cas9 protein  (Integrated DNA Technologies)


Bioz Verified Symbol Integrated DNA Technologies is a verified supplier
Bioz Manufacturer Symbol Integrated DNA Technologies manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    tracrRNA
    Description:
    Universal 67mer tracrRNA that contains proprietary chemical modifications conferring increased nuclease resistance Hybridizes to crRNA to activate the Cas9 enzyme
    Catalog Number:
    1072532
    Price:
    None
    Category:
    CRISPR
    Buy from Supplier


    Structured Review

    Integrated DNA Technologies cas9 protein
    Selection of dual crRNA protospacer sequences. (A) Schematic diagram of pksP coding sequence and the flanking regions that are targeted by dual in vitro -assembled <t>Cas9</t> RNPs. Designing the protospacers is described in Results. (B and C) Sequence alignment of pksP upstream (B) and downstream (C) regions of three distinct genetic backgrounds of A. fumigatus . The consensus sequence (highlighted in orange) was manually generated based on sequence alignment. The 5′ crRNA and 3′ crRNA protospacer sequences are marked by red open boxes. The protospacer-adjacent motif (PAM) sequences are marked by blue open boxes. Start and stop codons are highlighted in gray. The additional adenine in the pksP downstream region of the Δ akuB strain and the clinical isolate DI15-102 is shown in red font. Cas9 DSB sites (i.e., 3 nucleotides upstream of the PAM site [ 1 , 9 , 57 ]) are marked by a vertical line in the sequence. The sequences of the 35-bp and 50-bp regions that are used for microhomology-mediated integration are marked by a line above the sequence.
    Universal 67mer tracrRNA that contains proprietary chemical modifications conferring increased nuclease resistance Hybridizes to crRNA to activate the Cas9 enzyme
    https://www.bioz.com/result/cas9 protein/product/Integrated DNA Technologies
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cas9 protein - by Bioz Stars, 2021-08
    99/100 stars

    Images

    1) Product Images from "A Simple and Universal System for Gene Manipulation in Aspergillus fumigatus: In Vitro-Assembled Cas9-Guide RNA Ribonucleoproteins Coupled with Microhomology Repair Templates"

    Article Title: A Simple and Universal System for Gene Manipulation in Aspergillus fumigatus: In Vitro-Assembled Cas9-Guide RNA Ribonucleoproteins Coupled with Microhomology Repair Templates

    Journal: mSphere

    doi: 10.1128/mSphere.00446-17

    Selection of dual crRNA protospacer sequences. (A) Schematic diagram of pksP coding sequence and the flanking regions that are targeted by dual in vitro -assembled Cas9 RNPs. Designing the protospacers is described in Results. (B and C) Sequence alignment of pksP upstream (B) and downstream (C) regions of three distinct genetic backgrounds of A. fumigatus . The consensus sequence (highlighted in orange) was manually generated based on sequence alignment. The 5′ crRNA and 3′ crRNA protospacer sequences are marked by red open boxes. The protospacer-adjacent motif (PAM) sequences are marked by blue open boxes. Start and stop codons are highlighted in gray. The additional adenine in the pksP downstream region of the Δ akuB strain and the clinical isolate DI15-102 is shown in red font. Cas9 DSB sites (i.e., 3 nucleotides upstream of the PAM site [ 1 , 9 , 57 ]) are marked by a vertical line in the sequence. The sequences of the 35-bp and 50-bp regions that are used for microhomology-mediated integration are marked by a line above the sequence.
    Figure Legend Snippet: Selection of dual crRNA protospacer sequences. (A) Schematic diagram of pksP coding sequence and the flanking regions that are targeted by dual in vitro -assembled Cas9 RNPs. Designing the protospacers is described in Results. (B and C) Sequence alignment of pksP upstream (B) and downstream (C) regions of three distinct genetic backgrounds of A. fumigatus . The consensus sequence (highlighted in orange) was manually generated based on sequence alignment. The 5′ crRNA and 3′ crRNA protospacer sequences are marked by red open boxes. The protospacer-adjacent motif (PAM) sequences are marked by blue open boxes. Start and stop codons are highlighted in gray. The additional adenine in the pksP downstream region of the Δ akuB strain and the clinical isolate DI15-102 is shown in red font. Cas9 DSB sites (i.e., 3 nucleotides upstream of the PAM site [ 1 , 9 , 57 ]) are marked by a vertical line in the sequence. The sequences of the 35-bp and 50-bp regions that are used for microhomology-mediated integration are marked by a line above the sequence.

    Techniques Used: Selection, Sequencing, In Vitro, Generated

    High efficiency of gene deletion in all tested genetic backgrounds of A. fumigatus . In vitro -assembled Cas9 RNPs coupled with microhomology-mediated integration of the HygR cassette were tested in Δ akuB (A), Af293 (B), and DI15-102 (C) strains. (Above) Representative transformation plates are shown for each strain using 2 µg of the HygR repair template that is flanked by 35-bp microhomology arms. (Below) The assessment of pksP deletion efficiency across different strains is plotted as the number of Δ pksP mutants out of the total number of transformation colonies. Deletion efficiencies were assessed based on the color of conidia. The Δ pksP mutant produces white colonies, while ectopic integrations result in green colonies. Deletion efficiencies represent the average from at least three independent transformations. Error bars represent the standard deviation calculated for each combination of strain, the size of HygR microhomology arms, and concentration of the HygR repair template for all experimental replicates.
    Figure Legend Snippet: High efficiency of gene deletion in all tested genetic backgrounds of A. fumigatus . In vitro -assembled Cas9 RNPs coupled with microhomology-mediated integration of the HygR cassette were tested in Δ akuB (A), Af293 (B), and DI15-102 (C) strains. (Above) Representative transformation plates are shown for each strain using 2 µg of the HygR repair template that is flanked by 35-bp microhomology arms. (Below) The assessment of pksP deletion efficiency across different strains is plotted as the number of Δ pksP mutants out of the total number of transformation colonies. Deletion efficiencies were assessed based on the color of conidia. The Δ pksP mutant produces white colonies, while ectopic integrations result in green colonies. Deletion efficiencies represent the average from at least three independent transformations. Error bars represent the standard deviation calculated for each combination of strain, the size of HygR microhomology arms, and concentration of the HygR repair template for all experimental replicates.

    Techniques Used: In Vitro, Transformation Assay, Mutagenesis, Standard Deviation, Concentration Assay

    Southern blot analysis of Δ pksP mutant generated in the Af293 background. (A) Schematic representation of the genomic locus of the Af293 and Δ pksP strains. Deletion of the pksP gene was carried out using the HygR cassette. The cleavage sites of the dual in vitro -assembled Cas9 RNPs are marked by thick vertical lines. XhoI cutting sites are indicated in the pksP locus of the wild-type and Δ pksP strains. (B) Southern blot analysis of 6 arbitrarily selected colonies after digesting genomic DNA with the XhoI restriction enzyme. The wild type (WT) produced a 1.8-kb band that matches the expected wild-type banding pattern. Lanes 1, 2, 4, 5, and 6 displayed a 3.8-kb band which matches the expected pksP deletion banding pattern. The colony in lane 3 displayed a 7.6-kb band, likely containing a tandem integration of the HygR repair template at the pksP locus.
    Figure Legend Snippet: Southern blot analysis of Δ pksP mutant generated in the Af293 background. (A) Schematic representation of the genomic locus of the Af293 and Δ pksP strains. Deletion of the pksP gene was carried out using the HygR cassette. The cleavage sites of the dual in vitro -assembled Cas9 RNPs are marked by thick vertical lines. XhoI cutting sites are indicated in the pksP locus of the wild-type and Δ pksP strains. (B) Southern blot analysis of 6 arbitrarily selected colonies after digesting genomic DNA with the XhoI restriction enzyme. The wild type (WT) produced a 1.8-kb band that matches the expected wild-type banding pattern. Lanes 1, 2, 4, 5, and 6 displayed a 3.8-kb band which matches the expected pksP deletion banding pattern. The colony in lane 3 displayed a 7.6-kb band, likely containing a tandem integration of the HygR repair template at the pksP locus.

    Techniques Used: Southern Blot, Mutagenesis, Generated, In Vitro, Produced

    The concentration of Cas9 directly correlates with the efficiency of gene deletion. The analysis was carried out in the Af293 strain using 2 µg of the HygR repair template flanked by 35 bp of microhomology regions. Dilution of Cas9 is described in Materials and Methods. The effect of Cas9 concentration on pksP deletion rates was assessed based on the color of conidia. Deletion efficiencies represent the average from at least three independent transformations. Error bars represent the standard deviation calculated for each concentration of Cas9.
    Figure Legend Snippet: The concentration of Cas9 directly correlates with the efficiency of gene deletion. The analysis was carried out in the Af293 strain using 2 µg of the HygR repair template flanked by 35 bp of microhomology regions. Dilution of Cas9 is described in Materials and Methods. The effect of Cas9 concentration on pksP deletion rates was assessed based on the color of conidia. Deletion efficiencies represent the average from at least three independent transformations. Error bars represent the standard deviation calculated for each concentration of Cas9.

    Techniques Used: Concentration Assay, Standard Deviation

    Overview of microhomology-mediated gene deletion coupled with in vitro -assembled dual Cas9 RNP cleavage. (A) (1) Cas9, tracrRNA, and dual crRNAs that cleave upstream and downstream of the pksP gene were purchased from a commercial vendor. The assembly of dual gRNA duplexes was performed by separately mixing each crRNA with equimolar amounts of tracrRNA to a final concentration of 33 μM. The two mixtures were boiled at 95°C for 5 min and then cooled to room temperature (20 to 25°C) for 10 to 15 min to allow hybridization of the crRNA to the tracrRNA. (2) For generation of dual Cas9 RNPs, each gRNA duplex was separately mixed with Cas9 (1 µg/µl) and incubated at room temperature for 5 min to allow for the formation of RNP complexes. (3) For generation of the repair template, the HygR cassette was PCR amplified using primer sets that insert 35 bp or 50 bp of flanking microhomology regions for targeting the pksP gene locus. The resulting PCR fragments were purified and utilized as repair templates. (4) The two RNP reaction mixtures were mixed with the HygR repair template and then added to A. fumigatus protoplast suspension (5 × 10 7 conidia/ml). The protoplasts were then transformed according to a standard protocol. (B) Inside the protoplasts, the dual Cas9 RNPs cleave upstream and downstream of pksP , resulting in complete removal of the pksP coding sequence. In the presence of the HygR repair template, the cleaved pksP gene is replaced by the HygR repair template mediated by 35 to 50 bp of microhomology regions. Deletion mutants of the pksP gene exhibit white conidia, which allow for simple assessment of gene deletion based on the conidial color of the colonies.
    Figure Legend Snippet: Overview of microhomology-mediated gene deletion coupled with in vitro -assembled dual Cas9 RNP cleavage. (A) (1) Cas9, tracrRNA, and dual crRNAs that cleave upstream and downstream of the pksP gene were purchased from a commercial vendor. The assembly of dual gRNA duplexes was performed by separately mixing each crRNA with equimolar amounts of tracrRNA to a final concentration of 33 μM. The two mixtures were boiled at 95°C for 5 min and then cooled to room temperature (20 to 25°C) for 10 to 15 min to allow hybridization of the crRNA to the tracrRNA. (2) For generation of dual Cas9 RNPs, each gRNA duplex was separately mixed with Cas9 (1 µg/µl) and incubated at room temperature for 5 min to allow for the formation of RNP complexes. (3) For generation of the repair template, the HygR cassette was PCR amplified using primer sets that insert 35 bp or 50 bp of flanking microhomology regions for targeting the pksP gene locus. The resulting PCR fragments were purified and utilized as repair templates. (4) The two RNP reaction mixtures were mixed with the HygR repair template and then added to A. fumigatus protoplast suspension (5 × 10 7 conidia/ml). The protoplasts were then transformed according to a standard protocol. (B) Inside the protoplasts, the dual Cas9 RNPs cleave upstream and downstream of pksP , resulting in complete removal of the pksP coding sequence. In the presence of the HygR repair template, the cleaved pksP gene is replaced by the HygR repair template mediated by 35 to 50 bp of microhomology regions. Deletion mutants of the pksP gene exhibit white conidia, which allow for simple assessment of gene deletion based on the conidial color of the colonies.

    Techniques Used: In Vitro, Concentration Assay, Hybridization, Incubation, Polymerase Chain Reaction, Amplification, Purification, Transformation Assay, Sequencing

    2) Product Images from "Genomic GLO1 deletion modulates TXNIP expression, glucose metabolism, and redox homeostasis while accelerating human A375 malignant melanoma tumor growth"

    Article Title: Genomic GLO1 deletion modulates TXNIP expression, glucose metabolism, and redox homeostasis while accelerating human A375 malignant melanoma tumor growth

    Journal: Redox Biology

    doi: 10.1016/j.redox.2020.101838

    NanoString nCounter™ profiling identifies pronounced gene expression changes (including TXNIP upregulation) as a consequence of CRISPR/Cas9-based GLO1 deletion in human A375 malignant melanoma cells. NanoString™ analysis (using the nCounter™ PanCancer Progression Panel) was performed comparing gene expression between cultured human A375 malignant melanoma cells ( GLO1 _WT) and an isogenic variant ( GLO1 _KO [B40]). (a) Volcano plot [fold change (log2) versus p-value (log10)] depicting differential gene expression of 740 genes ( GLO1 _KO versus GLO1 _WT; cut-off criteria: fold change ≥ 2; p ≤ 0.05; upregulated: green dots; downregulated: red dots). (b) Left panel: heat map depiction of statistically significant expression changes; right panel: table summarizing numerical values of up- and downregulated genes; cut off criteria as specified in (a). (c) NanoString nCounter™ covariate plot of gene expression ‘pathway scores’ as a function of GLO1 genotype identifying GLO1 -responsive expression networks. (d) Volcano plots depicting individual expression pathways identified in panel (c) characterized by TXNIP upregulation representing the most pronounced expression change: ‘regulation of metabolism’ (out of 16 genes), ‘cellular growth’ (out of 97 genes), ‘cell cycle’ (out of 46 genes), and ‘metastasis suppression’ (out of 19 genes). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
    Figure Legend Snippet: NanoString nCounter™ profiling identifies pronounced gene expression changes (including TXNIP upregulation) as a consequence of CRISPR/Cas9-based GLO1 deletion in human A375 malignant melanoma cells. NanoString™ analysis (using the nCounter™ PanCancer Progression Panel) was performed comparing gene expression between cultured human A375 malignant melanoma cells ( GLO1 _WT) and an isogenic variant ( GLO1 _KO [B40]). (a) Volcano plot [fold change (log2) versus p-value (log10)] depicting differential gene expression of 740 genes ( GLO1 _KO versus GLO1 _WT; cut-off criteria: fold change ≥ 2; p ≤ 0.05; upregulated: green dots; downregulated: red dots). (b) Left panel: heat map depiction of statistically significant expression changes; right panel: table summarizing numerical values of up- and downregulated genes; cut off criteria as specified in (a). (c) NanoString nCounter™ covariate plot of gene expression ‘pathway scores’ as a function of GLO1 genotype identifying GLO1 -responsive expression networks. (d) Volcano plots depicting individual expression pathways identified in panel (c) characterized by TXNIP upregulation representing the most pronounced expression change: ‘regulation of metabolism’ (out of 16 genes), ‘cellular growth’ (out of 97 genes), ‘cell cycle’ (out of 46 genes), and ‘metastasis suppression’ (out of 19 genes). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

    Techniques Used: Expressing, CRISPR, Cell Culture, Variant Assay

    3) Product Images from "Efficient CRISPR/Cas9-mediated editing of trinucleotide repeat expansion in myotonic dystrophy patient-derived iPS and myogenic cells"

    Article Title: Efficient CRISPR/Cas9-mediated editing of trinucleotide repeat expansion in myotonic dystrophy patient-derived iPS and myogenic cells

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky548

    A dual gRNA approach for CRISPR/Cas9-mediated correction of DM1-iPSC Myo and evidence for trinucleotide CTG repeat excision. ( A ) Diagrammatic representation for targeting of the 3 ‘UTR region of the DMPK gene using a dual gRNA approach for CRISPR/Cas9-mediated gene correction. The dual gRNAs ( 5′ 3′-CTG repeat -gRNA ) target Cas9 on either side of the CTG repeat region for excision of the expanded trinucleotide repeat. ( B ) Cas9 immunofluorescence staining of CRISPR/Cas9 treated DM1-iPSC-Myo cells, at 1-week post transduction. The upper panel shows representative images of DM1-iPSC-Myo cells stained for Cas9 (in red) and co-stained with DAPI for nuclei (in blue) (scale bar = 50 μm). The lower panel shows the graph for the quantitation of microscopy data for Cas9 positive cells. ( C ) Representative electropherograms of Triplet Repeat Primed PCR (TP) products from DM1-iPSC-Myo after CRISPR/Cas9-mediated gene editing from three independent experiments for each of the three treatments (Cas9 and 5′ 3′-CTG repeat -gRNA; Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9) and untreated control conditions (WT-iPSC-Myo and DM1-iPSC-Myo). ( D ) Sanger sequencing results of on-target activity. The DMPK target locus was amplified by primers flanking the 2 SNPs [ C > T ; G > A : mutant > wild-type allele] and the CTG repeat region [ (CTG) ∼1371 /(CTG) 5 ]. The SNPs allowed discrimination of mutant ( C G ) and wild-type alleles (T A). Analysis of CRISPR/Cas9 activity on the targeted mutant allele showed a large deletion [(–) ∼4188 bp] between the 5′-CTG repeat -gRNA and 3′-CTG repeat -gRNA target sites. CRISPR/Cas9 activity on wild type allele was also detected by deletions between the corresponding gRNA target sites. Representative sequences of the wild-type allele with commonly found deletions and insertions are depicted in the figure. SNPs marked in red are seen in the mutant allele and those in blue are present in the wild type allele. Insertions are indicated by (+) and deletions are indicated by (–). Small letters represent the inserted nucleotides.
    Figure Legend Snippet: A dual gRNA approach for CRISPR/Cas9-mediated correction of DM1-iPSC Myo and evidence for trinucleotide CTG repeat excision. ( A ) Diagrammatic representation for targeting of the 3 ‘UTR region of the DMPK gene using a dual gRNA approach for CRISPR/Cas9-mediated gene correction. The dual gRNAs ( 5′ 3′-CTG repeat -gRNA ) target Cas9 on either side of the CTG repeat region for excision of the expanded trinucleotide repeat. ( B ) Cas9 immunofluorescence staining of CRISPR/Cas9 treated DM1-iPSC-Myo cells, at 1-week post transduction. The upper panel shows representative images of DM1-iPSC-Myo cells stained for Cas9 (in red) and co-stained with DAPI for nuclei (in blue) (scale bar = 50 μm). The lower panel shows the graph for the quantitation of microscopy data for Cas9 positive cells. ( C ) Representative electropherograms of Triplet Repeat Primed PCR (TP) products from DM1-iPSC-Myo after CRISPR/Cas9-mediated gene editing from three independent experiments for each of the three treatments (Cas9 and 5′ 3′-CTG repeat -gRNA; Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9) and untreated control conditions (WT-iPSC-Myo and DM1-iPSC-Myo). ( D ) Sanger sequencing results of on-target activity. The DMPK target locus was amplified by primers flanking the 2 SNPs [ C > T ; G > A : mutant > wild-type allele] and the CTG repeat region [ (CTG) ∼1371 /(CTG) 5 ]. The SNPs allowed discrimination of mutant ( C G ) and wild-type alleles (T A). Analysis of CRISPR/Cas9 activity on the targeted mutant allele showed a large deletion [(–) ∼4188 bp] between the 5′-CTG repeat -gRNA and 3′-CTG repeat -gRNA target sites. CRISPR/Cas9 activity on wild type allele was also detected by deletions between the corresponding gRNA target sites. Representative sequences of the wild-type allele with commonly found deletions and insertions are depicted in the figure. SNPs marked in red are seen in the mutant allele and those in blue are present in the wild type allele. Insertions are indicated by (+) and deletions are indicated by (–). Small letters represent the inserted nucleotides.

    Techniques Used: CRISPR, CTG Assay, Immunofluorescence, Staining, Transduction, Quantitation Assay, Microscopy, Polymerase Chain Reaction, Sequencing, Activity Assay, Amplification, Mutagenesis

    Analysis of CRISPR/Cas9 corrected DM1-iPSCs and isolated DM1-iPSC clones by Southern blot assay, target region sequencing, TP-PCR and ribonuclear foci staining. ( A ) Quantification of ribonuclear foci (NF) in CRISPR/Cas9-corrected DM1-iPSCs. The total number of ribonuclear foci per total number of nuclei was calculated. Total of nuclei counted is 1500. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P
    Figure Legend Snippet: Analysis of CRISPR/Cas9 corrected DM1-iPSCs and isolated DM1-iPSC clones by Southern blot assay, target region sequencing, TP-PCR and ribonuclear foci staining. ( A ) Quantification of ribonuclear foci (NF) in CRISPR/Cas9-corrected DM1-iPSCs. The total number of ribonuclear foci per total number of nuclei was calculated. Total of nuclei counted is 1500. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P

    Techniques Used: CRISPR, Isolation, Clone Assay, Southern Blot, Sequencing, Polymerase Chain Reaction, Staining, Two Tailed Test

    Generation of DM1-iPS cells (DM1-iPSCs) and DM1-iPSC derived inducible myogenic cells (DM1-iPSC-Myo). ( A ) Schematic overview showing CRISPR/Cas9 based correction of DM1 patient iPSCs derived myogenic cells (DM1-iPSC-Myo). ( B ) Representative image of DM1-iPSC clones and healthy control iPSCs stained for RNA foci by fluorescent in situ hybridization (FISH). An antisense Cy3-labeled probe was used against trinucleotide CUG expanded repeat. Arrowheads indicated ribonuclear foci. Upper panel represents stained nuclei at lower magnification (scale bar = 20μm) and lower panel represents higher magnification of selected region (scale bar = 2μm). Nuclei were counter-stained with DAPI. ( C ) Southern blot analysis to detect the length of trinucleotide CTG repeats in five DM1-iPSC clones from two DM1 patients (L22, L81 and L23; FL8 and FL5) and healthy control iPSCs. EcoR I digested genomic DNA was subjected to agarose gel electrophoresis and probed to detect the DMPK locus. (mut = mutant; wt = wild type) . ( D ) Representative image of FISH staining on DM1-iPSC-Myo for detection of ribonuclear foci. Arrowheads indicate multiple RNA foci in nuclei of DM1-iPSC-Myo. Healthy iPSC-Myo were used as a negative control. Upper panel represents stained nuclei at lower magnification (scale bar = 20 μm) and lower panel represents higher magnification of selected region (scale bar = 2 μm). Nuclei were counter-stained with DAPI. ( E ) Myogenic conversion of DM1-iPSC-Myo (L81 and L23) and healthy iPSC-Myo post MyoD induction were stained for a mature muscle marker, myosin heavy chain (MyHC) (scale bar = 100 μm). Nuclei were counter-stained with DAPI. ( F ) Southern blot analysis of trinucleotide CTG repeats length in DM1-iPSC-Myo (L81 and L23; FL8 and FL5) and healthy-iPSC-Myo to check the length of triplet repeats post-differentiation (mut = mutant; wt = wild type) .
    Figure Legend Snippet: Generation of DM1-iPS cells (DM1-iPSCs) and DM1-iPSC derived inducible myogenic cells (DM1-iPSC-Myo). ( A ) Schematic overview showing CRISPR/Cas9 based correction of DM1 patient iPSCs derived myogenic cells (DM1-iPSC-Myo). ( B ) Representative image of DM1-iPSC clones and healthy control iPSCs stained for RNA foci by fluorescent in situ hybridization (FISH). An antisense Cy3-labeled probe was used against trinucleotide CUG expanded repeat. Arrowheads indicated ribonuclear foci. Upper panel represents stained nuclei at lower magnification (scale bar = 20μm) and lower panel represents higher magnification of selected region (scale bar = 2μm). Nuclei were counter-stained with DAPI. ( C ) Southern blot analysis to detect the length of trinucleotide CTG repeats in five DM1-iPSC clones from two DM1 patients (L22, L81 and L23; FL8 and FL5) and healthy control iPSCs. EcoR I digested genomic DNA was subjected to agarose gel electrophoresis and probed to detect the DMPK locus. (mut = mutant; wt = wild type) . ( D ) Representative image of FISH staining on DM1-iPSC-Myo for detection of ribonuclear foci. Arrowheads indicate multiple RNA foci in nuclei of DM1-iPSC-Myo. Healthy iPSC-Myo were used as a negative control. Upper panel represents stained nuclei at lower magnification (scale bar = 20 μm) and lower panel represents higher magnification of selected region (scale bar = 2 μm). Nuclei were counter-stained with DAPI. ( E ) Myogenic conversion of DM1-iPSC-Myo (L81 and L23) and healthy iPSC-Myo post MyoD induction were stained for a mature muscle marker, myosin heavy chain (MyHC) (scale bar = 100 μm). Nuclei were counter-stained with DAPI. ( F ) Southern blot analysis of trinucleotide CTG repeats length in DM1-iPSC-Myo (L81 and L23; FL8 and FL5) and healthy-iPSC-Myo to check the length of triplet repeats post-differentiation (mut = mutant; wt = wild type) .

