Journal: Signal Transduction and Targeted Therapy

Article Title: Cyclin-dependent protein kinases and cell cycle regulation in biology and disease

doi: 10.1038/s41392-024-02080-z

Figure Lengend Snippet: Overview of CDKs-cyclin complexes and their main regulators

Article Snippet: CDK3 (305 amino acids, located at 17q25.1) is a protein predominantly localized in the cytosol, with high expression in the respiratory tract according to the Human Protein Atlas.

Techniques: Phospho-proteomics, Activation Assay, Activity Assay, HAT Assay, Binding Assay

Journal: Signal Transduction and Targeted Therapy

Article Title: Cyclin-dependent protein kinases and cell cycle regulation in biology and disease

doi: 10.1038/s41392-024-02080-z

Figure Lengend Snippet: Cell Cycle Progression via EGFR and Receptor Tyrosine Kinase Signaling . EGFR stimulation promotes the activation of the CycC-CDK3 complex, enabling the cell to exit quiescence (G0) and enter the G1 phase by priming RB phosphorylation. Activation of various Receptor Tyrosine Kinases (RTKs) can similarly promote G1 progression through signal cascades involving RAS-GTP and its downstream RAF/MEK/ERK and PI3K/AKT/mTOR pathways. These signaling cascades lead to the formation and activation of CycD-CDK4/6 complexes and their translocation to the nucleus. In the nucleus, CycD-CDK4/6 complexes further phosphorylate RB. The inhibition of RB allows the accumulation of E2F on DNA, promoting the transcription of genes essential for cell cycle progression and DNA replication. Subsequently, the activation of the CycE-CDK2 complex drives the transition from G1 to S phase by hyper-phosphorylating RB, enabling cell cycle progression independently of growth factor stimuli (bypassing the restriction point). The accumulation of CycA and the displacement of CycE from the CycE-CDK2 complex facilitate the formation of the CycA-CDK2 complex, which drives S phase entry, progression, and DNA synthesis. Following faithful DNA replication, the CycA-CDK1 complex triggers entry into mitosis. This is followed by the formation and activation of the CycB-CDK1 complex, which is necessary for the completion of proper cell division. The roles of activating proteins (such as CAK and CDC25A/B/C) and inhibitory proteins (such as CDK inhibitors, WEE1, and MYT1) on specific cyclin-CDK complexes are indicated by black arrows. Abbreviations used: RTKs Receptor Tyrosine Kinase, CAK complex CDK Activating Kinase complex, CycA cyclin A, CycB cyclin B, CycC cyclin C, CycD cyclin D, CycE cyclin E, CDC25 Cell Division Cycle 25. (Adapted from “Cell Cycle Checkpoints”, “RAS Pathway”, by BioRender.com (2024)

Article Snippet: CDK3 (305 amino acids, located at 17q25.1) is a protein predominantly localized in the cytosol, with high expression in the respiratory tract according to the Human Protein Atlas.

Techniques: Activation Assay, Phospho-proteomics, Translocation Assay, Inhibition, DNA Synthesis

Journal: Signal Transduction and Targeted Therapy

Article Title: Cyclin-dependent protein kinases and cell cycle regulation in biology and disease

doi: 10.1038/s41392-024-02080-z

Figure Lengend Snippet: The Role of CDKs in cancer

Article Snippet: CDK3 (305 amino acids, located at 17q25.1) is a protein predominantly localized in the cytosol, with high expression in the respiratory tract according to the Human Protein Atlas.

Techniques:

Journal: Cancer medicine

Article Title: The expression and role of SUZ12 in lung adenocarcinoma.

doi: 10.1002/cam4.70190

Figure Lengend Snippet: FIGURE 7 The effect of SUZ12 on CDKs and cyclins expression was tested by qRT-PCR and western blotting. sh-SUZ12 decreased CDK3 mRNA (A), CDK2/3 (C), and cyclin D1 (F) protein expression, while increased cyclin E1 protein expression (F), without significantly effected the cyclins mRNA (E). oe-SUZ12 increased CDK3/6 mRNA (B) and CDK3 protein expression (D). *p < 0.05, **p < 0.001.

