mouse CIDE-A cDNA and exposed to Bio-Max MR film. Ethidium bromide stain of RNA (10 μg/lane) prior to transfer to nylon membrane. The values represent the level of CIDE-A gene expression for the individual tissue as determined by DNA microarray analysis (ND: not determined). The approximated size (1.3 kb) of the CIDE-A mRNA is noted on the right. B) Immunoblot demonstrating increased CIDE-A protein levels in type 2 diabetic mouse liver. Sixty μg of liver and heart extract was electrophoresed on a 12.5% SDS-polyacrylamide gel and the resolved proteins transferred to a nitrocellulose membrane. The membrane was immunoblotted using a rabbit anti-mouse CIDE-A polyclonal antibody and a goat anti-rabbit IgG polyclonal antibody conjugated to horseradish peroxidase. Arrow indicates mouse CIDE-A. The values represent the level of CIDE-A gene expression for the individual tissue as determined by DNA microarray analysis (ND: not determined).

    Journal: Comparative Hepatology

    Article Title: CIDE-A is expressed in liver of old mice and in type 2 diabetic mouse liver exhibiting steatosis

    doi: 10.1186/1476-5926-6-4

    Figure Lengend Snippet: CIDE-A Northern and Immunoblot analyses . A) Northern analysis of RNA extracted from normal (C) and type 2 diabetic (D) liver and heart tissue. Total RNA (10 μg) from the appropriate tissues was resolved by denaturing agarose gel electrophoresis, transferred to positively charged nylon membrane, hybridized with the [α- 32 P]dCTP-labeled mouse CIDE-A cDNA and exposed to Bio-Max MR film. Ethidium bromide stain of RNA (10 μg/lane) prior to transfer to nylon membrane. The values represent the level of CIDE-A gene expression for the individual tissue as determined by DNA microarray analysis (ND: not determined). The approximated size (1.3 kb) of the CIDE-A mRNA is noted on the right. B) Immunoblot demonstrating increased CIDE-A protein levels in type 2 diabetic mouse liver. Sixty μg of liver and heart extract was electrophoresed on a 12.5% SDS-polyacrylamide gel and the resolved proteins transferred to a nitrocellulose membrane. The membrane was immunoblotted using a rabbit anti-mouse CIDE-A polyclonal antibody and a goat anti-rabbit IgG polyclonal antibody conjugated to horseradish peroxidase. Arrow indicates mouse CIDE-A. The values represent the level of CIDE-A gene expression for the individual tissue as determined by DNA microarray analysis (ND: not determined).

    Article Snippet: Real-time RT-PCR RNA was isolated from frozen liver as described above. cDNA transcripts were created using iScript cDNA Synthesis Kit (Cat# 170-8891, Bio-Rad Laboratories, Hercules, CA).

    Techniques: Northern Blot, Agarose Gel Electrophoresis, Labeling, Staining, Expressing, Microarray

    Regulation of M. smegmatis adenylate cyclase genes under starvation conditions. Semi-quantitative RT-PCR was used to compare adenylate cyclase mRNA levels between late-log phase cultures incubated for 4 h in mycomedia (control) or PBS (starvation). (A) A representative depiction of PCR-amplified cDNA separated using agarose gel electrophoresis. (B) Quantification of control (black bars) and starvation (white bars) PCR products depicted in A. (C) Average of three different experiments represented as fold differences of starvation compared to control expression. ∗ indicates statistically significant difference between expression in control and starvation for an individual gene ( P

    Journal: PeerJ

    Article Title: The role of transcriptional regulation in maintaining the availability of mycobacterial adenylate cyclases

    doi: 10.7717/peerj.298

    Figure Lengend Snippet: Regulation of M. smegmatis adenylate cyclase genes under starvation conditions. Semi-quantitative RT-PCR was used to compare adenylate cyclase mRNA levels between late-log phase cultures incubated for 4 h in mycomedia (control) or PBS (starvation). (A) A representative depiction of PCR-amplified cDNA separated using agarose gel electrophoresis. (B) Quantification of control (black bars) and starvation (white bars) PCR products depicted in A. (C) Average of three different experiments represented as fold differences of starvation compared to control expression. ∗ indicates statistically significant difference between expression in control and starvation for an individual gene ( P

    Article Snippet: Semi-quantitative RT-PCR cDNA was prepared from 0.5 µg of RNA using the iScript cDNA synthesis kit according to the manufacture’s specifications (BioRad).