    Techniques Used: Derivative Assay, CRISPR, Clone Assay, Staining, In Situ Hybridization, Fluorescence In Situ Hybridization, Labeling, Southern Blot, CTG Assay, Agarose Gel Electrophoresis, Mutagenesis, Negative Control, Marker

    Analysis of target region in the CRISPR/Cas9-corrected DM1-iPSC-Myo and ribonuclear foci staining of corrected DM1-iPSC-Myo and DM1 primary myoblasts. ( A ) Graph representing distribution of SMRT sequencing reads based on the various amplicon sizes ∼633 bp (excised fragments) and ∼723bp (WT fragments). The sequences ranging between ∼723 bp and ∼4000 bp were fragments with indels and partially deleted repeat regions. Each bar represents distribution of reads from each of the three conditions (Cas9 + 5′ 3′-CTG repeat -gRNA , Cas9 control and gRNA control) and untreated DM1-iPSC-Myo control. ( B ) Representative image of CRISPR/Cas9-corrected DM1-iPSC-Myo (L81) stained for ribonuclear foci. Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9 were used as negative controls. An antisense Cy3-labeled probe was used to detect the presence of ribonuclear foci (NF). The ribonuclear foci negative and positive nuclei were denoted as NF − (white) and NF + (red), respectively. Each representative image is a maximum intensity z projection of the z slice images. For all the conditions (Cas9 + 3′ 5′-CTG repeat -gRNA , scrambled gRNA and no Cas9) enlarged z slices of selected ribonuclear foci negative (NF-) and positive (NF+) nucleus are represented. Nuclei were counter-stained with DAPI (scale bar = 20 μm). ( C ) Quantification of ribonuclear foci (NF) in CRISPR/Cas9-corrected DM1-iPSC Myo. The total number of ribonuclear foci per total number of nuclei was calculated. Total of nuclei counted is 6500. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P
    Figure Legend Snippet: Analysis of target region in the CRISPR/Cas9-corrected DM1-iPSC-Myo and ribonuclear foci staining of corrected DM1-iPSC-Myo and DM1 primary myoblasts. ( A ) Graph representing distribution of SMRT sequencing reads based on the various amplicon sizes ∼633 bp (excised fragments) and ∼723bp (WT fragments). The sequences ranging between ∼723 bp and ∼4000 bp were fragments with indels and partially deleted repeat regions. Each bar represents distribution of reads from each of the three conditions (Cas9 + 5′ 3′-CTG repeat -gRNA , Cas9 control and gRNA control) and untreated DM1-iPSC-Myo control. ( B ) Representative image of CRISPR/Cas9-corrected DM1-iPSC-Myo (L81) stained for ribonuclear foci. Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9 were used as negative controls. An antisense Cy3-labeled probe was used to detect the presence of ribonuclear foci (NF). The ribonuclear foci negative and positive nuclei were denoted as NF − (white) and NF + (red), respectively. Each representative image is a maximum intensity z projection of the z slice images. For all the conditions (Cas9 + 3′ 5′-CTG repeat -gRNA , scrambled gRNA and no Cas9) enlarged z slices of selected ribonuclear foci negative (NF-) and positive (NF+) nucleus are represented. Nuclei were counter-stained with DAPI (scale bar = 20 μm). ( C ) Quantification of ribonuclear foci (NF) in CRISPR/Cas9-corrected DM1-iPSC Myo. The total number of ribonuclear foci per total number of nuclei was calculated. Total of nuclei counted is 6500. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P

    Techniques Used: CRISPR, Staining, Sequencing, Amplification, CTG Assay, Labeling, Two Tailed Test

    Biological effects of CRSIPR/Cas9 mediated correction of DM1-iPSC-Myo. ( A ) Dual staining for MBNL1 and ribonuclear foci co-localization in the CRSIPR/Cas9-corrected versus control conditions (Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9). Representative image of DM1-iPSC-Myo stained for MBNL1 and Ribonuclear foci by combined immunostaining-FISH staining. Each representative image is a maximum intensity z projection of the z slices. For control conditions, enlarged image of selected nuclei are represented under different filters. For the condition (Cas9 + 3′ 5′-CTG repeat -gRNA ) enlarged z slices of selected ribonuclear foci negative (NF-) and positive (NF+) nucleus are represented under different filters. Nuclei were counterstained with DAPI. ( B ) Quantification of the microscopy data is represented in term of ratio between the total dual positive (MBNL1 + RNA + foci)/total number of nuclei observed in each condition for the L23, L81, FL8 and FL5 DM1-iPSC-Myo cells. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P
    Figure Legend Snippet: Biological effects of CRSIPR/Cas9 mediated correction of DM1-iPSC-Myo. ( A ) Dual staining for MBNL1 and ribonuclear foci co-localization in the CRSIPR/Cas9-corrected versus control conditions (Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9). Representative image of DM1-iPSC-Myo stained for MBNL1 and Ribonuclear foci by combined immunostaining-FISH staining. Each representative image is a maximum intensity z projection of the z slices. For control conditions, enlarged image of selected nuclei are represented under different filters. For the condition (Cas9 + 3′ 5′-CTG repeat -gRNA ) enlarged z slices of selected ribonuclear foci negative (NF-) and positive (NF+) nucleus are represented under different filters. Nuclei were counterstained with DAPI. ( B ) Quantification of the microscopy data is represented in term of ratio between the total dual positive (MBNL1 + RNA + foci)/total number of nuclei observed in each condition for the L23, L81, FL8 and FL5 DM1-iPSC-Myo cells. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P

    Techniques Used: Staining, CTG Assay, Immunostaining, Fluorescence In Situ Hybridization, Microscopy, Two Tailed Test

    4) Product Images from "Distinct mechanisms underlie H2O2 sensing in C. elegans head and tail"

    Article Title: Distinct mechanisms underlie H2O2 sensing in C. elegans head and tail

    Journal: bioRxiv

    doi: 10.1101/2021.07.26.451501

    PRDX-2::GFP knock-in line expression pattern and its evolution upon H 2 O 2 treatment (A)-Sketch depicting the PRDX-2::GFP knock-in strategy using CRISPR Cas9-mediated genome editing. The sgRNA target sequence (boxed in red) was chosen a few base pairs upstream PRDX-2 STOP codon, to tag all prdx-2 isoforms. A flexible linker between PRDX-2 and the GFP was inserted to allow a correct folding of the fusion protein. After injection, three independent knock-in lines were recovered sharing the same expression pattern. (B) Spinning-disc confocal projections of a representative PRDX-2::GFP knock-in animal, in 4 body regions (correspondingly boxed in the top drawing). PRDX-2::GFP expression is observed in the tip of the nose (e3 cell), in pharyngeal muscle cells (pm), in body wall muscles (m), in the excretory pore cell (EPC), in proximal and distal gut cells (int1 and int9), and in several neuron pairs, indicated in blue. (C-G) An acute oxidative stress triggers an upregulation of PRDX-2 in the foregut, but not in neurons. (C-D) Spinning-disc confocal projections of control or H 2 O 2 -treated animals in the foregut (C) or in the head region (D). (E-G) Quantification of fluorescence intensity in controls and in H 2 O 2 -treated animals in the int1 cell (E), in the EPC (F), and I2 neurons (G). Bars indicate mean and s.d. ns, not significant, p > 0.05; *p
    Figure Legend Snippet: PRDX-2::GFP knock-in line expression pattern and its evolution upon H 2 O 2 treatment (A)-Sketch depicting the PRDX-2::GFP knock-in strategy using CRISPR Cas9-mediated genome editing. The sgRNA target sequence (boxed in red) was chosen a few base pairs upstream PRDX-2 STOP codon, to tag all prdx-2 isoforms. A flexible linker between PRDX-2 and the GFP was inserted to allow a correct folding of the fusion protein. After injection, three independent knock-in lines were recovered sharing the same expression pattern. (B) Spinning-disc confocal projections of a representative PRDX-2::GFP knock-in animal, in 4 body regions (correspondingly boxed in the top drawing). PRDX-2::GFP expression is observed in the tip of the nose (e3 cell), in pharyngeal muscle cells (pm), in body wall muscles (m), in the excretory pore cell (EPC), in proximal and distal gut cells (int1 and int9), and in several neuron pairs, indicated in blue. (C-G) An acute oxidative stress triggers an upregulation of PRDX-2 in the foregut, but not in neurons. (C-D) Spinning-disc confocal projections of control or H 2 O 2 -treated animals in the foregut (C) or in the head region (D). (E-G) Quantification of fluorescence intensity in controls and in H 2 O 2 -treated animals in the int1 cell (E), in the EPC (F), and I2 neurons (G). Bars indicate mean and s.d. ns, not significant, p > 0.05; *p

    Techniques Used: Knock-In, Expressing, CRISPR, Sequencing, Injection, Fluorescence

    5) Product Images from "Gene drive and resilience through renewal with next generation Cleave and Rescue selfish genetic elements"

    Article Title: Gene drive and resilience through renewal with next generation Cleave and Rescue selfish genetic elements

    Journal: bioRxiv

    doi: 10.1101/2019.12.13.876169

    Constructs used to create 1st and 2nd generation ClvR flies. Schematic representation of ClvR constructs including primers used for cloning. Primer sequences are in Dataset S1. (A) Rescue constructs including the Rescue gene, a td-tomato marker and an attP site, flanked by homology arms to fa cilitate insertion into the fly genome at 68E on the third chromosome. The gRNA to target 68E was driven from a U6 promoter located outside of the homology arms. (B) Cleaver constructs having an attB site, a 3xP3- GFP marker gene, germline Cas9 under the control of the nanos promoter and UTRs, as well as a set of 4 gRNAs each driven by a U6 promoter. (C) Rescue n donor plasmid having a 3xP3 promoter serving as homology arm, the Rescue n gene, a ubiquitous opie promoter and a partial GFP ORF (110 bp +UTR (SV40) missing the C-terminus of GFP served as the other homology arm.
    Figure Legend Snippet: Constructs used to create 1st and 2nd generation ClvR flies. Schematic representation of ClvR constructs including primers used for cloning. Primer sequences are in Dataset S1. (A) Rescue constructs including the Rescue gene, a td-tomato marker and an attP site, flanked by homology arms to fa cilitate insertion into the fly genome at 68E on the third chromosome. The gRNA to target 68E was driven from a U6 promoter located outside of the homology arms. (B) Cleaver constructs having an attB site, a 3xP3- GFP marker gene, germline Cas9 under the control of the nanos promoter and UTRs, as well as a set of 4 gRNAs each driven by a U6 promoter. (C) Rescue n donor plasmid having a 3xP3 promoter serving as homology arm, the Rescue n gene, a ubiquitous opie promoter and a partial GFP ORF (110 bp +UTR (SV40) missing the C-terminus of GFP served as the other homology arm.

    Techniques Used: Construct, Clone Assay, Marker, Plasmid Preparation

    Synthesis strategy to create 1st and 2nd generation ClvR flies. (A) CRISPR HR mediated insertion of Rescue n+1 . Plasmid A having the Rescue n+1 and a marker was injected into a strain expressing Cas9 in the germline ( nos -Cas9). A gRNA targeting a genomic region at 68E was expressed from the plasmid outside the homology arms. (B) PhiC31 mediated integration of Cleaver n+1 (Cas9 and gRNAs). Plasmid B having Cas9 and gRNAs targeting essential gene (n+1) was injected into flies from step A with a helper plasmid as the source for phiC31 integrase. (C) CRISPR HR mediated insertion of Rescue n into flies that will become ClvR n+1 +R n flies. Cas9/gRNA RNP complexes were injected to induce a DSB between the 3xP3 promoter and GFP alongside a donor template that had the Rescue n . The homology arms were designed in a way so that successful insertion will switch GFP expression from eye-specific to ubiquitous. (D) Final ClvR n+1 +R n flies. These flies were used in the gene drive experiments to replace populations carrying ClvR n elements. Red and green arrows indicate primers that were used to confirm correct insertion of the new Rescue n .
    Figure Legend Snippet: Synthesis strategy to create 1st and 2nd generation ClvR flies. (A) CRISPR HR mediated insertion of Rescue n+1 . Plasmid A having the Rescue n+1 and a marker was injected into a strain expressing Cas9 in the germline ( nos -Cas9). A gRNA targeting a genomic region at 68E was expressed from the plasmid outside the homology arms. (B) PhiC31 mediated integration of Cleaver n+1 (Cas9 and gRNAs). Plasmid B having Cas9 and gRNAs targeting essential gene (n+1) was injected into flies from step A with a helper plasmid as the source for phiC31 integrase. (C) CRISPR HR mediated insertion of Rescue n into flies that will become ClvR n+1 +R n flies. Cas9/gRNA RNP complexes were injected to induce a DSB between the 3xP3 promoter and GFP alongside a donor template that had the Rescue n . The homology arms were designed in a way so that successful insertion will switch GFP expression from eye-specific to ubiquitous. (D) Final ClvR n+1 +R n flies. These flies were used in the gene drive experiments to replace populations carrying ClvR n elements. Red and green arrows indicate primers that were used to confirm correct insertion of the new Rescue n .

    Techniques Used: CRISPR, Plasmid Preparation, Marker, Injection, Expressing

    First and second generation ClvR elements and their genetic behavior. (A) Components that make up a ClvR element. See text for details. (B) A Punnett square highlighting the genetic mechanism by which ClvR elements bias inheritance in their favor. Maternal chromosomes are indicated with a red circle (centromere), paternal chromosomes in blue. In a heterozygous female, Cas9 (located in the ClvR on chromosome 3 in this example) cleaves and mutates to LOF the endogenous target gene on chromosome 2, in the germline. In addition, active Cas9/gRNA complexes are deposited maternally into all eggs. After mating with a wildtype male, maternally transmitted Cas9/gRNA cleaves/mutates the target gene on the paternal chromosome. Progeny that do not inherit ClvR and its recoded Rescue die because they lack essential gene function. (C) A female transheterozygous for ClvR n , which has an inactive Cargo n , and ClvR n+1 , which carries a new Cargo n+1 . (D) Gamete and progeny genotypes for a cross between the transheterozygous ClvR n+1 / ClvR n female and a homozygous ClvR n / ClvR n male. Chromosomes carrying the two different essential genes being targeted (as in panels A and B) are not indicated for clarity of presentation.
    Figure Legend Snippet: First and second generation ClvR elements and their genetic behavior. (A) Components that make up a ClvR element. See text for details. (B) A Punnett square highlighting the genetic mechanism by which ClvR elements bias inheritance in their favor. Maternal chromosomes are indicated with a red circle (centromere), paternal chromosomes in blue. In a heterozygous female, Cas9 (located in the ClvR on chromosome 3 in this example) cleaves and mutates to LOF the endogenous target gene on chromosome 2, in the germline. In addition, active Cas9/gRNA complexes are deposited maternally into all eggs. After mating with a wildtype male, maternally transmitted Cas9/gRNA cleaves/mutates the target gene on the paternal chromosome. Progeny that do not inherit ClvR and its recoded Rescue die because they lack essential gene function. (C) A female transheterozygous for ClvR n , which has an inactive Cargo n , and ClvR n+1 , which carries a new Cargo n+1 . (D) Gamete and progeny genotypes for a cross between the transheterozygous ClvR n+1 / ClvR n female and a homozygous ClvR n / ClvR n male. Chromosomes carrying the two different essential genes being targeted (as in panels A and B) are not indicated for clarity of presentation.

    Techniques Used:

    6) Product Images from "MicroRNA-277 targets insulin-like peptides 7 and 8 to control lipid metabolism and reproduction in Aedes aegypti mosquitoes"

    Article Title: MicroRNA-277 targets insulin-like peptides 7 and 8 to control lipid metabolism and reproduction in Aedes aegypti mosquitoes

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1710970114

    Genomic disruption of ilp7 or ilp8 by CRISPR-Cas9 results in abnormal phenotypes of ovarian development and lipid storage in mosquitoes. ( A ) Graphical representation of the target sites for Cas9 and sgRNAs (red) with the PAM in blue. Sequence alignments of sgRNA-targeted genomic region are listed below. ( B ) Ovaries were dissected from WT, ▵ilp7 , and ▵ilp8 female mosquitoes at 24 h PBM. (Scale bar: 1 mm.) The ovarian ends with no follicles are indicated by the red arrows. The melanized abnormal ovary is magnified with a Leica SP5 confocal microscope in DIC imaging. ( C ) Lipid droplets in the fat body dissected from WT females and ▵ilp7 / ▵ilp8 mutant females (with abnormal ovaries) at 24 h PBM were detected using Nile red staining and examined with a Leica SP5 confocal midcroscope. (Scale bar: 25 μm.)
    Figure Legend Snippet: Genomic disruption of ilp7 or ilp8 by CRISPR-Cas9 results in abnormal phenotypes of ovarian development and lipid storage in mosquitoes. ( A ) Graphical representation of the target sites for Cas9 and sgRNAs (red) with the PAM in blue. Sequence alignments of sgRNA-targeted genomic region are listed below. ( B ) Ovaries were dissected from WT, ▵ilp7 , and ▵ilp8 female mosquitoes at 24 h PBM. (Scale bar: 1 mm.) The ovarian ends with no follicles are indicated by the red arrows. The melanized abnormal ovary is magnified with a Leica SP5 confocal microscope in DIC imaging. ( C ) Lipid droplets in the fat body dissected from WT females and ▵ilp7 / ▵ilp8 mutant females (with abnormal ovaries) at 24 h PBM were detected using Nile red staining and examined with a Leica SP5 confocal midcroscope. (Scale bar: 25 μm.)

    Techniques Used: CRISPR, Sequencing, Microscopy, Imaging, Mutagenesis, Staining

    Spatiotemporal expression profile of miR-277 and target site of miR277-sgRNA. ( A ) Relative expression of mature miR-277 in head (HD), fat body (FB), ovary (OV), midgut (MG), and Malpighian tube (MT) at 72 h PE and at 6, 24, and 48 h PBM. ( B ) Relative expression profile of mature miR-277 in female mosquito heads analyzed in larvae (LV), in pupae (PP), at 72 h PE, and at 6, 24, 48, and 72 h PBM. ( C ) Graphical representation of the target site for Cas9 and miR277-specific sgRNA (blue). The miR-277 mature sequence is labeled in red with PAMs. Data represent three biological replicates with 10 individuals in each replication and are shown as mean ± SEM.
    Figure Legend Snippet: Spatiotemporal expression profile of miR-277 and target site of miR277-sgRNA. ( A ) Relative expression of mature miR-277 in head (HD), fat body (FB), ovary (OV), midgut (MG), and Malpighian tube (MT) at 72 h PE and at 6, 24, and 48 h PBM. ( B ) Relative expression profile of mature miR-277 in female mosquito heads analyzed in larvae (LV), in pupae (PP), at 72 h PE, and at 6, 24, 48, and 72 h PBM. ( C ) Graphical representation of the target site for Cas9 and miR277-specific sgRNA (blue). The miR-277 mature sequence is labeled in red with PAMs. Data represent three biological replicates with 10 individuals in each replication and are shown as mean ± SEM.

    Techniques Used: Expressing, Sequencing, Labeling

    Genomic disruption of miR-277 by CRISPR-Cas9 blocks ovarian development and reduces the accumulation of lipids in mosquitoes. ( A ) Sequence alignment of sgRNA-targeted genomic region. ( B ) Ovaries were dissected from WT and miR-277 mutant ( ▵miR277 ) female mosquitoes at 24 h PBM. (Scale bar: 1 mm.) The abnormal ovary is magnified using a confocal microscope (Leica SP5) in differential interference contrast (DIC) imaging. OV, ovary. ( C ) Lipid droplets in the fat body dissected from WT females and ▵miR277 mutant females (with undeveloped ovaries) at 24 h PBM were detected by Nile red staining and imaged with a Leica SP5 confocal microscope. (Scale bar: 25 μm.)
    Figure Legend Snippet: Genomic disruption of miR-277 by CRISPR-Cas9 blocks ovarian development and reduces the accumulation of lipids in mosquitoes. ( A ) Sequence alignment of sgRNA-targeted genomic region. ( B ) Ovaries were dissected from WT and miR-277 mutant ( ▵miR277 ) female mosquitoes at 24 h PBM. (Scale bar: 1 mm.) The abnormal ovary is magnified using a confocal microscope (Leica SP5) in differential interference contrast (DIC) imaging. OV, ovary. ( C ) Lipid droplets in the fat body dissected from WT females and ▵miR277 mutant females (with undeveloped ovaries) at 24 h PBM were detected by Nile red staining and imaged with a Leica SP5 confocal microscope. (Scale bar: 25 μm.)

    Techniques Used: CRISPR, Sequencing, Mutagenesis, Microscopy, Imaging, Staining

    7) Product Images from "Efficient CRISPR/Cas9-mediated editing of trinucleotide repeat expansion in myotonic dystrophy patient-derived iPS and myogenic cells"

    Article Title: Efficient CRISPR/Cas9-mediated editing of trinucleotide repeat expansion in myotonic dystrophy patient-derived iPS and myogenic cells

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky548

    A dual gRNA approach for CRISPR/Cas9-mediated correction of DM1-iPSC Myo and evidence for trinucleotide CTG repeat excision. ( A ) Diagrammatic representation for targeting of the 3 ‘UTR region of the DMPK gene using a dual gRNA approach for CRISPR/Cas9-mediated gene correction. The dual gRNAs ( 5′ 3′-CTG repeat -gRNA ) target Cas9 on either side of the CTG repeat region for excision of the expanded trinucleotide repeat. ( B ) Cas9 immunofluorescence staining of CRISPR/Cas9 treated DM1-iPSC-Myo cells, at 1-week post transduction. The upper panel shows representative images of DM1-iPSC-Myo cells stained for Cas9 (in red) and co-stained with DAPI for nuclei (in blue) (scale bar = 50 μm). The lower panel shows the graph for the quantitation of microscopy data for Cas9 positive cells. ( C ) Representative electropherograms of Triplet Repeat Primed PCR (TP) products from DM1-iPSC-Myo after CRISPR/Cas9-mediated gene editing from three independent experiments for each of the three treatments (Cas9 and 5′ 3′-CTG repeat -gRNA; Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9) and untreated control conditions (WT-iPSC-Myo and DM1-iPSC-Myo). ( D ) Sanger sequencing results of on-target activity. The DMPK target locus was amplified by primers flanking the 2 SNPs [ C > T ; G > A : mutant > wild-type allele] and the CTG repeat region [ (CTG) ∼1371 /(CTG) 5 ]. The SNPs allowed discrimination of mutant ( C G ) and wild-type alleles (T A). Analysis of CRISPR/Cas9 activity on the targeted mutant allele showed a large deletion [(–) ∼4188 bp] between the 5′-CTG repeat -gRNA and 3′-CTG repeat -gRNA target sites. CRISPR/Cas9 activity on wild type allele was also detected by deletions between the corresponding gRNA target sites. Representative sequences of the wild-type allele with commonly found deletions and insertions are depicted in the figure. SNPs marked in red are seen in the mutant allele and those in blue are present in the wild type allele. Insertions are indicated by (+) and deletions are indicated by (–). Small letters represent the inserted nucleotides.
    Figure Legend Snippet: A dual gRNA approach for CRISPR/Cas9-mediated correction of DM1-iPSC Myo and evidence for trinucleotide CTG repeat excision. ( A ) Diagrammatic representation for targeting of the 3 ‘UTR region of the DMPK gene using a dual gRNA approach for CRISPR/Cas9-mediated gene correction. The dual gRNAs ( 5′ 3′-CTG repeat -gRNA ) target Cas9 on either side of the CTG repeat region for excision of the expanded trinucleotide repeat. ( B ) Cas9 immunofluorescence staining of CRISPR/Cas9 treated DM1-iPSC-Myo cells, at 1-week post transduction. The upper panel shows representative images of DM1-iPSC-Myo cells stained for Cas9 (in red) and co-stained with DAPI for nuclei (in blue) (scale bar = 50 μm). The lower panel shows the graph for the quantitation of microscopy data for Cas9 positive cells. ( C ) Representative electropherograms of Triplet Repeat Primed PCR (TP) products from DM1-iPSC-Myo after CRISPR/Cas9-mediated gene editing from three independent experiments for each of the three treatments (Cas9 and 5′ 3′-CTG repeat -gRNA; Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9) and untreated control conditions (WT-iPSC-Myo and DM1-iPSC-Myo). ( D ) Sanger sequencing results of on-target activity. The DMPK target locus was amplified by primers flanking the 2 SNPs [ C > T ; G > A : mutant > wild-type allele] and the CTG repeat region [ (CTG) ∼1371 /(CTG) 5 ]. The SNPs allowed discrimination of mutant ( C G ) and wild-type alleles (T A). Analysis of CRISPR/Cas9 activity on the targeted mutant allele showed a large deletion [(–) ∼4188 bp] between the 5′-CTG repeat -gRNA and 3′-CTG repeat -gRNA target sites. CRISPR/Cas9 activity on wild type allele was also detected by deletions between the corresponding gRNA target sites. Representative sequences of the wild-type allele with commonly found deletions and insertions are depicted in the figure. SNPs marked in red are seen in the mutant allele and those in blue are present in the wild type allele. Insertions are indicated by (+) and deletions are indicated by (–). Small letters represent the inserted nucleotides.