Article Snippet: The list of primary antibodies: SUZ12 (1 μg/mL, Abcam Cambridge, cat no: ab12073), CDK2 (1:1000; Proteintech, USA, cat. no. 10122- 1- AP), CDK3 (1:2000; Proteintech, USA, cat. no. 55103- 1- AP), CDK6 (1:2000; Proteintech, USA, cat. no. 14052- 1- AP), cyclin D1 (1:5000; Proteintech, USA, cat. no. 26939- 1- AP), cyclin E1 (1:1000; Proteintech, USA, cat. no. 11554- 1- AP), p18 (1:1000, BOSTER China, cat. no. M03299- 1), p19 (1:1000, BOSTER China, cat. no. MA1075), p53 (1:5000; Proteintech, USA, cat. no. 60283- 2- Ig), p- p53 (1:2000; Proteintech, USA, cat. no. 28961- 1- AP), p57 (1:1000, BOSTER China, cat. no. BM4129), Rb (1:1000, BOSTER China, cat. no. BM4500), pRb (1:1000, BOSTER China, cat. no. BM4338), Bcl- 2 (1:1000; Proteintech, USA, cat. no. 26593- 1- AP), Bax (1:2000; Proteintech, USA, cat. no. 50599- 2- lg), Ecadherin (1:5000; Proteintech, USA, cat. no. 20874- 1- AP), N- cadherin (1:3000; Proteintech, USA, cat. no. 22018- 1- AP), vimentin (1:4000; Proteintech, USA, cat. no. 10366- 1- AP), MMP1 (1:1000, BOSTER China, cat. no. A00733- 1), MMP2 (1:500, BOSTER China, cat. no. BM4075), MMP9 (1:1000, BOSTER China, cat. no. PB0709), MMP14 (1:1000, BOSTER China, cat. no. BM4119), TIMP1 (1:1000, Bioss China, cat. no. bs0415R), TIMP2 (1:1000, Bioss China, cat. no. bs- 10395R), TIMP3 (1:1000; Proteintech, USA, cat. no. 10858- 1- AP), ITGB1 (1:1000, BOSTER China, cat. no. BM4308), ITGB3 (1:1000, BOSTER China, cat. no. BA1670), ITGB5 (1:1000, BOSTER China, cat. no. A04201- 1), nm23 (1:1000, BOSTER China, cat. no. BA3787), PD- L1 (1:3000; Proteintech, USA, cat. no. 66248- 1- Ig), and βactin (1:5000; Proteintech, USA, cat. no. 66009- 1- Ig).

Techniques: Expressing, Quantitative RT-PCR, Western Blot

Journal: Cancer Medicine

Article Title: The expression and role of SUZ12 in lung adenocarcinoma

doi: 10.1002/cam4.70190

Figure Lengend Snippet: The effect of SUZ12 on CDKs and cyclins expression was tested by qRT‐PCR and western blotting. sh‐SUZ12 decreased CDK3 mRNA (A), CDK2/3 (C), and cyclin D1 (F) protein expression, while increased cyclin E1 protein expression (F), without significantly effected the cyclins mRNA (E). oe‐SUZ12 increased CDK3/6 mRNA (B) and CDK3 protein expression (D). * p < 0.05, ** p < 0.001.

Article Snippet: The list of primary antibodies: SUZ12 (1 μg/mL, Abcam Cambridge, cat no: ab12073), CDK2 (1:1000; Proteintech, USA, cat. no. 10122‐1‐AP), CDK3 (1:2000; Proteintech, USA, cat. no. 55103‐1‐AP), CDK6 (1:2000; Proteintech, USA, cat. no. 14052‐1‐AP), cyclin D1 (1:5000; Proteintech, USA, cat. no. 26939‐1‐AP), cyclin E1 (1:1000; Proteintech, USA, cat. no. 11554‐1‐AP), p18 (1:1000, BOSTER China, cat. no. M03299‐1), p19 (1:1000, BOSTER China, cat. no. MA1075), p53 (1:5000; Proteintech, USA, cat. no. 60283‐2‐Ig), p‐p53 (1:2000; Proteintech, USA, cat. no. 28961‐1‐AP), p57 (1:1000, BOSTER China, cat. no. BM4129), Rb (1:1000, BOSTER China, cat. no. BM4500), pRb (1:1000, BOSTER China, cat. no. BM4338), Bcl‐2 (1:1000; Proteintech, USA, cat. no. 26593‐1‐AP), Bax (1:2000; Proteintech, USA, cat. no. 50599‐2‐lg), E‐cadherin (1:5000; Proteintech, USA, cat. no. 20874‐1‐AP), N‐cadherin (1:3000; Proteintech, USA, cat. no. 22018‐1‐AP), vimentin (1:4000; Proteintech, USA, cat. no. 10366‐1‐AP), MMP1 (1:1000, BOSTER China, cat. no. A00733‐1), MMP2 (1:500, BOSTER China, cat. no. BM4075), MMP9 (1:1000, BOSTER China, cat. no. PB0709), MMP14 (1:1000, BOSTER China, cat. no. BM4119), TIMP1 (1:1000, Bioss China, cat. no. bs‐0415R), TIMP2 (1:1000, Bioss China, cat. no. bs‐10395R), TIMP3 (1:1000; Proteintech, USA, cat. no. 10858‐1‐AP), ITGB1 (1:1000, BOSTER China, cat. no. BM4308), ITGB3 (1:1000, BOSTER China, cat. no. BA1670), ITGB5 (1:1000, BOSTER China, cat. no. A04201‐1), nm23 (1:1000, BOSTER China, cat. no. BA3787), PD‐L1 (1:3000; Proteintech, USA, cat. no. 66248‐1‐Ig), and β‐actin (1:5000; Proteintech, USA, cat. no. 66009‐1‐Ig).