    Techniques: Quantitative RT-PCR, Incubation, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Expressing

    RNA-mediated knockdown of ixofin3D expression results in decreased aggregation of Borrelia burgdorferi on the gut. A. Confocal microscopy of PFA-fixed guts from 72 h fed B. burgdorferi -infected nymphs injected with ds ixofin3D or ds gfp RNA. Nuclei, and spirochetes stained with propidium iodide (red), and anti- B. burgdorferi (N40) IgG (FITC-green) respectively. B . Mean pixel intensities of regions of interest in the FITC channel (representing anti- B. burgdorferi serum binding to spirochetes) of the confocal images obtained in A . Each data point represents one region of interest. C . Confocal microscopy of PFA-fixed salivary glands from 72 h fed B. burgdorferi -infected nymphs injected with ds ixofin3D or ds gfp RNA. Nuclei, and spirochetes stained with propidium iodide (red), and anti- B. burgdorferi (N40) IgG (FITC-green) respectively. In A and C magnification ×40. D . Spirochetes in each salivary gland pair counted manually. Each data point represents one salivary gland pair. E . Confocal microscopy of guts from 72 h fed B. burgdorferi -infected nymphs injected with ds ixofin3D or ds gfp RNA washed to remove unbound Borrelia , and PFA fixed prior to staining. Nuclei were stained with propidium iodide (red), and spirochetes with anti- B. burgdorferi (N40) IgG (FITC-green). Magnification ×40. F . qRT-PCR assessment of Borrelia burden in washed tick guts. Each data point in B represents a pool of 3 guts. G . Mean pixel intensities of regions of interest in the FITC channel (representing anti- B. burgdorferi serum binding) of the confocal images obtained in E . Each data point represents one region of interest. Error bars in B , D , F and G represent mean ± SEM. Mean values significantly different in a two-tailed non-parametric Mann-Whitney test indicated by one asterisk ( p

    Journal: PLoS Pathogens

    Article Title: A Tick Gut Protein with Fibronectin III Domains Aids Borrelia burgdorferi Congregation to the Gut during Transmission

    doi: 10.1371/journal.ppat.1004278

    Figure Lengend Snippet: RNA-mediated knockdown of ixofin3D expression results in decreased aggregation of Borrelia burgdorferi on the gut. A. Confocal microscopy of PFA-fixed guts from 72 h fed B. burgdorferi -infected nymphs injected with ds ixofin3D or ds gfp RNA. Nuclei, and spirochetes stained with propidium iodide (red), and anti- B. burgdorferi (N40) IgG (FITC-green) respectively. B . Mean pixel intensities of regions of interest in the FITC channel (representing anti- B. burgdorferi serum binding to spirochetes) of the confocal images obtained in A . Each data point represents one region of interest. C . Confocal microscopy of PFA-fixed salivary glands from 72 h fed B. burgdorferi -infected nymphs injected with ds ixofin3D or ds gfp RNA. Nuclei, and spirochetes stained with propidium iodide (red), and anti- B. burgdorferi (N40) IgG (FITC-green) respectively. In A and C magnification ×40. D . Spirochetes in each salivary gland pair counted manually. Each data point represents one salivary gland pair. E . Confocal microscopy of guts from 72 h fed B. burgdorferi -infected nymphs injected with ds ixofin3D or ds gfp RNA washed to remove unbound Borrelia , and PFA fixed prior to staining. Nuclei were stained with propidium iodide (red), and spirochetes with anti- B. burgdorferi (N40) IgG (FITC-green). Magnification ×40. F . qRT-PCR assessment of Borrelia burden in washed tick guts. Each data point in B represents a pool of 3 guts. G . Mean pixel intensities of regions of interest in the FITC channel (representing anti- B. burgdorferi serum binding) of the confocal images obtained in E . Each data point represents one region of interest. Error bars in B , D , F and G represent mean ± SEM. Mean values significantly different in a two-tailed non-parametric Mann-Whitney test indicated by one asterisk ( p

    Article Snippet: Tick RNA isolation and quantitative RT-PCR Ticks were allowed to feed for 24 h, for 72 h, or to repletion (between 80 and 96 h after initiation of tick feeding) and RNA isolated from guts and salivary glands using Trizol (Invitrogen, CA) as described earlier . cDNA was synthesized using the iScript RT-PCR kit (Bio-Rad, CA) and analyzed by quantitative PCR for the expression of tick actin and B. burgdorferi and also ixofin3D , clone 2, 3 and 4 using gene-specific primers (listed in table S1) and the iQ SYBR Green Supermix (Bio-Rad, Hercules, CA) on a Opticon Engine MJ cycler (Bio-Rad, CA).