    Techniques Used: CRISPR, CTG Assay, Immunofluorescence, Staining, Transduction, Quantitation Assay, Microscopy, Polymerase Chain Reaction, Sequencing, Activity Assay, Amplification, Mutagenesis

    Analysis of CRISPR/Cas9 corrected DM1-iPSCs and isolated DM1-iPSC clones by Southern blot assay, target region sequencing, TP-PCR and ribonuclear foci staining. ( A ) Quantification of ribonuclear foci (NF) in CRISPR/Cas9-corrected DM1-iPSCs. The total number of ribonuclear foci per total number of nuclei was calculated. Total of nuclei counted is 1500. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P
    Figure Legend Snippet: Analysis of CRISPR/Cas9 corrected DM1-iPSCs and isolated DM1-iPSC clones by Southern blot assay, target region sequencing, TP-PCR and ribonuclear foci staining. ( A ) Quantification of ribonuclear foci (NF) in CRISPR/Cas9-corrected DM1-iPSCs. The total number of ribonuclear foci per total number of nuclei was calculated. Total of nuclei counted is 1500. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P

    Techniques Used: CRISPR, Isolation, Clone Assay, Southern Blot, Sequencing, Polymerase Chain Reaction, Staining, Two Tailed Test

    Generation of DM1-iPS cells (DM1-iPSCs) and DM1-iPSC derived inducible myogenic cells (DM1-iPSC-Myo). ( A ) Schematic overview showing CRISPR/Cas9 based correction of DM1 patient iPSCs derived myogenic cells (DM1-iPSC-Myo). ( B ) Representative image of DM1-iPSC clones and healthy control iPSCs stained for RNA foci by fluorescent in situ hybridization (FISH). An antisense Cy3-labeled probe was used against trinucleotide CUG expanded repeat. Arrowheads indicated ribonuclear foci. Upper panel represents stained nuclei at lower magnification (scale bar = 20μm) and lower panel represents higher magnification of selected region (scale bar = 2μm). Nuclei were counter-stained with DAPI. ( C ) Southern blot analysis to detect the length of trinucleotide CTG repeats in five DM1-iPSC clones from two DM1 patients (L22, L81 and L23; FL8 and FL5) and healthy control iPSCs. EcoR I digested genomic DNA was subjected to agarose gel electrophoresis and probed to detect the DMPK locus. (mut = mutant; wt = wild type) . ( D ) Representative image of FISH staining on DM1-iPSC-Myo for detection of ribonuclear foci. Arrowheads indicate multiple RNA foci in nuclei of DM1-iPSC-Myo. Healthy iPSC-Myo were used as a negative control. Upper panel represents stained nuclei at lower magnification (scale bar = 20 μm) and lower panel represents higher magnification of selected region (scale bar = 2 μm). Nuclei were counter-stained with DAPI. ( E ) Myogenic conversion of DM1-iPSC-Myo (L81 and L23) and healthy iPSC-Myo post MyoD induction were stained for a mature muscle marker, myosin heavy chain (MyHC) (scale bar = 100 μm). Nuclei were counter-stained with DAPI. ( F ) Southern blot analysis of trinucleotide CTG repeats length in DM1-iPSC-Myo (L81 and L23; FL8 and FL5) and healthy-iPSC-Myo to check the length of triplet repeats post-differentiation (mut = mutant; wt = wild type) .
    Figure Legend Snippet: Generation of DM1-iPS cells (DM1-iPSCs) and DM1-iPSC derived inducible myogenic cells (DM1-iPSC-Myo). ( A ) Schematic overview showing CRISPR/Cas9 based correction of DM1 patient iPSCs derived myogenic cells (DM1-iPSC-Myo). ( B ) Representative image of DM1-iPSC clones and healthy control iPSCs stained for RNA foci by fluorescent in situ hybridization (FISH). An antisense Cy3-labeled probe was used against trinucleotide CUG expanded repeat. Arrowheads indicated ribonuclear foci. Upper panel represents stained nuclei at lower magnification (scale bar = 20μm) and lower panel represents higher magnification of selected region (scale bar = 2μm). Nuclei were counter-stained with DAPI. ( C ) Southern blot analysis to detect the length of trinucleotide CTG repeats in five DM1-iPSC clones from two DM1 patients (L22, L81 and L23; FL8 and FL5) and healthy control iPSCs. EcoR I digested genomic DNA was subjected to agarose gel electrophoresis and probed to detect the DMPK locus. (mut = mutant; wt = wild type) . ( D ) Representative image of FISH staining on DM1-iPSC-Myo for detection of ribonuclear foci. Arrowheads indicate multiple RNA foci in nuclei of DM1-iPSC-Myo. Healthy iPSC-Myo were used as a negative control. Upper panel represents stained nuclei at lower magnification (scale bar = 20 μm) and lower panel represents higher magnification of selected region (scale bar = 2 μm). Nuclei were counter-stained with DAPI. ( E ) Myogenic conversion of DM1-iPSC-Myo (L81 and L23) and healthy iPSC-Myo post MyoD induction were stained for a mature muscle marker, myosin heavy chain (MyHC) (scale bar = 100 μm). Nuclei were counter-stained with DAPI. ( F ) Southern blot analysis of trinucleotide CTG repeats length in DM1-iPSC-Myo (L81 and L23; FL8 and FL5) and healthy-iPSC-Myo to check the length of triplet repeats post-differentiation (mut = mutant; wt = wild type) .

    Techniques Used: Derivative Assay, CRISPR, Clone Assay, Staining, In Situ Hybridization, Fluorescence In Situ Hybridization, Labeling, Southern Blot, CTG Assay, Agarose Gel Electrophoresis, Mutagenesis, Negative Control, Marker

    Analysis of target region in the CRISPR/Cas9-corrected DM1-iPSC-Myo and ribonuclear foci staining of corrected DM1-iPSC-Myo and DM1 primary myoblasts. ( A ) Graph representing distribution of SMRT sequencing reads based on the various amplicon sizes ∼633 bp (excised fragments) and ∼723bp (WT fragments). The sequences ranging between ∼723 bp and ∼4000 bp were fragments with indels and partially deleted repeat regions. Each bar represents distribution of reads from each of the three conditions (Cas9 + 5′ 3′-CTG repeat -gRNA , Cas9 control and gRNA control) and untreated DM1-iPSC-Myo control. ( B ) Representative image of CRISPR/Cas9-corrected DM1-iPSC-Myo (L81) stained for ribonuclear foci. Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9 were used as negative controls. An antisense Cy3-labeled probe was used to detect the presence of ribonuclear foci (NF). The ribonuclear foci negative and positive nuclei were denoted as NF − (white) and NF + (red), respectively. Each representative image is a maximum intensity z projection of the z slice images. For all the conditions (Cas9 + 3′ 5′-CTG repeat -gRNA , scrambled gRNA and no Cas9) enlarged z slices of selected ribonuclear foci negative (NF-) and positive (NF+) nucleus are represented. Nuclei were counter-stained with DAPI (scale bar = 20 μm). ( C ) Quantification of ribonuclear foci (NF) in CRISPR/Cas9-corrected DM1-iPSC Myo. The total number of ribonuclear foci per total number of nuclei was calculated. Total of nuclei counted is 6500. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P
    Figure Legend Snippet: Analysis of target region in the CRISPR/Cas9-corrected DM1-iPSC-Myo and ribonuclear foci staining of corrected DM1-iPSC-Myo and DM1 primary myoblasts. ( A ) Graph representing distribution of SMRT sequencing reads based on the various amplicon sizes ∼633 bp (excised fragments) and ∼723bp (WT fragments). The sequences ranging between ∼723 bp and ∼4000 bp were fragments with indels and partially deleted repeat regions. Each bar represents distribution of reads from each of the three conditions (Cas9 + 5′ 3′-CTG repeat -gRNA , Cas9 control and gRNA control) and untreated DM1-iPSC-Myo control. ( B ) Representative image of CRISPR/Cas9-corrected DM1-iPSC-Myo (L81) stained for ribonuclear foci. Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9 were used as negative controls. An antisense Cy3-labeled probe was used to detect the presence of ribonuclear foci (NF). The ribonuclear foci negative and positive nuclei were denoted as NF − (white) and NF + (red), respectively. Each representative image is a maximum intensity z projection of the z slice images. For all the conditions (Cas9 + 3′ 5′-CTG repeat -gRNA , scrambled gRNA and no Cas9) enlarged z slices of selected ribonuclear foci negative (NF-) and positive (NF+) nucleus are represented. Nuclei were counter-stained with DAPI (scale bar = 20 μm). ( C ) Quantification of ribonuclear foci (NF) in CRISPR/Cas9-corrected DM1-iPSC Myo. The total number of ribonuclear foci per total number of nuclei was calculated. Total of nuclei counted is 6500. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P

    Techniques Used: CRISPR, Staining, Sequencing, Amplification, CTG Assay, Labeling, Two Tailed Test

    Biological effects of CRSIPR/Cas9 mediated correction of DM1-iPSC-Myo. ( A ) Dual staining for MBNL1 and ribonuclear foci co-localization in the CRSIPR/Cas9-corrected versus control conditions (Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9). Representative image of DM1-iPSC-Myo stained for MBNL1 and Ribonuclear foci by combined immunostaining-FISH staining. Each representative image is a maximum intensity z projection of the z slices. For control conditions, enlarged image of selected nuclei are represented under different filters. For the condition (Cas9 + 3′ 5′-CTG repeat -gRNA ) enlarged z slices of selected ribonuclear foci negative (NF-) and positive (NF+) nucleus are represented under different filters. Nuclei were counterstained with DAPI. ( B ) Quantification of the microscopy data is represented in term of ratio between the total dual positive (MBNL1 + RNA + foci)/total number of nuclei observed in each condition for the L23, L81, FL8 and FL5 DM1-iPSC-Myo cells. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P
    Figure Legend Snippet: Biological effects of CRSIPR/Cas9 mediated correction of DM1-iPSC-Myo. ( A ) Dual staining for MBNL1 and ribonuclear foci co-localization in the CRSIPR/Cas9-corrected versus control conditions (Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9). Representative image of DM1-iPSC-Myo stained for MBNL1 and Ribonuclear foci by combined immunostaining-FISH staining. Each representative image is a maximum intensity z projection of the z slices. For control conditions, enlarged image of selected nuclei are represented under different filters. For the condition (Cas9 + 3′ 5′-CTG repeat -gRNA ) enlarged z slices of selected ribonuclear foci negative (NF-) and positive (NF+) nucleus are represented under different filters. Nuclei were counterstained with DAPI. ( B ) Quantification of the microscopy data is represented in term of ratio between the total dual positive (MBNL1 + RNA + foci)/total number of nuclei observed in each condition for the L23, L81, FL8 and FL5 DM1-iPSC-Myo cells. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P

    Techniques Used: Staining, CTG Assay, Immunostaining, Fluorescence In Situ Hybridization, Microscopy, Two Tailed Test

    8) Product Images from "POMK regulates dystroglycan function via LARGE1-mediated elongation of matriglycan"

    Article Title: POMK regulates dystroglycan function via LARGE1-mediated elongation of matriglycan

    Journal: eLife

    doi: 10.7554/eLife.61388

    Schematic for Generation of Floxed Alleles of Pomk . Map of 5’ and 3’ LoxP sites (orange). LoxP sites flanking exon 5 of Pomk (large black box), which encodes the majority of the kinase domain of POMK, were inserted using CRISPR/Cas9. Cre-mediated recombination of the floxed allele of Pomk is predicted to lead to a loss of exon 5.
    Figure Legend Snippet: Schematic for Generation of Floxed Alleles of Pomk . Map of 5’ and 3’ LoxP sites (orange). LoxP sites flanking exon 5 of Pomk (large black box), which encodes the majority of the kinase domain of POMK, were inserted using CRISPR/Cas9. Cre-mediated recombination of the floxed allele of Pomk is predicted to lead to a loss of exon 5.

    Techniques Used: CRISPR

    9) Product Images from "Elongation factor ELOF1 drives transcription-coupled repair and prevents genome instability"

    Article Title: Elongation factor ELOF1 drives transcription-coupled repair and prevents genome instability

    Journal: bioRxiv

    doi: 10.1101/2021.05.11.443558

    Genome-wide CRISPR/cas9 screen identifies ELOF1 as a novel factor involved in the UV-induced DNA damage response. (A) Schematic of the CRISPR/cas9 screen. MRC-5 (SV40) cells infected with a lentiviral sgRNA library were mock-treated or irradiated daily with 6.8 J/m 2 UV-C for 10 consecutive days. sgRNA abundance was determined by sequencing and UV-sensitive genes were identified by comparing the abundance in UV-irradiated cells over mock-treated cells. The screen was performed in duplicate. (B) UV-sensitive genes were ranked based on the gene-based P-value resulting from MaGecK analysis of the change in abundance of sgRNAs in UV-treated over mock-treated. Dotted line indicates FDR=0.1. Genes involved in NER or TLS are color-coded. (C) Top 10 enriched GO terms (biological process) identified using g:Profiler of UV-sensitive genes with FDR
    Figure Legend Snippet: Genome-wide CRISPR/cas9 screen identifies ELOF1 as a novel factor involved in the UV-induced DNA damage response. (A) Schematic of the CRISPR/cas9 screen. MRC-5 (SV40) cells infected with a lentiviral sgRNA library were mock-treated or irradiated daily with 6.8 J/m 2 UV-C for 10 consecutive days. sgRNA abundance was determined by sequencing and UV-sensitive genes were identified by comparing the abundance in UV-irradiated cells over mock-treated cells. The screen was performed in duplicate. (B) UV-sensitive genes were ranked based on the gene-based P-value resulting from MaGecK analysis of the change in abundance of sgRNAs in UV-treated over mock-treated. Dotted line indicates FDR=0.1. Genes involved in NER or TLS are color-coded. (C) Top 10 enriched GO terms (biological process) identified using g:Profiler of UV-sensitive genes with FDR

    Techniques Used: Genome Wide, CRISPR, Infection, Irradiation, Sequencing

    (A) Indicated mutant yeast strains were serially 10-fold diluted, spotted, and exposed to indicated UV-C doses. (B) Schematic showing the CPD-seq method. Isolated DNA is sonicated and adaptors are ligated. Subsequently, CPDs are cleaved by T4 endonuclease V and APE1 nuclease to generate 3’ ends. Following denaturing of the DNA, the ends are ligated to a second adaptor that allows sequencing of CPDs. (C) Gene plot analysis of CPD-seq data following 2-hour repair for ∼4500 yeast genes, ordered by transcription frequency. Plots depict fraction of unrepaired CPDs following 2-hour repair relative to no repair for both the transcribed strand (TS) and non-transcribed strand (NTS) for gene coding regions, regions upstream of the transcription start site (TSS), and downstream of the transcription termination site (TTS). Each row represents approximately 10 genes to display the plot in a compact manner. (D) Analysis of bulk repair of UV-induced CPD lesions in Wt and elf1 Δ mutant yeast. The repair of CPD lesions at various time points was measured by T4 endonuclease V digestion and alkaline gel electrophoresis of genomic DNA isolated from UV-irradiated yeast (100 J/m 2 UV-C light). A representative gel is shown on the left. The right panel depicts the quantification of CPD repair at each time point from at least three independent experiments ±SEM. * P ≤0.05. (E) Single nucleotide resolution analysis of CPD-seq data downstream of the TTS of ∼4500 yeast genes. Plots depict fraction of unrepaired CPDs following 2-hour repair relative to no repair for both TS and NTS. Nucleosome positioning data is shown for reference. (F) Controls for UV spotting assays shown in Fig. 3I . (G) Image showing repair of CPDs in the TS of the RPB2 gene for indicated yeast strains. The image was generated by converting counts of sequencing reads aligned to the sites of the RPB2 fragment into bands. ‘ U ’ indicates samples from unirradiated cells. Nucleotide positions relative to the TSS (+1) of the RPB2 gene are indicated on the left. (H) Left panel: Relative percentage of CPDs remaining in the short region (within 54 bp) immediately downstream of the transcription start site of the RPB2 gene. Right panel: Relative percentage of CPDs remaining in the more downstream region (from 69 to 353 bp) of the RPB2 gene. Error bars (S.D.) are shown only for most relevant strains for clarity. (I) Schematic representation of the C. elegans elof-1 genomic organization, depicting the 180 bp emc203 deletion allele generated with CRISPR/Cas9. Shaded boxes represent exons with coding sequences shown in black.
    Figure Legend Snippet: (A) Indicated mutant yeast strains were serially 10-fold diluted, spotted, and exposed to indicated UV-C doses. (B) Schematic showing the CPD-seq method. Isolated DNA is sonicated and adaptors are ligated. Subsequently, CPDs are cleaved by T4 endonuclease V and APE1 nuclease to generate 3’ ends. Following denaturing of the DNA, the ends are ligated to a second adaptor that allows sequencing of CPDs. (C) Gene plot analysis of CPD-seq data following 2-hour repair for ∼4500 yeast genes, ordered by transcription frequency. Plots depict fraction of unrepaired CPDs following 2-hour repair relative to no repair for both the transcribed strand (TS) and non-transcribed strand (NTS) for gene coding regions, regions upstream of the transcription start site (TSS), and downstream of the transcription termination site (TTS). Each row represents approximately 10 genes to display the plot in a compact manner. (D) Analysis of bulk repair of UV-induced CPD lesions in Wt and elf1 Δ mutant yeast. The repair of CPD lesions at various time points was measured by T4 endonuclease V digestion and alkaline gel electrophoresis of genomic DNA isolated from UV-irradiated yeast (100 J/m 2 UV-C light). A representative gel is shown on the left. The right panel depicts the quantification of CPD repair at each time point from at least three independent experiments ±SEM. * P ≤0.05. (E) Single nucleotide resolution analysis of CPD-seq data downstream of the TTS of ∼4500 yeast genes. Plots depict fraction of unrepaired CPDs following 2-hour repair relative to no repair for both TS and NTS. Nucleosome positioning data is shown for reference. (F) Controls for UV spotting assays shown in Fig. 3I . (G) Image showing repair of CPDs in the TS of the RPB2 gene for indicated yeast strains. The image was generated by converting counts of sequencing reads aligned to the sites of the RPB2 fragment into bands. ‘ U ’ indicates samples from unirradiated cells. Nucleotide positions relative to the TSS (+1) of the RPB2 gene are indicated on the left. (H) Left panel: Relative percentage of CPDs remaining in the short region (within 54 bp) immediately downstream of the transcription start site of the RPB2 gene. Right panel: Relative percentage of CPDs remaining in the more downstream region (from 69 to 353 bp) of the RPB2 gene. Error bars (S.D.) are shown only for most relevant strains for clarity. (I) Schematic representation of the C. elegans elof-1 genomic organization, depicting the 180 bp emc203 deletion allele generated with CRISPR/Cas9. Shaded boxes represent exons with coding sequences shown in black.

    Techniques Used: Mutagenesis, Isolation, Sonication, Sequencing, Nucleic Acid Electrophoresis, Irradiation, Generated, CRISPR

    10) Product Images from "Selection and gene flow shape niche-associated variation in pheromone response"

    Article Title: Selection and gene flow shape niche-associated variation in pheromone response

    Journal: Nature ecology & evolution

    doi: 10.1038/s41559-019-0982-3

    Natural variant in the ascr#5 receptor gene, srg-37 , underlies natural differences in dauer formation (a) A schematic plot for the srg-37 gene structure (grey), 94-bp natural deletion allele ean179 (red), and CRISPR-Cas9 genome-editing target sequences for the putative loss-of-function deletion (purple) are shown. (b) Tukey box plots of dauer formation split by srg-37 genotype are shown. Each dot corresponds to the phenotype of an individual strain, which is plotted on the y-axis by the normalized dauer fraction. Strains are grouped by their srg-37 genotype, where REF (blue) corresponds to the wild-type reference allele from the laboratory N2 strain and DEL (red) corresponds to the natural 94-bp deletion allele ( ean179 ). (c) Tukey box plots of the ascr#5 dose-response differences at 25°C among two wild isolates and srg-37(lf) mutants in both backgrounds are shown with data points plotted behind. A dose response comparison is shown between (Left) JU346 srg-37(+) (blue) and JU346 srg-37(lf) (purple) and (Right) NIC166 srg-37(ean179) (red) and NIC166 srg-37(lf) (purple). The concentration of ascr#5 is shown on the x-axis, and the fraction of dauer formation is shown on the y-axis. (d) Tajima’s D statistics across the srg-36 srg-37 locus are shown. Each dot corresponds to a Tajima’s D statistic calculated from the allele frequency spectrum of 50 SNVs across 249 wild isolates. The gene structures of srg-36 (blue) and srg-37 (pink) are shown below the plot. The genomic position in Mb is plotted on the x-axis, and Tajima’s D statistics are plotted on the y-axis. (e) Tukey box plots of srg-36 and srg-37 loss-of-function experiments under control (red, 0.4% ethanol) and ascr#5 pheromone conditions (blue, 2 μM of ascr#5) at 25°C are shown with data points plotted behind. Genotypes of srg-36 and srg-37 are shown on the x-axis, where triangles represent the CRISPR-Cas9-mediated deletions. Fractions of dauer formation are shown on the y-axis. (b, c, e) The horizontal line in the middle of the box is the median, and the box denotes the 25th to 75th quantiles of the data. The vertical line represents the 1.5 interquartile range.
    Figure Legend Snippet: Natural variant in the ascr#5 receptor gene, srg-37 , underlies natural differences in dauer formation (a) A schematic plot for the srg-37 gene structure (grey), 94-bp natural deletion allele ean179 (red), and CRISPR-Cas9 genome-editing target sequences for the putative loss-of-function deletion (purple) are shown. (b) Tukey box plots of dauer formation split by srg-37 genotype are shown. Each dot corresponds to the phenotype of an individual strain, which is plotted on the y-axis by the normalized dauer fraction. Strains are grouped by their srg-37 genotype, where REF (blue) corresponds to the wild-type reference allele from the laboratory N2 strain and DEL (red) corresponds to the natural 94-bp deletion allele ( ean179 ). (c) Tukey box plots of the ascr#5 dose-response differences at 25°C among two wild isolates and srg-37(lf) mutants in both backgrounds are shown with data points plotted behind. A dose response comparison is shown between (Left) JU346 srg-37(+) (blue) and JU346 srg-37(lf) (purple) and (Right) NIC166 srg-37(ean179) (red) and NIC166 srg-37(lf) (purple). The concentration of ascr#5 is shown on the x-axis, and the fraction of dauer formation is shown on the y-axis. (d) Tajima’s D statistics across the srg-36 srg-37 locus are shown. Each dot corresponds to a Tajima’s D statistic calculated from the allele frequency spectrum of 50 SNVs across 249 wild isolates. The gene structures of srg-36 (blue) and srg-37 (pink) are shown below the plot. The genomic position in Mb is plotted on the x-axis, and Tajima’s D statistics are plotted on the y-axis. (e) Tukey box plots of srg-36 and srg-37 loss-of-function experiments under control (red, 0.4% ethanol) and ascr#5 pheromone conditions (blue, 2 μM of ascr#5) at 25°C are shown with data points plotted behind. Genotypes of srg-36 and srg-37 are shown on the x-axis, where triangles represent the CRISPR-Cas9-mediated deletions. Fractions of dauer formation are shown on the y-axis. (b, c, e) The horizontal line in the middle of the box is the median, and the box denotes the 25th to 75th quantiles of the data. The vertical line represents the 1.5 interquartile range.