Techniques: Expressing, Quantitative RT-PCR, Western Blot

Journal: Molecular and cellular biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway.

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: Figure 8 Proposed model for PTP1B regulation of cell cycle. PTP1B dephosphorylates and activates Cdk3, which in turn phosphorylates Rb, favoring its dissociation from E2F and promoting the expression of genes needed for the progression to S phase.

Article Snippet: Then, cells were blocked with 40 lL of blocking solution in a humidity chamber at 37 C for 1 h, and incubated with the primary antibodies: polyclonal rabbit antibody against PTP1B (2mg/mL; #5311; Cell Signaling Technology, Boston, MA, USA) and monoclonal mouse antibody against Cdk3 (2mg/mL; sc-81836; Santa Cruz Biotechnology, Dallas, TX, USA) at 4 C overnight.

Techniques: Expressing

Journal: Molecular and cellular biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway.

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: Figure 8 Proposed model for PTP1B regulation of cell cycle. PTP1B dephosphorylates and activates Cdk3, which in turn phosphorylates Rb, favoring its dissociation from E2F and promoting the expression of genes needed for the progression to S phase.

Article Snippet: The primer sequences for mutagenesis were Cdk3AF Fwd: 50 aagatcggagagggcgcctttggggtggtgtacaa 30 and Cdk3AF Rev: 50 ttgtacaccaccccaaaggcgccctctccgatctt 30 . siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA).

Techniques: Expressing

Journal: Molecular and Cellular Biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: Schematic illustration of the SILAC-based quantitative phosphoproteomic approach. (A) Representative Western blot of Ptp1b +/+ and Ptp1b −/− cells. (B) Ptp1b +/+ and Ptp1b −/− cells were cultured in “light” (red) or “heavy” (blue) medium and stimulated with EGF for 15 min. After lysis, the samples were mixed and incubated with antiphosphotyrosine antibodies for enrichment of tyrosine-phosphorylated proteins. Then, the phosphoprotein fraction was digested with trypsin, and phosphopeptides were enriched again with TiO 2 beads. Phosphopeptides were analyzed by LC-MS/MS. (C) Proteins identified in this assay were classified according to their cellular function.

Article Snippet: The primer sequences for mutagenesis were Cdk3 AF Fwd: 5′ aagatcggagagggc g cct t tggggtggtgtacaa 3′ and Cdk3 AF Rev: 5′ ttgtacaccacccca a agg c gccctctccgatctt 3′. siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA).

Techniques: Multiplex sample analysis, Western Blot, Cell Culture, Lysis, Incubation, Liquid Chromatography with Mass Spectroscopy, Cell Function Assay

Journal: Molecular and Cellular Biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: Predicted structure of PTP1B in complex with some of the putative substrates identified by SILAC-based phosphoproteomics. (A) Visualization of the complex of Cdk3 (yellow) and the catalytic domain of PTP1B (grey). The catalytic residue Cys215 of PTP1B and pTyr15 of Cdk are indicated in green and red, respectively. (B) Closer view of the PTP1B-Cdk3 interaction. The distance between pTyr15 of Cdk3 and Cys215 of PTP1B is indicated. (C) Visualization of the complex of IR β (yellow) and PTP1B (grey). The catalytic residue Cys215 indicated in green is close to IR β pTyr1146 indicated in red. (D) Closer view of the PTP1B-IR β interaction. The distance between Cdk3 pTyr1146 and PTP1B Cys215 is indicated. (E) Visualization of the complex of DOK1 (yellow) and PTP1B (grey). The catalytic residue Cys215 indicated in green is close to DOK1 pTyr362 indicated in red. (F) Closer view of the PTP1B-DOK1 interaction. The distance between DOK1 pTyr362 and PTP1B Cys215 is indicated.(G) Visualization of the complex of EphA (yellow) and PTP1B (gray). The catalytic residue Cys215 indicated in green is close to EphA pTyr205 indicated in red. (F) Closer view of the PTP1B-EphA interaction. The distance between EphA pTyr205 and PTP1B Cys215 is indicated.