    Techniques: Expressing, Confocal Microscopy, Infection, Injection, Staining, Binding Assay, Quantitative RT-PCR, Two Tailed Test, MANN-WHITNEY

    RNA interference-mediated decrease in Ixofin3D results in decreased B. burgdorferi burden in the salivary glands and in murine skin. Double-stranded ixofin3D (ds ixofin3D ) or ds gfp was injected through the anal pore 3 h prior to B. burgdorferi -infected tick challenge (4–5 ticks/mouse). A . Engorgement weights of ticks fed to repletion. Each data point represents one tick; B . qRT-PCR assessment of ixofin3D expression; and C . Borrelia burden in tick guts and salivary glands. Each data point in B and C represents a pool of 3 guts or salivary glands; and D . qPCR assessment of Borrelia burden in murine skin at 7 and 14 days post-tick feeding. Each data point represents one mouse. Error bars represent mean ± SEM and mean values significantly different in a two-tailed non-parametric Mann-Whitney test ( p

    Journal: PLoS Pathogens

    Article Title: A Tick Gut Protein with Fibronectin III Domains Aids Borrelia burgdorferi Congregation to the Gut during Transmission

    doi: 10.1371/journal.ppat.1004278

    Figure Lengend Snippet: RNA interference-mediated decrease in Ixofin3D results in decreased B. burgdorferi burden in the salivary glands and in murine skin. Double-stranded ixofin3D (ds ixofin3D ) or ds gfp was injected through the anal pore 3 h prior to B. burgdorferi -infected tick challenge (4–5 ticks/mouse). A . Engorgement weights of ticks fed to repletion. Each data point represents one tick; B . qRT-PCR assessment of ixofin3D expression; and C . Borrelia burden in tick guts and salivary glands. Each data point in B and C represents a pool of 3 guts or salivary glands; and D . qPCR assessment of Borrelia burden in murine skin at 7 and 14 days post-tick feeding. Each data point represents one mouse. Error bars represent mean ± SEM and mean values significantly different in a two-tailed non-parametric Mann-Whitney test ( p

    Article Snippet: Tick RNA isolation and quantitative RT-PCR Ticks were allowed to feed for 24 h, for 72 h, or to repletion (between 80 and 96 h after initiation of tick feeding) and RNA isolated from guts and salivary glands using Trizol (Invitrogen, CA) as described earlier . cDNA was synthesized using the iScript RT-PCR kit (Bio-Rad, CA) and analyzed by quantitative PCR for the expression of tick actin and B. burgdorferi and also ixofin3D , clone 2, 3 and 4 using gene-specific primers (listed in table S1) and the iQ SYBR Green Supermix (Bio-Rad, Hercules, CA) on a Opticon Engine MJ cycler (Bio-Rad, CA).

    Techniques: Injection, Infection, Quantitative RT-PCR, Expressing, Real-time Polymerase Chain Reaction, Two Tailed Test, MANN-WHITNEY

    Impact of passive and active immunization against Ixofin3D-PF on B. burgdorferi burden in ticks and in murine skin. A–C: Rabbit anti-rIxofin3D-PF serum or rabbit anti-Ovalbumin serum was passively transferred into each mouse 24 h prior to B. burgdorferi -infected tick challenge (4–5 ticks/mouse). A. Engorgement weights of repleted ticks; B. qRT-PCR assessment of Borrelia burden in tick guts and salivary glands; C. qPCR assessment of Borrelia burden in murine skin at 7 and 14 days post-tick feeding. D–F: Mice actively immunized with rIxofin3D-PF or Ovalbumin and challenged with B. burgdorferi -infected ticks (4–5 ticks/mouse). D. Engorgement weights of repleted ticks; E. qRT-PCR assessment of Borrelia burden in tick guts and salivary glands; F. qPCR assessment of Borrelia burden in mice skin at 7 and 14 days post-tick feeding. Each data point in A and D represents one tick. Each data point in B and E represents a pool of 2–3 guts or salivary glands. Each data point in C and F represents one mouse. Error bars represent mean ± SEM and mean values significantly different in a two-tailed non-parametric Mann-Whitney test ( p

