Structured Review

TaKaRa cdna template
The DNA, <t>cDNA</t> nucleotide sequence and deduced amino acid sequence of <t>VpSBP16</t> from V . pesudoreticulata ( A ) and Exon-intron structures of VpSBP16 ( B ). The SBP domain is shown in red and the two zinc-binding sites of the C2HCH type (zinc finger 1 and zinc finger 2) are indicated with green and yellow boxes. The conserved basic amino acids of the nuclear location signal are shaded in dark grey.
Cdna Template, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 234 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cdna template/product/TaKaRa
Average 97 stars, based on 234 article reviews
Price from $9.99 to $1999.99
cdna template - by Bioz Stars, 2020-01
97/100 stars

Images

1) Product Images from "Overexpression of a SBP-Box Gene (VpSBP16) from Chinese Wild Vitis Species in Arabidopsis Improves Salinity and Drought Stress Tolerance"

Article Title: Overexpression of a SBP-Box Gene (VpSBP16) from Chinese Wild Vitis Species in Arabidopsis Improves Salinity and Drought Stress Tolerance

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms19040940

The DNA, cDNA nucleotide sequence and deduced amino acid sequence of VpSBP16 from V . pesudoreticulata ( A ) and Exon-intron structures of VpSBP16 ( B ). The SBP domain is shown in red and the two zinc-binding sites of the C2HCH type (zinc finger 1 and zinc finger 2) are indicated with green and yellow boxes. The conserved basic amino acids of the nuclear location signal are shaded in dark grey.
Figure Legend Snippet: The DNA, cDNA nucleotide sequence and deduced amino acid sequence of VpSBP16 from V . pesudoreticulata ( A ) and Exon-intron structures of VpSBP16 ( B ). The SBP domain is shown in red and the two zinc-binding sites of the C2HCH type (zinc finger 1 and zinc finger 2) are indicated with green and yellow boxes. The conserved basic amino acids of the nuclear location signal are shaded in dark grey.

Techniques Used: Sequencing, Binding Assay

Cloning of VpSBP16 from V . pesudoreticulata . ( A ) PCR amplification of the full-length VpSBP16 cDNA and ( B ) DNA from Vitis pseudoreticulata . M1: DNA marker DL5000; M2: DNA marker λ-Hind III; 1: VpSBP16 PCR product from cDNA; 2 and 3: VpSBP16 PCR product.
Figure Legend Snippet: Cloning of VpSBP16 from V . pesudoreticulata . ( A ) PCR amplification of the full-length VpSBP16 cDNA and ( B ) DNA from Vitis pseudoreticulata . M1: DNA marker DL5000; M2: DNA marker λ-Hind III; 1: VpSBP16 PCR product from cDNA; 2 and 3: VpSBP16 PCR product.

Techniques Used: Clone Assay, Polymerase Chain Reaction, Amplification, Marker

2) Product Images from "The SBP-Box Gene VpSBP11 from Chinese Wild Vitis Is Involved in Floral Transition and Affects Leaf Development"

Article Title: The SBP-Box Gene VpSBP11 from Chinese Wild Vitis Is Involved in Floral Transition and Affects Leaf Development

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms18071493

Cloning and sequence analysis of VpSBP11 from V . pesudoreticulata . ( A ) PCR amplification of the full length VpSBP11 DNA and ( B ) complementary DNA (cDNA) from Vitis pseudoreticulata . M1: DNA marker DL5000; M2: DNA marker DL2000; 1: VpSBP11 PCR product from DNA; 2: VpSBP11 PCR product from cDNA; ( C ) The full length DNA, cDNA nucleotide sequence, and deduced amino acid sequence of VpSBP11 from V . pesudoreticulata . The Squamosa promoter binding protein (SBP) domain is shown in red and the two zinc-binding sites of the C2HCH type (zinc finger 1 and zinc finger 2) are shown in the green and yellow boxes, respectively. The conserved basic amino acids of the nuclear location signal are shaded in dark grey.
Figure Legend Snippet: Cloning and sequence analysis of VpSBP11 from V . pesudoreticulata . ( A ) PCR amplification of the full length VpSBP11 DNA and ( B ) complementary DNA (cDNA) from Vitis pseudoreticulata . M1: DNA marker DL5000; M2: DNA marker DL2000; 1: VpSBP11 PCR product from DNA; 2: VpSBP11 PCR product from cDNA; ( C ) The full length DNA, cDNA nucleotide sequence, and deduced amino acid sequence of VpSBP11 from V . pesudoreticulata . The Squamosa promoter binding protein (SBP) domain is shown in red and the two zinc-binding sites of the C2HCH type (zinc finger 1 and zinc finger 2) are shown in the green and yellow boxes, respectively. The conserved basic amino acids of the nuclear location signal are shaded in dark grey.

Techniques Used: Clone Assay, Sequencing, Polymerase Chain Reaction, Amplification, Marker, Binding Assay

3) Product Images from "RNA interference-mediated knockdown of voltage-gated sodium channel (MpNav) gene causes mortality in peach-potato aphid, Myzus persicae"

Article Title: RNA interference-mediated knockdown of voltage-gated sodium channel (MpNav) gene causes mortality in peach-potato aphid, Myzus persicae

Journal: Scientific Reports

doi: 10.1038/s41598-019-41832-8

Dietary delivery of MpNa v dsRNA alters MpNa v expression in M . persicae . Relative abundances of MpNa v H1 gene transcripts, as determined by qRT-PCR of cDNA made from total RNA isolated from whole body 1 to 7 days after the indicated dietary treatments of M . persicae . Data represent the mean ± SEM of three independent experiments. MpNa v mRNA was normalized with Actin as an endogenous control. Treatment was compared with controls using ANOVA (Tukey Kramer multiple comparison, p
Figure Legend Snippet: Dietary delivery of MpNa v dsRNA alters MpNa v expression in M . persicae . Relative abundances of MpNa v H1 gene transcripts, as determined by qRT-PCR of cDNA made from total RNA isolated from whole body 1 to 7 days after the indicated dietary treatments of M . persicae . Data represent the mean ± SEM of three independent experiments. MpNa v mRNA was normalized with Actin as an endogenous control. Treatment was compared with controls using ANOVA (Tukey Kramer multiple comparison, p

Techniques Used: Expressing, Quantitative RT-PCR, Isolation

4) Product Images from "Development and Functional Analysis of Novel Genetic Promoters Using DNA Shuffling, Hybridization and a Combination Thereof"

Article Title: Development and Functional Analysis of Novel Genetic Promoters Using DNA Shuffling, Hybridization and a Combination Thereof

Journal: PLoS ONE

doi: 10.1371/journal.pone.0031931

Transgenic analysis of promoter constructs. ( a ) Comparative stable expression analysis of parent and hybrid promoter-GUS constructs in transgenic tobacco plants. Promoter activities of parent and hybrid promoters were monitored in 21-days-old tobacco ( Nicotiana tabacum cv. Samsun NN) seedlings (R1 progeny, 2nd generation, Kan R ) grown aseptically on an MS-agar medium in presence of kanamycin (300 µg/ml) and 3% sucrose. Soluble protein extracts (5 µg) from whole seedlings were used for the GUS assay. The data presented in the histogram as an average of three independent experiments for each construct with respective standard deviation (SD). The statistical analysis revealed a P value of 0.001 implying highly significant. In the histogram, GUS constructs: (1) Untransformed control tissue extract from the wild type Nicotiana tabacum cv Samsun NN (2) pKYLXGUS, with CaMV35S promoter, (3) pKFScpGUS, with FScp promoter; (4) pKFSGUS, with FS promoter; (5) pKFGUS, with F promoter; (6) pKFcpGUS, with Fcp promoter; (7) pKFSuasGUS, with FSuas promoter; (8) pKFuasGUS, with Fuas promoter; (9) pKFuasFScpGUS, with FuasFScp promoter; (10) pKFSuasFcpGUS, with FSuasFcp promoter; were shown. ( b ) Comparative expression analysis of transgenic plants expressing GUS constructs of parent and hybrid promoters by qRT-PCR assay. For each construct, 21-days-old seedlings (R1 progeny, 2nd generation, Kan R ) from independent transgenic lines were selected. Estimation of relative GUS transcript accumulation in transgenic plants developed using GUS constructs driven by CaMV35S, FScp, FS, F, Fcp, FSuas, Fuas, FuasFScp and FSuasFcp promoters was performed by qRT-RCR as described in “ Materials and Methods ”. The data presented in the histogram were average fold difference of GUS transcript ± SD of two independent experiments carried out using cDNA derived from two RNA samples extracted from two different plants expressing individual promoter constructs. In the histogram, each bar represents number of fold increase in transcript level of GUS gene in plants compared to CaMV35S (taken as 1.0). Histograms (2) pKYLXGUS; (3) pKFScpGUS; (4) pKFSGUS; (5) pKFGUS; (6) pKFcpGUS; (7) pKFSuasGUS; 8: pKFuasGUS; (9) pKFuasFScpGUS; (10) pKFSuasFcpGUS were shown.
Figure Legend Snippet: Transgenic analysis of promoter constructs. ( a ) Comparative stable expression analysis of parent and hybrid promoter-GUS constructs in transgenic tobacco plants. Promoter activities of parent and hybrid promoters were monitored in 21-days-old tobacco ( Nicotiana tabacum cv. Samsun NN) seedlings (R1 progeny, 2nd generation, Kan R ) grown aseptically on an MS-agar medium in presence of kanamycin (300 µg/ml) and 3% sucrose. Soluble protein extracts (5 µg) from whole seedlings were used for the GUS assay. The data presented in the histogram as an average of three independent experiments for each construct with respective standard deviation (SD). The statistical analysis revealed a P value of 0.001 implying highly significant. In the histogram, GUS constructs: (1) Untransformed control tissue extract from the wild type Nicotiana tabacum cv Samsun NN (2) pKYLXGUS, with CaMV35S promoter, (3) pKFScpGUS, with FScp promoter; (4) pKFSGUS, with FS promoter; (5) pKFGUS, with F promoter; (6) pKFcpGUS, with Fcp promoter; (7) pKFSuasGUS, with FSuas promoter; (8) pKFuasGUS, with Fuas promoter; (9) pKFuasFScpGUS, with FuasFScp promoter; (10) pKFSuasFcpGUS, with FSuasFcp promoter; were shown. ( b ) Comparative expression analysis of transgenic plants expressing GUS constructs of parent and hybrid promoters by qRT-PCR assay. For each construct, 21-days-old seedlings (R1 progeny, 2nd generation, Kan R ) from independent transgenic lines were selected. Estimation of relative GUS transcript accumulation in transgenic plants developed using GUS constructs driven by CaMV35S, FScp, FS, F, Fcp, FSuas, Fuas, FuasFScp and FSuasFcp promoters was performed by qRT-RCR as described in “ Materials and Methods ”. The data presented in the histogram were average fold difference of GUS transcript ± SD of two independent experiments carried out using cDNA derived from two RNA samples extracted from two different plants expressing individual promoter constructs. In the histogram, each bar represents number of fold increase in transcript level of GUS gene in plants compared to CaMV35S (taken as 1.0). Histograms (2) pKYLXGUS; (3) pKFScpGUS; (4) pKFSGUS; (5) pKFGUS; (6) pKFcpGUS; (7) pKFSuasGUS; 8: pKFuasGUS; (9) pKFuasFScpGUS; (10) pKFSuasFcpGUS were shown.