Article Snippet: The primer sequences for mutagenesis were Cdk3 AF Fwd: 5′ aagatcggagagggc g cct t tggggtggtgtacaa 3′ and Cdk3 AF Rev: 5′ ttgtacaccacccca a agg c gccctctccgatctt 3′. siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA).

Techniques: Multiplex sample analysis, Phospho-proteomics, Residue

Journal: Molecular and Cellular Biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: Minimal distance from the catalytic residues on PTP1B’s phosphatase domain to the phosphorous atom of its substrates

Article Snippet: The primer sequences for mutagenesis were Cdk3 AF Fwd: 5′ aagatcggagagggc g cct t tggggtggtgtacaa 3′ and Cdk3 AF Rev: 5′ ttgtacaccacccca a agg c gccctctccgatctt 3′. siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA).

Techniques: Ligand Binding Assay

Journal: Molecular and Cellular Biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: PTP1B dephosphorylates a Cdk3 derived peptide in vitro and both proteins interact in GB cells. (A) The in vitro activity of PTP1B against a phosphopeptide corresponding to residues 9-21 of Cdk3 (KIGEGT pY GVVYKA) was determined by using a malachite-green based assay. An IR β phosphopeptide (TRDI pY ETDYYRK) was used as positive control and the nonphosphorylated peptides of Cdk3 and IR β were used as negative controls. Each assay was independently repeated with four replicates and the nmol of phosphate released were calculated. Data are presented as means ± SE. (B). Assessment of Cdk3 activity in Ptp1b +/+ and Ptp1b −/− MEFs. Cell lysates were subjected to Western blot with anti-PTP1B, anti-Cdk3 or anti-phospho Cdk3 antibodies. GAPDH was used as loading control. (C) Co-immunoprecipitation of ectopically expressed wild-type or trapping mutant PTP1B and Cdk3. Cell lysates of transfected cells incubated with or without 1 mM of sodium orthovanadate were subjected to immunoprecipitation with anti-myc or isotype control IgG antibodies and the presence of Cdk3 in the complex was assessed with anti-HA antibodies. The presence of PTP1B and Cdk3 in cell extracts prior to immunoprecipitation was verified using specific antibodies (input). (D) Co-immunoprecipitation of endogenous PTP1B and Cdk3. LN229, U87-MG and U251 cell lysates were subjected to immunoprecipitation with anti-PTP1B or isotype control IgG antibodies and the presence of Cdk3 in the complex was assessed with anti-Cdk3 antibodies. The presence of PTP1B and Cdk3 in cell extracts prior to immunoprecipitation was verified using specific antibodies (input). (E) The physical interaction between endogenously expressed PTP1B and Cdk3 in LN229, U87-MG and U251 GB cells was determined using proximity ligation assays. The figure shows representative confocal microscopy images in which PTP1B-Cdk3 interactions appear as individual fluorescent red dots (lower panels). Anti-mouse and anti-rabbit isotype IgG antibodies were used as negative controls (upper panels).

Article Snippet: The primer sequences for mutagenesis were Cdk3 AF Fwd: 5′ aagatcggagagggc g cct t tggggtggtgtacaa 3′ and Cdk3 AF Rev: 5′ ttgtacaccacccca a agg c gccctctccgatctt 3′. siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA).

Techniques: Derivative Assay, In Vitro, Activity Assay, Phospho-proteomics, Malachite Green Assay, Positive Control, Western Blot, Control, Immunoprecipitation, Mutagenesis, Transfection, Incubation, Ligation, Confocal Microscopy

Journal: Molecular and Cellular Biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: PTP1B and Cdk3 depletion impairs cell proliferation. (A) GB cells were transfected with siRNAs targeting PTP1B or Cdk3, and the expression of both proteins was assessed by immunoblot. GAPDH was used as loading control. (B) GB cells were synchronized at G0 by serum deprivation and incubated 3 h with vehicle, claramine 2 µM, trodusquemine 2 µM, or transfected with nontargeting siRNAs or siRNAs targeting PTP1B or Cdk3. Cells were counted every 24 h. Proliferation of LN229, U87-MG and U251 cells is represented as mean ± SE of three independent experiments. (C) Ptp1b +/+ and Ptp1b −/− MEFs were synchronized at G0 by serum deprivation and incubated 3 h with vehicle, claramine 2 µM, trodusquemine 2 µM. Cells were counted every 24 h. Proliferation of Ptp1b +/+ and Ptp1b −/− MEFs is represented as mean ± SE of three independent experiments.