    Journal: PLoS Pathogens

    Article Title: A Tick Gut Protein with Fibronectin III Domains Aids Borrelia burgdorferi Congregation to the Gut during Transmission

    doi: 10.1371/journal.ppat.1004278

    Figure Lengend Snippet: Impact of passive and active immunization against Ixofin3D-PF on B. burgdorferi burden in ticks and in murine skin. A–C: Rabbit anti-rIxofin3D-PF serum or rabbit anti-Ovalbumin serum was passively transferred into each mouse 24 h prior to B. burgdorferi -infected tick challenge (4–5 ticks/mouse). A. Engorgement weights of repleted ticks; B. qRT-PCR assessment of Borrelia burden in tick guts and salivary glands; C. qPCR assessment of Borrelia burden in murine skin at 7 and 14 days post-tick feeding. D–F: Mice actively immunized with rIxofin3D-PF or Ovalbumin and challenged with B. burgdorferi -infected ticks (4–5 ticks/mouse). D. Engorgement weights of repleted ticks; E. qRT-PCR assessment of Borrelia burden in tick guts and salivary glands; F. qPCR assessment of Borrelia burden in mice skin at 7 and 14 days post-tick feeding. Each data point in A and D represents one tick. Each data point in B and E represents a pool of 2–3 guts or salivary glands. Each data point in C and F represents one mouse. Error bars represent mean ± SEM and mean values significantly different in a two-tailed non-parametric Mann-Whitney test ( p

    Article Snippet: Tick RNA isolation and quantitative RT-PCR Ticks were allowed to feed for 24 h, for 72 h, or to repletion (between 80 and 96 h after initiation of tick feeding) and RNA isolated from guts and salivary glands using Trizol (Invitrogen, CA) as described earlier . cDNA was synthesized using the iScript RT-PCR kit (Bio-Rad, CA) and analyzed by quantitative PCR for the expression of tick actin and B. burgdorferi and also ixofin3D , clone 2, 3 and 4 using gene-specific primers (listed in table S1) and the iQ SYBR Green Supermix (Bio-Rad, Hercules, CA) on a Opticon Engine MJ cycler (Bio-Rad, CA).

    Techniques: Infection, Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Mouse Assay, Two Tailed Test, MANN-WHITNEY

    Full-length sequence of Ixofin3D (Genbank accession number KF709698). A. Amino acid (AA) sequence corresponding to: the annotated ISCW008121 (green), fragment obtained by 5′ RNA Ligase Mediated Rapid Amplification of cDNA Ends (RLM-RACE) (grey), yeast surface display Clone 1 (red), fragment obtained by 3′ RLM-RACE (blue), and the annotated ISCW005809 (yellow). B . Predicted analysis of full-length Ixofin3D using the Simple Modular Architecture Research Tool available at http://smart.embl-heidelberg.de .

    Journal: PLoS Pathogens

    Article Title: A Tick Gut Protein with Fibronectin III Domains Aids Borrelia burgdorferi Congregation to the Gut during Transmission

    doi: 10.1371/journal.ppat.1004278

    Figure Lengend Snippet: Full-length sequence of Ixofin3D (Genbank accession number KF709698). A. Amino acid (AA) sequence corresponding to: the annotated ISCW008121 (green), fragment obtained by 5′ RNA Ligase Mediated Rapid Amplification of cDNA Ends (RLM-RACE) (grey), yeast surface display Clone 1 (red), fragment obtained by 3′ RLM-RACE (blue), and the annotated ISCW005809 (yellow). B . Predicted analysis of full-length Ixofin3D using the Simple Modular Architecture Research Tool available at http://smart.embl-heidelberg.de .

    Article Snippet: Tick RNA isolation and quantitative RT-PCR Ticks were allowed to feed for 24 h, for 72 h, or to repletion (between 80 and 96 h after initiation of tick feeding) and RNA isolated from guts and salivary glands using Trizol (Invitrogen, CA) as described earlier . cDNA was synthesized using the iScript RT-PCR kit (Bio-Rad, CA) and analyzed by quantitative PCR for the expression of tick actin and B. burgdorferi and also ixofin3D , clone 2, 3 and 4 using gene-specific primers (listed in table S1) and the iQ SYBR Green Supermix (Bio-Rad, Hercules, CA) on a Opticon Engine MJ cycler (Bio-Rad, CA).