Techniques Used: Transgenic Assay, Construct, Expressing, Mass Spectrometry, GUS Gene Assay, Standard Deviation, Quantitative RT-PCR, Derivative Assay

5) Product Images from "Differential Effect of ?-radiation-induced Heme Oxygenase-1 Activity in Female and Male C57BL/6 Mice"

Article Title: Differential Effect of ?-radiation-induced Heme Oxygenase-1 Activity in Female and Male C57BL/6 Mice

Journal: Journal of Korean Medical Science

doi: 10.3346/jkms.2005.20.4.535

HO-1 mRNA expression levels in the liver of female C57BL/6 mice after whole-body irradiation with 10 Gy. ( A ) The purified total RNA was converted to cDNA and amplified by reverse transcriptase polymerase chain reaction (RT-PCR). The amplified RT-PCR product was visualized on 1% agarose gel. ( B ) The band density was quantified in comparison to the β-actin mRNA expression using image analyzer. Four mice were used in each test and control group. All data are shown as means±SEM. * p
Figure Legend Snippet: HO-1 mRNA expression levels in the liver of female C57BL/6 mice after whole-body irradiation with 10 Gy. ( A ) The purified total RNA was converted to cDNA and amplified by reverse transcriptase polymerase chain reaction (RT-PCR). The amplified RT-PCR product was visualized on 1% agarose gel. ( B ) The band density was quantified in comparison to the β-actin mRNA expression using image analyzer. Four mice were used in each test and control group. All data are shown as means±SEM. * p

Techniques Used: Expressing, Mouse Assay, Irradiation, Purification, Amplification, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis

6) Product Images from "Galectin-3 protects keratinocytes from UVB-induced apoptosis by enhancing AKT activation and suppressing ERK activation"

Article Title: Galectin-3 protects keratinocytes from UVB-induced apoptosis by enhancing AKT activation and suppressing ERK activation

Journal: The Journal of investigative dermatology

doi: 10.1038/jid.2008.119

Galectin-3 deficiency does not alter the expression of other galectins (a) Total RNA was extracted from keratinocytes from gal3 +/+ and gal3 −/− mice and cDNA was synthesized. Real-time PCR was performed to quantify mRNA. The results were normalized to HPRT. (b) Total RNA was extracted from keratinocytes exposed to UVB at the indicated time points. Real-time PCR was performed to quantify galectin−1, −7 and −9 mRNA. The results were normalized to HPRT. Bars represent mean ± SD. Similar results were obtained in two additional experiments.
Figure Legend Snippet: Galectin-3 deficiency does not alter the expression of other galectins (a) Total RNA was extracted from keratinocytes from gal3 +/+ and gal3 −/− mice and cDNA was synthesized. Real-time PCR was performed to quantify mRNA. The results were normalized to HPRT. (b) Total RNA was extracted from keratinocytes exposed to UVB at the indicated time points. Real-time PCR was performed to quantify galectin−1, −7 and −9 mRNA. The results were normalized to HPRT. Bars represent mean ± SD. Similar results were obtained in two additional experiments.

Techniques Used: Expressing, Mouse Assay, Synthesized, Real-time Polymerase Chain Reaction

7) Product Images from "Expression analysis data of T-cell surface antigen CD2 gene from rock bream (Oplegnathus fasciatus)"

Article Title: Expression analysis data of T-cell surface antigen CD2 gene from rock bream (Oplegnathus fasciatus)

Journal: Data in Brief

doi: 10.1016/j.dib.2019.103832

Detection of CD2 genes in different tissues of healthy rock bream by real-time PCR. EF-1α was used for normalizing the real-time PCR results. Data are presented as the mean ± SD from three independent cDNA samples with three replicates from each sample. Asterisks (*) indicate significant differences (p
Figure Legend Snippet: Detection of CD2 genes in different tissues of healthy rock bream by real-time PCR. EF-1α was used for normalizing the real-time PCR results. Data are presented as the mean ± SD from three independent cDNA samples with three replicates from each sample. Asterisks (*) indicate significant differences (p

Techniques Used: Real-time Polymerase Chain Reaction

Related Articles

Clone Assay:

Article Title: The SBP-Box Gene VpSBP11 from Chinese Wild Vitis Is Involved in Floral Transition and Affects Leaf Development
Article Snippet: Paragraph title: 4.2. Cloning of VpSBP11 and Sequence Analysis ... A pair of gene-specific primers (VpSBP11- F1 and VpSBP11- R1) ( ) were used to amplify the predicted VpSBP11 ORF from the cDNA template with Taq DNA polymerase (TaKaRa Biotechnology, Dalian, China) and the following cycling program: 94 °C for 3 min, 35 cycles at 94 °C for 30 s, 58 °C for 30 s, 72 °C for 2 min, and extension at 72 °C for 10 min.

Article Title: Overexpression of a SBP-Box Gene (VpSBP16) from Chinese Wild Vitis Species in Arabidopsis Improves Salinity and Drought Stress Tolerance
Article Snippet: A pair of gene-specific primers ( VpSBP16 -F1 and VpSBP16 -R1) ( ) were used to amplify the predicted VpSBP16 ORF from the cDNA template with Taq DNA polymerase (TaKaRa Biotechnology, Dalian, China) and the following cycling program: 94 °C for 3 min, 35 cycles at 94 °C for 30 s, 58 °C for 30 s and 72 °C for 2 min; and extension at 72 °C for 10 min. .. The amplified products were cloned into the pGEM-Teasy vector (Promega, Madison, WI, USA) to generate pGEM-Teasy- VpSBP16 , and transformed into E. coli strain DH5α .

Amplification:

Article Title: Genome-wide identification of epithelial-mesenchymal transition-associated microRNAs reveals novel targets for glioblastoma therapy
Article Snippet: Total RNA was converted into a cDNA template using PrimeScript™ RT reagent kit (Takara Bio, Inc., Otsu, Japan). .. N-cadherin were amplified with the primer: 5′-GGTGGAGGAGAAGAAGACCAG-3′ (Sense) and 5′-GGCATCAGGCTCCACAGT-3′ (Antisense).

Article Title: Genome-Wide Analysis of the YABBY Gene Family in Grapevine and Functional Characterization of VvYABBY4
Article Snippet: Each reaction was conducted in triplicate with a final volume of 20 μl, including 1.6-μl primer (1.0 μM), 1.0-μl cDNA template, 10.0-μl SYBR green (TaKaRa, Bio Inc.), and 7.4-μl sterile distilled H2 O. .. The PCR amplification profile used was following a previous study ( ).

Article Title: The SBP-Box Gene VpSBP11 from Chinese Wild Vitis Is Involved in Floral Transition and Affects Leaf Development
Article Snippet: A pair of gene-specific primers (VpSBP11- F1 and VpSBP11- R1) ( ) were used to amplify the predicted VpSBP11 ORF from the cDNA template with Taq DNA polymerase (TaKaRa Biotechnology, Dalian, China) and the following cycling program: 94 °C for 3 min, 35 cycles at 94 °C for 30 s, 58 °C for 30 s, 72 °C for 2 min, and extension at 72 °C for 10 min. .. The amplified products were cloned into the pGEM-Teasy vector (Promega) to generate pGEM-Teasy-VpSBP11 and transformed into the E.coli strain DH5α.

Article Title: Overexpression of a SBP-Box Gene (VpSBP16) from Chinese Wild Vitis Species in Arabidopsis Improves Salinity and Drought Stress Tolerance
Article Snippet: A pair of gene-specific primers ( VpSBP16 -F1 and VpSBP16 -R1) ( ) were used to amplify the predicted VpSBP16 ORF from the cDNA template with Taq DNA polymerase (TaKaRa Biotechnology, Dalian, China) and the following cycling program: 94 °C for 3 min, 35 cycles at 94 °C for 30 s, 58 °C for 30 s and 72 °C for 2 min; and extension at 72 °C for 10 min. .. The amplified products were cloned into the pGEM-Teasy vector (Promega, Madison, WI, USA) to generate pGEM-Teasy- VpSBP16 , and transformed into E. coli strain DH5α .

Article Title: The Asian arowana (Scleropages formosus) genome provides new insights into the evolution of an early lineage of teleosts
Article Snippet: .. Amplification of each sample was performed in triplicate with each reaction well containing 20 μL of a PCR mixture consisting of 1 μL cDNA template, 10 μL SYBR Premix (TaKaRa, Dalian, China), 0.6 μL forward and reverse primer (20 pmol/L), 0.4 μL ROX reference dye, and 8 μL dd H2 O. .. The PCR reaction was performed using the ABI Stepone plus (Applied Biosystems, Foster City, CA, USA) with SYBR Premix Ex TaqTM (TaKaRa, Dalian, China).