Article Snippet: The primer sequences for mutagenesis were Cdk3 AF Fwd: 5′ aagatcggagagggc g cct t tggggtggtgtacaa 3′ and Cdk3 AF Rev: 5′ ttgtacaccacccca a agg c gccctctccgatctt 3′. siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA).

Techniques: Transfection, Expressing, Western Blot, Control, Incubation

Journal: Molecular and Cellular Biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: PTP1B reduced activity impairs Cdk3 activation and induces cell cycle arrest in human GB cells. GB cells were synchronized at G0 by serum deprivation for 48 h and incubated 3 h with vehicle (A), claramine 2 µM (B), or trodusquemine 2 µM. Cell cycle arrest was released by the addition of 10% FBS and cells were collected at the indicated times. The activity of Cdk3 was assessed by immunoblot. GAPDH was used as loading control. (D) GB cells were synchronized at G0 and incubated 3 h with vehicle, claramine 2 µM or trodusquemine 2 µM as previously mentioned, or transfected with nontargeting siRNAs or siRNAs targeting PTP1B or Cdk3. Cell cycle arrest was released by the addition of 10% FBS, cells were fixed at indicated time points and stained with propidium iodide. Quantification of the percentage of cells at each phase is represented. Statistical differences between control and experimental groups of cells are indicated (* P < 0.05). Data are representative of three independent experiments.

Article Snippet: The primer sequences for mutagenesis were Cdk3 AF Fwd: 5′ aagatcggagagggc g cct t tggggtggtgtacaa 3′ and Cdk3 AF Rev: 5′ ttgtacaccacccca a agg c gccctctccgatctt 3′. siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA).

Techniques: Activity Assay, Activation Assay, Incubation, Western Blot, Control, Transfection, Staining

Journal: Molecular and Cellular Biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: PTP1B reduced activity negatively affects Cdk3/Rb/E2F signaling in human GB cells. (A) The activities of Cdk3 and Rb in GB cells treated with vehicle, claramine 2 µM or trodusquemine 2 µM were assessed by immunoblot using total and phospho-specific antibodies. (B) The activities of Cdk3 and Rb in GB cells transfected with siRNAs targeting PTP1B were assessed by immunoblot using total and phospho-specific antibodies. (C) The expression levels of the E2F target genes: Cdk1, Cyclin A, and Cyclin E1 were assessed by RT-qPCR. All data were normalized to control GAPDH. Fold changes were calculated using the ΔCt method (2 -ΔΔCt ). Data are representative of three independent experiments.

Article Snippet: The primer sequences for mutagenesis were Cdk3 AF Fwd: 5′ aagatcggagagggc g cct t tggggtggtgtacaa 3′ and Cdk3 AF Rev: 5′ ttgtacaccacccca a agg c gccctctccgatctt 3′. siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA).

Techniques: Activity Assay, Western Blot, Transfection, Expressing, Quantitative RT-PCR, Control

Journal: Molecular and Cellular Biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: Activated Cdk3 bypasses requirement for PTP1B for proliferation and cell cycle progression. (A) GB cells were transfected with a plasmid encoding a constitutively active Cdk3 mutant. The presence of Cdk3 AF in cell extracts was verified by Western blot using anti-HA antibodies. (B) GB cells were mock transfected or transfected with a plasmid encoding a constitutively active Cdk3 mutant and incubated 3 h with vehicle, claramine 2 µM or trodusquemine 2 µM. Cells were counted every 24 h. Proliferation of LN229, U87-MG and U251 cells is represented as mean ± SE of three independent experiments. (C) GB cells were mock transfected or transfected with a plasmid encoding a constitutively active Cdk3 mutant, synchronized at G0 and incubated 3 h with vehicle, claramine 2 µM or trodusquemine 2 µM as previously described. Cell cycle arrest was released by the addition of 10% FBS, cells were fixed at indicated time points and stained with propidium iodide. Quantification of the percentage of cells at each phase is represented in the bar graphics. Statistical differences between control and experimental groups of cells are indicated (* P < 0.05). Data are representative of three independent experiments. (D) GB cells were mock transfected or transfected with a plasmid encoding a constitutively active Cdk3 mutant, synchronized at G0 and incubated 3 h with vehicle, claramine 2 µM or trodusquemine 2 µM as previously mentioned. Cell cycle arrest was released by the addition of 10% FBS. The expression levels of the E2F target genes: Cdk1, cyclin A, and cyclin E1 were assessed by RT-qPCR. All data were normalized to control GAPDH. Fold changes were calculated using the ΔCt method (2 -ΔΔCt ). Data are representative of three independent experiments.