    Techniques: Sequencing, Rapid Amplification of cDNA Ends

    Ixofin3D localization in the tick gut. A. Purified Drosophila -expressed recombinant Ixofin3D-PF electrophoresed on SDS 12% polyacrylamide gel and Lane 1 , Coomassie blue stained; Lane 2 , Periodic Acid-Schiff stained; and Lane 3 , rIxofin3D-PF immunoblotted and probed with polyclonal rabbit anti-Ixofin3D-PF serum. B . Confocal microscopy of PFA-fixed guts of 24 and 72h fed uninfected and B. burgdorferi -infected nymphs. Gut nuclei, B. burgdorferi and Ixofin3D stained with TO-PRO-3 (blue), anti B. burgdorferi (FITC-green) and anti-rIxofin3D-PF serum (TRITC-red) respectively. Magnification ×20. Guts stained with anti-Ovalbumin IgG (TRITC-red) served as antibody control. C . Mean pixel intensities of regions of interest in the TRITC channel (representing anti-rIxofin3D-PF serum binding to Ixofin3D) of the confocal images obtained in B . Each data point represents one region of interest. Error bars represent mean ± SEM and mean values significantly different in a one-way ANOVA with Tukey's multiple comparison test indicated by two asterisks ( p

    Journal: PLoS Pathogens

    Article Title: A Tick Gut Protein with Fibronectin III Domains Aids Borrelia burgdorferi Congregation to the Gut during Transmission

    doi: 10.1371/journal.ppat.1004278

    Figure Lengend Snippet: Ixofin3D localization in the tick gut. A. Purified Drosophila -expressed recombinant Ixofin3D-PF electrophoresed on SDS 12% polyacrylamide gel and Lane 1 , Coomassie blue stained; Lane 2 , Periodic Acid-Schiff stained; and Lane 3 , rIxofin3D-PF immunoblotted and probed with polyclonal rabbit anti-Ixofin3D-PF serum. B . Confocal microscopy of PFA-fixed guts of 24 and 72h fed uninfected and B. burgdorferi -infected nymphs. Gut nuclei, B. burgdorferi and Ixofin3D stained with TO-PRO-3 (blue), anti B. burgdorferi (FITC-green) and anti-rIxofin3D-PF serum (TRITC-red) respectively. Magnification ×20. Guts stained with anti-Ovalbumin IgG (TRITC-red) served as antibody control. C . Mean pixel intensities of regions of interest in the TRITC channel (representing anti-rIxofin3D-PF serum binding to Ixofin3D) of the confocal images obtained in B . Each data point represents one region of interest. Error bars represent mean ± SEM and mean values significantly different in a one-way ANOVA with Tukey's multiple comparison test indicated by two asterisks ( p

    Article Snippet: Tick RNA isolation and quantitative RT-PCR Ticks were allowed to feed for 24 h, for 72 h, or to repletion (between 80 and 96 h after initiation of tick feeding) and RNA isolated from guts and salivary glands using Trizol (Invitrogen, CA) as described earlier . cDNA was synthesized using the iScript RT-PCR kit (Bio-Rad, CA) and analyzed by quantitative PCR for the expression of tick actin and B. burgdorferi and also ixofin3D , clone 2, 3 and 4 using gene-specific primers (listed in table S1) and the iQ SYBR Green Supermix (Bio-Rad, Hercules, CA) on a Opticon Engine MJ cycler (Bio-Rad, CA).

    Techniques: Purification, Recombinant, Staining, Confocal Microscopy, Infection, Binding Assay

    In vitro analysis of Ixofin3D- Borrelia burgdorferi interaction. A. Imunofluorescence microscopy of PFA-fixed in vitro grown B. burgdorferi to assess binding to rIxofin3D-PF. B. burgdorferi was detected with FITC-conjugated B. burgdorferi antisera (FITC-green), rIxofin3D-PF (Panel 1) was detected using rabbit anti-Ixofin3D-PF IgG (TRITC-red), and rIxophilin (Panel 2) was detected using mouse anti-rIxophilin IgG (TRITC-red). Magnification ×20. B. ELISA assessment of dose-dependent binding of rIxofin3D-PF to B. burgdorferi membrane protein extract-coated plates compared to rIxophilin, a tick protein that does not bind to Borrelia .