Article Title: Differential Effect of ?-radiation-induced Heme Oxygenase-1 Activity in Female and Male C57BL/6 Mice
Article Snippet: .. Then produced cDNA was amplified by polymerase chain reaction (PCR) in the mixture containing 10 µL cDNA template from RT reaction, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5mM MgCl2 , 0.5mM each of dNTP, 1.0 µM of each primer, and 0.5 U Tag DNA polymerase (Takara, Tokyo, Japan). .. The oligonucleotide primers used in these experiments are as followings; HO-1 PCR primer (5'-primer 5'-AACAAGCAGAACCCAGTC-3', 3'-primer: 5'-TGTCATCTCCAGAGT-GTTC-3'), β-actin primer (5'-primer: 5'-TGGAATCCTGTGGCATCCATGAAA-3', 3'-primer: 5'-TAAAACGCAGCTCAGTAACAGTCCG-3').

Article Title: RNA interference-mediated knockdown of voltage-gated sodium channel (MpNav) gene causes mortality in peach-potato aphid, Myzus persicae
Article Snippet: Synthesis of dsRNA molecules For RNAi experiments, a 289 bp fragment of the M . persicae MpNa v (heteromer H1) gene (NCBI Accession FN601405) and a 329 bp fragment of the Aequorea victoria green-fluorescent protein (GFP) gene (NCBI Accession M62653) were amplified from cDNA obtained from adult aphids using PCR. .. The reaction mixture for PCR contained 500 ng of the cDNA template, 0.5 µm of forward and reverse primers, 1.75 mM Mg2+ , 0.25 mM of each dNTP (Takara Bio, Japan), 1X PCR buffer, 5U/µl Taq DNA polymerase (Takara Bio) and double-distilled H2 O to make a 25 µl total reaction volume.

Synthesized:

Article Title: The effect of an alternative chromosome 17 probe on fluorescence in situ hybridization for the assessment of HER2 amplification in invasive breast cancer
Article Snippet: This sequence was synthesized to a pUc-CEP17 plasmid purchased from Biocin Healthcare. .. The PCR was performed in a volume of 20 µl, including 2 µl cDNA template, 10 µl Taq PCR mix (Takara Biotechnology Co., Ltd.), 1 µl forward and reverse primers (10 µm) and 6 µl nuclease-free water.

Article Title: Identification and Functional Characterization of a Microtubule-Associated Protein, GhCLASP2, From Upland Cotton (Gossypium hirsutum L.)
Article Snippet: Total RNA was extracted from cotton roots, stems, leaves, flowers, and fibers of different developmental stages. cDNA was synthesized by using an EASYspin Plus Plant RNA Kit (Aidlab) with gDNA Eraser (Takara). .. The gene-specific primers used in the study were shown in Supplementary Table . sqPCR was performed using cDNA template and ExTaq DNA Polymerase (Takara) by 28 cycles at an annealing temperature of 58°C.

Article Title: The Impact of Chronic Heat Stress on the Growth, Survival, Feeding, and Differential Gene Expression in the Sea Urchin Strongylocentrotus intermedius
Article Snippet: The DEG input RNA was used as template for cDNA synthesis. cDNA was synthesized using PrimeScriptTM RT reagent Kit (TaKaRa, Japan). .. Primers used in qRT-PCR analyses were designed by Primer Premier 5.0 ( ). qRT-PCR was performed in a total volume of 16 μL, which consisted of 2 μL of the cDNA template, 8 μL of 2× SYBR Green Master mix (TaKaRa, Japan), 0.3 μL of ROX reference dye II, 4.5 μL of PCR-grade water, and 0.6 μL (10 mM) of each primer.

Article Title: Development and Functional Analysis of Novel Genetic Promoters Using DNA Shuffling, Hybridization and a Combination Thereof
Article Snippet: The cDNA was synthesized using RNA (DNase I treated) isolated from transgenic tobacco plants expressing pKFuasGUS, pKFSuasGUS, pKFcpGUS, pKFScpGUS, pKFGUS, pKFSGUS, pKFuasFScpGUS and pKFSuasFcpGUS promoter construct individually using cDNA synthesis Kit (Fermentas, USA). .. The qRT- PCR for relative expression analysis was performed using the corresponding cDNA template (1∶15 dilution) and SYBR Premix Ex Taq™ II (Perfect Real Time, Takara Bio Inc., Japan) employing Opticon-2 Real-time PCR machine (MJ Research, Bio-Rad; Model; CFD-3220).

Article Title: The SBP-Box Gene VpSBP11 from Chinese Wild Vitis Is Involved in Floral Transition and Affects Leaf Development
Article Snippet: The cDNA was synthesized from 1.0 µg total RNA using 500 ng of random hexamers and the M-MLV reverse transcriptase (Promega, Beijing, China). .. A pair of gene-specific primers (VpSBP11- F1 and VpSBP11- R1) ( ) were used to amplify the predicted VpSBP11 ORF from the cDNA template with Taq DNA polymerase (TaKaRa Biotechnology, Dalian, China) and the following cycling program: 94 °C for 3 min, 35 cycles at 94 °C for 30 s, 58 °C for 30 s, 72 °C for 2 min, and extension at 72 °C for 10 min.

Article Title: Overexpression of a SBP-Box Gene (VpSBP16) from Chinese Wild Vitis Species in Arabidopsis Improves Salinity and Drought Stress Tolerance
Article Snippet: The cDNA was synthesized from total RNA samples extracted from V. pseudoreticulata ‘Baihe-35-1’ leaves. .. A pair of gene-specific primers ( VpSBP16 -F1 and VpSBP16 -R1) ( ) were used to amplify the predicted VpSBP16 ORF from the cDNA template with Taq DNA polymerase (TaKaRa Biotechnology, Dalian, China) and the following cycling program: 94 °C for 3 min, 35 cycles at 94 °C for 30 s, 58 °C for 30 s and 72 °C for 2 min; and extension at 72 °C for 10 min.

Article Title: The Asian arowana (Scleropages formosus) genome provides new insights into the evolution of an early lineage of teleosts
Article Snippet: Single-stranded cDNA was synthesized from 1 μg of total RNA from each sample using the PrimeScript1st Strand cDNA Synthesis Kit (TaKaRa, Dalian, China). .. Amplification of each sample was performed in triplicate with each reaction well containing 20 μL of a PCR mixture consisting of 1 μL cDNA template, 10 μL SYBR Premix (TaKaRa, Dalian, China), 0.6 μL forward and reverse primer (20 pmol/L), 0.4 μL ROX reference dye, and 8 μL dd H2 O.

Article Title: Expression analysis data of T-cell surface antigen CD2 gene from rock bream (Oplegnathus fasciatus)
Article Snippet: 1 μl of total RNA, 1 μl of anchored-oligo (dT) primer and 11 μl of water The mixture was reacted at 65 °C for 10 minutes and then on ice for 5 minutes. cDNA was synthesized by mixing 4 μl of Transcriptor Reverse Transcriptase Reaction Buffer, 0.5 μl of Protector RNase Inhibitor, 2 μl of Deoxynucleotide Mix and 0.5 μl of Transcriptor Reverse Transcriptase for 30 min at 55 °C and 85 °C for 5 min . .. For quantitative real-time PCR, 1 μl of cDNA template, 1 μl of forward and reverse primers, 12.5 μl of SYBR Green, and 9.5 μl of DDW were mixed in a total volume of 25 μl using SYBR Green Master Mix (TaKaRa, Shiga, Japan) according to the manufacturer and incubated at 50 °C for 4 minutes After initial denaturation at 95 °C for 10 min, reaction was carried out 45 times at 95 °C for 20 sec and 60 °C for 1 min.

Quantitative RT-PCR:

Article Title: Genome-wide identification of epithelial-mesenchymal transition-associated microRNAs reveals novel targets for glioblastoma therapy
Article Snippet: Paragraph title: Reverse transcription quantitative PCR (RT-qPCR) ... Total RNA was converted into a cDNA template using PrimeScript™ RT reagent kit (Takara Bio, Inc., Otsu, Japan).

Article Title: Identification and Functional Characterization of a Microtubule-Associated Protein, GhCLASP2, From Upland Cotton (Gossypium hirsutum L.)
Article Snippet: Paragraph title: Isolation of Total RNA, Semi-quantitative PCR, and qRT-PCR Analysis ... The gene-specific primers used in the study were shown in Supplementary Table . sqPCR was performed using cDNA template and ExTaq DNA Polymerase (Takara) by 28 cycles at an annealing temperature of 58°C.

Article Title: The Impact of Chronic Heat Stress on the Growth, Survival, Feeding, and Differential Gene Expression in the Sea Urchin Strongylocentrotus intermedius
Article Snippet: .. Primers used in qRT-PCR analyses were designed by Primer Premier 5.0 ( ). qRT-PCR was performed in a total volume of 16 μL, which consisted of 2 μL of the cDNA template, 8 μL of 2× SYBR Green Master mix (TaKaRa, Japan), 0.3 μL of ROX reference dye II, 4.5 μL of PCR-grade water, and 0.6 μL (10 mM) of each primer. .. The running program was set as follows: 95°C for 30 s; followed by 40 cycles of 95°C for 5 s and annealing temperature 56°C for 32 s. At the end of reaction, PCR melting curve analysis was conducted to confirm single PCR products.

Article Title: Development and Functional Analysis of Novel Genetic Promoters Using DNA Shuffling, Hybridization and a Combination Thereof
Article Snippet: .. The qRT- PCR for relative expression analysis was performed using the corresponding cDNA template (1∶15 dilution) and SYBR Premix Ex Taq™ II (Perfect Real Time, Takara Bio Inc., Japan) employing Opticon-2 Real-time PCR machine (MJ Research, Bio-Rad; Model; CFD-3220). .. Gene specific primers for GUS and GADPH ( ) were used at a concentration of 0.9 µmolar to get 95% efficiency.

Real-time Polymerase Chain Reaction:

Article Title: Genome-wide identification of epithelial-mesenchymal transition-associated microRNAs reveals novel targets for glioblastoma therapy
Article Snippet: Paragraph title: Reverse transcription quantitative PCR (RT-qPCR) ... Total RNA was converted into a cDNA template using PrimeScript™ RT reagent kit (Takara Bio, Inc., Otsu, Japan).

Article Title: Development and Functional Analysis of Novel Genetic Promoters Using DNA Shuffling, Hybridization and a Combination Thereof
Article Snippet: .. The qRT- PCR for relative expression analysis was performed using the corresponding cDNA template (1∶15 dilution) and SYBR Premix Ex Taq™ II (Perfect Real Time, Takara Bio Inc., Japan) employing Opticon-2 Real-time PCR machine (MJ Research, Bio-Rad; Model; CFD-3220). .. Gene specific primers for GUS and GADPH ( ) were used at a concentration of 0.9 µmolar to get 95% efficiency.