Article Snippet: The primer sequences for mutagenesis were Cdk3 AF Fwd: 5′ aagatcggagagggc g cct t tggggtggtgtacaa 3′ and Cdk3 AF Rev: 5′ ttgtacaccacccca a agg c gccctctccgatctt 3′. siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA).

Techniques: Transfection, Plasmid Preparation, Mutagenesis, Western Blot, Incubation, Staining, Control, Expressing, Quantitative RT-PCR

Journal: Molecular and Cellular Biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: Proposed model for PTP1B regulation of cell cycle. PTP1B dephosphorylates and activates Cdk3, which in turn phosphorylates Rb, favoring its dissociation from E2F and promoting the expression of genes needed for the progression to S phase.

Article Snippet: The primer sequences for mutagenesis were Cdk3 AF Fwd: 5′ aagatcggagagggc g cct t tggggtggtgtacaa 3′ and Cdk3 AF Rev: 5′ ttgtacaccacccca a agg c gccctctccgatctt 3′. siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA).

Techniques: Expressing

Journal: Molecular and Cellular Biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: Identification of cell cycle related substrates of PTP1B

Article Snippet: The primer sequences for mutagenesis were Cdk3 AF Fwd: 5′ aagatcggagagggc g cct t tggggtggtgtacaa 3′ and Cdk3 AF Rev: 5′ ttgtacaccacccca a agg c gccctctccgatctt 3′. siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA).

Techniques: Sequencing

Journal: Molecular and Cellular Biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: Predicted structure of PTP1B in complex with some of the putative substrates identified by SILAC-based phosphoproteomics. (A) Visualization of the complex of Cdk3 (yellow) and the catalytic domain of PTP1B (grey). The catalytic residue Cys215 of PTP1B and pTyr15 of Cdk are indicated in green and red, respectively. (B) Closer view of the PTP1B-Cdk3 interaction. The distance between pTyr15 of Cdk3 and Cys215 of PTP1B is indicated. (C) Visualization of the complex of IR β (yellow) and PTP1B (grey). The catalytic residue Cys215 indicated in green is close to IR β pTyr1146 indicated in red. (D) Closer view of the PTP1B-IR β interaction. The distance between Cdk3 pTyr1146 and PTP1B Cys215 is indicated. (E) Visualization of the complex of DOK1 (yellow) and PTP1B (grey). The catalytic residue Cys215 indicated in green is close to DOK1 pTyr362 indicated in red. (F) Closer view of the PTP1B-DOK1 interaction. The distance between DOK1 pTyr362 and PTP1B Cys215 is indicated.(G) Visualization of the complex of EphA (yellow) and PTP1B (gray). The catalytic residue Cys215 indicated in green is close to EphA pTyr205 indicated in red. (F) Closer view of the PTP1B-EphA interaction. The distance between EphA pTyr205 and PTP1B Cys215 is indicated.

Article Snippet: The primer sequences for mutagenesis were Cdk3 AF Fwd: 5′ aagatcggagagggc g cct t tggggtggtgtacaa 3′ and Cdk3 AF Rev: 5′ ttgtacaccacccca a agg c gccctctccgatctt 3′. siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA).

Techniques: Multiplex sample analysis, Phospho-proteomics, Residue

Journal: Molecular and Cellular Biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: Minimal distance from the catalytic residues on PTP1B’s phosphatase domain to the phosphorous atom of its substrates

Article Snippet: The primer sequences for mutagenesis were Cdk3 AF Fwd: 5′ aagatcggagagggc g cct t tggggtggtgtacaa 3′ and Cdk3 AF Rev: 5′ ttgtacaccacccca a agg c gccctctccgatctt 3′. siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA).