    Journal: PLoS Pathogens

    Article Title: A Tick Gut Protein with Fibronectin III Domains Aids Borrelia burgdorferi Congregation to the Gut during Transmission

    doi: 10.1371/journal.ppat.1004278

    Figure Lengend Snippet: In vitro analysis of Ixofin3D- Borrelia burgdorferi interaction. A. Imunofluorescence microscopy of PFA-fixed in vitro grown B. burgdorferi to assess binding to rIxofin3D-PF. B. burgdorferi was detected with FITC-conjugated B. burgdorferi antisera (FITC-green), rIxofin3D-PF (Panel 1) was detected using rabbit anti-Ixofin3D-PF IgG (TRITC-red), and rIxophilin (Panel 2) was detected using mouse anti-rIxophilin IgG (TRITC-red). Magnification ×20. B. ELISA assessment of dose-dependent binding of rIxofin3D-PF to B. burgdorferi membrane protein extract-coated plates compared to rIxophilin, a tick protein that does not bind to Borrelia .

    Article Snippet: Tick RNA isolation and quantitative RT-PCR Ticks were allowed to feed for 24 h, for 72 h, or to repletion (between 80 and 96 h after initiation of tick feeding) and RNA isolated from guts and salivary glands using Trizol (Invitrogen, CA) as described earlier . cDNA was synthesized using the iScript RT-PCR kit (Bio-Rad, CA) and analyzed by quantitative PCR for the expression of tick actin and B. burgdorferi and also ixofin3D , clone 2, 3 and 4 using gene-specific primers (listed in table S1) and the iQ SYBR Green Supermix (Bio-Rad, Hercules, CA) on a Opticon Engine MJ cycler (Bio-Rad, CA).

    Techniques: In Vitro, Microscopy, Binding Assay, Enzyme-linked Immunosorbent Assay

    TAB1 inhibits IL-2 and increases IL-10 production. (A) T-cell hybridoma 2B4 was transduced with retrovirus that contained the vector alone (Mock) or human TAB1 (TAB1), and stable cell lines were selected in the presence of G418 (500 μg/ml). RNA was prepared from each cell line and was subjected to RT-PCR analysis for TAB1 mRNA expression. PCR was performed for 18, 24, 30, and 36 cycles (as indicated by the triangles over the lanes). (B) p38α was immunoprecipitated with specific antibodies from lysates of Mock-2B4 cells (Mock) or TAB1-2B4 cells (TAB1) and was subjected to an in vitro kinase assay with ATF2 19-96 peptide as a substrate. The quantity of p38α was assessed by immunoblotting with anti-p38α antibody. (C) Mock-2B4 cells (Mock) and TAB1-2B4 cells (TAB1) were incubated with (SB) or without (Nil) SB203580 (10 μM) for 2 h, lysed, and subjected to immunoblotting with anti-phospho-p38 and anti-p38α antibodies. (D) Mock-2B4 cells (Mock) and TAB1-2B4 cells (TAB1) were cultured for 18 h in plates coated (TCR) or not coated (Nil) with anti-TCR MAb (10 μg/ml) and were subjected to RT-PCR analysis for IL-2, IL-10, and G3PDH mRNAs. (E) Mock-2B4 cells (Mock) and TAB1-2B4 cells (TAB1) were cultured with anti-TCR MAb (TCR) or with PMA (20 ng/ml) and ionomycin (Iono; 1 μM) for 24 h. The levels of IL-2 in the supernatants were determined by an ELISA. Error bars indicate standard deviations. (F) Jurkat cells were transiently transfected with pGL2B luciferase reporter constructs driven by the mouse IL-10 promoter (−1536 to +64), with vector pCMVF, which contained either no insert (Mock) or human TAB1 cDNA (TAB1), and with internal control phRL-TK. Cells were cultured with PMA (100 ng/ml) and ionomycin (2 μM) for 18 h, and luciferase activity was measured.