    Techniques Used: Variant Assay, CRISPR, Concentration Assay

    11) Product Images from "Gene silencing by double-stranded RNA from C. elegans neurons reveals functional mosaicism of RNA interference"

    Article Title: Gene silencing by double-stranded RNA from C. elegans neurons reveals functional mosaicism of RNA interference

    Journal: bioRxiv

    doi: 10.1101/393074

    Schematic of genomic changes made using Cas9-based genome editing. Genomic changes introduced into the rde-11 , gtbp-1 , rrf-2 , rrf-3 , ego-1 , mut-16 , unc-22 , and sur-5 loci in this study are indicated. The sgRNA target site is indicated (blue for insertions and orange for point mutations and deletions) on the gene structure (exons = grey boxes, introns = grey lines, stop codon = black). Homology-directed repair templates were used to either insert gfp sequences (B, G and H), create point mutations (A, E and F) or to delete the region between two target sites (C and D). Asterisks indicate stop codons and scale bars are as indicated.
    Figure Legend Snippet: Schematic of genomic changes made using Cas9-based genome editing. Genomic changes introduced into the rde-11 , gtbp-1 , rrf-2 , rrf-3 , ego-1 , mut-16 , unc-22 , and sur-5 loci in this study are indicated. The sgRNA target site is indicated (blue for insertions and orange for point mutations and deletions) on the gene structure (exons = grey boxes, introns = grey lines, stop codon = black). Homology-directed repair templates were used to either insert gfp sequences (B, G and H), create point mutations (A, E and F) or to delete the region between two target sites (C and D). Asterisks indicate stop codons and scale bars are as indicated.

    Techniques Used:

    Silencing in the absence of RRF-1 can occur at multiple gfp targets expressed under the control of different regulatory elements. (A) Silencing in the absence of RRF-1 does not depend on chromosomal location of target sequences. Effect of Prgef-1::gfp -dsRNA and loss of rrf-1 on GFP fluorescence in animals with Peft-3::gfp transgenes located on different chromosomes was quantified as in Figure 2B . Grey boxes, cyan boxes, red bars, n, and asterisks are as in Figure 2B . (B-C) A single-copy gene fusion generated using Cas9-based genome editing can be silenced by neuronal dsRNA in rrf-1(-) animals. Representative L4-staged animals that express GFP in all tissues ( Pgtbp-1::gtbp-1::gfp , top ) and animals that in addition express Prgef-1::gfp -dsRNA in rrf-1(+) or rrf-1(-) backgrounds ( middle or bottom , respectively) are shown (B). Insets are representative of the region quantified in multiple animals. Quantification of silencing for GFP expressed from Pgtbp-1::gtbp-1::gfp is shown (C). Grey boxes, cyan boxes, red bars, n, and asterisks are as in Figure 2B . Scale bar = 50 µm. (D) Silencing in the absence of RRF-1 is associated with a detectable decrease in protein levels. Western blot of GFP protein levels in Peft-3::gfp animals expressing gfp -dsRNA in an otherwise wild type background (+/+), mut-16(-) background (no silencing) or rrf-1(-) background (partial silencing). Levels of GFP are normalized to αα -tubulin and the median ratios of 3 technical replicates are shown.
    Figure Legend Snippet: Silencing in the absence of RRF-1 can occur at multiple gfp targets expressed under the control of different regulatory elements. (A) Silencing in the absence of RRF-1 does not depend on chromosomal location of target sequences. Effect of Prgef-1::gfp -dsRNA and loss of rrf-1 on GFP fluorescence in animals with Peft-3::gfp transgenes located on different chromosomes was quantified as in Figure 2B . Grey boxes, cyan boxes, red bars, n, and asterisks are as in Figure 2B . (B-C) A single-copy gene fusion generated using Cas9-based genome editing can be silenced by neuronal dsRNA in rrf-1(-) animals. Representative L4-staged animals that express GFP in all tissues ( Pgtbp-1::gtbp-1::gfp , top ) and animals that in addition express Prgef-1::gfp -dsRNA in rrf-1(+) or rrf-1(-) backgrounds ( middle or bottom , respectively) are shown (B). Insets are representative of the region quantified in multiple animals. Quantification of silencing for GFP expressed from Pgtbp-1::gtbp-1::gfp is shown (C). Grey boxes, cyan boxes, red bars, n, and asterisks are as in Figure 2B . Scale bar = 50 µm. (D) Silencing in the absence of RRF-1 is associated with a detectable decrease in protein levels. Western blot of GFP protein levels in Peft-3::gfp animals expressing gfp -dsRNA in an otherwise wild type background (+/+), mut-16(-) background (no silencing) or rrf-1(-) background (partial silencing). Levels of GFP are normalized to αα -tubulin and the median ratios of 3 technical replicates are shown.

    Techniques Used: Fluorescence, Generated, Western Blot, Expressing

    12) Product Images from "A variant in IL6ST with a selective IL-11 signaling defect in human and mouse"

    Article Title: A variant in IL6ST with a selective IL-11 signaling defect in human and mouse

    Journal: Bone Research

    doi: 10.1038/s41413-020-0098-z

    Mice with a homozygous Il6st p.R279Q substitution develop facial synostosis. a CRISPR/Cas9-mediated generation of Il6st p.R279Q mice. An sgRNA sequence was selected to direct Cas9 cleavage close to the Arg-279-encoding codon. Genome editing was mediated by homology-directed repair with a 120 nt single strand (ss) DNA donor which introduced a c.[835G > A;836A > G] mutation resulting in a p.Arg279Gln exchange. In addition, a c.854G > A silent mutation to destroy the PAM sequence, and a c.857C > T silent mutation to insert a Bgl II site were introduced. PAM sequence is highlighted in light orange and sgRNA target sequence in light blue. Nucleotide exchanges are marked in red and the Bgl II site is underlined in blue. b IL-11 signaling is impaired in Il6st p.R279Q homozygous mice. Primary murine skin fibroblasts were stimulated for 15 min with the indicated cytokines and phosphorylation of STAT3 was analyzed by flow cytometry. HypIL-6 and HypIL-11 are artificial fusion proteins of IL-6 and soluble IL6RA or IL-11 and soluble IL11RA respectively. Shown is one representative plot and the quantification of n = 3–6 animals/group in technical duplicates in two independent experiments; results from fibroblasts of mouse line 4 and 6 were combined. * P
    Figure Legend Snippet: Mice with a homozygous Il6st p.R279Q substitution develop facial synostosis. a CRISPR/Cas9-mediated generation of Il6st p.R279Q mice. An sgRNA sequence was selected to direct Cas9 cleavage close to the Arg-279-encoding codon. Genome editing was mediated by homology-directed repair with a 120 nt single strand (ss) DNA donor which introduced a c.[835G > A;836A > G] mutation resulting in a p.Arg279Gln exchange. In addition, a c.854G > A silent mutation to destroy the PAM sequence, and a c.857C > T silent mutation to insert a Bgl II site were introduced. PAM sequence is highlighted in light orange and sgRNA target sequence in light blue. Nucleotide exchanges are marked in red and the Bgl II site is underlined in blue. b IL-11 signaling is impaired in Il6st p.R279Q homozygous mice. Primary murine skin fibroblasts were stimulated for 15 min with the indicated cytokines and phosphorylation of STAT3 was analyzed by flow cytometry. HypIL-6 and HypIL-11 are artificial fusion proteins of IL-6 and soluble IL6RA or IL-11 and soluble IL11RA respectively. Shown is one representative plot and the quantification of n = 3–6 animals/group in technical duplicates in two independent experiments; results from fibroblasts of mouse line 4 and 6 were combined. * P

    Techniques Used: Mouse Assay, CRISPR, Sequencing, Mutagenesis, Flow Cytometry

    13) Product Images from "Combi-CRISPR: combination of NHEJ and HDR provides efficient and precise plasmid-based knock-ins in mice and rats"

    Article Title: Combi-CRISPR: combination of NHEJ and HDR provides efficient and precise plasmid-based knock-ins in mice and rats

    Journal: Human Genetics

    doi: 10.1007/s00439-020-02198-4

    Knock-in rats generated by injection of two sgRNAs, Cas9, and a donor dsDNA in rat zygotes. a Methods to integrate the P2A-Cre cassette at the terminal codon of the Pvalb gene with lssDNA (above) or dsDNA (bottom). Microinjection of two sgRNA, Cas9, and dsDNA provided a KI rat (#1) carrying precise KIs of the Cre cassette at the sgRNA-1 targeting site and a 1 bp deletion mutation at the sgRNA-2 targeting site. b , e Comparison of three methods using dsDNA with single sgRNA-1 (HR), lssDNA with sgRNA-1 (lssDNA), or dsDNA with two sgRNAs ( Combi -CRISPR) for KIs in rat zygotes. c , f PCR analysis using primer sets amplifying the internal region of the Cre cassette (first screening) or for 5′ genome-donor boundary (Upstream) and donor-3′ genome boundary (Downstream in second screening) in delivered rat pups (#1–2 for c and #1–5 for f ). M: 100 bp DNA ladder marker. d Methods to integrate the P2A-Cre cassette at the terminal codon of the Th gene with lssDNA (above) or dsDNA (bottom). Microinjection of two sgRNA, Cas9, and dsDNA provided two KI rats (#4, 5) carrying precise KIs of the Cre cassette at the sgRNA-1 targeting site and insertion or deletion mutations at the sgRNA-2 targeting site. Integration of the P2A-Cre cassette with the 3′ HA, and confirmation of the vector sequences by PCR and sequencing analysis in #3 rat
    Figure Legend Snippet: Knock-in rats generated by injection of two sgRNAs, Cas9, and a donor dsDNA in rat zygotes. a Methods to integrate the P2A-Cre cassette at the terminal codon of the Pvalb gene with lssDNA (above) or dsDNA (bottom). Microinjection of two sgRNA, Cas9, and dsDNA provided a KI rat (#1) carrying precise KIs of the Cre cassette at the sgRNA-1 targeting site and a 1 bp deletion mutation at the sgRNA-2 targeting site. b , e Comparison of three methods using dsDNA with single sgRNA-1 (HR), lssDNA with sgRNA-1 (lssDNA), or dsDNA with two sgRNAs ( Combi -CRISPR) for KIs in rat zygotes. c , f PCR analysis using primer sets amplifying the internal region of the Cre cassette (first screening) or for 5′ genome-donor boundary (Upstream) and donor-3′ genome boundary (Downstream in second screening) in delivered rat pups (#1–2 for c and #1–5 for f ). M: 100 bp DNA ladder marker. d Methods to integrate the P2A-Cre cassette at the terminal codon of the Th gene with lssDNA (above) or dsDNA (bottom). Microinjection of two sgRNA, Cas9, and dsDNA provided two KI rats (#4, 5) carrying precise KIs of the Cre cassette at the sgRNA-1 targeting site and insertion or deletion mutations at the sgRNA-2 targeting site. Integration of the P2A-Cre cassette with the 3′ HA, and confirmation of the vector sequences by PCR and sequencing analysis in #3 rat

    Techniques Used: Knock-In, Generated, Injection, Mutagenesis, CRISPR, Polymerase Chain Reaction, Marker, Plasmid Preparation, Sequencing

    Schematic representation of precise and efficient knock-ins by Combi -CRISPR. A dsDNA donor vector was used with Cas9 and two sgRNAs, one designed to cut the targeted genome sequences (sgRNA-2) and the other to cut both the flanked genomic region and one homology arm of the dsDNA plasmid (sgRNA-1 targeting). The NHEJ repair pathway dominantly induces indel mutations (purple) at the sgRNA-2 targeting site. Thereafter, the HDR pathway integrates a KI cassette (red) without any mutation at the sgRNA-1 targeting site. In some cases, the whole donor vector was integrated at the sgRNA-2 targeting site via NHEJ (black)
    Figure Legend Snippet: Schematic representation of precise and efficient knock-ins by Combi -CRISPR. A dsDNA donor vector was used with Cas9 and two sgRNAs, one designed to cut the targeted genome sequences (sgRNA-2) and the other to cut both the flanked genomic region and one homology arm of the dsDNA plasmid (sgRNA-1 targeting). The NHEJ repair pathway dominantly induces indel mutations (purple) at the sgRNA-2 targeting site. Thereafter, the HDR pathway integrates a KI cassette (red) without any mutation at the sgRNA-1 targeting site. In some cases, the whole donor vector was integrated at the sgRNA-2 targeting site via NHEJ (black)

    Techniques Used: CRISPR, Plasmid Preparation, Non-Homologous End Joining, Mutagenesis

    Injection of two sgRNAs, Cas9, and a donor dsDNA into mouse zygotes. a Methods to integrate the P2A-ERT2-iCre-ERT2 cassette at the terminal codon of the Kcnab1 gene with lssDNA (above) or dsDNA (bottom). Microinjection of two sgRNAs, Cas9, and dsDNA provided three KI mice (#1, 2, and 5) carrying precise KIs of the iCre cassette at the sgRNA-1 targeting site and insertion or deletion mutations at the sgRNA-2 targeting site. b , e Comparison of three methods using dsDNA with single sgRNA-1 (HR), lssDNA with sgRNA-1 (lssDNA), or dsDNA with two sgRNAs ( Combi -CRISPR) for KIs in mouse zygotes. c , f PCR analysis using primer sets amplifying the internal region of the iCre cassette (first screening) or for 5′ genome-donor boundary (Upstream) and donor-3′ genome boundary (Downstream in second screening) in delivered mouse pups (#1–9 for c and #1–5 for f ). M: 100 bp DNA ladder marker. d Methods to integrate P2A-iCre cassette at the terminal codon of the Mc4r gene with lssDNA (above) or dsDNA (bottom). Microinjection of two sgRNA, Cas9, and dsDNA provided three KI mice (#2–4) carrying precise KIs of the iCre cassette at the sgRNA-1 targeting site and several deletion mutations at the sgRNA-2 targeting site
    Figure Legend Snippet: Injection of two sgRNAs, Cas9, and a donor dsDNA into mouse zygotes. a Methods to integrate the P2A-ERT2-iCre-ERT2 cassette at the terminal codon of the Kcnab1 gene with lssDNA (above) or dsDNA (bottom). Microinjection of two sgRNAs, Cas9, and dsDNA provided three KI mice (#1, 2, and 5) carrying precise KIs of the iCre cassette at the sgRNA-1 targeting site and insertion or deletion mutations at the sgRNA-2 targeting site. b , e Comparison of three methods using dsDNA with single sgRNA-1 (HR), lssDNA with sgRNA-1 (lssDNA), or dsDNA with two sgRNAs ( Combi -CRISPR) for KIs in mouse zygotes. c , f PCR analysis using primer sets amplifying the internal region of the iCre cassette (first screening) or for 5′ genome-donor boundary (Upstream) and donor-3′ genome boundary (Downstream in second screening) in delivered mouse pups (#1–9 for c and #1–5 for f ). M: 100 bp DNA ladder marker. d Methods to integrate P2A-iCre cassette at the terminal codon of the Mc4r gene with lssDNA (above) or dsDNA (bottom). Microinjection of two sgRNA, Cas9, and dsDNA provided three KI mice (#2–4) carrying precise KIs of the iCre cassette at the sgRNA-1 targeting site and several deletion mutations at the sgRNA-2 targeting site

    Techniques Used: Injection, Mouse Assay, CRISPR, Polymerase Chain Reaction, Marker

    14) Product Images from "A model to study NMDA receptors in early nervous system development"

    Article Title: A model to study NMDA receptors in early nervous system development

    Journal: bioRxiv

    doi: 10.1101/807115

    Generation of loss-of-function lesions in grin1a and grin1b using CRISPR-Cas9. (A) Membrane topology of two NMDAR subunits (functional NMDARs are tetramers). Blue and red arrows indicate approximate sites for gRNA targets for grin1a and grin1b , respectively. NMDARs are composed of four modular domains: the extracellular ATD and LBD; the membrane-embedded TMD; and the intracellular CTD. Each individual subunit contributes three transmembrane segments (M1, M2 M4) and a M2 pore loop to form the ion channel. The most highly conserved motif in iGluRs, the SYTANLAAF motif (labeled in yellow), is within the M3 segment. gRNAs were designed to prevent generation of this motif and downstream elements (half of LBD, M4 and CTD). (B C) Schematic of gRNA target sites for grin1a (blue arrow) (B) and grin1b (red arrow) (C) as well as alignments of nucleotide ( upper ) and amino acid ( lower ) sequences. Induced mutations within the nucleotide sequences are denoted as either dashes (deletions) or highlighted blue (insertions). gRNA target site on the nucleotide sequence (gray highlight) and PAM sites (bolded) are adjacent to generated mutations. Altered amino acid sequence (bolded) and early stop codons (Red STOP) are generated in all alleles, disrupting the SYTANLAAF motif (yellow highlight) as well as removing the D2 lobe of the LBD, which would make the receptor non-functional. (D E) Lesions altered mRNA size in expected fashions. cDNA amplification of: ( D ) grin1a +/+ and grin1a −/− (unless otherwise noted, grin1a −/− denotes the sbu90 allele) producing expected product sizes of 147 bp and 140 bp, respectively; and ( E ) grin1b +/+ and grin1b −/− (unless otherwise noted, grin1b −/− denotes the sbu94 allele) producing expected product sizes of 109 bp and 126 bp, respectively. M denotes marker. For all genotypes, RNA was collected from homozygous intercrosses at 3 dpf.
    Figure Legend Snippet: Generation of loss-of-function lesions in grin1a and grin1b using CRISPR-Cas9. (A) Membrane topology of two NMDAR subunits (functional NMDARs are tetramers). Blue and red arrows indicate approximate sites for gRNA targets for grin1a and grin1b , respectively. NMDARs are composed of four modular domains: the extracellular ATD and LBD; the membrane-embedded TMD; and the intracellular CTD. Each individual subunit contributes three transmembrane segments (M1, M2 M4) and a M2 pore loop to form the ion channel. The most highly conserved motif in iGluRs, the SYTANLAAF motif (labeled in yellow), is within the M3 segment. gRNAs were designed to prevent generation of this motif and downstream elements (half of LBD, M4 and CTD). (B C) Schematic of gRNA target sites for grin1a (blue arrow) (B) and grin1b (red arrow) (C) as well as alignments of nucleotide ( upper ) and amino acid ( lower ) sequences. Induced mutations within the nucleotide sequences are denoted as either dashes (deletions) or highlighted blue (insertions). gRNA target site on the nucleotide sequence (gray highlight) and PAM sites (bolded) are adjacent to generated mutations. Altered amino acid sequence (bolded) and early stop codons (Red STOP) are generated in all alleles, disrupting the SYTANLAAF motif (yellow highlight) as well as removing the D2 lobe of the LBD, which would make the receptor non-functional. (D E) Lesions altered mRNA size in expected fashions. cDNA amplification of: ( D ) grin1a +/+ and grin1a −/− (unless otherwise noted, grin1a −/− denotes the sbu90 allele) producing expected product sizes of 147 bp and 140 bp, respectively; and ( E ) grin1b +/+ and grin1b −/− (unless otherwise noted, grin1b −/− denotes the sbu94 allele) producing expected product sizes of 109 bp and 126 bp, respectively. M denotes marker. For all genotypes, RNA was collected from homozygous intercrosses at 3 dpf.

    Techniques Used: CRISPR, Functional Assay, Labeling, Sequencing, Generated, Amplification, Marker

    15) Product Images from "Loss of Nuclear DNA ligase III Can Revert PARP Inhibitor Resistance in BRCA1-deficient Cells by Increasing DNA Replication Stress"

    Article Title: Loss of Nuclear DNA ligase III Can Revert PARP Inhibitor Resistance in BRCA1-deficient Cells by Increasing DNA Replication Stress

    Journal: bioRxiv

    doi: 10.1101/2021.03.24.436323

    Resistance to PARPi in Brca1 −/− ;Trp53bp1 −/− cells is Mediated by Nuclear LIG3. (A) Schematic representation of the generation of nuclear mutants. LIG3 gene contains two translation initiation ATG sites. The sequence flanked by both ATG sites functions as a mitochondrial targeting sequence. If translation is initiated at the upstream ATG site, a mitochondrial protein is produced, whereas translation initiated at the downstream ATG site produces the nuclear form. Ablation of the nuclear ATG allows cells to retain mitochondrial LIG3 function, but not nuclear function. CRISPR/Cas9 system was used to introduce in-frame ATG > CTC mutation in the nuclear ATG through the delivery of an homology repair template. (B) Immunoblot of LIG3 in whole cell lysates of KB1P-177a5, parental, heterozygous and homozygous mutants. (C) Immunostaining of LIG3 together with MitoTracker staining to examine the subcellular localization of LIG3 in mutant cells. (D) Quantification and (E) representative images of long-term clonogenic assay with KB1P-G3, KB1P-177a5, parental and mutant cells, treated with olaparib or untreated. Data are represented as mean ± SD. ***p
    Figure Legend Snippet: Resistance to PARPi in Brca1 −/− ;Trp53bp1 −/− cells is Mediated by Nuclear LIG3. (A) Schematic representation of the generation of nuclear mutants. LIG3 gene contains two translation initiation ATG sites. The sequence flanked by both ATG sites functions as a mitochondrial targeting sequence. If translation is initiated at the upstream ATG site, a mitochondrial protein is produced, whereas translation initiated at the downstream ATG site produces the nuclear form. Ablation of the nuclear ATG allows cells to retain mitochondrial LIG3 function, but not nuclear function. CRISPR/Cas9 system was used to introduce in-frame ATG > CTC mutation in the nuclear ATG through the delivery of an homology repair template. (B) Immunoblot of LIG3 in whole cell lysates of KB1P-177a5, parental, heterozygous and homozygous mutants. (C) Immunostaining of LIG3 together with MitoTracker staining to examine the subcellular localization of LIG3 in mutant cells. (D) Quantification and (E) representative images of long-term clonogenic assay with KB1P-G3, KB1P-177a5, parental and mutant cells, treated with olaparib or untreated. Data are represented as mean ± SD. ***p

    Techniques Used: Sequencing, Produced, CRISPR, Introduce, Mutagenesis, Immunostaining, Staining, Clonogenic Assay

    16) Product Images from "Multiplexed CRISPR/CAS9‐mediated engineering of pre‐clinical mouse models bearing native human B cell receptors"

    Article Title: Multiplexed CRISPR/CAS9‐mediated engineering of pre‐clinical mouse models bearing native human B cell receptors

    Journal: The EMBO Journal

    doi: 10.15252/embj.2020105926

    Generation of a KI mouse model bearing a pre‐rearranged PGT121 κ Strategy for the insertion of PGT121 pre‐rearranged VJ into the mouse Ig κ locus. Targeting DNA donor with 5ʹ (3.9 kb) and 3ʹ (3.9 kb) homology arms to the C57BL/6 WT mouse Ig κ locus, murine promoter, leader, and the human PGT121 light chain VJ sequences are located between two homology arms. Two sgRNAs, 18 and 11, were targeted at J4‐J5 region of Ig κ locus. CRISPR/Cas9‐mediated HDR leads to the insertion of the promoter and PGT121 sequences into the C57BL/6 mouse genome. V segments, enhancers, and the kappa constant regions are shown in gray and labeled appropriately. Yellow rectangles represent J segments; dark blue oval represents the Vκ4‐53 promoter (P); light blue line represents the inserted segment and red rectangles show the rearranged PGT121 VJ. “T” represents TaqMan probe. WT probes were used for the detection of WT allele, Leader probes were used for the detection of the 5ʹend of the insertion, the specific probes were used for the detection of pre‐arranged VJ insertion for PGT121 (probe sequences, see Appendix Table S1 ). A fragment of genomic DNA (2.2 kb) was amplified by PCR and in vitro sgRNA‐guided Cas9‐mediated cleavage assay was performed with each of the sgRNAs. sgRNA‐targeting sites are indicated by arrows, genomic DNA size is indicated by asterisk. B220 + single B cells from peripheral blood of three PGT121 LC KI naïve mice were sorted. B220 + B‐cell populations and their frequencies are shown in FACS plots (left panel). Ig light chains from single‐cell sorted B cells were PCR amplified and sequenced. The resulting IGLV libraries were compared to the PGT121 LC reference sequence. The pie charts indicate the frequency of IGLV sequences identical to human PGT121 (red) and mouse IGLV (gray).
    Figure Legend Snippet: Generation of a KI mouse model bearing a pre‐rearranged PGT121 κ Strategy for the insertion of PGT121 pre‐rearranged VJ into the mouse Ig κ locus. Targeting DNA donor with 5ʹ (3.9 kb) and 3ʹ (3.9 kb) homology arms to the C57BL/6 WT mouse Ig κ locus, murine promoter, leader, and the human PGT121 light chain VJ sequences are located between two homology arms. Two sgRNAs, 18 and 11, were targeted at J4‐J5 region of Ig κ locus. CRISPR/Cas9‐mediated HDR leads to the insertion of the promoter and PGT121 sequences into the C57BL/6 mouse genome. V segments, enhancers, and the kappa constant regions are shown in gray and labeled appropriately. Yellow rectangles represent J segments; dark blue oval represents the Vκ4‐53 promoter (P); light blue line represents the inserted segment and red rectangles show the rearranged PGT121 VJ. “T” represents TaqMan probe. WT probes were used for the detection of WT allele, Leader probes were used for the detection of the 5ʹend of the insertion, the specific probes were used for the detection of pre‐arranged VJ insertion for PGT121 (probe sequences, see Appendix Table S1 ). A fragment of genomic DNA (2.2 kb) was amplified by PCR and in vitro sgRNA‐guided Cas9‐mediated cleavage assay was performed with each of the sgRNAs. sgRNA‐targeting sites are indicated by arrows, genomic DNA size is indicated by asterisk. B220 + single B cells from peripheral blood of three PGT121 LC KI naïve mice were sorted. B220 + B‐cell populations and their frequencies are shown in FACS plots (left panel). Ig light chains from single‐cell sorted B cells were PCR amplified and sequenced. The resulting IGLV libraries were compared to the PGT121 LC reference sequence. The pie charts indicate the frequency of IGLV sequences identical to human PGT121 (red) and mouse IGLV (gray).