Article Title: Genome-Wide Analysis of the YABBY Gene Family in Grapevine and Functional Characterization of VvYABBY4
Article Snippet: Quantitative real-time PCR analysis was performed with an IQ5 real-time PCR machine (Bio-Rad, Hercules, CA, USA). .. Each reaction was conducted in triplicate with a final volume of 20 μl, including 1.6-μl primer (1.0 μM), 1.0-μl cDNA template, 10.0-μl SYBR green (TaKaRa, Bio Inc.), and 7.4-μl sterile distilled H2 O.

Article Title: Galectin-3 protects keratinocytes from UVB-induced apoptosis by enhancing AKT activation and suppressing ERK activation
Article Snippet: Paragraph title: Real-time PCR analysis ... The reaction mixture consisted of 50 ng of cDNA template, 1x SYBR Green PCR master mix (TAKARA, Tokyo, Japan) and 200 nM primer mix (forward and reverse primers combined).

Article Title: Expression analysis data of T-cell surface antigen CD2 gene from rock bream (Oplegnathus fasciatus)
Article Snippet: .. For quantitative real-time PCR, 1 μl of cDNA template, 1 μl of forward and reverse primers, 12.5 μl of SYBR Green, and 9.5 μl of DDW were mixed in a total volume of 25 μl using SYBR Green Master Mix (TaKaRa, Shiga, Japan) according to the manufacturer and incubated at 50 °C for 4 minutes After initial denaturation at 95 °C for 10 min, reaction was carried out 45 times at 95 °C for 20 sec and 60 °C for 1 min. .. The degree of CD2 mRNA expression was compared with the expression level of elongation factor (EF) -1α (forward: 5′- CCCCTGCAGGACGTCTACAA -3′, reverse: 5′- AACACGACCGACGGGTACA -3′) mRNA and three repetitions were performed for each gene for the accuracy of the experiment.

Incubation:

Article Title: Expression analysis data of T-cell surface antigen CD2 gene from rock bream (Oplegnathus fasciatus)
Article Snippet: .. For quantitative real-time PCR, 1 μl of cDNA template, 1 μl of forward and reverse primers, 12.5 μl of SYBR Green, and 9.5 μl of DDW were mixed in a total volume of 25 μl using SYBR Green Master Mix (TaKaRa, Shiga, Japan) according to the manufacturer and incubated at 50 °C for 4 minutes After initial denaturation at 95 °C for 10 min, reaction was carried out 45 times at 95 °C for 20 sec and 60 °C for 1 min. .. The degree of CD2 mRNA expression was compared with the expression level of elongation factor (EF) -1α (forward: 5′- CCCCTGCAGGACGTCTACAA -3′, reverse: 5′- AACACGACCGACGGGTACA -3′) mRNA and three repetitions were performed for each gene for the accuracy of the experiment.

Expressing:

Article Title: Identification and Functional Characterization of a Microtubule-Associated Protein, GhCLASP2, From Upland Cotton (Gossypium hirsutum L.)
Article Snippet: The expression levels of GhCLASPs were analyzed by semi-quantitative PCR (sqPCR) and quantitative real-time RT-PCR (qRT-PCR). .. The gene-specific primers used in the study were shown in Supplementary Table . sqPCR was performed using cDNA template and ExTaq DNA Polymerase (Takara) by 28 cycles at an annealing temperature of 58°C.

Article Title: The Impact of Chronic Heat Stress on the Growth, Survival, Feeding, and Differential Gene Expression in the Sea Urchin Strongylocentrotus intermedius
Article Snippet: Primers used in qRT-PCR analyses were designed by Primer Premier 5.0 ( ). qRT-PCR was performed in a total volume of 16 μL, which consisted of 2 μL of the cDNA template, 8 μL of 2× SYBR Green Master mix (TaKaRa, Japan), 0.3 μL of ROX reference dye II, 4.5 μL of PCR-grade water, and 0.6 μL (10 mM) of each primer. .. The relative expression level of each candidate DEG was determined using the comparative 2-ΔΔ C t method ( ).

Article Title: Development and Functional Analysis of Novel Genetic Promoters Using DNA Shuffling, Hybridization and a Combination Thereof
Article Snippet: .. The qRT- PCR for relative expression analysis was performed using the corresponding cDNA template (1∶15 dilution) and SYBR Premix Ex Taq™ II (Perfect Real Time, Takara Bio Inc., Japan) employing Opticon-2 Real-time PCR machine (MJ Research, Bio-Rad; Model; CFD-3220). .. Gene specific primers for GUS and GADPH ( ) were used at a concentration of 0.9 µmolar to get 95% efficiency.

Article Title: Genome-Wide Analysis of the YABBY Gene Family in Grapevine and Functional Characterization of VvYABBY4
Article Snippet: Paragraph title: Gene Expression Analysis ... Each reaction was conducted in triplicate with a final volume of 20 μl, including 1.6-μl primer (1.0 μM), 1.0-μl cDNA template, 10.0-μl SYBR green (TaKaRa, Bio Inc.), and 7.4-μl sterile distilled H2 O.

Article Title: The Asian arowana (Scleropages formosus) genome provides new insights into the evolution of an early lineage of teleosts
Article Snippet: Amplification of each sample was performed in triplicate with each reaction well containing 20 μL of a PCR mixture consisting of 1 μL cDNA template, 10 μL SYBR Premix (TaKaRa, Dalian, China), 0.6 μL forward and reverse primer (20 pmol/L), 0.4 μL ROX reference dye, and 8 μL dd H2 O. .. The relative expression level of the gene was calculated using the 2 −ΔΔCt method ( ).

Article Title: Differential Effect of ?-radiation-induced Heme Oxygenase-1 Activity in Female and Male C57BL/6 Mice
Article Snippet: Paragraph title: HO-1 mRNA expression determination ... Then produced cDNA was amplified by polymerase chain reaction (PCR) in the mixture containing 10 µL cDNA template from RT reaction, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5mM MgCl2 , 0.5mM each of dNTP, 1.0 µM of each primer, and 0.5 U Tag DNA polymerase (Takara, Tokyo, Japan).

Article Title: Expression analysis data of T-cell surface antigen CD2 gene from rock bream (Oplegnathus fasciatus)
Article Snippet: For quantitative real-time PCR, 1 μl of cDNA template, 1 μl of forward and reverse primers, 12.5 μl of SYBR Green, and 9.5 μl of DDW were mixed in a total volume of 25 μl using SYBR Green Master Mix (TaKaRa, Shiga, Japan) according to the manufacturer and incubated at 50 °C for 4 minutes After initial denaturation at 95 °C for 10 min, reaction was carried out 45 times at 95 °C for 20 sec and 60 °C for 1 min. .. The degree of CD2 mRNA expression was compared with the expression level of elongation factor (EF) -1α (forward: 5′- CCCCTGCAGGACGTCTACAA -3′, reverse: 5′- AACACGACCGACGGGTACA -3′) mRNA and three repetitions were performed for each gene for the accuracy of the experiment.

Transformation Assay:

Article Title: The SBP-Box Gene VpSBP11 from Chinese Wild Vitis Is Involved in Floral Transition and Affects Leaf Development
Article Snippet: A pair of gene-specific primers (VpSBP11- F1 and VpSBP11- R1) ( ) were used to amplify the predicted VpSBP11 ORF from the cDNA template with Taq DNA polymerase (TaKaRa Biotechnology, Dalian, China) and the following cycling program: 94 °C for 3 min, 35 cycles at 94 °C for 30 s, 58 °C for 30 s, 72 °C for 2 min, and extension at 72 °C for 10 min. .. The amplified products were cloned into the pGEM-Teasy vector (Promega) to generate pGEM-Teasy-VpSBP11 and transformed into the E.coli strain DH5α.

Article Title: Overexpression of a SBP-Box Gene (VpSBP16) from Chinese Wild Vitis Species in Arabidopsis Improves Salinity and Drought Stress Tolerance
Article Snippet: A pair of gene-specific primers ( VpSBP16 -F1 and VpSBP16 -R1) ( ) were used to amplify the predicted VpSBP16 ORF from the cDNA template with Taq DNA polymerase (TaKaRa Biotechnology, Dalian, China) and the following cycling program: 94 °C for 3 min, 35 cycles at 94 °C for 30 s, 58 °C for 30 s and 72 °C for 2 min; and extension at 72 °C for 10 min. .. The amplified products were cloned into the pGEM-Teasy vector (Promega, Madison, WI, USA) to generate pGEM-Teasy- VpSBP16 , and transformed into E. coli strain DH5α .

Generated:

Article Title: Development and Functional Analysis of Novel Genetic Promoters Using DNA Shuffling, Hybridization and a Combination Thereof
Article Snippet: A standard curve was generated using serially diluted cDNA as described earlier . .. The qRT- PCR for relative expression analysis was performed using the corresponding cDNA template (1∶15 dilution) and SYBR Premix Ex Taq™ II (Perfect Real Time, Takara Bio Inc., Japan) employing Opticon-2 Real-time PCR machine (MJ Research, Bio-Rad; Model; CFD-3220).

Polymerase Chain Reaction:

Article Title: The effect of an alternative chromosome 17 probe on fluorescence in situ hybridization for the assessment of HER2 amplification in invasive breast cancer
Article Snippet: .. The PCR was performed in a volume of 20 µl, including 2 µl cDNA template, 10 µl Taq PCR mix (Takara Biotechnology Co., Ltd.), 1 µl forward and reverse primers (10 µm) and 6 µl nuclease-free water. ..

Article Title: Identification and Functional Characterization of a Microtubule-Associated Protein, GhCLASP2, From Upland Cotton (Gossypium hirsutum L.)
Article Snippet: Paragraph title: Isolation of Total RNA, Semi-quantitative PCR, and qRT-PCR Analysis ... The gene-specific primers used in the study were shown in Supplementary Table . sqPCR was performed using cDNA template and ExTaq DNA Polymerase (Takara) by 28 cycles at an annealing temperature of 58°C.