    Journal: Molecular and Cellular Biology

    Article Title: Regulation of the Maintenance of Peripheral T-Cell Anergy by TAB1-Mediated p38? Activation

    doi: 10.1128/MCB.24.16.6957-6966.2004

    Figure Lengend Snippet: TAB1 inhibits IL-2 and increases IL-10 production. (A) T-cell hybridoma 2B4 was transduced with retrovirus that contained the vector alone (Mock) or human TAB1 (TAB1), and stable cell lines were selected in the presence of G418 (500 μg/ml). RNA was prepared from each cell line and was subjected to RT-PCR analysis for TAB1 mRNA expression. PCR was performed for 18, 24, 30, and 36 cycles (as indicated by the triangles over the lanes). (B) p38α was immunoprecipitated with specific antibodies from lysates of Mock-2B4 cells (Mock) or TAB1-2B4 cells (TAB1) and was subjected to an in vitro kinase assay with ATF2 19-96 peptide as a substrate. The quantity of p38α was assessed by immunoblotting with anti-p38α antibody. (C) Mock-2B4 cells (Mock) and TAB1-2B4 cells (TAB1) were incubated with (SB) or without (Nil) SB203580 (10 μM) for 2 h, lysed, and subjected to immunoblotting with anti-phospho-p38 and anti-p38α antibodies. (D) Mock-2B4 cells (Mock) and TAB1-2B4 cells (TAB1) were cultured for 18 h in plates coated (TCR) or not coated (Nil) with anti-TCR MAb (10 μg/ml) and were subjected to RT-PCR analysis for IL-2, IL-10, and G3PDH mRNAs. (E) Mock-2B4 cells (Mock) and TAB1-2B4 cells (TAB1) were cultured with anti-TCR MAb (TCR) or with PMA (20 ng/ml) and ionomycin (Iono; 1 μM) for 24 h. The levels of IL-2 in the supernatants were determined by an ELISA. Error bars indicate standard deviations. (F) Jurkat cells were transiently transfected with pGL2B luciferase reporter constructs driven by the mouse IL-10 promoter (−1536 to +64), with vector pCMVF, which contained either no insert (Mock) or human TAB1 cDNA (TAB1), and with internal control phRL-TK. Cells were cultured with PMA (100 ng/ml) and ionomycin (2 μM) for 18 h, and luciferase activity was measured.

    Article Snippet: Jurkat cells (107 ) were transiently transfected with vector pCMVF, which contained no insert or human TAB1 cDNA (10 μg), in addition to internal control phRL-TK (3 μg) and luciferase reporter construct pGL2B driven by the mouse IL-10 promoter (−1536 to +64) (5 μg) by electroporation (220 V, 65 ms) with a Gene Pulser (Bio-Rad, Hercules, Calif.).

    Techniques: Transduction, Plasmid Preparation, Stable Transfection, Reverse Transcription Polymerase Chain Reaction, Expressing, Polymerase Chain Reaction, Immunoprecipitation, In Vitro, Kinase Assay, Incubation, Cell Culture, Enzyme-linked Immunosorbent Assay, Transfection, Luciferase, Construct, Activity Assay

    The inhibition of ERK kinase activity by TAB1 is dependent on p38. (A) Mock-2B4 cells (Mock) and TAB1-2B4 cells (TAB1) were cultured with various doses of PMA (0 to 60 ng/ml) for 10 min, and the levels of phosphorylated ERK and total ERK were determined by immunoblotting with specific antibodies. (B) Mock-2B4 cells (Mock) and TAB1-2B4 cells (TAB1) were cultured in the presence (SB) or absence (Cont) of SB203580 (10 μM) for 2 h and subsequently stimulated with PMA (0, 10, or 20 ng/ml) for 10 min. Cells were lysed, and the levels of phosphorylated ERK and total ERK were determined by immunoblotting with specific antibodies. (C) Mock-2B4 cells were transduced with a retroviral supernatant containing empty vector (Mock/Mock) or p38DN (Mock/p38DN) to establish stable cell lines. TAB1-2B4 cells were also transduced to establish cell lines expressing empty vector (TAB1/Mock) or p38DN cDNA (TAB1/p38DN). These cell lines were stimulated with PMA (0, 5, or 25 ng/ml) for 10 min and lysed, and the levels of phosphorylated MAPks and total MAPKs were determined by immunoblotting with specific antibodies. Representative results from two independent experiments are shown. (D) Mock-2B4 cells (Mock) and TAB1-2B4 cells (TAB1) were treated or not treated with SB203580 (10 μM) for 2 h and stimulated with PMA (20 ng/ml) and ionomycin (Iono; 2 μM) for 8 h in the presence (SB) or absence (Cont) of SB203580, respectively. Cells were subjected to RT-PCR analysis for IL-2 and G3PDH mRNAs. Representative results from two independent experiments are shown. (E) Mock/Mock, Mock/p38DN, TAB1/Mock, and TAB1/p38DN cells were stimulated with PMA (0, 5, or 25 ng/ml) and ionomycin (2 μM) for 8 h. Cells were subjected to RT-PCR analysis for IL-2, IL-10, and G3PDH mRNAs. Representative results from two independent experiments are shown. (F) Mock/Mock, Mock/p38DN, TAB1/Mock, and TAB1/p38DN cells were stimulated with anti-TCR MAb (H57; 10 μg/ml) for 24 h. The levels of IL-2 in culture supernatants were determined by an ELISA. IL-2 was not detectable in cultures without anti-TCR MAb.