    Techniques Used: CRISPR, Labeling, Amplification, Polymerase Chain Reaction, In Vitro, Cleavage Assay, Mouse Assay, FACS, Sequencing

    Generation of CLK09 and CLK19 human BCR knock‐in mouse model Table shows the total number of pups, the number or frequency of human HC‐, human LC‐and human BCR KI pups after One‐step CRISPR/Cas9 microinjection of CLK09 and CLK19. Binding activity detection of heterozygous CLK09 human BCR KI mice to eOD‐GT8.8‐week‐old mice were detected by FACS. X ‐axis and Y ‐axis represent that BCR were stained with eOD‐GT8 tetramer conjugated with Alexa Fluor™ 488 and Alexa Fluor™ 647, respectively. Representative dots were gated as in Fig 2D . Quantification of eOD‐GT8 targeting CLK09 KI mice. X ‐axis represents F0 ( n = 1) and F2 ( n = 2) pups, Y ‐axis represents as in Fig 2E . Bars indicate mean ± SD from mice in each group. Binding activity detection of heterozygous and homozygous CLK19 human BCR KI mice to eOD‐GT8. 8‐week‐old mice were detected by FACS. X and Y axes represent as in (B). Quantification of eOD‐GT8 binding in H CLK19/WT κ CLK19/WT KI mice. X ‐axis represents F0 ( n = 3) and F1 ( n = 2) animals, Y ‐axis represents as in Fig 2E . Bars indicate mean ± SD from mice in each group.
    Figure Legend Snippet: Generation of CLK09 and CLK19 human BCR knock‐in mouse model Table shows the total number of pups, the number or frequency of human HC‐, human LC‐and human BCR KI pups after One‐step CRISPR/Cas9 microinjection of CLK09 and CLK19. Binding activity detection of heterozygous CLK09 human BCR KI mice to eOD‐GT8.8‐week‐old mice were detected by FACS. X ‐axis and Y ‐axis represent that BCR were stained with eOD‐GT8 tetramer conjugated with Alexa Fluor™ 488 and Alexa Fluor™ 647, respectively. Representative dots were gated as in Fig 2D . Quantification of eOD‐GT8 targeting CLK09 KI mice. X ‐axis represents F0 ( n = 1) and F2 ( n = 2) pups, Y ‐axis represents as in Fig 2E . Bars indicate mean ± SD from mice in each group. Binding activity detection of heterozygous and homozygous CLK19 human BCR KI mice to eOD‐GT8. 8‐week‐old mice were detected by FACS. X and Y axes represent as in (B). Quantification of eOD‐GT8 binding in H CLK19/WT κ CLK19/WT KI mice. X ‐axis represents F0 ( n = 3) and F1 ( n = 2) animals, Y ‐axis represents as in Fig 2E . Bars indicate mean ± SD from mice in each group.

    Techniques Used: Knock-In, CRISPR, Binding Assay, Activity Assay, Mouse Assay, FACS, Staining

    Generation of CLK21 human BCR knock‐in mouse model Table shows the total number of pups, the number or frequency of human HC‐, human LC‐, and human BCR KI pups after One‐step CRISPR/Cas9 microinjection of CLK21. CLK21 KI mice F0 and F1 generations. Squares represent male mice and circles represent female mice. Upper halves of squares or circles represent Ig κ, and the lower halves represent Ig H, as shown in the schematic. F0 generation mice genotyping results showing 7, 9 and 14 are H CLK21/WT κ WT/WT , 1 and 4 are H WT/WT κ CLK21/WT , and 2, 3, 6, and 12 are H CLK21/WT κ CLK21/WT . Mouse 3 was crossed with WT to obtain 11 F1 progeny: Five F1 mice are H WT/WT κ CLK21/WT , four are H CLK21/WT κ CLK21/WT and two are WT. Single‐cell sequencing for naïve B cells from heterozygous CLK21 double KI mice. Left column shows the gating strategy for sorting naïve B cells (upper) and eOD‐GT8‐specific naïve B cells (lower). Right pie charts show the frequency of paired HC and LC sequences among total naïve B cells (upper) and eOD‐GT8‐specific naïve B cells (lower). Germline‐targeting eOD‐GT8 binding activity of B cells from WT, H CLK21/WT κ WT/WT , H WT/WT κ CLK21/WT ) , and H CLK21/WT , κ CLK21/WT KI mice. 8‐week‐old mice were detected by FACS. X and Y axes represent that BCR were stained with eOD‐GT8 tetramer conjugated with Alexa Fluor™ 488 and Alexa Fluor™ 647, respectively. Representative dots were gated from Scatter/Singlet/Live (SSL), B220 + IgM + IgD + . Quantification of eOD‐GT8 binding in CLK21 KI mice. X‐axis represents F0 ( n = 1) and F1 ( n = 3) KI animals, and the Y ‐axis represents the percentage of eOD‐GT8 targeting binders in mature (IgM + IgD + ) B cells. Bars indicate mean ± SD from mice in each group.
    Figure Legend Snippet: Generation of CLK21 human BCR knock‐in mouse model Table shows the total number of pups, the number or frequency of human HC‐, human LC‐, and human BCR KI pups after One‐step CRISPR/Cas9 microinjection of CLK21. CLK21 KI mice F0 and F1 generations. Squares represent male mice and circles represent female mice. Upper halves of squares or circles represent Ig κ, and the lower halves represent Ig H, as shown in the schematic. F0 generation mice genotyping results showing 7, 9 and 14 are H CLK21/WT κ WT/WT , 1 and 4 are H WT/WT κ CLK21/WT , and 2, 3, 6, and 12 are H CLK21/WT κ CLK21/WT . Mouse 3 was crossed with WT to obtain 11 F1 progeny: Five F1 mice are H WT/WT κ CLK21/WT , four are H CLK21/WT κ CLK21/WT and two are WT. Single‐cell sequencing for naïve B cells from heterozygous CLK21 double KI mice. Left column shows the gating strategy for sorting naïve B cells (upper) and eOD‐GT8‐specific naïve B cells (lower). Right pie charts show the frequency of paired HC and LC sequences among total naïve B cells (upper) and eOD‐GT8‐specific naïve B cells (lower). Germline‐targeting eOD‐GT8 binding activity of B cells from WT, H CLK21/WT κ WT/WT , H WT/WT κ CLK21/WT ) , and H CLK21/WT , κ CLK21/WT KI mice. 8‐week‐old mice were detected by FACS. X and Y axes represent that BCR were stained with eOD‐GT8 tetramer conjugated with Alexa Fluor™ 488 and Alexa Fluor™ 647, respectively. Representative dots were gated from Scatter/Singlet/Live (SSL), B220 + IgM + IgD + . Quantification of eOD‐GT8 binding in CLK21 KI mice. X‐axis represents F0 ( n = 1) and F1 ( n = 3) KI animals, and the Y ‐axis represents the percentage of eOD‐GT8 targeting binders in mature (IgM + IgD + ) B cells. Bars indicate mean ± SD from mice in each group.

    Techniques Used: Knock-In, CRISPR, Mouse Assay, Sequencing, Binding Assay, Activity Assay, FACS, Staining

    17) Product Images from "H3 acetylation selectively promotes basal progenitor proliferation and neocortex expansion by activating TRNP1 expression"

    Article Title: H3 acetylation selectively promotes basal progenitor proliferation and neocortex expansion by activating TRNP1 expression

    Journal: bioRxiv

    doi: 10.1101/2021.03.06.434209

    In vitro testing of TRNP1 gRNAs. (A/B) TBR2-cells have higher basal levels of H3K9ac at TRNP1 promoter (A) and higher basal expression (B) of this gene compared to TBR2+ BPs. (C) DNA sequence alignment for two ortholog regions of mouse (m) and human (h) TRNP1 promoter and primers, which were used in CHIP/qPCR experiment (see also Fig. 6C ). Note that mhPrimer_1 set was used to amplify the region 1 of both mouse and human TRNP1 promoter. The mPrimer_2 and hPrimer_2 sets, which have similar sequence, were used to amplify the region 2. (D/E) TSA treatment significantly increases H3K9ac levels at TRNP1 promoter (D) and upregulates its expression (E) specifically in TBR2+ BPs but not in TBR2-cells. (F/G) Analysis of the Cas9 cutting efficiency guided by various gRNAs targeting the TRNP1 promoter. (F) Depiction of different gRNAs targeting various regions in TRNP1 promoter that were used for testing. (G) Agarose gel showing the cutting efficiency of each tested gRNA-Cas9 complex on a 1016-bp-long PCR product of TRNP1 promoter region. (H/I) ChIP/qPCR (H) and qPCR (I) analyses indicate that transfection of Neuro2A cells with gTRNP1#2 and #4 increases H3K9ac level at TRNP1 promoter (H) and upregulates its expression (I). Values are presented as means ± SEMs (*P
    Figure Legend Snippet: In vitro testing of TRNP1 gRNAs. (A/B) TBR2-cells have higher basal levels of H3K9ac at TRNP1 promoter (A) and higher basal expression (B) of this gene compared to TBR2+ BPs. (C) DNA sequence alignment for two ortholog regions of mouse (m) and human (h) TRNP1 promoter and primers, which were used in CHIP/qPCR experiment (see also Fig. 6C ). Note that mhPrimer_1 set was used to amplify the region 1 of both mouse and human TRNP1 promoter. The mPrimer_2 and hPrimer_2 sets, which have similar sequence, were used to amplify the region 2. (D/E) TSA treatment significantly increases H3K9ac levels at TRNP1 promoter (D) and upregulates its expression (E) specifically in TBR2+ BPs but not in TBR2-cells. (F/G) Analysis of the Cas9 cutting efficiency guided by various gRNAs targeting the TRNP1 promoter. (F) Depiction of different gRNAs targeting various regions in TRNP1 promoter that were used for testing. (G) Agarose gel showing the cutting efficiency of each tested gRNA-Cas9 complex on a 1016-bp-long PCR product of TRNP1 promoter region. (H/I) ChIP/qPCR (H) and qPCR (I) analyses indicate that transfection of Neuro2A cells with gTRNP1#2 and #4 increases H3K9ac level at TRNP1 promoter (H) and upregulates its expression (I). Values are presented as means ± SEMs (*P

    Techniques Used: In Vitro, Expressing, Sequencing, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Transfection

    18) Product Images from "Generation and characterization of Six2 conditional mice"

    Article Title: Generation and characterization of Six2 conditional mice

    Journal: Genesis (New York, N.Y. : 2000)

    doi: 10.1002/dvg.23365

    Design and generation of mice carrying the Six2 conditional allele. (a) Schematic of the CRISPR/Cas9-mediated gene targeting strategy to insert LoxP sites (green triangles) into 5’ and 3’ target sites (green dots) to flank exon-1 of the Six2 gene. E1, exon1; E2, exon2. F1, R1, F2, and R2 indicate approximate locations of PCR primers used for genotyping. (b) Sequences of sgRNA1 target site and the donor oligo template for 5’ LoxP insertion. Sequence of sgRNA1 target site sequence is shown on the top, with protospacer adjacent motif (PAM) in red font. The asymmetric single-stranded oligo donor (ssODN) template used for homology-directed repair to insert the 5’ loxP site into intron-1 is shown. Sequences in blue font (80 nucleotides) and black font (37 nucleotides) represent the asymmetric proximal and distal homology arms. The LoxP sequence is shown in green font, with three extra nucleotides to create a BamH1 restriction site for genotyping verification. (c) Sequences of sgRNA2 target site and the donor oligo template for 3’ LoxP insertion into intron-2 of the Six2 gene. Sequences in blue font (85 nucleotides) and black font (38 nucleotide) in the donor oligo represent the asymmetric proximal and distal homology arms. The LoxP sequence is shown in green font, with four additional nucleotides added to create a BamH1 restriction site for genotyping. (d) PCR genotyping results showing the identification of the wildtype and Six2 f alleles.
    Figure Legend Snippet: Design and generation of mice carrying the Six2 conditional allele. (a) Schematic of the CRISPR/Cas9-mediated gene targeting strategy to insert LoxP sites (green triangles) into 5’ and 3’ target sites (green dots) to flank exon-1 of the Six2 gene. E1, exon1; E2, exon2. F1, R1, F2, and R2 indicate approximate locations of PCR primers used for genotyping. (b) Sequences of sgRNA1 target site and the donor oligo template for 5’ LoxP insertion. Sequence of sgRNA1 target site sequence is shown on the top, with protospacer adjacent motif (PAM) in red font. The asymmetric single-stranded oligo donor (ssODN) template used for homology-directed repair to insert the 5’ loxP site into intron-1 is shown. Sequences in blue font (80 nucleotides) and black font (37 nucleotides) represent the asymmetric proximal and distal homology arms. The LoxP sequence is shown in green font, with three extra nucleotides to create a BamH1 restriction site for genotyping verification. (c) Sequences of sgRNA2 target site and the donor oligo template for 3’ LoxP insertion into intron-2 of the Six2 gene. Sequences in blue font (85 nucleotides) and black font (38 nucleotide) in the donor oligo represent the asymmetric proximal and distal homology arms. The LoxP sequence is shown in green font, with four additional nucleotides added to create a BamH1 restriction site for genotyping. (d) PCR genotyping results showing the identification of the wildtype and Six2 f alleles.

    Techniques Used: Mouse Assay, CRISPR, Polymerase Chain Reaction, Sequencing

    19) Product Images from "2-Locus Cleave and Rescue selfish elements harness a recombination rate-dependent generational clock for self limiting gene drive"

    Article Title: 2-Locus Cleave and Rescue selfish elements harness a recombination rate-dependent generational clock for self limiting gene drive

    Journal: bioRxiv

    doi: 10.1101/2020.07.09.196253

    Population behavior of 2-locus drive components Rescue tko and Cas9/ Cleaver alone and together as a complete 2-locus 50cM ClvR V2 element. Behavior of Rescue -only (A) and Cas9/Cleaver-only (B) behavior in a WT ( w 1118 ) background. (C) Genotype frequencies of Rescue tko (solid lines) and Cas9/Cleaver (dashed lines) when introduced together as a complete 2-locus 50cM ClvR V2 element , in four replicates (red, green, orange, and yellow). Predicted drive behavior from a model in which Rescue tko and Cleaver have additive fitness costs of 6.5% and 7.5%, respectively, are shown a blue lines (see methods for details). (D) Drive populations from (C) to which a 50% WT addition was made following generation 15.
    Figure Legend Snippet: Population behavior of 2-locus drive components Rescue tko and Cas9/ Cleaver alone and together as a complete 2-locus 50cM ClvR V2 element. Behavior of Rescue -only (A) and Cas9/Cleaver-only (B) behavior in a WT ( w 1118 ) background. (C) Genotype frequencies of Rescue tko (solid lines) and Cas9/Cleaver (dashed lines) when introduced together as a complete 2-locus 50cM ClvR V2 element , in four replicates (red, green, orange, and yellow). Predicted drive behavior from a model in which Rescue tko and Cleaver have additive fitness costs of 6.5% and 7.5%, respectively, are shown a blue lines (see methods for details). (D) Drive populations from (C) to which a 50% WT addition was made following generation 15.

    Techniques Used:

    Dynamics of 2-locus ClvR in three populations connected by bidirectional migration. Shown are frequencies (y-axis) over generations (x-axis) in 3 populations connected by migration (1% migration rate between populations 1 and 2, and between 2 and 3) after an initial 50% release, for a 2-locus ClvR V2 with a 5% FC per allele. (A-C) Single release of 2-locus 50cM ClvR V2. Rescue -bearing genotypes (yellow), Cas9-bearing genotypes (red), and LOF alleles (orange). (D-F) Same as above but with additional 5% releases every 20 generations. (G-O) Single 50% release of 2-locus ClvR ≤50cM with varying degrees of linkage: 50 cM (yellow), 25 cM (orange), 10 cM (green), 5 cM (purple), 2 cM (olive), 1 cM (red), 0 cM (blue).
    Figure Legend Snippet: Dynamics of 2-locus ClvR in three populations connected by bidirectional migration. Shown are frequencies (y-axis) over generations (x-axis) in 3 populations connected by migration (1% migration rate between populations 1 and 2, and between 2 and 3) after an initial 50% release, for a 2-locus ClvR V2 with a 5% FC per allele. (A-C) Single release of 2-locus 50cM ClvR V2. Rescue -bearing genotypes (yellow), Cas9-bearing genotypes (red), and LOF alleles (orange). (D-F) Same as above but with additional 5% releases every 20 generations. (G-O) Single 50% release of 2-locus ClvR ≤50cM with varying degrees of linkage: 50 cM (yellow), 25 cM (orange), 10 cM (green), 5 cM (purple), 2 cM (olive), 1 cM (red), 0 cM (blue).

    Techniques Used: Migration

    Drive outcomes with all the scored genotypes. Legend on top of panels with Rescue /Cargo-bearing in red, Cas9-bearing in orange, Cleaver/Rescue in violet, Cleaver -only in green, Rescue -only in blue, and WT in yellow. (A-D) Replicates A-D. WT and Cleaver;Rescue in dotted lines for visibility.
    Figure Legend Snippet: Drive outcomes with all the scored genotypes. Legend on top of panels with Rescue /Cargo-bearing in red, Cas9-bearing in orange, Cleaver/Rescue in violet, Cleaver -only in green, Rescue -only in blue, and WT in yellow. (A-D) Replicates A-D. WT and Cleaver;Rescue in dotted lines for visibility.

    Techniques Used:

    2-locus ClvR constructs, markers and alignment of Cas9 mutation. (A) Schematic of 2-locus ClvR constructs. The Cleaver (Cas9) is on the 2nd chromosome, Rescue /Cargo/gRNAs are on the 3rd. (B-D) Marker expression in different genotypes. (B) Cleaver;Rescue fly expressing eye-specific ( 3xP3 ) and ubiquitous ( OpIE ) td-tomato , (C) Cleaver -only fly expressing eye-specific td-tomato (D) Rescue -only fly expressing ubiquitous td-tomato . (E) Cas9 LOF mutation in original ClvR tko locus. The sequence alignment shows the mutation induced.
    Figure Legend Snippet: 2-locus ClvR constructs, markers and alignment of Cas9 mutation. (A) Schematic of 2-locus ClvR constructs. The Cleaver (Cas9) is on the 2nd chromosome, Rescue /Cargo/gRNAs are on the 3rd. (B-D) Marker expression in different genotypes. (B) Cleaver;Rescue fly expressing eye-specific ( 3xP3 ) and ubiquitous ( OpIE ) td-tomato , (C) Cleaver -only fly expressing eye-specific td-tomato (D) Rescue -only fly expressing ubiquitous td-tomato . (E) Cas9 LOF mutation in original ClvR tko locus. The sequence alignment shows the mutation induced.

    Techniques Used: Construct, Mutagenesis, Marker, Expressing, Sequencing

    Heatmaps and single modeling runs with different genetic linkage and migration rate. Heatmaps showing the average of Rescue frequency for 100 (A-C) and 300 generations (D-F) . Linkage ranging from 0-50 cM, migration rate from 0.1-20% per generation (plot axes not to scale). (G-O) Single modeling runs from above with 0.1% (G-I) , 1% (J-L) , and 5% (M-O) migration rate. 1 cM in blue, 4 cM in red, 10 cM in green, Rescue solid, cleaved alleles dotted, and Cas9 with dashed lines
    Figure Legend Snippet: Heatmaps and single modeling runs with different genetic linkage and migration rate. Heatmaps showing the average of Rescue frequency for 100 (A-C) and 300 generations (D-F) . Linkage ranging from 0-50 cM, migration rate from 0.1-20% per generation (plot axes not to scale). (G-O) Single modeling runs from above with 0.1% (G-I) , 1% (J-L) , and 5% (M-O) migration rate. 1 cM in blue, 4 cM in red, 10 cM in green, Rescue solid, cleaved alleles dotted, and Cas9 with dashed lines

    Techniques Used: Migration

    Population dynamics of Killer-Rescue /Cargo, 1- and 2-locus 50cM ClvR V2. (A-F, and J-O) Plotted are genotype/allele frequencies (y-axis) over generations (x-axis). Release percentages are 10% (yellow), 20% (blue), 30% (green), 40% (red), and 60% (orange). (A-F) elements have no fitness costs; (J-O) 5% fitness cost/allele In these panels there is a 50% release percentage of WT in generation 150. Allele and genotype frequencies after this point are indicated with dotted lines. ( G-I) Rescue /Cargo (blue line) allele (G) and genotype frequencies over 50 generations (H) , and 600 generations (I); LOF (green lines); and Cas9 driver (always at zero; red line) in a population initially fixed for Cargo/ Rescue and LOF alleles, and lacking Cas9 (generation 0), into which a 50% release of WT is carried out in generation 1.
    Figure Legend Snippet: Population dynamics of Killer-Rescue /Cargo, 1- and 2-locus 50cM ClvR V2. (A-F, and J-O) Plotted are genotype/allele frequencies (y-axis) over generations (x-axis). Release percentages are 10% (yellow), 20% (blue), 30% (green), 40% (red), and 60% (orange). (A-F) elements have no fitness costs; (J-O) 5% fitness cost/allele In these panels there is a 50% release percentage of WT in generation 150. Allele and genotype frequencies after this point are indicated with dotted lines. ( G-I) Rescue /Cargo (blue line) allele (G) and genotype frequencies over 50 generations (H) , and 600 generations (I); LOF (green lines); and Cas9 driver (always at zero; red line) in a population initially fixed for Cargo/ Rescue and LOF alleles, and lacking Cas9 (generation 0), into which a 50% release of WT is carried out in generation 1.

    Techniques Used:

    1- and 2-locus ClvR configurations. (A) 1-locus ClvR . (B) 2-locus ClvR 50cM Version 1, in which Cargo/ Rescue and Cas9/gRNAs are on separate chromosomes, and thus show independent segregation (map distance of 50 cM (centi Morgan)) during meiosis. (C) 2-locus 50cM ClvR Version 2, in which Cas9 is on a different chromosome from gRNAs/Cargo/ Rescue. (D) 2-locus ClvR 50cM Version 3, in which gRNAs are on a different chromosome from Cas9/Cargo/ Rescue . (E) 2-locus ClvR
    Figure Legend Snippet: 1- and 2-locus ClvR configurations. (A) 1-locus ClvR . (B) 2-locus ClvR 50cM Version 1, in which Cargo/ Rescue and Cas9/gRNAs are on separate chromosomes, and thus show independent segregation (map distance of 50 cM (centi Morgan)) during meiosis. (C) 2-locus 50cM ClvR Version 2, in which Cas9 is on a different chromosome from gRNAs/Cargo/ Rescue. (D) 2-locus ClvR 50cM Version 3, in which gRNAs are on a different chromosome from Cas9/Cargo/ Rescue . (E) 2-locus ClvR

    Techniques Used:

    Comparison of Killer-Rescue and 2-locus ClvR genetics. (A) Shown is a cross between a heterozygous carrier of a Killer-Rescue to WT. Offspring inheriting only the Killer allele die, ⅓ of the remaining offspring carry the Killer , ⅔ carry the Rescue , ⅓ remains WT. (B) Shown is a cross between a female heterozygous for 2-locus ClvR to a WT male. Cas9 mutates the target gene to LOF in the female germline. The target allele coming from the WT male gets mutated in the zygote due to maternal carryover of Cas9/gRNA complexes. This results in half of the offspring dying because they don’t carry a copy of the Rescue. Of the remaining progeny 100% carry the Rescue and 50% carry the Cleaver . (C) When a 2-locus ClvR male mates with a WT female, all the progeny survives. The target gene that was mutated in the male germline remains in the offspring (black circle). (D) When an individual heterozygous for the target gene mates again with a ClvR male, some of the offspring will end up with 2 mutated copies of the target gene and die. Only individuals that carry the Rescue are protected. (E) When individuals with one copy of the target gene mate with each other, ¼ of the progeny will die. This results in WT alleles being lost from the population even if the Cleaver allele was already eliminated (action at a distance).
    Figure Legend Snippet: Comparison of Killer-Rescue and 2-locus ClvR genetics. (A) Shown is a cross between a heterozygous carrier of a Killer-Rescue to WT. Offspring inheriting only the Killer allele die, ⅓ of the remaining offspring carry the Killer , ⅔ carry the Rescue , ⅓ remains WT. (B) Shown is a cross between a female heterozygous for 2-locus ClvR to a WT male. Cas9 mutates the target gene to LOF in the female germline. The target allele coming from the WT male gets mutated in the zygote due to maternal carryover of Cas9/gRNA complexes. This results in half of the offspring dying because they don’t carry a copy of the Rescue. Of the remaining progeny 100% carry the Rescue and 50% carry the Cleaver . (C) When a 2-locus ClvR male mates with a WT female, all the progeny survives. The target gene that was mutated in the male germline remains in the offspring (black circle). (D) When an individual heterozygous for the target gene mates again with a ClvR male, some of the offspring will end up with 2 mutated copies of the target gene and die. Only individuals that carry the Rescue are protected. (E) When individuals with one copy of the target gene mate with each other, ¼ of the progeny will die. This results in WT alleles being lost from the population even if the Cleaver allele was already eliminated (action at a distance).