Article Title: The Impact of Chronic Heat Stress on the Growth, Survival, Feeding, and Differential Gene Expression in the Sea Urchin Strongylocentrotus intermedius
Article Snippet: .. Primers used in qRT-PCR analyses were designed by Primer Premier 5.0 ( ). qRT-PCR was performed in a total volume of 16 μL, which consisted of 2 μL of the cDNA template, 8 μL of 2× SYBR Green Master mix (TaKaRa, Japan), 0.3 μL of ROX reference dye II, 4.5 μL of PCR-grade water, and 0.6 μL (10 mM) of each primer. .. The running program was set as follows: 95°C for 30 s; followed by 40 cycles of 95°C for 5 s and annealing temperature 56°C for 32 s. At the end of reaction, PCR melting curve analysis was conducted to confirm single PCR products.

Article Title: Genome-Wide Analysis of the YABBY Gene Family in Grapevine and Functional Characterization of VvYABBY4
Article Snippet: Each reaction was conducted in triplicate with a final volume of 20 μl, including 1.6-μl primer (1.0 μM), 1.0-μl cDNA template, 10.0-μl SYBR green (TaKaRa, Bio Inc.), and 7.4-μl sterile distilled H2 O. .. The PCR amplification profile used was following a previous study ( ).

Article Title: Galectin-3 protects keratinocytes from UVB-induced apoptosis by enhancing AKT activation and suppressing ERK activation
Article Snippet: .. The reaction mixture consisted of 50 ng of cDNA template, 1x SYBR Green PCR master mix (TAKARA, Tokyo, Japan) and 200 nM primer mix (forward and reverse primers combined). .. Cycling parameters were 95°C for 10 min to activate DNA polymerase, then 40 cycles of 95°C for 20 sec and 60°C for 1 min. Primer sets used are as follows: Galectin-1, GAAAAGACAGCAACAACCTGTGCCTAC and GAGGGCTACAGGCTGGCTGGC; Galectin-3, GACAGTCAGCCTTCCCCTTTGAGAG and AGGCACACAGGGCCGGTTTCGG; Galectin-7, GGCACTGTCATGAGAATTCGAGGC and CGGTGGTGGAAGTGGAGATATTCGTC; Galectin-9, GTGATATCCAGCTGACCCACGTGC and ATGATATCAGGGTGGCTCTCCTG; hypoxanthine ribosyltransferase (HPRT), TGGATATGCCCTTGACTATAATGAGTACTTCAG and GTCTGGGGACGCAGCAACTGAC.

Article Title: Arenobufagin Induces Apoptotic Cell Death in Human Non-Small-Cell Lung Cancer Cells via the Noxa-Related Pathway
Article Snippet: Paragraph title: 4.7. RNA Extraction and Reverse-Transcription PCR ... The reaction mix contained: 2.5 µL 10 × Ex Taq Buffer, 2 µL dNTP Mixture, 200 nM forward and reverse primers, 100 ng cDNA template, 0.25 µL TaKaRa Ex Taq and ddH2 O up to 25 µL volume.

Article Title: The Asian arowana (Scleropages formosus) genome provides new insights into the evolution of an early lineage of teleosts
Article Snippet: .. Amplification of each sample was performed in triplicate with each reaction well containing 20 μL of a PCR mixture consisting of 1 μL cDNA template, 10 μL SYBR Premix (TaKaRa, Dalian, China), 0.6 μL forward and reverse primer (20 pmol/L), 0.4 μL ROX reference dye, and 8 μL dd H2 O. .. The PCR reaction was performed using the ABI Stepone plus (Applied Biosystems, Foster City, CA, USA) with SYBR Premix Ex TaqTM (TaKaRa, Dalian, China).

Article Title: Differential Effect of ?-radiation-induced Heme Oxygenase-1 Activity in Female and Male C57BL/6 Mice
Article Snippet: .. Then produced cDNA was amplified by polymerase chain reaction (PCR) in the mixture containing 10 µL cDNA template from RT reaction, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5mM MgCl2 , 0.5mM each of dNTP, 1.0 µM of each primer, and 0.5 U Tag DNA polymerase (Takara, Tokyo, Japan). .. The oligonucleotide primers used in these experiments are as followings; HO-1 PCR primer (5'-primer 5'-AACAAGCAGAACCCAGTC-3', 3'-primer: 5'-TGTCATCTCCAGAGT-GTTC-3'), β-actin primer (5'-primer: 5'-TGGAATCCTGTGGCATCCATGAAA-3', 3'-primer: 5'-TAAAACGCAGCTCAGTAACAGTCCG-3').

Article Title: RNA interference-mediated knockdown of voltage-gated sodium channel (MpNav) gene causes mortality in peach-potato aphid, Myzus persicae
Article Snippet: .. The reaction mixture for PCR contained 500 ng of the cDNA template, 0.5 µm of forward and reverse primers, 1.75 mM Mg2+ , 0.25 mM of each dNTP (Takara Bio, Japan), 1X PCR buffer, 5U/µl Taq DNA polymerase (Takara Bio) and double-distilled H2 O to make a 25 µl total reaction volume. .. The PCR conditions were 95 °C for 5 min, followed by 35 cycles of 95 °C for 30 s, 55–60 °C for 30 s and 72 °C for 30 s, and an additional final polymerization step of 72 °C for 5 min. PCR products were purified using TIANgel Midi Purification Kit (Tiangen, Beijing, China).

Article Title: Oncogenic Activity of Amplified Miniature Chromosome Maintenance 8 in Human Malignancies
Article Snippet: .. PCR was performed on the cDNA template from the donor prostate (Clontech) using the following conditions: 94 °C for 1 min, followed by 35 cycles of 94 °C for 30 s, 68 °C for 3 min, and a final 3 min extension step at 68 °C. .. The PCR product was restricted with Nde1 and Sal1 (New England Biolabs, MA), gel purified, and ligated into a similarly digested pGBKT7 vector.

Sequencing:

Article Title: The effect of an alternative chromosome 17 probe on fluorescence in situ hybridization for the assessment of HER2 amplification in invasive breast cancer
Article Snippet: The DNA sequence was labeled using the following primers (forward, 5′-GGAATCTGCAAGTGGATATG-3′ and reverse, 5′-CAGAACTACTCTATGAAAAGC-3′). .. The PCR was performed in a volume of 20 µl, including 2 µl cDNA template, 10 µl Taq PCR mix (Takara Biotechnology Co., Ltd.), 1 µl forward and reverse primers (10 µm) and 6 µl nuclease-free water.

Article Title: Genome-wide identification of epithelial-mesenchymal transition-associated microRNAs reveals novel targets for glioblastoma therapy
Article Snippet: Total RNA was converted into a cDNA template using PrimeScript™ RT reagent kit (Takara Bio, Inc., Otsu, Japan). .. N-cadherin mRNA level was analyzed by RT-qPCR on the ABI 7300 HT Sequence Detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.) using the SYBR® PrimeScript™ RT-PCR kit (Takara Bio, Inc.).

Article Title: Genome-Wide Analysis of the YABBY Gene Family in Grapevine and Functional Characterization of VvYABBY4
Article Snippet: Each reaction was conducted in triplicate with a final volume of 20 μl, including 1.6-μl primer (1.0 μM), 1.0-μl cDNA template, 10.0-μl SYBR green (TaKaRa, Bio Inc.), and 7.4-μl sterile distilled H2 O. .. The sequence of the gene-specific primers used for each of the YABBY genes in grapevine, as well as two house-keeping VvACTIN (GenBank Accession number AY680701) and VvEF1-α (GenBank Accession number EC931777) gene, is listed in .

Article Title: The SBP-Box Gene VpSBP11 from Chinese Wild Vitis Is Involved in Floral Transition and Affects Leaf Development
Article Snippet: Paragraph title: 4.2. Cloning of VpSBP11 and Sequence Analysis ... A pair of gene-specific primers (VpSBP11- F1 and VpSBP11- R1) ( ) were used to amplify the predicted VpSBP11 ORF from the cDNA template with Taq DNA polymerase (TaKaRa Biotechnology, Dalian, China) and the following cycling program: 94 °C for 3 min, 35 cycles at 94 °C for 30 s, 58 °C for 30 s, 72 °C for 2 min, and extension at 72 °C for 10 min.

Article Title: Overexpression of a SBP-Box Gene (VpSBP16) from Chinese Wild Vitis Species in Arabidopsis Improves Salinity and Drought Stress Tolerance
Article Snippet: A pair of gene-specific primers ( VpSBP16 -F1 and VpSBP16 -R1) ( ) were used to amplify the predicted VpSBP16 ORF from the cDNA template with Taq DNA polymerase (TaKaRa Biotechnology, Dalian, China) and the following cycling program: 94 °C for 3 min, 35 cycles at 94 °C for 30 s, 58 °C for 30 s and 72 °C for 2 min; and extension at 72 °C for 10 min. .. The subcellular localization of VpSBP16 was predicted using the Center for Biological Sequence analysis software ( ; ).

Article Title: Galectin-3 protects keratinocytes from UVB-induced apoptosis by enhancing AKT activation and suppressing ERK activation
Article Snippet: Real-time quantitative PCR were carried out in an ABI Prism 7700 sequence detection system (Applied Biosystems) in a 25 µl volume. .. The reaction mixture consisted of 50 ng of cDNA template, 1x SYBR Green PCR master mix (TAKARA, Tokyo, Japan) and 200 nM primer mix (forward and reverse primers combined).

Article Title: The Asian arowana (Scleropages formosus) genome provides new insights into the evolution of an early lineage of teleosts
Article Snippet: The PCR products were excised, purified and subcloned into the pMD19-T vector for sequencing to confirm whether it was the target sequence. .. Amplification of each sample was performed in triplicate with each reaction well containing 20 μL of a PCR mixture consisting of 1 μL cDNA template, 10 μL SYBR Premix (TaKaRa, Dalian, China), 0.6 μL forward and reverse primer (20 pmol/L), 0.4 μL ROX reference dye, and 8 μL dd H2 O.

Article Title: RNA interference-mediated knockdown of voltage-gated sodium channel (MpNav) gene causes mortality in peach-potato aphid, Myzus persicae
Article Snippet: The T7 promoter sequence 5′GGATCCTAATACGACTCACTATAGGA3′ was added in front of the forward and reverse PCR primers as required for subsequent dsRNA synthesis (Table ). .. The reaction mixture for PCR contained 500 ng of the cDNA template, 0.5 µm of forward and reverse primers, 1.75 mM Mg2+ , 0.25 mM of each dNTP (Takara Bio, Japan), 1X PCR buffer, 5U/µl Taq DNA polymerase (Takara Bio) and double-distilled H2 O to make a 25 µl total reaction volume.