    Journal: Molecular and Cellular Biology

    Article Title: Regulation of the Maintenance of Peripheral T-Cell Anergy by TAB1-Mediated p38? Activation

    doi: 10.1128/MCB.24.16.6957-6966.2004

    Figure Lengend Snippet: The inhibition of ERK kinase activity by TAB1 is dependent on p38. (A) Mock-2B4 cells (Mock) and TAB1-2B4 cells (TAB1) were cultured with various doses of PMA (0 to 60 ng/ml) for 10 min, and the levels of phosphorylated ERK and total ERK were determined by immunoblotting with specific antibodies. (B) Mock-2B4 cells (Mock) and TAB1-2B4 cells (TAB1) were cultured in the presence (SB) or absence (Cont) of SB203580 (10 μM) for 2 h and subsequently stimulated with PMA (0, 10, or 20 ng/ml) for 10 min. Cells were lysed, and the levels of phosphorylated ERK and total ERK were determined by immunoblotting with specific antibodies. (C) Mock-2B4 cells were transduced with a retroviral supernatant containing empty vector (Mock/Mock) or p38DN (Mock/p38DN) to establish stable cell lines. TAB1-2B4 cells were also transduced to establish cell lines expressing empty vector (TAB1/Mock) or p38DN cDNA (TAB1/p38DN). These cell lines were stimulated with PMA (0, 5, or 25 ng/ml) for 10 min and lysed, and the levels of phosphorylated MAPks and total MAPKs were determined by immunoblotting with specific antibodies. Representative results from two independent experiments are shown. (D) Mock-2B4 cells (Mock) and TAB1-2B4 cells (TAB1) were treated or not treated with SB203580 (10 μM) for 2 h and stimulated with PMA (20 ng/ml) and ionomycin (Iono; 2 μM) for 8 h in the presence (SB) or absence (Cont) of SB203580, respectively. Cells were subjected to RT-PCR analysis for IL-2 and G3PDH mRNAs. Representative results from two independent experiments are shown. (E) Mock/Mock, Mock/p38DN, TAB1/Mock, and TAB1/p38DN cells were stimulated with PMA (0, 5, or 25 ng/ml) and ionomycin (2 μM) for 8 h. Cells were subjected to RT-PCR analysis for IL-2, IL-10, and G3PDH mRNAs. Representative results from two independent experiments are shown. (F) Mock/Mock, Mock/p38DN, TAB1/Mock, and TAB1/p38DN cells were stimulated with anti-TCR MAb (H57; 10 μg/ml) for 24 h. The levels of IL-2 in culture supernatants were determined by an ELISA. IL-2 was not detectable in cultures without anti-TCR MAb.

    Article Snippet: Jurkat cells (107 ) were transiently transfected with vector pCMVF, which contained no insert or human TAB1 cDNA (10 μg), in addition to internal control phRL-TK (3 μg) and luciferase reporter construct pGL2B driven by the mouse IL-10 promoter (−1536 to +64) (5 μg) by electroporation (220 V, 65 ms) with a Gene Pulser (Bio-Rad, Hercules, Calif.).

    Techniques: Inhibition, Activity Assay, Cell Culture, Transduction, Plasmid Preparation, Stable Transfection, Expressing, Reverse Transcription Polymerase Chain Reaction, Enzyme-linked Immunosorbent Assay