Techniques: Ligand Binding Assay

Journal: Molecular and Cellular Biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: PTP1B dephosphorylates a Cdk3 derived peptide in vitro and both proteins interact in GB cells. (A) The in vitro activity of PTP1B against a phosphopeptide corresponding to residues 9-21 of Cdk3 (KIGEGT pY GVVYKA) was determined by using a malachite-green based assay. An IR β phosphopeptide (TRDI pY ETDYYRK) was used as positive control and the nonphosphorylated peptides of Cdk3 and IR β were used as negative controls. Each assay was independently repeated with four replicates and the nmol of phosphate released were calculated. Data are presented as means ± SE. (B). Assessment of Cdk3 activity in Ptp1b +/+ and Ptp1b −/− MEFs. Cell lysates were subjected to Western blot with anti-PTP1B, anti-Cdk3 or anti-phospho Cdk3 antibodies. GAPDH was used as loading control. (C) Co-immunoprecipitation of ectopically expressed wild-type or trapping mutant PTP1B and Cdk3. Cell lysates of transfected cells incubated with or without 1 mM of sodium orthovanadate were subjected to immunoprecipitation with anti-myc or isotype control IgG antibodies and the presence of Cdk3 in the complex was assessed with anti-HA antibodies. The presence of PTP1B and Cdk3 in cell extracts prior to immunoprecipitation was verified using specific antibodies (input). (D) Co-immunoprecipitation of endogenous PTP1B and Cdk3. LN229, U87-MG and U251 cell lysates were subjected to immunoprecipitation with anti-PTP1B or isotype control IgG antibodies and the presence of Cdk3 in the complex was assessed with anti-Cdk3 antibodies. The presence of PTP1B and Cdk3 in cell extracts prior to immunoprecipitation was verified using specific antibodies (input). (E) The physical interaction between endogenously expressed PTP1B and Cdk3 in LN229, U87-MG and U251 GB cells was determined using proximity ligation assays. The figure shows representative confocal microscopy images in which PTP1B-Cdk3 interactions appear as individual fluorescent red dots (lower panels). Anti-mouse and anti-rabbit isotype IgG antibodies were used as negative controls (upper panels).

Article Snippet: The primer sequences for mutagenesis were Cdk3 AF Fwd: 5′ aagatcggagagggc g cct t tggggtggtgtacaa 3′ and Cdk3 AF Rev: 5′ ttgtacaccacccca a agg c gccctctccgatctt 3′. siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA).

Techniques: Derivative Assay, In Vitro, Activity Assay, Phospho-proteomics, Malachite Green Assay, Positive Control, Western Blot, Control, Immunoprecipitation, Mutagenesis, Transfection, Incubation, Ligation, Confocal Microscopy

Journal: Molecular and Cellular Biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: PTP1B and Cdk3 depletion impairs cell proliferation. (A) GB cells were transfected with siRNAs targeting PTP1B or Cdk3, and the expression of both proteins was assessed by immunoblot. GAPDH was used as loading control. (B) GB cells were synchronized at G0 by serum deprivation and incubated 3 h with vehicle, claramine 2 µM, trodusquemine 2 µM, or transfected with nontargeting siRNAs or siRNAs targeting PTP1B or Cdk3. Cells were counted every 24 h. Proliferation of LN229, U87-MG and U251 cells is represented as mean ± SE of three independent experiments. (C) Ptp1b +/+ and Ptp1b −/− MEFs were synchronized at G0 by serum deprivation and incubated 3 h with vehicle, claramine 2 µM, trodusquemine 2 µM. Cells were counted every 24 h. Proliferation of Ptp1b +/+ and Ptp1b −/− MEFs is represented as mean ± SE of three independent experiments.

Article Snippet: The primer sequences for mutagenesis were Cdk3 AF Fwd: 5′ aagatcggagagggc g cct t tggggtggtgtacaa 3′ and Cdk3 AF Rev: 5′ ttgtacaccacccca a agg c gccctctccgatctt 3′. siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA).

Techniques: Transfection, Expressing, Western Blot, Control, Incubation

Journal: Molecular and Cellular Biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: PTP1B reduced activity impairs Cdk3 activation and induces cell cycle arrest in human GB cells. GB cells were synchronized at G0 by serum deprivation for 48 h and incubated 3 h with vehicle (A), claramine 2 µM (B), or trodusquemine 2 µM. Cell cycle arrest was released by the addition of 10% FBS and cells were collected at the indicated times. The activity of Cdk3 was assessed by immunoblot. GAPDH was used as loading control. (D) GB cells were synchronized at G0 and incubated 3 h with vehicle, claramine 2 µM or trodusquemine 2 µM as previously mentioned, or transfected with nontargeting siRNAs or siRNAs targeting PTP1B or Cdk3. Cell cycle arrest was released by the addition of 10% FBS, cells were fixed at indicated time points and stained with propidium iodide. Quantification of the percentage of cells at each phase is represented. Statistical differences between control and experimental groups of cells are indicated (* P < 0.05). Data are representative of three independent experiments.