    Techniques Used:

    20) Product Images from "Engineering of Primary Human B cells with CRISPR/Cas9 Targeted Nuclease"

    Article Title: Engineering of Primary Human B cells with CRISPR/Cas9 Targeted Nuclease

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-30358-0

    B cells are efficiently edited by CRISPR/Cas9. ( A ) B cells were enriched and isolated, electroporated with either chemically modified sgRNA or Alt-R gRNA in combination with either Cas9 protein or chemically modified mRNA encoding Cas9 protein, and then assessed for indel formation (n = 6). ( B ) Frequency of indel formation as measured by TIDE analysis ( left panel ) and loss of CD19 expression as measured by flow cytometry ( right panel ), viability ( left panel ) and total cell numbers ( right panel ) (*indicate p
    Figure Legend Snippet: B cells are efficiently edited by CRISPR/Cas9. ( A ) B cells were enriched and isolated, electroporated with either chemically modified sgRNA or Alt-R gRNA in combination with either Cas9 protein or chemically modified mRNA encoding Cas9 protein, and then assessed for indel formation (n = 6). ( B ) Frequency of indel formation as measured by TIDE analysis ( left panel ) and loss of CD19 expression as measured by flow cytometry ( right panel ), viability ( left panel ) and total cell numbers ( right panel ) (*indicate p

    Techniques Used: CRISPR, Isolation, Modification, Expressing, Flow Cytometry, Cytometry

    B cells can be engineered using homologous recombination with rAAV6 donor and CRISPR/Cas9. ( A ) A schematic design of the DNA donor template for a splice acceptor- EGFP system targeting the AAVS1 site by HR used in this study. ( B ) Percentage of EGFP+ cells represent integration frequency following transfection with rAAV6 containing a splice acceptor- EGFP system at the indicated MOIs (n = 3). ( C ) PCR amplification using a combination of EGFP and AAVS1 primers of samples engineered with RNPs targeting AAVS1 and exposed to rAAV6 containing a splice acceptor-EGFP system at the indicated MOIs, as well as no gRNA (represented by ‘–’) and H 2 O controls.
    Figure Legend Snippet: B cells can be engineered using homologous recombination with rAAV6 donor and CRISPR/Cas9. ( A ) A schematic design of the DNA donor template for a splice acceptor- EGFP system targeting the AAVS1 site by HR used in this study. ( B ) Percentage of EGFP+ cells represent integration frequency following transfection with rAAV6 containing a splice acceptor- EGFP system at the indicated MOIs (n = 3). ( C ) PCR amplification using a combination of EGFP and AAVS1 primers of samples engineered with RNPs targeting AAVS1 and exposed to rAAV6 containing a splice acceptor-EGFP system at the indicated MOIs, as well as no gRNA (represented by ‘–’) and H 2 O controls.

    Techniques Used: Homologous Recombination, CRISPR, Transfection, Polymerase Chain Reaction, Amplification

    21) Product Images from "Disrupting the ghrelin-growth hormone axis limits ghrelin's orexigenic but not glucoregulatory actions"

    Article Title: Disrupting the ghrelin-growth hormone axis limits ghrelin's orexigenic but not glucoregulatory actions

    Journal: Molecular Metabolism

    doi: 10.1016/j.molmet.2021.101258

    Generation and validation of a novel GH-IRES-Cre mouse line. (A) Schematic of the derivation of the GH-IRES-Cre mice using CRISPER-Cas9 genome editing to insert an IRES-Cre cassette into exon 5 of the GH gene (insertion site marked by an arrow). (B) Validation of somatotroph-specific Cre activity in the GH-IRES-Cre mouse line as performed by observing overlapping GH immunoreactivity and tdTomato fluorescence in pituitaries but not brains of mice harboring a GH-IRES-Cre allele and a Rosa26-lox-STOP-lox-tdTomato transgene. Representative photomicrographs of a pituitary [at 10x magnification (a–c) and 40x magnification (d–f)] and brain [at 10x magnification as a negative control)] (g–l). tdTomato fluorescence (red) (a, d, g, and j); GH immunoreactivity (green) in the same sections (b, e, h, and k); co-localized tdTomato and GH immunoreactivity (yellow) in the same sections (c, f, i, and l); and DAPI nuclear stain (blue) (I and l). Note: In panel B.b, the labels A, I, and P indicate A: anterior lobe; I: intermediate lobe; and P: posterior lobe of the pituitary. n = 4. Scale bars = 100 μm. Expression of (C) GH mRNA and (D) Cre in various tissues. Data are 2 -ΔΔCt values relative to the expression of GH or Cre in the pituitary, n = 5.
    Figure Legend Snippet: Generation and validation of a novel GH-IRES-Cre mouse line. (A) Schematic of the derivation of the GH-IRES-Cre mice using CRISPER-Cas9 genome editing to insert an IRES-Cre cassette into exon 5 of the GH gene (insertion site marked by an arrow). (B) Validation of somatotroph-specific Cre activity in the GH-IRES-Cre mouse line as performed by observing overlapping GH immunoreactivity and tdTomato fluorescence in pituitaries but not brains of mice harboring a GH-IRES-Cre allele and a Rosa26-lox-STOP-lox-tdTomato transgene. Representative photomicrographs of a pituitary [at 10x magnification (a–c) and 40x magnification (d–f)] and brain [at 10x magnification as a negative control)] (g–l). tdTomato fluorescence (red) (a, d, g, and j); GH immunoreactivity (green) in the same sections (b, e, h, and k); co-localized tdTomato and GH immunoreactivity (yellow) in the same sections (c, f, i, and l); and DAPI nuclear stain (blue) (I and l). Note: In panel B.b, the labels A, I, and P indicate A: anterior lobe; I: intermediate lobe; and P: posterior lobe of the pituitary. n = 4. Scale bars = 100 μm. Expression of (C) GH mRNA and (D) Cre in various tissues. Data are 2 -ΔΔCt values relative to the expression of GH or Cre in the pituitary, n = 5.

    Techniques Used: Mouse Assay, Activity Assay, Fluorescence, Negative Control, Staining, Expressing

    22) Product Images from "Engineering of Primary Human B cells with CRISPR/Cas9 Targeted Nuclease"

    Article Title: Engineering of Primary Human B cells with CRISPR/Cas9 Targeted Nuclease

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-30358-0

    B cells are efficiently edited by CRISPR/Cas9. ( A ) B cells were enriched and isolated, electroporated with either chemically modified sgRNA or Alt-R gRNA in combination with either Cas9 protein or chemically modified mRNA encoding Cas9 protein, and then assessed for indel formation (n = 6). ( B ) Frequency of indel formation as measured by TIDE analysis ( left panel ) and loss of CD19 expression as measured by flow cytometry ( right panel ), viability ( left panel ) and total cell numbers ( right panel ) (*indicate p
    Figure Legend Snippet: B cells are efficiently edited by CRISPR/Cas9. ( A ) B cells were enriched and isolated, electroporated with either chemically modified sgRNA or Alt-R gRNA in combination with either Cas9 protein or chemically modified mRNA encoding Cas9 protein, and then assessed for indel formation (n = 6). ( B ) Frequency of indel formation as measured by TIDE analysis ( left panel ) and loss of CD19 expression as measured by flow cytometry ( right panel ), viability ( left panel ) and total cell numbers ( right panel ) (*indicate p

    Techniques Used: CRISPR, Isolation, Modification, Expressing, Flow Cytometry, Cytometry

    B cells can be engineered using homologous recombination with rAAV6 donor and CRISPR/Cas9. ( A ) A schematic design of the DNA donor template for a splice acceptor- EGFP system targeting the AAVS1 site by HR used in this study. ( B ) Percentage of EGFP+ cells represent integration frequency following transfection with rAAV6 containing a splice acceptor- EGFP system at the indicated MOIs (n = 3). ( C ) PCR amplification using a combination of EGFP and AAVS1 primers of samples engineered with RNPs targeting AAVS1 and exposed to rAAV6 containing a splice acceptor-EGFP system at the indicated MOIs, as well as no gRNA (represented by ‘–’) and H 2 O controls.
    Figure Legend Snippet: B cells can be engineered using homologous recombination with rAAV6 donor and CRISPR/Cas9. ( A ) A schematic design of the DNA donor template for a splice acceptor- EGFP system targeting the AAVS1 site by HR used in this study. ( B ) Percentage of EGFP+ cells represent integration frequency following transfection with rAAV6 containing a splice acceptor- EGFP system at the indicated MOIs (n = 3). ( C ) PCR amplification using a combination of EGFP and AAVS1 primers of samples engineered with RNPs targeting AAVS1 and exposed to rAAV6 containing a splice acceptor-EGFP system at the indicated MOIs, as well as no gRNA (represented by ‘–’) and H 2 O controls.

    Techniques Used: Homologous Recombination, CRISPR, Transfection, Polymerase Chain Reaction, Amplification

    23) Product Images from "LDLRAD3 is a receptor for Venezuelan equine encephalitis virus"

    Article Title: LDLRAD3 is a receptor for Venezuelan equine encephalitis virus

    Journal: Nature

    doi: 10.1038/s41586-020-2915-3

    Generation and clinical assessment of C57BL/6 mice with deletions in Ldlrad3 by CRISPR-Cas9 gene targeting. a. Scheme of Ldlrad3 gene locus with two sgRNA targeting guides for a site in exon 2 of both isoforms. The full-length and truncated Δ32 N-terminus residue Ldlrad3 isoforms are colored red (top) and orange (bottom), respectively. b. Sequencing and alignment of Ldlrad3 sgRNA targeting region in exon 2 (11- and 14-nucleotide frameshift deletions) in gene-edited Ldlrad3 mice. The amino acid residues and the two sgRNA guides used for gene-editing (blue and orange arrows) are indicated above. c-d. Seven-week-old male and female mice with deletions in Ldlrad3 (Δ11 or Δ14 nucleotides; homozygous or compound heterozygous) or wild-type C57BL/6 mice were inoculated subcutaneously with 10 3 PFU of VEEV TrD ( c, left panel ) or 10 2 FFU of VEEV ZPC738 ( d ). Mice were monitored for weight change. Data are from two experiments (VEEV TrD: WT, n = 12; Δ Ldlrad3 , n = 10; VEEV ZPC738: WT, n = 9; Δ Ldlrad3 , n = 8; two-way ANOVA with Dunnett’s post-test: ** P
    Figure Legend Snippet: Generation and clinical assessment of C57BL/6 mice with deletions in Ldlrad3 by CRISPR-Cas9 gene targeting. a. Scheme of Ldlrad3 gene locus with two sgRNA targeting guides for a site in exon 2 of both isoforms. The full-length and truncated Δ32 N-terminus residue Ldlrad3 isoforms are colored red (top) and orange (bottom), respectively. b. Sequencing and alignment of Ldlrad3 sgRNA targeting region in exon 2 (11- and 14-nucleotide frameshift deletions) in gene-edited Ldlrad3 mice. The amino acid residues and the two sgRNA guides used for gene-editing (blue and orange arrows) are indicated above. c-d. Seven-week-old male and female mice with deletions in Ldlrad3 (Δ11 or Δ14 nucleotides; homozygous or compound heterozygous) or wild-type C57BL/6 mice were inoculated subcutaneously with 10 3 PFU of VEEV TrD ( c, left panel ) or 10 2 FFU of VEEV ZPC738 ( d ). Mice were monitored for weight change. Data are from two experiments (VEEV TrD: WT, n = 12; Δ Ldlrad3 , n = 10; VEEV ZPC738: WT, n = 9; Δ Ldlrad3 , n = 8; two-way ANOVA with Dunnett’s post-test: ** P

    Techniques Used: Mouse Assay, CRISPR, Sequencing

    CRISPR-Cas9-based screen identifying Ldlrad3 as required factor for VEEV infectivity. a. Δ B4galt7 N2a cells were transfected separately with two half libraries containing 130,209 sgRNAs, puromycin selected, and then inoculated with SINV-VEEV-GFP (TrD strain) at an MOI of 1. After 24 h, GFP-negative cells were sorted, expanded in the presence of anti-VEEV mAbs (VEEV-57, VEEV-67, and VEEV-68 [2 μg/ml]), and re-inoculated with SINV-VEEV-GFP. The infection and sorting process were repeated twice. Genomic DNA from GFP-negative cells was sequenced for sgRNA abundance. b . Representative flow cytometry histogram of parental N2a (gray) and Δ B4galt7 N2a (red) cells stained for heparan sulfate (HS) surface expression using R17 25 , a rodent herpesvirus immune evasion protein that binds to HS. c. . d. Sequence alignment of mouse ( Mus musculus ), mouse Δ32 N-terminus isoform, human ( Homo sapiens ), rhesus macaque ( Macaca mulatta ), cattle ( Bos taurus ), horse ( Equus caballus ), dog ( Canis lupus familiaris ), and chicken ( Gallus gallus ) Ldlrad3 ectodomain using ESPript 3. Red boxes indicate conserved residues between orthologs. The predicted domains based on sequence similarity to other related proteins and the transmembrane domain are indicated below the sequence.
    Figure Legend Snippet: CRISPR-Cas9-based screen identifying Ldlrad3 as required factor for VEEV infectivity. a. Δ B4galt7 N2a cells were transfected separately with two half libraries containing 130,209 sgRNAs, puromycin selected, and then inoculated with SINV-VEEV-GFP (TrD strain) at an MOI of 1. After 24 h, GFP-negative cells were sorted, expanded in the presence of anti-VEEV mAbs (VEEV-57, VEEV-67, and VEEV-68 [2 μg/ml]), and re-inoculated with SINV-VEEV-GFP. The infection and sorting process were repeated twice. Genomic DNA from GFP-negative cells was sequenced for sgRNA abundance. b . Representative flow cytometry histogram of parental N2a (gray) and Δ B4galt7 N2a (red) cells stained for heparan sulfate (HS) surface expression using R17 25 , a rodent herpesvirus immune evasion protein that binds to HS. c. . d. Sequence alignment of mouse ( Mus musculus ), mouse Δ32 N-terminus isoform, human ( Homo sapiens ), rhesus macaque ( Macaca mulatta ), cattle ( Bos taurus ), horse ( Equus caballus ), dog ( Canis lupus familiaris ), and chicken ( Gallus gallus ) Ldlrad3 ectodomain using ESPript 3. Red boxes indicate conserved residues between orthologs. The predicted domains based on sequence similarity to other related proteins and the transmembrane domain are indicated below the sequence.

    Techniques Used: CRISPR, Infection, Transfection, Flow Cytometry, Staining, Expressing, Sequencing

    24) Product Images from "Efficient CRISPR/Cas9-mediated editing of trinucleotide repeat expansion in myotonic dystrophy patient-derived iPS and myogenic cells"

    Article Title: Efficient CRISPR/Cas9-mediated editing of trinucleotide repeat expansion in myotonic dystrophy patient-derived iPS and myogenic cells

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky548

    A dual gRNA approach for CRISPR/Cas9-mediated correction of DM1-iPSC Myo and evidence for trinucleotide CTG repeat excision. ( A ) Diagrammatic representation for targeting of the 3 ‘UTR region of the DMPK gene using a dual gRNA approach for CRISPR/Cas9-mediated gene correction. The dual gRNAs ( 5′ 3′-CTG repeat -gRNA ) target Cas9 on either side of the CTG repeat region for excision of the expanded trinucleotide repeat. ( B ) Cas9 immunofluorescence staining of CRISPR/Cas9 treated DM1-iPSC-Myo cells, at 1-week post transduction. The upper panel shows representative images of DM1-iPSC-Myo cells stained for Cas9 (in red) and co-stained with DAPI for nuclei (in blue) (scale bar = 50 μm). The lower panel shows the graph for the quantitation of microscopy data for Cas9 positive cells. ( C ) Representative electropherograms of Triplet Repeat Primed PCR (TP) products from DM1-iPSC-Myo after CRISPR/Cas9-mediated gene editing from three independent experiments for each of the three treatments (Cas9 and 5′ 3′-CTG repeat -gRNA; Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9) and untreated control conditions (WT-iPSC-Myo and DM1-iPSC-Myo). ( D ) Sanger sequencing results of on-target activity. The DMPK target locus was amplified by primers flanking the 2 SNPs [ C > T ; G > A : mutant > wild-type allele] and the CTG repeat region [ (CTG) ∼1371 /(CTG) 5 ]. The SNPs allowed discrimination of mutant ( C G ) and wild-type alleles (T A). Analysis of CRISPR/Cas9 activity on the targeted mutant allele showed a large deletion [(–) ∼4188 bp] between the 5′-CTG repeat -gRNA and 3′-CTG repeat -gRNA target sites. CRISPR/Cas9 activity on wild type allele was also detected by deletions between the corresponding gRNA target sites. Representative sequences of the wild-type allele with commonly found deletions and insertions are depicted in the figure. SNPs marked in red are seen in the mutant allele and those in blue are present in the wild type allele. Insertions are indicated by (+) and deletions are indicated by (–). Small letters represent the inserted nucleotides.
    Figure Legend Snippet: A dual gRNA approach for CRISPR/Cas9-mediated correction of DM1-iPSC Myo and evidence for trinucleotide CTG repeat excision. ( A ) Diagrammatic representation for targeting of the 3 ‘UTR region of the DMPK gene using a dual gRNA approach for CRISPR/Cas9-mediated gene correction. The dual gRNAs ( 5′ 3′-CTG repeat -gRNA ) target Cas9 on either side of the CTG repeat region for excision of the expanded trinucleotide repeat. ( B ) Cas9 immunofluorescence staining of CRISPR/Cas9 treated DM1-iPSC-Myo cells, at 1-week post transduction. The upper panel shows representative images of DM1-iPSC-Myo cells stained for Cas9 (in red) and co-stained with DAPI for nuclei (in blue) (scale bar = 50 μm). The lower panel shows the graph for the quantitation of microscopy data for Cas9 positive cells. ( C ) Representative electropherograms of Triplet Repeat Primed PCR (TP) products from DM1-iPSC-Myo after CRISPR/Cas9-mediated gene editing from three independent experiments for each of the three treatments (Cas9 and 5′ 3′-CTG repeat -gRNA; Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9) and untreated control conditions (WT-iPSC-Myo and DM1-iPSC-Myo). ( D ) Sanger sequencing results of on-target activity. The DMPK target locus was amplified by primers flanking the 2 SNPs [ C > T ; G > A : mutant > wild-type allele] and the CTG repeat region [ (CTG) ∼1371 /(CTG) 5 ]. The SNPs allowed discrimination of mutant ( C G ) and wild-type alleles (T A). Analysis of CRISPR/Cas9 activity on the targeted mutant allele showed a large deletion [(–) ∼4188 bp] between the 5′-CTG repeat -gRNA and 3′-CTG repeat -gRNA target sites. CRISPR/Cas9 activity on wild type allele was also detected by deletions between the corresponding gRNA target sites. Representative sequences of the wild-type allele with commonly found deletions and insertions are depicted in the figure. SNPs marked in red are seen in the mutant allele and those in blue are present in the wild type allele. Insertions are indicated by (+) and deletions are indicated by (–). Small letters represent the inserted nucleotides.

    Techniques Used: CRISPR, CTG Assay, Immunofluorescence, Staining, Transduction, Quantitation Assay, Microscopy, Polymerase Chain Reaction, Sequencing, Activity Assay, Amplification, Mutagenesis

    Analysis of CRISPR/Cas9 corrected DM1-iPSCs and isolated DM1-iPSC clones by Southern blot assay, target region sequencing, TP-PCR and ribonuclear foci staining. ( A ) Quantification of ribonuclear foci (NF) in CRISPR/Cas9-corrected DM1-iPSCs. The total number of ribonuclear foci per total number of nuclei was calculated. Total of nuclei counted is 1500. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P
    Figure Legend Snippet: Analysis of CRISPR/Cas9 corrected DM1-iPSCs and isolated DM1-iPSC clones by Southern blot assay, target region sequencing, TP-PCR and ribonuclear foci staining. ( A ) Quantification of ribonuclear foci (NF) in CRISPR/Cas9-corrected DM1-iPSCs. The total number of ribonuclear foci per total number of nuclei was calculated. Total of nuclei counted is 1500. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P

    Techniques Used: CRISPR, Isolation, Clone Assay, Southern Blot, Sequencing, Polymerase Chain Reaction, Staining, Two Tailed Test

    Generation of DM1-iPS cells (DM1-iPSCs) and DM1-iPSC derived inducible myogenic cells (DM1-iPSC-Myo). ( A ) Schematic overview showing CRISPR/Cas9 based correction of DM1 patient iPSCs derived myogenic cells (DM1-iPSC-Myo). ( B ) Representative image of DM1-iPSC clones and healthy control iPSCs stained for RNA foci by fluorescent in situ hybridization (FISH). An antisense Cy3-labeled probe was used against trinucleotide CUG expanded repeat. Arrowheads indicated ribonuclear foci. Upper panel represents stained nuclei at lower magnification (scale bar = 20μm) and lower panel represents higher magnification of selected region (scale bar = 2μm). Nuclei were counter-stained with DAPI. ( C ) Southern blot analysis to detect the length of trinucleotide CTG repeats in five DM1-iPSC clones from two DM1 patients (L22, L81 and L23; FL8 and FL5) and healthy control iPSCs. EcoR I digested genomic DNA was subjected to agarose gel electrophoresis and probed to detect the DMPK locus. (mut = mutant; wt = wild type) . ( D ) Representative image of FISH staining on DM1-iPSC-Myo for detection of ribonuclear foci. Arrowheads indicate multiple RNA foci in nuclei of DM1-iPSC-Myo. Healthy iPSC-Myo were used as a negative control. Upper panel represents stained nuclei at lower magnification (scale bar = 20 μm) and lower panel represents higher magnification of selected region (scale bar = 2 μm). Nuclei were counter-stained with DAPI. ( E ) Myogenic conversion of DM1-iPSC-Myo (L81 and L23) and healthy iPSC-Myo post MyoD induction were stained for a mature muscle marker, myosin heavy chain (MyHC) (scale bar = 100 μm). Nuclei were counter-stained with DAPI. ( F ) Southern blot analysis of trinucleotide CTG repeats length in DM1-iPSC-Myo (L81 and L23; FL8 and FL5) and healthy-iPSC-Myo to check the length of triplet repeats post-differentiation (mut = mutant; wt = wild type) .
    Figure Legend Snippet: Generation of DM1-iPS cells (DM1-iPSCs) and DM1-iPSC derived inducible myogenic cells (DM1-iPSC-Myo). ( A ) Schematic overview showing CRISPR/Cas9 based correction of DM1 patient iPSCs derived myogenic cells (DM1-iPSC-Myo). ( B ) Representative image of DM1-iPSC clones and healthy control iPSCs stained for RNA foci by fluorescent in situ hybridization (FISH). An antisense Cy3-labeled probe was used against trinucleotide CUG expanded repeat. Arrowheads indicated ribonuclear foci. Upper panel represents stained nuclei at lower magnification (scale bar = 20μm) and lower panel represents higher magnification of selected region (scale bar = 2μm). Nuclei were counter-stained with DAPI. ( C ) Southern blot analysis to detect the length of trinucleotide CTG repeats in five DM1-iPSC clones from two DM1 patients (L22, L81 and L23; FL8 and FL5) and healthy control iPSCs. EcoR I digested genomic DNA was subjected to agarose gel electrophoresis and probed to detect the DMPK locus. (mut = mutant; wt = wild type) . ( D ) Representative image of FISH staining on DM1-iPSC-Myo for detection of ribonuclear foci. Arrowheads indicate multiple RNA foci in nuclei of DM1-iPSC-Myo. Healthy iPSC-Myo were used as a negative control. Upper panel represents stained nuclei at lower magnification (scale bar = 20 μm) and lower panel represents higher magnification of selected region (scale bar = 2 μm). Nuclei were counter-stained with DAPI. ( E ) Myogenic conversion of DM1-iPSC-Myo (L81 and L23) and healthy iPSC-Myo post MyoD induction were stained for a mature muscle marker, myosin heavy chain (MyHC) (scale bar = 100 μm). Nuclei were counter-stained with DAPI. ( F ) Southern blot analysis of trinucleotide CTG repeats length in DM1-iPSC-Myo (L81 and L23; FL8 and FL5) and healthy-iPSC-Myo to check the length of triplet repeats post-differentiation (mut = mutant; wt = wild type) .