Isolation:

Article Title: Identification and Functional Characterization of a Microtubule-Associated Protein, GhCLASP2, From Upland Cotton (Gossypium hirsutum L.)
Article Snippet: Paragraph title: Isolation of Total RNA, Semi-quantitative PCR, and qRT-PCR Analysis ... The gene-specific primers used in the study were shown in Supplementary Table . sqPCR was performed using cDNA template and ExTaq DNA Polymerase (Takara) by 28 cycles at an annealing temperature of 58°C.

Article Title: Development and Functional Analysis of Novel Genetic Promoters Using DNA Shuffling, Hybridization and a Combination Thereof
Article Snippet: The cDNA was synthesized using RNA (DNase I treated) isolated from transgenic tobacco plants expressing pKFuasGUS, pKFSuasGUS, pKFcpGUS, pKFScpGUS, pKFGUS, pKFSGUS, pKFuasFScpGUS and pKFSuasFcpGUS promoter construct individually using cDNA synthesis Kit (Fermentas, USA). .. The qRT- PCR for relative expression analysis was performed using the corresponding cDNA template (1∶15 dilution) and SYBR Premix Ex Taq™ II (Perfect Real Time, Takara Bio Inc., Japan) employing Opticon-2 Real-time PCR machine (MJ Research, Bio-Rad; Model; CFD-3220).

Article Title: Genome-Wide Analysis of the YABBY Gene Family in Grapevine and Functional Characterization of VvYABBY4
Article Snippet: Gene Expression Analysis Total RNA was isolated from 100 to 200 mg of all the samples using an EZNA Plant RNA Kit (R6827-01; Omega Bio-Tek, Norcross, GA, USA), according to the manufacturer’s instructions. .. Each reaction was conducted in triplicate with a final volume of 20 μl, including 1.6-μl primer (1.0 μM), 1.0-μl cDNA template, 10.0-μl SYBR green (TaKaRa, Bio Inc.), and 7.4-μl sterile distilled H2 O.

Article Title: Overexpression of a SBP-Box Gene (VpSBP16) from Chinese Wild Vitis Species in Arabidopsis Improves Salinity and Drought Stress Tolerance
Article Snippet: Paragraph title: 4.2. Isolation and Analysis of the VpSBP16 cDNA ... A pair of gene-specific primers ( VpSBP16 -F1 and VpSBP16 -R1) ( ) were used to amplify the predicted VpSBP16 ORF from the cDNA template with Taq DNA polymerase (TaKaRa Biotechnology, Dalian, China) and the following cycling program: 94 °C for 3 min, 35 cycles at 94 °C for 30 s, 58 °C for 30 s and 72 °C for 2 min; and extension at 72 °C for 10 min.

Article Title: Expression analysis data of T-cell surface antigen CD2 gene from rock bream (Oplegnathus fasciatus)
Article Snippet: The isolated total RNA was treated with DNase according to manufacturer's instructions using RNase-free DNase (Promega, USA). .. For quantitative real-time PCR, 1 μl of cDNA template, 1 μl of forward and reverse primers, 12.5 μl of SYBR Green, and 9.5 μl of DDW were mixed in a total volume of 25 μl using SYBR Green Master Mix (TaKaRa, Shiga, Japan) according to the manufacturer and incubated at 50 °C for 4 minutes After initial denaturation at 95 °C for 10 min, reaction was carried out 45 times at 95 °C for 20 sec and 60 °C for 1 min.

Size-exclusion Chromatography:

Article Title: Galectin-3 protects keratinocytes from UVB-induced apoptosis by enhancing AKT activation and suppressing ERK activation
Article Snippet: The reaction mixture consisted of 50 ng of cDNA template, 1x SYBR Green PCR master mix (TAKARA, Tokyo, Japan) and 200 nM primer mix (forward and reverse primers combined). .. Cycling parameters were 95°C for 10 min to activate DNA polymerase, then 40 cycles of 95°C for 20 sec and 60°C for 1 min. Primer sets used are as follows: Galectin-1, GAAAAGACAGCAACAACCTGTGCCTAC and GAGGGCTACAGGCTGGCTGGC; Galectin-3, GACAGTCAGCCTTCCCCTTTGAGAG and AGGCACACAGGGCCGGTTTCGG; Galectin-7, GGCACTGTCATGAGAATTCGAGGC and CGGTGGTGGAAGTGGAGATATTCGTC; Galectin-9, GTGATATCCAGCTGACCCACGTGC and ATGATATCAGGGTGGCTCTCCTG; hypoxanthine ribosyltransferase (HPRT), TGGATATGCCCTTGACTATAATGAGTACTTCAG and GTCTGGGGACGCAGCAACTGAC.

Article Title: Differential Effect of ?-radiation-induced Heme Oxygenase-1 Activity in Female and Male C57BL/6 Mice
Article Snippet: Then produced cDNA was amplified by polymerase chain reaction (PCR) in the mixture containing 10 µL cDNA template from RT reaction, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5mM MgCl2 , 0.5mM each of dNTP, 1.0 µM of each primer, and 0.5 U Tag DNA polymerase (Takara, Tokyo, Japan). .. PCR was performed with a DNA thermal cycle (Hybaid, Ashford, U.K.) at 94℃ for 30 sec, at 56℃ for 30 sec, and at 72℃ for 30 sec per cycle.

Article Title: Expression analysis data of T-cell surface antigen CD2 gene from rock bream (Oplegnathus fasciatus)
Article Snippet: .. For quantitative real-time PCR, 1 μl of cDNA template, 1 μl of forward and reverse primers, 12.5 μl of SYBR Green, and 9.5 μl of DDW were mixed in a total volume of 25 μl using SYBR Green Master Mix (TaKaRa, Shiga, Japan) according to the manufacturer and incubated at 50 °C for 4 minutes After initial denaturation at 95 °C for 10 min, reaction was carried out 45 times at 95 °C for 20 sec and 60 °C for 1 min. .. The degree of CD2 mRNA expression was compared with the expression level of elongation factor (EF) -1α (forward: 5′- CCCCTGCAGGACGTCTACAA -3′, reverse: 5′- AACACGACCGACGGGTACA -3′) mRNA and three repetitions were performed for each gene for the accuracy of the experiment.

Labeling:

Article Title: The effect of an alternative chromosome 17 probe on fluorescence in situ hybridization for the assessment of HER2 amplification in invasive breast cancer
Article Snippet: The DNA sequence was labeled using the following primers (forward, 5′-GGAATCTGCAAGTGGATATG-3′ and reverse, 5′-CAGAACTACTCTATGAAAAGC-3′). .. The PCR was performed in a volume of 20 µl, including 2 µl cDNA template, 10 µl Taq PCR mix (Takara Biotechnology Co., Ltd.), 1 µl forward and reverse primers (10 µm) and 6 µl nuclease-free water.

Purification:

Article Title: The Asian arowana (Scleropages formosus) genome provides new insights into the evolution of an early lineage of teleosts
Article Snippet: The PCR products were excised, purified and subcloned into the pMD19-T vector for sequencing to confirm whether it was the target sequence. .. Amplification of each sample was performed in triplicate with each reaction well containing 20 μL of a PCR mixture consisting of 1 μL cDNA template, 10 μL SYBR Premix (TaKaRa, Dalian, China), 0.6 μL forward and reverse primer (20 pmol/L), 0.4 μL ROX reference dye, and 8 μL dd H2 O.

Article Title: Differential Effect of ?-radiation-induced Heme Oxygenase-1 Activity in Female and Male C57BL/6 Mice
Article Snippet: After thawing liver samples frozen in liquid nitrogen, RNA was purified from the liver using RNAzol (Tel-Test, Friendswood, U.S.A.), and RNA concentration was spectrophotometrically determined by absorbance at 260 nm. .. Then produced cDNA was amplified by polymerase chain reaction (PCR) in the mixture containing 10 µL cDNA template from RT reaction, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5mM MgCl2 , 0.5mM each of dNTP, 1.0 µM of each primer, and 0.5 U Tag DNA polymerase (Takara, Tokyo, Japan).

Article Title: RNA interference-mediated knockdown of voltage-gated sodium channel (MpNav) gene causes mortality in peach-potato aphid, Myzus persicae
Article Snippet: The reaction mixture for PCR contained 500 ng of the cDNA template, 0.5 µm of forward and reverse primers, 1.75 mM Mg2+ , 0.25 mM of each dNTP (Takara Bio, Japan), 1X PCR buffer, 5U/µl Taq DNA polymerase (Takara Bio) and double-distilled H2 O to make a 25 µl total reaction volume. .. The PCR conditions were 95 °C for 5 min, followed by 35 cycles of 95 °C for 30 s, 55–60 °C for 30 s and 72 °C for 30 s, and an additional final polymerization step of 72 °C for 5 min. PCR products were purified using TIANgel Midi Purification Kit (Tiangen, Beijing, China).

Article Title: Oncogenic Activity of Amplified Miniature Chromosome Maintenance 8 in Human Malignancies
Article Snippet: PCR was performed on the cDNA template from the donor prostate (Clontech) using the following conditions: 94 °C for 1 min, followed by 35 cycles of 94 °C for 30 s, 68 °C for 3 min, and a final 3 min extension step at 68 °C. .. The PCR product was restricted with Nde1 and Sal1 (New England Biolabs, MA), gel purified, and ligated into a similarly digested pGBKT7 vector.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Genome-wide identification of epithelial-mesenchymal transition-associated microRNAs reveals novel targets for glioblastoma therapy
Article Snippet: Total RNA was converted into a cDNA template using PrimeScript™ RT reagent kit (Takara Bio, Inc., Otsu, Japan). .. N-cadherin mRNA level was analyzed by RT-qPCR on the ABI 7300 HT Sequence Detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.) using the SYBR® PrimeScript™ RT-PCR kit (Takara Bio, Inc.).