Article Snippet: The primer sequences for mutagenesis were Cdk3 AF Fwd: 5′ aagatcggagagggc g cct t tggggtggtgtacaa 3′ and Cdk3 AF Rev: 5′ ttgtacaccacccca a agg c gccctctccgatctt 3′. siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA).

Techniques: Activity Assay, Activation Assay, Incubation, Western Blot, Control, Transfection, Staining

Journal: Molecular and Cellular Biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: PTP1B reduced activity negatively affects Cdk3/Rb/E2F signaling in human GB cells. (A) The activities of Cdk3 and Rb in GB cells treated with vehicle, claramine 2 µM or trodusquemine 2 µM were assessed by immunoblot using total and phospho-specific antibodies. (B) The activities of Cdk3 and Rb in GB cells transfected with siRNAs targeting PTP1B were assessed by immunoblot using total and phospho-specific antibodies. (C) The expression levels of the E2F target genes: Cdk1, Cyclin A, and Cyclin E1 were assessed by RT-qPCR. All data were normalized to control GAPDH. Fold changes were calculated using the ΔCt method (2 -ΔΔCt ). Data are representative of three independent experiments.

Article Snippet: The primer sequences for mutagenesis were Cdk3 AF Fwd: 5′ aagatcggagagggc g cct t tggggtggtgtacaa 3′ and Cdk3 AF Rev: 5′ ttgtacaccacccca a agg c gccctctccgatctt 3′. siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA).

Techniques: Activity Assay, Western Blot, Transfection, Expressing, Quantitative RT-PCR, Control

Journal: Molecular and Cellular Biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: Activated Cdk3 bypasses requirement for PTP1B for proliferation and cell cycle progression. (A) GB cells were transfected with a plasmid encoding a constitutively active Cdk3 mutant. The presence of Cdk3 AF in cell extracts was verified by Western blot using anti-HA antibodies. (B) GB cells were mock transfected or transfected with a plasmid encoding a constitutively active Cdk3 mutant and incubated 3 h with vehicle, claramine 2 µM or trodusquemine 2 µM. Cells were counted every 24 h. Proliferation of LN229, U87-MG and U251 cells is represented as mean ± SE of three independent experiments. (C) GB cells were mock transfected or transfected with a plasmid encoding a constitutively active Cdk3 mutant, synchronized at G0 and incubated 3 h with vehicle, claramine 2 µM or trodusquemine 2 µM as previously described. Cell cycle arrest was released by the addition of 10% FBS, cells were fixed at indicated time points and stained with propidium iodide. Quantification of the percentage of cells at each phase is represented in the bar graphics. Statistical differences between control and experimental groups of cells are indicated (* P < 0.05). Data are representative of three independent experiments. (D) GB cells were mock transfected or transfected with a plasmid encoding a constitutively active Cdk3 mutant, synchronized at G0 and incubated 3 h with vehicle, claramine 2 µM or trodusquemine 2 µM as previously mentioned. Cell cycle arrest was released by the addition of 10% FBS. The expression levels of the E2F target genes: Cdk1, cyclin A, and cyclin E1 were assessed by RT-qPCR. All data were normalized to control GAPDH. Fold changes were calculated using the ΔCt method (2 -ΔΔCt ). Data are representative of three independent experiments.

Article Snippet: The primer sequences for mutagenesis were Cdk3 AF Fwd: 5′ aagatcggagagggc g cct t tggggtggtgtacaa 3′ and Cdk3 AF Rev: 5′ ttgtacaccacccca a agg c gccctctccgatctt 3′. siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA).

Techniques: Transfection, Plasmid Preparation, Mutagenesis, Western Blot, Incubation, Staining, Control, Expressing, Quantitative RT-PCR

Journal: Molecular and Cellular Biology

Article Title: A PTP1B-Cdk3 Signaling Axis Promotes Cell Cycle Progression of Human Glioblastoma Cells through an Rb-E2F Dependent Pathway

doi: 10.1080/10985549.2023.2273193

Figure Lengend Snippet: Proposed model for PTP1B regulation of cell cycle. PTP1B dephosphorylates and activates Cdk3, which in turn phosphorylates Rb, favoring its dissociation from E2F and promoting the expression of genes needed for the progression to S phase.

Article Snippet: The primer sequences for mutagenesis were Cdk3 AF Fwd: 5′ aagatcggagagggc g cct t tggggtggtgtacaa 3′ and Cdk3 AF Rev: 5′ ttgtacaccacccca a agg c gccctctccgatctt 3′. siRNAs targeting human PTP1B (sc-36328) and Cdk3 (sc-37578) were obtained from Santa Cruz (Dallas, TX, USA).

Techniques: Expressing