    Techniques Used: Derivative Assay, CRISPR, Clone Assay, Staining, In Situ Hybridization, Fluorescence In Situ Hybridization, Labeling, Southern Blot, CTG Assay, Agarose Gel Electrophoresis, Mutagenesis, Negative Control, Marker

    Analysis of target region in the CRISPR/Cas9-corrected DM1-iPSC-Myo and ribonuclear foci staining of corrected DM1-iPSC-Myo and DM1 primary myoblasts. ( A ) Graph representing distribution of SMRT sequencing reads based on the various amplicon sizes ∼633 bp (excised fragments) and ∼723bp (WT fragments). The sequences ranging between ∼723 bp and ∼4000 bp were fragments with indels and partially deleted repeat regions. Each bar represents distribution of reads from each of the three conditions (Cas9 + 5′ 3′-CTG repeat -gRNA , Cas9 control and gRNA control) and untreated DM1-iPSC-Myo control. ( B ) Representative image of CRISPR/Cas9-corrected DM1-iPSC-Myo (L81) stained for ribonuclear foci. Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9 were used as negative controls. An antisense Cy3-labeled probe was used to detect the presence of ribonuclear foci (NF). The ribonuclear foci negative and positive nuclei were denoted as NF − (white) and NF + (red), respectively. Each representative image is a maximum intensity z projection of the z slice images. For all the conditions (Cas9 + 3′ 5′-CTG repeat -gRNA , scrambled gRNA and no Cas9) enlarged z slices of selected ribonuclear foci negative (NF-) and positive (NF+) nucleus are represented. Nuclei were counter-stained with DAPI (scale bar = 20 μm). ( C ) Quantification of ribonuclear foci (NF) in CRISPR/Cas9-corrected DM1-iPSC Myo. The total number of ribonuclear foci per total number of nuclei was calculated. Total of nuclei counted is 6500. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P
    Figure Legend Snippet: Analysis of target region in the CRISPR/Cas9-corrected DM1-iPSC-Myo and ribonuclear foci staining of corrected DM1-iPSC-Myo and DM1 primary myoblasts. ( A ) Graph representing distribution of SMRT sequencing reads based on the various amplicon sizes ∼633 bp (excised fragments) and ∼723bp (WT fragments). The sequences ranging between ∼723 bp and ∼4000 bp were fragments with indels and partially deleted repeat regions. Each bar represents distribution of reads from each of the three conditions (Cas9 + 5′ 3′-CTG repeat -gRNA , Cas9 control and gRNA control) and untreated DM1-iPSC-Myo control. ( B ) Representative image of CRISPR/Cas9-corrected DM1-iPSC-Myo (L81) stained for ribonuclear foci. Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9 were used as negative controls. An antisense Cy3-labeled probe was used to detect the presence of ribonuclear foci (NF). The ribonuclear foci negative and positive nuclei were denoted as NF − (white) and NF + (red), respectively. Each representative image is a maximum intensity z projection of the z slice images. For all the conditions (Cas9 + 3′ 5′-CTG repeat -gRNA , scrambled gRNA and no Cas9) enlarged z slices of selected ribonuclear foci negative (NF-) and positive (NF+) nucleus are represented. Nuclei were counter-stained with DAPI (scale bar = 20 μm). ( C ) Quantification of ribonuclear foci (NF) in CRISPR/Cas9-corrected DM1-iPSC Myo. The total number of ribonuclear foci per total number of nuclei was calculated. Total of nuclei counted is 6500. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P

    Techniques Used: CRISPR, Staining, Sequencing, Amplification, CTG Assay, Labeling, Two Tailed Test

    Biological effects of CRSIPR/Cas9 mediated correction of DM1-iPSC-Myo. ( A ) Dual staining for MBNL1 and ribonuclear foci co-localization in the CRSIPR/Cas9-corrected versus control conditions (Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9). Representative image of DM1-iPSC-Myo stained for MBNL1 and Ribonuclear foci by combined immunostaining-FISH staining. Each representative image is a maximum intensity z projection of the z slices. For control conditions, enlarged image of selected nuclei are represented under different filters. For the condition (Cas9 + 3′ 5′-CTG repeat -gRNA ) enlarged z slices of selected ribonuclear foci negative (NF-) and positive (NF+) nucleus are represented under different filters. Nuclei were counterstained with DAPI. ( B ) Quantification of the microscopy data is represented in term of ratio between the total dual positive (MBNL1 + RNA + foci)/total number of nuclei observed in each condition for the L23, L81, FL8 and FL5 DM1-iPSC-Myo cells. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P
    Figure Legend Snippet: Biological effects of CRSIPR/Cas9 mediated correction of DM1-iPSC-Myo. ( A ) Dual staining for MBNL1 and ribonuclear foci co-localization in the CRSIPR/Cas9-corrected versus control conditions (Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9). Representative image of DM1-iPSC-Myo stained for MBNL1 and Ribonuclear foci by combined immunostaining-FISH staining. Each representative image is a maximum intensity z projection of the z slices. For control conditions, enlarged image of selected nuclei are represented under different filters. For the condition (Cas9 + 3′ 5′-CTG repeat -gRNA ) enlarged z slices of selected ribonuclear foci negative (NF-) and positive (NF+) nucleus are represented under different filters. Nuclei were counterstained with DAPI. ( B ) Quantification of the microscopy data is represented in term of ratio between the total dual positive (MBNL1 + RNA + foci)/total number of nuclei observed in each condition for the L23, L81, FL8 and FL5 DM1-iPSC-Myo cells. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P

    Techniques Used: Staining, CTG Assay, Immunostaining, Fluorescence In Situ Hybridization, Microscopy, Two Tailed Test

    25) Product Images from "Robust differentiation of human pluripotent stem cells into endothelial cells via temporal modulation of ETV2 with modified mRNA"

    Article Title: Robust differentiation of human pluripotent stem cells into endothelial cells via temporal modulation of ETV2 with modified mRNA

    Journal: bioRxiv

    doi: 10.1101/2020.03.02.973289

    VEGF signaling and activation of endogenous ETV2 in the standard S1-S2 differentiation protocol. ( A-D ) Generation of h-iPSCs-KDR -/- and h-iPSCs-ETV2 -/- clones by CRISPR/Cas9. ( A ) Sanger sequencing of the two edited alleles encoding the 3 rd exon of KDR . ( B ) Flow cytometry showed the conversion of h-iPSCs-KDR -/- into FLK1-/CD31+ h-iECs at 48 h using the early modETV2 protocol. ( C ) Sanger sequencing of the two edited alleles encoding the 4 th exon of ETV2 . ( D ) Immunofluorescence staining for ETV2 at 72 h using the S1-S2 differentiation protocol. Nuclei stained by DAPI. Scale bar, 200 μm. ( E ) Differences in differentiation efficiency between four alternative S1-S2 methodologies and the S1-modETV2 protocol for h-iPSC clones lacking either ETV2 and KDR (h-iPSC-ETV2 -/- and h-iPSC-KDR -/- ). Only S1-modETV2 protocol could successfully derive h-iECs from either h-iPSC-ETV2 -/- or h-iPSC-KDR -/- cell lines with high efficiency. In contrast, the four alternative S1-S2 methodologies failed to get any h-iECs. ( F-G ) Effect of VEGF-A concentration on h-iEC yield using the S1-S2 differentiation protocol. ( F ) Dose dependent conversion efficiency of h-iPSCs into CD31+ h-iECs by flow cytometry. ( G ) Immunofluorescence staining for ETV2 and VE-Cadherin at 72 h with different concentrations of VEGF-A. Nuclei stained by DAPI. Scale bar, 50 μm.
    Figure Legend Snippet: VEGF signaling and activation of endogenous ETV2 in the standard S1-S2 differentiation protocol. ( A-D ) Generation of h-iPSCs-KDR -/- and h-iPSCs-ETV2 -/- clones by CRISPR/Cas9. ( A ) Sanger sequencing of the two edited alleles encoding the 3 rd exon of KDR . ( B ) Flow cytometry showed the conversion of h-iPSCs-KDR -/- into FLK1-/CD31+ h-iECs at 48 h using the early modETV2 protocol. ( C ) Sanger sequencing of the two edited alleles encoding the 4 th exon of ETV2 . ( D ) Immunofluorescence staining for ETV2 at 72 h using the S1-S2 differentiation protocol. Nuclei stained by DAPI. Scale bar, 200 μm. ( E ) Differences in differentiation efficiency between four alternative S1-S2 methodologies and the S1-modETV2 protocol for h-iPSC clones lacking either ETV2 and KDR (h-iPSC-ETV2 -/- and h-iPSC-KDR -/- ). Only S1-modETV2 protocol could successfully derive h-iECs from either h-iPSC-ETV2 -/- or h-iPSC-KDR -/- cell lines with high efficiency. In contrast, the four alternative S1-S2 methodologies failed to get any h-iECs. ( F-G ) Effect of VEGF-A concentration on h-iEC yield using the S1-S2 differentiation protocol. ( F ) Dose dependent conversion efficiency of h-iPSCs into CD31+ h-iECs by flow cytometry. ( G ) Immunofluorescence staining for ETV2 and VE-Cadherin at 72 h with different concentrations of VEGF-A. Nuclei stained by DAPI. Scale bar, 50 μm.

    Techniques Used: Activation Assay, Clone Assay, CRISPR, Sequencing, Flow Cytometry, Immunofluorescence, Staining, Concentration Assay

    26) Product Images from "Engineering of Primary Human B cells with CRISPR/Cas9 Targeted Nuclease"

    Article Title: Engineering of Primary Human B cells with CRISPR/Cas9 Targeted Nuclease

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-30358-0

    B cells are efficiently edited by CRISPR/Cas9. ( A ) B cells were enriched and isolated, electroporated with either chemically modified sgRNA or Alt-R gRNA in combination with either Cas9 protein or chemically modified mRNA encoding Cas9 protein, and then assessed for indel formation (n = 6). ( B ) Frequency of indel formation as measured by TIDE analysis ( left panel ) and loss of CD19 expression as measured by flow cytometry ( right panel ), viability ( left panel ) and total cell numbers ( right panel ) (*indicate p
    Figure Legend Snippet: B cells are efficiently edited by CRISPR/Cas9. ( A ) B cells were enriched and isolated, electroporated with either chemically modified sgRNA or Alt-R gRNA in combination with either Cas9 protein or chemically modified mRNA encoding Cas9 protein, and then assessed for indel formation (n = 6). ( B ) Frequency of indel formation as measured by TIDE analysis ( left panel ) and loss of CD19 expression as measured by flow cytometry ( right panel ), viability ( left panel ) and total cell numbers ( right panel ) (*indicate p

    Techniques Used: CRISPR, Isolation, Modification, Expressing, Flow Cytometry, Cytometry

    B cells can be engineered using homologous recombination with rAAV6 donor and CRISPR/Cas9. ( A ) A schematic design of the DNA donor template for a splice acceptor- EGFP system targeting the AAVS1 site by HR used in this study. ( B ) Percentage of EGFP+ cells represent integration frequency following transfection with rAAV6 containing a splice acceptor- EGFP system at the indicated MOIs (n = 3). ( C ) PCR amplification using a combination of EGFP and AAVS1 primers of samples engineered with RNPs targeting AAVS1 and exposed to rAAV6 containing a splice acceptor-EGFP system at the indicated MOIs, as well as no gRNA (represented by ‘–’) and H 2 O controls.
    Figure Legend Snippet: B cells can be engineered using homologous recombination with rAAV6 donor and CRISPR/Cas9. ( A ) A schematic design of the DNA donor template for a splice acceptor- EGFP system targeting the AAVS1 site by HR used in this study. ( B ) Percentage of EGFP+ cells represent integration frequency following transfection with rAAV6 containing a splice acceptor- EGFP system at the indicated MOIs (n = 3). ( C ) PCR amplification using a combination of EGFP and AAVS1 primers of samples engineered with RNPs targeting AAVS1 and exposed to rAAV6 containing a splice acceptor-EGFP system at the indicated MOIs, as well as no gRNA (represented by ‘–’) and H 2 O controls.

    Techniques Used: Homologous Recombination, CRISPR, Transfection, Polymerase Chain Reaction, Amplification

    27) Product Images from "Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I"

    Article Title: Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I

    Journal: Nature Communications

    doi: 10.1038/s41467-019-11962-8

    OFF-target analysis of the CCR5 sgRNA. Percent reads with Indels at 62 off-target sites (OT) predicted using COSMID. For each site, red dots indicate samples treated with WT Cas9 and blue dots indicate samples treated with HiFi Cas9. The limit of detection for NGS is 0.1% and is indicated on the graph by a dashed line
    Figure Legend Snippet: OFF-target analysis of the CCR5 sgRNA. Percent reads with Indels at 62 off-target sites (OT) predicted using COSMID. For each site, red dots indicate samples treated with WT Cas9 and blue dots indicate samples treated with HiFi Cas9. The limit of detection for NGS is 0.1% and is indicated on the graph by a dashed line

    Techniques Used: Next-Generation Sequencing

    Efficient CRIPR/Cas9-mediated integration of IDUA overexpression cassettes into the CCR5 locus in human CD34+ HSPCs. a Schematic of targeted integration of IDUA and expression cassettes. The AAV6 genome was constructed to have 500 bp arms of homology centered on the cut site, and the IDUA sequence placed under the control of the SFFV or the PGK promoter (E = Exon). In two DNA templates, YFP was expressed downstream of IDUA using the self-cleaving P2A peptide. b Representative FACs and histogram plots 3-days post-modification of mock and human HSPCs that underwent RNP and AAV6 exposure with YFP-containing expression cassettes. c Targeting frequencies in cord blood (CB, red dots) and adult peripheral blood (PB, blue dots)-derived HSPCs read by percent fluorescent cells in YFP-expressing cassettes and percent colonies with targeted CCR5 alleles by single cell-derived colony genotyping in cassettes without the reporter. Each dot represents the average of duplicates for a human cell donor. For RNP + AAV6 conditions with YFP templates, n = 20 and n = 11 independent human donors for CB and PB respectively. For the template without selection n = 6 independent human donors in CB and PB. Data shown as mean ± SD. d Distribution of wild type (WT), mono and bi-allelically modified cells ( n = 400) in YFP-positive HSPCs
    Figure Legend Snippet: Efficient CRIPR/Cas9-mediated integration of IDUA overexpression cassettes into the CCR5 locus in human CD34+ HSPCs. a Schematic of targeted integration of IDUA and expression cassettes. The AAV6 genome was constructed to have 500 bp arms of homology centered on the cut site, and the IDUA sequence placed under the control of the SFFV or the PGK promoter (E = Exon). In two DNA templates, YFP was expressed downstream of IDUA using the self-cleaving P2A peptide. b Representative FACs and histogram plots 3-days post-modification of mock and human HSPCs that underwent RNP and AAV6 exposure with YFP-containing expression cassettes. c Targeting frequencies in cord blood (CB, red dots) and adult peripheral blood (PB, blue dots)-derived HSPCs read by percent fluorescent cells in YFP-expressing cassettes and percent colonies with targeted CCR5 alleles by single cell-derived colony genotyping in cassettes without the reporter. Each dot represents the average of duplicates for a human cell donor. For RNP + AAV6 conditions with YFP templates, n = 20 and n = 11 independent human donors for CB and PB respectively. For the template without selection n = 6 independent human donors in CB and PB. Data shown as mean ± SD. d Distribution of wild type (WT), mono and bi-allelically modified cells ( n = 400) in YFP-positive HSPCs

    Techniques Used: Over Expression, Expressing, Construct, Sequencing, FACS, Modification, Derivative Assay, Selection

    28) Product Images from "Efficient CRISPR/Cas9-mediated editing of trinucleotide repeat expansion in myotonic dystrophy patient-derived iPS and myogenic cells"

    Article Title: Efficient CRISPR/Cas9-mediated editing of trinucleotide repeat expansion in myotonic dystrophy patient-derived iPS and myogenic cells

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky548

    A dual gRNA approach for CRISPR/Cas9-mediated correction of DM1-iPSC Myo and evidence for trinucleotide CTG repeat excision. ( A ) Diagrammatic representation for targeting of the 3 ‘UTR region of the DMPK gene using a dual gRNA approach for CRISPR/Cas9-mediated gene correction. The dual gRNAs ( 5′ 3′-CTG repeat -gRNA ) target Cas9 on either side of the CTG repeat region for excision of the expanded trinucleotide repeat. ( B ) Cas9 immunofluorescence staining of CRISPR/Cas9 treated DM1-iPSC-Myo cells, at 1-week post transduction. The upper panel shows representative images of DM1-iPSC-Myo cells stained for Cas9 (in red) and co-stained with DAPI for nuclei (in blue) (scale bar = 50 μm). The lower panel shows the graph for the quantitation of microscopy data for Cas9 positive cells. ( C ) Representative electropherograms of Triplet Repeat Primed PCR (TP) products from DM1-iPSC-Myo after CRISPR/Cas9-mediated gene editing from three independent experiments for each of the three treatments (Cas9 and 5′ 3′-CTG repeat -gRNA; Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9) and untreated control conditions (WT-iPSC-Myo and DM1-iPSC-Myo). ( D ) Sanger sequencing results of on-target activity. The DMPK target locus was amplified by primers flanking the 2 SNPs [ C > T ; G > A : mutant > wild-type allele] and the CTG repeat region [ (CTG) ∼1371 /(CTG) 5 ]. The SNPs allowed discrimination of mutant ( C G ) and wild-type alleles (T A). Analysis of CRISPR/Cas9 activity on the targeted mutant allele showed a large deletion [(–) ∼4188 bp] between the 5′-CTG repeat -gRNA and 3′-CTG repeat -gRNA target sites. CRISPR/Cas9 activity on wild type allele was also detected by deletions between the corresponding gRNA target sites. Representative sequences of the wild-type allele with commonly found deletions and insertions are depicted in the figure. SNPs marked in red are seen in the mutant allele and those in blue are present in the wild type allele. Insertions are indicated by (+) and deletions are indicated by (–). Small letters represent the inserted nucleotides.
    Figure Legend Snippet: A dual gRNA approach for CRISPR/Cas9-mediated correction of DM1-iPSC Myo and evidence for trinucleotide CTG repeat excision. ( A ) Diagrammatic representation for targeting of the 3 ‘UTR region of the DMPK gene using a dual gRNA approach for CRISPR/Cas9-mediated gene correction. The dual gRNAs ( 5′ 3′-CTG repeat -gRNA ) target Cas9 on either side of the CTG repeat region for excision of the expanded trinucleotide repeat. ( B ) Cas9 immunofluorescence staining of CRISPR/Cas9 treated DM1-iPSC-Myo cells, at 1-week post transduction. The upper panel shows representative images of DM1-iPSC-Myo cells stained for Cas9 (in red) and co-stained with DAPI for nuclei (in blue) (scale bar = 50 μm). The lower panel shows the graph for the quantitation of microscopy data for Cas9 positive cells. ( C ) Representative electropherograms of Triplet Repeat Primed PCR (TP) products from DM1-iPSC-Myo after CRISPR/Cas9-mediated gene editing from three independent experiments for each of the three treatments (Cas9 and 5′ 3′-CTG repeat -gRNA; Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9) and untreated control conditions (WT-iPSC-Myo and DM1-iPSC-Myo). ( D ) Sanger sequencing results of on-target activity. The DMPK target locus was amplified by primers flanking the 2 SNPs [ C > T ; G > A : mutant > wild-type allele] and the CTG repeat region [ (CTG) ∼1371 /(CTG) 5 ]. The SNPs allowed discrimination of mutant ( C G ) and wild-type alleles (T A). Analysis of CRISPR/Cas9 activity on the targeted mutant allele showed a large deletion [(–) ∼4188 bp] between the 5′-CTG repeat -gRNA and 3′-CTG repeat -gRNA target sites. CRISPR/Cas9 activity on wild type allele was also detected by deletions between the corresponding gRNA target sites. Representative sequences of the wild-type allele with commonly found deletions and insertions are depicted in the figure. SNPs marked in red are seen in the mutant allele and those in blue are present in the wild type allele. Insertions are indicated by (+) and deletions are indicated by (–). Small letters represent the inserted nucleotides.

    Techniques Used: CRISPR, CTG Assay, Immunofluorescence, Staining, Transduction, Quantitation Assay, Microscopy, Polymerase Chain Reaction, Sequencing, Activity Assay, Amplification, Mutagenesis

    Analysis of CRISPR/Cas9 corrected DM1-iPSCs and isolated DM1-iPSC clones by Southern blot assay, target region sequencing, TP-PCR and ribonuclear foci staining. ( A ) Quantification of ribonuclear foci (NF) in CRISPR/Cas9-corrected DM1-iPSCs. The total number of ribonuclear foci per total number of nuclei was calculated. Total of nuclei counted is 1500. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P
    Figure Legend Snippet: Analysis of CRISPR/Cas9 corrected DM1-iPSCs and isolated DM1-iPSC clones by Southern blot assay, target region sequencing, TP-PCR and ribonuclear foci staining. ( A ) Quantification of ribonuclear foci (NF) in CRISPR/Cas9-corrected DM1-iPSCs. The total number of ribonuclear foci per total number of nuclei was calculated. Total of nuclei counted is 1500. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P

    Techniques Used: CRISPR, Isolation, Clone Assay, Southern Blot, Sequencing, Polymerase Chain Reaction, Staining, Two Tailed Test

    Generation of DM1-iPS cells (DM1-iPSCs) and DM1-iPSC derived inducible myogenic cells (DM1-iPSC-Myo). ( A ) Schematic overview showing CRISPR/Cas9 based correction of DM1 patient iPSCs derived myogenic cells (DM1-iPSC-Myo). ( B ) Representative image of DM1-iPSC clones and healthy control iPSCs stained for RNA foci by fluorescent in situ hybridization (FISH). An antisense Cy3-labeled probe was used against trinucleotide CUG expanded repeat. Arrowheads indicated ribonuclear foci. Upper panel represents stained nuclei at lower magnification (scale bar = 20μm) and lower panel represents higher magnification of selected region (scale bar = 2μm). Nuclei were counter-stained with DAPI. ( C ) Southern blot analysis to detect the length of trinucleotide CTG repeats in five DM1-iPSC clones from two DM1 patients (L22, L81 and L23; FL8 and FL5) and healthy control iPSCs. EcoR I digested genomic DNA was subjected to agarose gel electrophoresis and probed to detect the DMPK locus. (mut = mutant; wt = wild type) . ( D ) Representative image of FISH staining on DM1-iPSC-Myo for detection of ribonuclear foci. Arrowheads indicate multiple RNA foci in nuclei of DM1-iPSC-Myo. Healthy iPSC-Myo were used as a negative control. Upper panel represents stained nuclei at lower magnification (scale bar = 20 μm) and lower panel represents higher magnification of selected region (scale bar = 2 μm). Nuclei were counter-stained with DAPI. ( E ) Myogenic conversion of DM1-iPSC-Myo (L81 and L23) and healthy iPSC-Myo post MyoD induction were stained for a mature muscle marker, myosin heavy chain (MyHC) (scale bar = 100 μm). Nuclei were counter-stained with DAPI. ( F ) Southern blot analysis of trinucleotide CTG repeats length in DM1-iPSC-Myo (L81 and L23; FL8 and FL5) and healthy-iPSC-Myo to check the length of triplet repeats post-differentiation (mut = mutant; wt = wild type) .
    Figure Legend Snippet: Generation of DM1-iPS cells (DM1-iPSCs) and DM1-iPSC derived inducible myogenic cells (DM1-iPSC-Myo). ( A ) Schematic overview showing CRISPR/Cas9 based correction of DM1 patient iPSCs derived myogenic cells (DM1-iPSC-Myo). ( B ) Representative image of DM1-iPSC clones and healthy control iPSCs stained for RNA foci by fluorescent in situ hybridization (FISH). An antisense Cy3-labeled probe was used against trinucleotide CUG expanded repeat. Arrowheads indicated ribonuclear foci. Upper panel represents stained nuclei at lower magnification (scale bar = 20μm) and lower panel represents higher magnification of selected region (scale bar = 2μm). Nuclei were counter-stained with DAPI. ( C ) Southern blot analysis to detect the length of trinucleotide CTG repeats in five DM1-iPSC clones from two DM1 patients (L22, L81 and L23; FL8 and FL5) and healthy control iPSCs. EcoR I digested genomic DNA was subjected to agarose gel electrophoresis and probed to detect the DMPK locus. (mut = mutant; wt = wild type) . ( D ) Representative image of FISH staining on DM1-iPSC-Myo for detection of ribonuclear foci. Arrowheads indicate multiple RNA foci in nuclei of DM1-iPSC-Myo. Healthy iPSC-Myo were used as a negative control. Upper panel represents stained nuclei at lower magnification (scale bar = 20 μm) and lower panel represents higher magnification of selected region (scale bar = 2 μm). Nuclei were counter-stained with DAPI. ( E ) Myogenic conversion of DM1-iPSC-Myo (L81 and L23) and healthy iPSC-Myo post MyoD induction were stained for a mature muscle marker, myosin heavy chain (MyHC) (scale bar = 100 μm). Nuclei were counter-stained with DAPI. ( F ) Southern blot analysis of trinucleotide CTG repeats length in DM1-iPSC-Myo (L81 and L23; FL8 and FL5) and healthy-iPSC-Myo to check the length of triplet repeats post-differentiation (mut = mutant; wt = wild type) .