Article Title: The Impact of Chronic Heat Stress on the Growth, Survival, Feeding, and Differential Gene Expression in the Sea Urchin Strongylocentrotus intermedius
Article Snippet: qRT-PCR Validation Annotated DEGs were validated using quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR). .. Primers used in qRT-PCR analyses were designed by Primer Premier 5.0 ( ). qRT-PCR was performed in a total volume of 16 μL, which consisted of 2 μL of the cDNA template, 8 μL of 2× SYBR Green Master mix (TaKaRa, Japan), 0.3 μL of ROX reference dye II, 4.5 μL of PCR-grade water, and 0.6 μL (10 mM) of each primer.

Article Title: Differential Effect of ?-radiation-induced Heme Oxygenase-1 Activity in Female and Male C57BL/6 Mice
Article Snippet: HO-1 mRNA expression determination Semiquantitative reverse transcriptase polymerase chain reaction (RT-PCR) was used for the mRNA expression level determination. .. Then produced cDNA was amplified by polymerase chain reaction (PCR) in the mixture containing 10 µL cDNA template from RT reaction, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5mM MgCl2 , 0.5mM each of dNTP, 1.0 µM of each primer, and 0.5 U Tag DNA polymerase (Takara, Tokyo, Japan).

Construct:

Article Title: Development and Functional Analysis of Novel Genetic Promoters Using DNA Shuffling, Hybridization and a Combination Thereof
Article Snippet: The cDNA was synthesized using RNA (DNase I treated) isolated from transgenic tobacco plants expressing pKFuasGUS, pKFSuasGUS, pKFcpGUS, pKFScpGUS, pKFGUS, pKFSGUS, pKFuasFScpGUS and pKFSuasFcpGUS promoter construct individually using cDNA synthesis Kit (Fermentas, USA). .. The qRT- PCR for relative expression analysis was performed using the corresponding cDNA template (1∶15 dilution) and SYBR Premix Ex Taq™ II (Perfect Real Time, Takara Bio Inc., Japan) employing Opticon-2 Real-time PCR machine (MJ Research, Bio-Rad; Model; CFD-3220).

Plasmid Preparation:

Article Title: The effect of an alternative chromosome 17 probe on fluorescence in situ hybridization for the assessment of HER2 amplification in invasive breast cancer
Article Snippet: This sequence was synthesized to a pUc-CEP17 plasmid purchased from Biocin Healthcare. .. The PCR was performed in a volume of 20 µl, including 2 µl cDNA template, 10 µl Taq PCR mix (Takara Biotechnology Co., Ltd.), 1 µl forward and reverse primers (10 µm) and 6 µl nuclease-free water.

Article Title: The SBP-Box Gene VpSBP11 from Chinese Wild Vitis Is Involved in Floral Transition and Affects Leaf Development
Article Snippet: A pair of gene-specific primers (VpSBP11- F1 and VpSBP11- R1) ( ) were used to amplify the predicted VpSBP11 ORF from the cDNA template with Taq DNA polymerase (TaKaRa Biotechnology, Dalian, China) and the following cycling program: 94 °C for 3 min, 35 cycles at 94 °C for 30 s, 58 °C for 30 s, 72 °C for 2 min, and extension at 72 °C for 10 min. .. The amplified products were cloned into the pGEM-Teasy vector (Promega) to generate pGEM-Teasy-VpSBP11 and transformed into the E.coli strain DH5α.

Article Title: Overexpression of a SBP-Box Gene (VpSBP16) from Chinese Wild Vitis Species in Arabidopsis Improves Salinity and Drought Stress Tolerance
Article Snippet: A pair of gene-specific primers ( VpSBP16 -F1 and VpSBP16 -R1) ( ) were used to amplify the predicted VpSBP16 ORF from the cDNA template with Taq DNA polymerase (TaKaRa Biotechnology, Dalian, China) and the following cycling program: 94 °C for 3 min, 35 cycles at 94 °C for 30 s, 58 °C for 30 s and 72 °C for 2 min; and extension at 72 °C for 10 min. .. The amplified products were cloned into the pGEM-Teasy vector (Promega, Madison, WI, USA) to generate pGEM-Teasy- VpSBP16 , and transformed into E. coli strain DH5α .

Article Title: The Asian arowana (Scleropages formosus) genome provides new insights into the evolution of an early lineage of teleosts
Article Snippet: The PCR products were excised, purified and subcloned into the pMD19-T vector for sequencing to confirm whether it was the target sequence. .. Amplification of each sample was performed in triplicate with each reaction well containing 20 μL of a PCR mixture consisting of 1 μL cDNA template, 10 μL SYBR Premix (TaKaRa, Dalian, China), 0.6 μL forward and reverse primer (20 pmol/L), 0.4 μL ROX reference dye, and 8 μL dd H2 O.

Article Title: Oncogenic Activity of Amplified Miniature Chromosome Maintenance 8 in Human Malignancies
Article Snippet: Paragraph title: Plasmid construction ... PCR was performed on the cDNA template from the donor prostate (Clontech) using the following conditions: 94 °C for 1 min, followed by 35 cycles of 94 °C for 30 s, 68 °C for 3 min, and a final 3 min extension step at 68 °C.

Software:

Article Title: Development and Functional Analysis of Novel Genetic Promoters Using DNA Shuffling, Hybridization and a Combination Thereof
Article Snippet: The qRT- PCR for relative expression analysis was performed using the corresponding cDNA template (1∶15 dilution) and SYBR Premix Ex Taq™ II (Perfect Real Time, Takara Bio Inc., Japan) employing Opticon-2 Real-time PCR machine (MJ Research, Bio-Rad; Model; CFD-3220). .. The Ct value for each reaction was obtained with the help of the software attached with the machine and fold changes in the transcript levels of each construct (considered for qRT-PCR) were presented.

Article Title: Genome-Wide Analysis of the YABBY Gene Family in Grapevine and Functional Characterization of VvYABBY4
Article Snippet: Each reaction was conducted in triplicate with a final volume of 20 μl, including 1.6-μl primer (1.0 μM), 1.0-μl cDNA template, 10.0-μl SYBR green (TaKaRa, Bio Inc.), and 7.4-μl sterile distilled H2 O. .. Relative expression levels were analyzed using IQ5 software and the normalized expression method ( ).

Article Title: Overexpression of a SBP-Box Gene (VpSBP16) from Chinese Wild Vitis Species in Arabidopsis Improves Salinity and Drought Stress Tolerance
Article Snippet: A pair of gene-specific primers ( VpSBP16 -F1 and VpSBP16 -R1) ( ) were used to amplify the predicted VpSBP16 ORF from the cDNA template with Taq DNA polymerase (TaKaRa Biotechnology, Dalian, China) and the following cycling program: 94 °C for 3 min, 35 cycles at 94 °C for 30 s, 58 °C for 30 s and 72 °C for 2 min; and extension at 72 °C for 10 min. .. The subcellular localization of VpSBP16 was predicted using the Center for Biological Sequence analysis software ( ; ).

Article Title: RNA interference-mediated knockdown of voltage-gated sodium channel (MpNav) gene causes mortality in peach-potato aphid, Myzus persicae
Article Snippet: Primers were chosen based on the results of GeneScripts primer design software ( https://www.genscript.com/tools/pcr-primers-designer ). .. The reaction mixture for PCR contained 500 ng of the cDNA template, 0.5 µm of forward and reverse primers, 1.75 mM Mg2+ , 0.25 mM of each dNTP (Takara Bio, Japan), 1X PCR buffer, 5U/µl Taq DNA polymerase (Takara Bio) and double-distilled H2 O to make a 25 µl total reaction volume.

SYBR Green Assay:

Article Title: Identification and Functional Characterization of a Microtubule-Associated Protein, GhCLASP2, From Upland Cotton (Gossypium hirsutum L.)
Article Snippet: The gene-specific primers used in the study were shown in Supplementary Table . sqPCR was performed using cDNA template and ExTaq DNA Polymerase (Takara) by 28 cycles at an annealing temperature of 58°C. .. The qRT-PCR reactions were conducted using a SYBR Green I Master mixture (Roche, Basel, Switzerland) according to the manufacturer’s protocol on a Light Cycler 480II system (Roche, Switzerland) under conditions of an initial denaturation at 95°C for 2 min followed by 40 cycles of denaturing at 95°C for 15 s, annealing at 58°C for 20 s, and extending at 72°C for 15 s. For each tissue, three biological replicates each with three technical replicates were analyzed.

Article Title: The Impact of Chronic Heat Stress on the Growth, Survival, Feeding, and Differential Gene Expression in the Sea Urchin Strongylocentrotus intermedius
Article Snippet: .. Primers used in qRT-PCR analyses were designed by Primer Premier 5.0 ( ). qRT-PCR was performed in a total volume of 16 μL, which consisted of 2 μL of the cDNA template, 8 μL of 2× SYBR Green Master mix (TaKaRa, Japan), 0.3 μL of ROX reference dye II, 4.5 μL of PCR-grade water, and 0.6 μL (10 mM) of each primer. .. The running program was set as follows: 95°C for 30 s; followed by 40 cycles of 95°C for 5 s and annealing temperature 56°C for 32 s. At the end of reaction, PCR melting curve analysis was conducted to confirm single PCR products.

Article Title: Genome-Wide Analysis of the YABBY Gene Family in Grapevine and Functional Characterization of VvYABBY4
Article Snippet: .. Each reaction was conducted in triplicate with a final volume of 20 μl, including 1.6-μl primer (1.0 μM), 1.0-μl cDNA template, 10.0-μl SYBR green (TaKaRa, Bio Inc.), and 7.4-μl sterile distilled H2 O. .. The PCR amplification profile used was following a previous study ( ).

Article Title: Galectin-3 protects keratinocytes from UVB-induced apoptosis by enhancing AKT activation and suppressing ERK activation
Article Snippet: .. The reaction mixture consisted of 50 ng of cDNA template, 1x SYBR Green PCR master mix (TAKARA, Tokyo, Japan) and 200 nM primer mix (forward and reverse primers combined). .. Cycling parameters were 95°C for 10 min to activate DNA polymerase, then 40 cycles of 95°C for 20 sec and 60°C for 1 min. Primer sets used are as follows: Galectin-1, GAAAAGACAGCAACAACCTGTGCCTAC and GAGGGCTACAGGCTGGCTGGC; Galectin-3, GACAGTCAGCCTTCCCCTTTGAGAG and AGGCACACAGGGCCGGTTTCGG; Galectin-7, GGCACTGTCATGAGAATTCGAGGC and CGGTGGTGGAAGTGGAGATATTCGTC; Galectin-9, GTGATATCCAGCTGACCCACGTGC and ATGATATCAGGGTGGCTCTCCTG; hypoxanthine ribosyltransferase (HPRT), TGGATATGCCCTTGACTATAATGAGTACTTCAG and GTCTGGGGACGCAGCAACTGAC.

Article Title: Expression analysis data of T-cell surface antigen CD2 gene from rock bream (Oplegnathus fasciatus)
Article Snippet: .. For quantitative real-time PCR, 1 μl of cDNA template, 1 μl of forward and reverse primers, 12.5 μl of SYBR Green, and 9.5 μl of DDW were mixed in a total volume of 25 μl using SYBR Green Master Mix (TaKaRa, Shiga, Japan) according to the manufacturer and incubated at 50 °C for 4 minutes After initial denaturation at 95 °C for 10 min, reaction was carried out 45 times at 95 °C for 20 sec and 60 °C for 1 min. .. The degree of CD2 mRNA expression was compared with the expression level of elongation factor (EF) -1α (forward: 5′- CCCCTGCAGGACGTCTACAA -3′, reverse: 5′- AACACGACCGACGGGTACA -3′) mRNA and three repetitions were performed for each gene for the accuracy of the experiment.

RNA Extraction:

Article Title: Arenobufagin Induces Apoptotic Cell Death in Human Non-Small-Cell Lung Cancer Cells via the Noxa-Related Pathway
Article Snippet: Paragraph title: 4.7. RNA Extraction and Reverse-Transcription PCR ... The reaction mix contained: 2.5 µL 10 × Ex Taq Buffer, 2 µL dNTP Mixture, 200 nM forward and reverse primers, 100 ng cDNA template, 0.25 µL TaKaRa Ex Taq and ddH2 O up to 25 µL volume.

Agarose Gel Electrophoresis:

Article Title: Genome-Wide Analysis of the YABBY Gene Family in Grapevine and Functional Characterization of VvYABBY4
Article Snippet: Agarose gel electrophoresis was used to check the integrity of RNA. .. Each reaction was conducted in triplicate with a final volume of 20 μl, including 1.6-μl primer (1.0 μM), 1.0-μl cDNA template, 10.0-μl SYBR green (TaKaRa, Bio Inc.), and 7.4-μl sterile distilled H2 O.

Article Title: Differential Effect of ?-radiation-induced Heme Oxygenase-1 Activity in Female and Male C57BL/6 Mice
Article Snippet: Then produced cDNA was amplified by polymerase chain reaction (PCR) in the mixture containing 10 µL cDNA template from RT reaction, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5mM MgCl2 , 0.5mM each of dNTP, 1.0 µM of each primer, and 0.5 U Tag DNA polymerase (Takara, Tokyo, Japan). .. The PCR products were visualized by electrophoresis on 1% agarose gel in the presence of 0.5 µg/mL ethidium bromide.

Article Title: RNA interference-mediated knockdown of voltage-gated sodium channel (MpNav) gene causes mortality in peach-potato aphid, Myzus persicae
Article Snippet: The reaction mixture for PCR contained 500 ng of the cDNA template, 0.5 µm of forward and reverse primers, 1.75 mM Mg2+ , 0.25 mM of each dNTP (Takara Bio, Japan), 1X PCR buffer, 5U/µl Taq DNA polymerase (Takara Bio) and double-distilled H2 O to make a 25 µl total reaction volume. .. The dsRNA quality was monitored on agarose gel electrophoresis, and the concentration was determined by spectrophotometry (Nano Drop 1000, Thermo Scientific, US). dsRNA products were stored at −80 °C prior to further use.

Electrophoresis:

Article Title: Differential Effect of ?-radiation-induced Heme Oxygenase-1 Activity in Female and Male C57BL/6 Mice
Article Snippet: Then produced cDNA was amplified by polymerase chain reaction (PCR) in the mixture containing 10 µL cDNA template from RT reaction, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5mM MgCl2 , 0.5mM each of dNTP, 1.0 µM of each primer, and 0.5 U Tag DNA polymerase (Takara, Tokyo, Japan). .. The PCR products were visualized by electrophoresis on 1% agarose gel in the presence of 0.5 µg/mL ethidium bromide.

Transgenic Assay:

Article Title: Development and Functional Analysis of Novel Genetic Promoters Using DNA Shuffling, Hybridization and a Combination Thereof
Article Snippet: The cDNA was synthesized using RNA (DNase I treated) isolated from transgenic tobacco plants expressing pKFuasGUS, pKFSuasGUS, pKFcpGUS, pKFScpGUS, pKFGUS, pKFSGUS, pKFuasFScpGUS and pKFSuasFcpGUS promoter construct individually using cDNA synthesis Kit (Fermentas, USA). .. The qRT- PCR for relative expression analysis was performed using the corresponding cDNA template (1∶15 dilution) and SYBR Premix Ex Taq™ II (Perfect Real Time, Takara Bio Inc., Japan) employing Opticon-2 Real-time PCR machine (MJ Research, Bio-Rad; Model; CFD-3220).

Spectrophotometry:

Article Title: Genome-Wide Analysis of the YABBY Gene Family in Grapevine and Functional Characterization of VvYABBY4
Article Snippet: Moreover, total RNA was quantified with Nanodrop8000 Spectrophotometer (Thermo Scientific, Waltham, MA, USA). .. Each reaction was conducted in triplicate with a final volume of 20 μl, including 1.6-μl primer (1.0 μM), 1.0-μl cDNA template, 10.0-μl SYBR green (TaKaRa, Bio Inc.), and 7.4-μl sterile distilled H2 O.

Article Title: RNA interference-mediated knockdown of voltage-gated sodium channel (MpNav) gene causes mortality in peach-potato aphid, Myzus persicae
Article Snippet: The reaction mixture for PCR contained 500 ng of the cDNA template, 0.5 µm of forward and reverse primers, 1.75 mM Mg2+ , 0.25 mM of each dNTP (Takara Bio, Japan), 1X PCR buffer, 5U/µl Taq DNA polymerase (Takara Bio) and double-distilled H2 O to make a 25 µl total reaction volume. .. The dsRNA quality was monitored on agarose gel electrophoresis, and the concentration was determined by spectrophotometry (Nano Drop 1000, Thermo Scientific, US). dsRNA products were stored at −80 °C prior to further use.

Produced:

Article Title: Differential Effect of ?-radiation-induced Heme Oxygenase-1 Activity in Female and Male C57BL/6 Mice
Article Snippet: .. Then produced cDNA was amplified by polymerase chain reaction (PCR) in the mixture containing 10 µL cDNA template from RT reaction, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5mM MgCl2 , 0.5mM each of dNTP, 1.0 µM of each primer, and 0.5 U Tag DNA polymerase (Takara, Tokyo, Japan). .. The oligonucleotide primers used in these experiments are as followings; HO-1 PCR primer (5'-primer 5'-AACAAGCAGAACCCAGTC-3', 3'-primer: 5'-TGTCATCTCCAGAGT-GTTC-3'), β-actin primer (5'-primer: 5'-TGGAATCCTGTGGCATCCATGAAA-3', 3'-primer: 5'-TAAAACGCAGCTCAGTAACAGTCCG-3').

Concentration Assay:

Article Title: Development and Functional Analysis of Novel Genetic Promoters Using DNA Shuffling, Hybridization and a Combination Thereof
Article Snippet: The qRT- PCR for relative expression analysis was performed using the corresponding cDNA template (1∶15 dilution) and SYBR Premix Ex Taq™ II (Perfect Real Time, Takara Bio Inc., Japan) employing Opticon-2 Real-time PCR machine (MJ Research, Bio-Rad; Model; CFD-3220). .. Gene specific primers for GUS and GADPH ( ) were used at a concentration of 0.9 µmolar to get 95% efficiency.

Article Title: Differential Effect of ?-radiation-induced Heme Oxygenase-1 Activity in Female and Male C57BL/6 Mice
Article Snippet: After thawing liver samples frozen in liquid nitrogen, RNA was purified from the liver using RNAzol (Tel-Test, Friendswood, U.S.A.), and RNA concentration was spectrophotometrically determined by absorbance at 260 nm. .. Then produced cDNA was amplified by polymerase chain reaction (PCR) in the mixture containing 10 µL cDNA template from RT reaction, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5mM MgCl2 , 0.5mM each of dNTP, 1.0 µM of each primer, and 0.5 U Tag DNA polymerase (Takara, Tokyo, Japan).

Article Title: RNA interference-mediated knockdown of voltage-gated sodium channel (MpNav) gene causes mortality in peach-potato aphid, Myzus persicae
Article Snippet: The reaction mixture for PCR contained 500 ng of the cDNA template, 0.5 µm of forward and reverse primers, 1.75 mM Mg2+ , 0.25 mM of each dNTP (Takara Bio, Japan), 1X PCR buffer, 5U/µl Taq DNA polymerase (Takara Bio) and double-distilled H2 O to make a 25 µl total reaction volume. .. The dsRNA quality was monitored on agarose gel electrophoresis, and the concentration was determined by spectrophotometry (Nano Drop 1000, Thermo Scientific, US). dsRNA products were stored at −80 °C prior to further use.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    TaKaRa rnase free water
    Rnase Free Water, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase free water/product/TaKaRa
    Average 90 stars, based on 34 article reviews
    Price from $9.99 to $1999.99
    rnase free water - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    TaKaRa one step rna pcr kit
    One Step Rna Pcr Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 94 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/one step rna pcr kit/product/TaKaRa
    Average 90 stars, based on 94 article reviews
    Price from $9.99 to $1999.99
    one step rna pcr kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    TaKaRa primescript reverse transcriptase
    Primescript Reverse Transcriptase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 325 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primescript reverse transcriptase/product/TaKaRa
    Average 90 stars, based on 325 article reviews
    Price from $9.99 to $1999.99
    primescript reverse transcriptase - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    TaKaRa primescript rt master mix
    Primescript Rt Master Mix, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primescript rt master mix/product/TaKaRa
    Average 90 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    primescript rt master mix - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results