    Techniques Used: Derivative Assay, CRISPR, Clone Assay, Staining, In Situ Hybridization, Fluorescence In Situ Hybridization, Labeling, Southern Blot, CTG Assay, Agarose Gel Electrophoresis, Mutagenesis, Negative Control, Marker

    Analysis of target region in the CRISPR/Cas9-corrected DM1-iPSC-Myo and ribonuclear foci staining of corrected DM1-iPSC-Myo and DM1 primary myoblasts. ( A ) Graph representing distribution of SMRT sequencing reads based on the various amplicon sizes ∼633 bp (excised fragments) and ∼723bp (WT fragments). The sequences ranging between ∼723 bp and ∼4000 bp were fragments with indels and partially deleted repeat regions. Each bar represents distribution of reads from each of the three conditions (Cas9 + 5′ 3′-CTG repeat -gRNA , Cas9 control and gRNA control) and untreated DM1-iPSC-Myo control. ( B ) Representative image of CRISPR/Cas9-corrected DM1-iPSC-Myo (L81) stained for ribonuclear foci. Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9 were used as negative controls. An antisense Cy3-labeled probe was used to detect the presence of ribonuclear foci (NF). The ribonuclear foci negative and positive nuclei were denoted as NF − (white) and NF + (red), respectively. Each representative image is a maximum intensity z projection of the z slice images. For all the conditions (Cas9 + 3′ 5′-CTG repeat -gRNA , scrambled gRNA and no Cas9) enlarged z slices of selected ribonuclear foci negative (NF-) and positive (NF+) nucleus are represented. Nuclei were counter-stained with DAPI (scale bar = 20 μm). ( C ) Quantification of ribonuclear foci (NF) in CRISPR/Cas9-corrected DM1-iPSC Myo. The total number of ribonuclear foci per total number of nuclei was calculated. Total of nuclei counted is 6500. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P
    Figure Legend Snippet: Analysis of target region in the CRISPR/Cas9-corrected DM1-iPSC-Myo and ribonuclear foci staining of corrected DM1-iPSC-Myo and DM1 primary myoblasts. ( A ) Graph representing distribution of SMRT sequencing reads based on the various amplicon sizes ∼633 bp (excised fragments) and ∼723bp (WT fragments). The sequences ranging between ∼723 bp and ∼4000 bp were fragments with indels and partially deleted repeat regions. Each bar represents distribution of reads from each of the three conditions (Cas9 + 5′ 3′-CTG repeat -gRNA , Cas9 control and gRNA control) and untreated DM1-iPSC-Myo control. ( B ) Representative image of CRISPR/Cas9-corrected DM1-iPSC-Myo (L81) stained for ribonuclear foci. Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9 were used as negative controls. An antisense Cy3-labeled probe was used to detect the presence of ribonuclear foci (NF). The ribonuclear foci negative and positive nuclei were denoted as NF − (white) and NF + (red), respectively. Each representative image is a maximum intensity z projection of the z slice images. For all the conditions (Cas9 + 3′ 5′-CTG repeat -gRNA , scrambled gRNA and no Cas9) enlarged z slices of selected ribonuclear foci negative (NF-) and positive (NF+) nucleus are represented. Nuclei were counter-stained with DAPI (scale bar = 20 μm). ( C ) Quantification of ribonuclear foci (NF) in CRISPR/Cas9-corrected DM1-iPSC Myo. The total number of ribonuclear foci per total number of nuclei was calculated. Total of nuclei counted is 6500. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P

    Techniques Used: CRISPR, Staining, Sequencing, Amplification, CTG Assay, Labeling, Two Tailed Test

    Biological effects of CRSIPR/Cas9 mediated correction of DM1-iPSC-Myo. ( A ) Dual staining for MBNL1 and ribonuclear foci co-localization in the CRSIPR/Cas9-corrected versus control conditions (Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9). Representative image of DM1-iPSC-Myo stained for MBNL1 and Ribonuclear foci by combined immunostaining-FISH staining. Each representative image is a maximum intensity z projection of the z slices. For control conditions, enlarged image of selected nuclei are represented under different filters. For the condition (Cas9 + 3′ 5′-CTG repeat -gRNA ) enlarged z slices of selected ribonuclear foci negative (NF-) and positive (NF+) nucleus are represented under different filters. Nuclei were counterstained with DAPI. ( B ) Quantification of the microscopy data is represented in term of ratio between the total dual positive (MBNL1 + RNA + foci)/total number of nuclei observed in each condition for the L23, L81, FL8 and FL5 DM1-iPSC-Myo cells. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P
    Figure Legend Snippet: Biological effects of CRSIPR/Cas9 mediated correction of DM1-iPSC-Myo. ( A ) Dual staining for MBNL1 and ribonuclear foci co-localization in the CRSIPR/Cas9-corrected versus control conditions (Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9). Representative image of DM1-iPSC-Myo stained for MBNL1 and Ribonuclear foci by combined immunostaining-FISH staining. Each representative image is a maximum intensity z projection of the z slices. For control conditions, enlarged image of selected nuclei are represented under different filters. For the condition (Cas9 + 3′ 5′-CTG repeat -gRNA ) enlarged z slices of selected ribonuclear foci negative (NF-) and positive (NF+) nucleus are represented under different filters. Nuclei were counterstained with DAPI. ( B ) Quantification of the microscopy data is represented in term of ratio between the total dual positive (MBNL1 + RNA + foci)/total number of nuclei observed in each condition for the L23, L81, FL8 and FL5 DM1-iPSC-Myo cells. The data is represented as mean ± SEM. The statistics were performed using two-tailed unpaired Student's t -test (*** P

    Techniques Used: Staining, CTG Assay, Immunostaining, Fluorescence In Situ Hybridization, Microscopy, Two Tailed Test

    29) Product Images from "Elongation factor ELOF1 drives transcription-coupled repair and prevents genome instability"

    Article Title: Elongation factor ELOF1 drives transcription-coupled repair and prevents genome instability

    Journal: Nature cell biology

    doi: 10.1038/s41556-021-00692-z

    Role of yeast elf1 in TC-NER. (a) Indicated mutant yeast strains were serially 10-fold diluted, spotted, and exposed to indicated UV-C doses. Spot assay has been performed three times with similar results. (b) Schematic showing the CPD-seq method. Isolated DNA is sonicated and adaptors are ligated. CPDs are cleaved by T4 endonuclease V and APE1 nuclease to generate 3’ ends. Following denaturing of the DNA, ends are ligated to a second adaptor that allows CPD sequencing. (c) Gene plot analysis of CPD-seq data for ~4500 yeast genes, ordered by transcription frequency 65 . Plots depict unrepaired CPDs following 2-hour repair relative to no repair for both the transcribed strand (TS) and non-transcribed strand (NTS). Each row represents approximately 10 genes. TSS=transcription start site, TTS=transcription termination site. (d) Left panel: Representative gel of bulk repair of UV-induced CPD lesions in Wt and elf1 Δ mutant yeast measured by T4 endonuclease V digestion and alkaline gel electrophoresis of genomic DNA isolated from UV-irradiated yeast (100 J/m 2 UV-C light) after the indicated time. Right panel: Quantification of CPD repair from n=3 WT and n=4 elf1Δ experiments ±SEM. * P ≤0.05 analyzed by unpaired two-sided t-test. (e) Single nucleotide resolution analysis of CPD-seq data downstream of the TSS of ~5200 yeast genes. Plots depict fraction of unrepaired CPDs following 2-hour repair relative to no repair for both TS and NTS. Nucleosome positioning data 50 is shown for reference. (f) Controls for UV spotting assays shown in Fig. 4d . (g) Image showing repair of CPDs in the TS of the RPB2 gene for indicated yeast strains. The image was generated by converting sequencing reads aligned to RPB2 into bands. U: unirradiated cells. Nucleotide positions relative to TSS (+1) are indicated on the left. (h) Left: Relative percentage of CPDs remaining within 54 bp downstream of the TSS of the RPB2 gene. Right: Relative percentage of CPDs remaining in the downstream region (69-353 bp) of the RPB2 gene. Data are presented as mean values from all CPD sites within the indicated regions (0-54 and 69-353 bp) of the RPB2 gene ±SD from one single experiment, error bars are shown for most relevant strains. n = 8 sites (left panel), and n = 73 (right panel) is 73. (i) Representation of the C. elegans elof-1 genomic organization, depicting the 180 bp emc203 deletion allele generated with CRISPR/Cas9. Shaded boxes: exons, black: coding sequences. Numerical data are provided in source data extended data fig. 5 .
    Figure Legend Snippet: Role of yeast elf1 in TC-NER. (a) Indicated mutant yeast strains were serially 10-fold diluted, spotted, and exposed to indicated UV-C doses. Spot assay has been performed three times with similar results. (b) Schematic showing the CPD-seq method. Isolated DNA is sonicated and adaptors are ligated. CPDs are cleaved by T4 endonuclease V and APE1 nuclease to generate 3’ ends. Following denaturing of the DNA, ends are ligated to a second adaptor that allows CPD sequencing. (c) Gene plot analysis of CPD-seq data for ~4500 yeast genes, ordered by transcription frequency 65 . Plots depict unrepaired CPDs following 2-hour repair relative to no repair for both the transcribed strand (TS) and non-transcribed strand (NTS). Each row represents approximately 10 genes. TSS=transcription start site, TTS=transcription termination site. (d) Left panel: Representative gel of bulk repair of UV-induced CPD lesions in Wt and elf1 Δ mutant yeast measured by T4 endonuclease V digestion and alkaline gel electrophoresis of genomic DNA isolated from UV-irradiated yeast (100 J/m 2 UV-C light) after the indicated time. Right panel: Quantification of CPD repair from n=3 WT and n=4 elf1Δ experiments ±SEM. * P ≤0.05 analyzed by unpaired two-sided t-test. (e) Single nucleotide resolution analysis of CPD-seq data downstream of the TSS of ~5200 yeast genes. Plots depict fraction of unrepaired CPDs following 2-hour repair relative to no repair for both TS and NTS. Nucleosome positioning data 50 is shown for reference. (f) Controls for UV spotting assays shown in Fig. 4d . (g) Image showing repair of CPDs in the TS of the RPB2 gene for indicated yeast strains. The image was generated by converting sequencing reads aligned to RPB2 into bands. U: unirradiated cells. Nucleotide positions relative to TSS (+1) are indicated on the left. (h) Left: Relative percentage of CPDs remaining within 54 bp downstream of the TSS of the RPB2 gene. Right: Relative percentage of CPDs remaining in the downstream region (69-353 bp) of the RPB2 gene. Data are presented as mean values from all CPD sites within the indicated regions (0-54 and 69-353 bp) of the RPB2 gene ±SD from one single experiment, error bars are shown for most relevant strains. n = 8 sites (left panel), and n = 73 (right panel) is 73. (i) Representation of the C. elegans elof-1 genomic organization, depicting the 180 bp emc203 deletion allele generated with CRISPR/Cas9. Shaded boxes: exons, black: coding sequences. Numerical data are provided in source data extended data fig. 5 .

    Techniques Used: Mutagenesis, Spot Test, Isolation, Sonication, Sequencing, Nucleic Acid Electrophoresis, Irradiation, Generated, CRISPR

    Genome-wide CRISPR/cas9 screen identifies ELOF1 as a factor involved in the UV-induced DNA damage response. (a) Schematic of the CRISPR/cas9 screen. MRC-5 (SV40) cells were transduced with a lentiviral sgRNA library 12 . The resulting pool of gene-edited cells was split into a control and a UV irradiated group. Cells were respectively mock-treated or daily UV-irradiated with 6.8 J/m 2 UV-C for 10 consecutive days, thereby maintaining ~50% cell confluency throughout the screen ( Extended data Fig.1a ). sgRNA abundance was determined by next-generation sequencing of PCR-amplified incorporated sgRNAs from the isolated genomic DNA of surviving cell pools 47 . UV-sensitive genes were identified by comparing the abundance in UV-irradiated cells over mock-treated cells using MAGeCK analysis. The screen was performed in duplicate. (b) UV-sensitive genes were ranked based on the gene-based P-value resulting from MaGecK analysis of the change in abundance of sgRNAs in UV-treated over mock-treated. Dotted line indicates FDR=0.1. Genes involved in NER or TLS are color-coded. (c) Relative colony survival of HCT116 wildtype (Wt) cells, indicated knock-out cells (-/-) or rescued cells exposed to the indicated doses of UV-C. (d) Relative colony survival of MRC-5 cells transfected with indicated siRNAs following exposure to the indicated doses of UV-C. (e) Relative colony survival of HCT116 ELOF1 KO cells with expression of the indicated ELOF1 mutants following exposure to the indicated doses of UV-C. Zn: zinc-finger mutant, ΔN: deletion of N-terminus. Data shown in c-e represent average ± SEM (n = 3 independent experiments) *P≤0.05 relative to Wt/siCTRL analyzed by one-sided unpaired T-test. Numerical data are provided in source data fig. 1 .
    Figure Legend Snippet: Genome-wide CRISPR/cas9 screen identifies ELOF1 as a factor involved in the UV-induced DNA damage response. (a) Schematic of the CRISPR/cas9 screen. MRC-5 (SV40) cells were transduced with a lentiviral sgRNA library 12 . The resulting pool of gene-edited cells was split into a control and a UV irradiated group. Cells were respectively mock-treated or daily UV-irradiated with 6.8 J/m 2 UV-C for 10 consecutive days, thereby maintaining ~50% cell confluency throughout the screen ( Extended data Fig.1a ). sgRNA abundance was determined by next-generation sequencing of PCR-amplified incorporated sgRNAs from the isolated genomic DNA of surviving cell pools 47 . UV-sensitive genes were identified by comparing the abundance in UV-irradiated cells over mock-treated cells using MAGeCK analysis. The screen was performed in duplicate. (b) UV-sensitive genes were ranked based on the gene-based P-value resulting from MaGecK analysis of the change in abundance of sgRNAs in UV-treated over mock-treated. Dotted line indicates FDR=0.1. Genes involved in NER or TLS are color-coded. (c) Relative colony survival of HCT116 wildtype (Wt) cells, indicated knock-out cells (-/-) or rescued cells exposed to the indicated doses of UV-C. (d) Relative colony survival of MRC-5 cells transfected with indicated siRNAs following exposure to the indicated doses of UV-C. (e) Relative colony survival of HCT116 ELOF1 KO cells with expression of the indicated ELOF1 mutants following exposure to the indicated doses of UV-C. Zn: zinc-finger mutant, ΔN: deletion of N-terminus. Data shown in c-e represent average ± SEM (n = 3 independent experiments) *P≤0.05 relative to Wt/siCTRL analyzed by one-sided unpaired T-test. Numerical data are provided in source data fig. 1 .

    Techniques Used: Genome Wide, CRISPR, Transduction, Irradiation, Next-Generation Sequencing, Polymerase Chain Reaction, Amplification, Isolation, Knock-Out, Transfection, Expressing, Mutagenesis

    30) Product Images from "Generation of glucocorticoid-resistant SARS-CoV-2 T cells for adoptive cell therapy"

    Article Title: Generation of glucocorticoid-resistant SARS-CoV-2 T cells for adoptive cell therapy

    Journal: Cell Reports

    doi: 10.1016/j.celrep.2021.109432

    Expanded SARS-CoV-2 CTLs can be genetically modified to become steroid resistant (A and B) NR3C1 KO efficiency shown by PCR gel electrophoresis (A) and western blot (B) in SARS-CoV-2 CTLs expanded with IL-2/4/7 or IL-2/7/15, after electroporation with Cas9 alone or Cas9 complexed with crRNA 1 and crRNA 2 targeting exon 2 of the NR3C1 gene. SARS-CoV-2 CTLs electroporated with Cas9 alone were used as controls. β-Actin was used as loading control for the western blot. (C) Representative fluorescence-activated cell sorting (FACS) plots showing the percentage of apoptotic cells (Annexin V+) and live or dead cells (live/dead stain) in control Cas9 versus NR3C1 KO SARS-CoV-2 CTLs after culture with or without dexamethasone (Dexa; 200 μM) for 72 h. Inset values indicate the percentage of Annexin V and live/dead cells from each group. (D) Bar graph summarizing the percentage of live cells between control Cas9 and NR3C1 KO SARS-CoV-2 CTLs treated with or without 200 μM Dexa for 72 h (n = 3 samples). Bars represent median values with interquartile range. p values are indicated above the graphs. (E) Representative FACs plots showing the distribution of CD4+ and CD8+ T cells (top panel) and phenotype based on CD62L and CD45RA expression (bottom panel) in Cas9-only or NR3C1 KO SARS-CoV-2 CTLs with or without 200 μM Dexa. (F) Percentage of CD4+ and CD8+ T cells within SARS-CoV-2 CTLs treated with control Cas9 (blue), NR3C1 KO (red), or NR3C1 KO plus Dexa (200 μM, green). (G) Frequency of SARS-CoV-2 CTLs producing IFN-γ, TNF-α, or IL-2 in control Cas9 (blue), NR3C1 KO (red), or NR3C1 KO plus Dexa (200 μM, green) in response to 6 h of stimulation with viral PepMix (n = 3 samples). Functional analysis of the Cas9 + Dexa group was not performed because of the absence of viable cells resulting from the lymphocytotoxic effect of steroids. The bars represent mean values with SD. NS, not significant. Statistical analysis by paired t test (D) or two-way ANOVA with Tukey’s correction for multiple comparisons (F and G).
    Figure Legend Snippet: Expanded SARS-CoV-2 CTLs can be genetically modified to become steroid resistant (A and B) NR3C1 KO efficiency shown by PCR gel electrophoresis (A) and western blot (B) in SARS-CoV-2 CTLs expanded with IL-2/4/7 or IL-2/7/15, after electroporation with Cas9 alone or Cas9 complexed with crRNA 1 and crRNA 2 targeting exon 2 of the NR3C1 gene. SARS-CoV-2 CTLs electroporated with Cas9 alone were used as controls. β-Actin was used as loading control for the western blot. (C) Representative fluorescence-activated cell sorting (FACS) plots showing the percentage of apoptotic cells (Annexin V+) and live or dead cells (live/dead stain) in control Cas9 versus NR3C1 KO SARS-CoV-2 CTLs after culture with or without dexamethasone (Dexa; 200 μM) for 72 h. Inset values indicate the percentage of Annexin V and live/dead cells from each group. (D) Bar graph summarizing the percentage of live cells between control Cas9 and NR3C1 KO SARS-CoV-2 CTLs treated with or without 200 μM Dexa for 72 h (n = 3 samples). Bars represent median values with interquartile range. p values are indicated above the graphs. (E) Representative FACs plots showing the distribution of CD4+ and CD8+ T cells (top panel) and phenotype based on CD62L and CD45RA expression (bottom panel) in Cas9-only or NR3C1 KO SARS-CoV-2 CTLs with or without 200 μM Dexa. (F) Percentage of CD4+ and CD8+ T cells within SARS-CoV-2 CTLs treated with control Cas9 (blue), NR3C1 KO (red), or NR3C1 KO plus Dexa (200 μM, green). (G) Frequency of SARS-CoV-2 CTLs producing IFN-γ, TNF-α, or IL-2 in control Cas9 (blue), NR3C1 KO (red), or NR3C1 KO plus Dexa (200 μM, green) in response to 6 h of stimulation with viral PepMix (n = 3 samples). Functional analysis of the Cas9 + Dexa group was not performed because of the absence of viable cells resulting from the lymphocytotoxic effect of steroids. The bars represent mean values with SD. NS, not significant. Statistical analysis by paired t test (D) or two-way ANOVA with Tukey’s correction for multiple comparisons (F and G).

    Techniques Used: Genetically Modified, Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Western Blot, Electroporation, Fluorescence, FACS, Staining, Expressing, Functional Assay

    31) Product Images from "Gene silencing by double-stranded RNA from C. elegans neurons reveals functional mosaicism of RNA interference"

    Article Title: Gene silencing by double-stranded RNA from C. elegans neurons reveals functional mosaicism of RNA interference

    Journal: bioRxiv

    doi: 10.1101/393074

    Schematic of genomic changes made using Cas9-based genome editing. Genomic changes introduced into the rde-11 , gtbp-1 , rrf-2 , rrf-3 , ego-1 , mut-16 , unc-22 , and sur-5 loci in this study are indicated. The sgRNA target site is indicated (blue for insertions and orange for point mutations and deletions) on the gene structure (exons = grey boxes, introns = grey lines, stop codon = black). Homology-directed repair templates were used to either insert gfp sequences (B, G and H), create point mutations (A, E and F) or to delete the region between two target sites (C and D). Asterisks indicate stop codons and scale bars are as indicated.
    Figure Legend Snippet: Schematic of genomic changes made using Cas9-based genome editing. Genomic changes introduced into the rde-11 , gtbp-1 , rrf-2 , rrf-3 , ego-1 , mut-16 , unc-22 , and sur-5 loci in this study are indicated. The sgRNA target site is indicated (blue for insertions and orange for point mutations and deletions) on the gene structure (exons = grey boxes, introns = grey lines, stop codon = black). Homology-directed repair templates were used to either insert gfp sequences (B, G and H), create point mutations (A, E and F) or to delete the region between two target sites (C and D). Asterisks indicate stop codons and scale bars are as indicated.

    Techniques Used:

    Silencing in the absence of RRF-1 can occur at multiple gfp targets expressed under the control of different regulatory elements. (A) Silencing in the absence of RRF-1 does not depend on chromosomal location of target sequences. Effect of Prgef-1::gfp -dsRNA and loss of rrf-1 on GFP fluorescence in animals with Peft-3::gfp transgenes located on different chromosomes was quantified as in Figure 2B . Grey boxes, cyan boxes, red bars, n, and asterisks are as in Figure 2B . (B-C) A single-copy gene fusion generated using Cas9-based genome editing can be silenced by neuronal dsRNA in rrf-1(-) animals. Representative L4-staged animals that express GFP in all tissues ( Pgtbp-1::gtbp-1::gfp , top ) and animals that in addition express Prgef-1::gfp -dsRNA in rrf-1(+) or rrf-1(-) backgrounds ( middle or bottom , respectively) are shown (B). Insets are representative of the region quantified in multiple animals. Quantification of silencing for GFP expressed from Pgtbp-1::gtbp-1::gfp is shown (C). Grey boxes, cyan boxes, red bars, n, and asterisks are as in Figure 2B . Scale bar = 50 µm. (D) Silencing in the absence of RRF-1 is associated with a detectable decrease in protein levels. Western blot of GFP protein levels in Peft-3::gfp animals expressing gfp -dsRNA in an otherwise wild type background (+/+), mut-16(-) background (no silencing) or rrf-1(-) background (partial silencing). Levels of GFP are normalized to αα -tubulin and the median ratios of 3 technical replicates are shown.
    Figure Legend Snippet: Silencing in the absence of RRF-1 can occur at multiple gfp targets expressed under the control of different regulatory elements. (A) Silencing in the absence of RRF-1 does not depend on chromosomal location of target sequences. Effect of Prgef-1::gfp -dsRNA and loss of rrf-1 on GFP fluorescence in animals with Peft-3::gfp transgenes located on different chromosomes was quantified as in Figure 2B . Grey boxes, cyan boxes, red bars, n, and asterisks are as in Figure 2B . (B-C) A single-copy gene fusion generated using Cas9-based genome editing can be silenced by neuronal dsRNA in rrf-1(-) animals. Representative L4-staged animals that express GFP in all tissues ( Pgtbp-1::gtbp-1::gfp , top ) and animals that in addition express Prgef-1::gfp -dsRNA in rrf-1(+) or rrf-1(-) backgrounds ( middle or bottom , respectively) are shown (B). Insets are representative of the region quantified in multiple animals. Quantification of silencing for GFP expressed from Pgtbp-1::gtbp-1::gfp is shown (C). Grey boxes, cyan boxes, red bars, n, and asterisks are as in Figure 2B . Scale bar = 50 µm. (D) Silencing in the absence of RRF-1 is associated with a detectable decrease in protein levels. Western blot of GFP protein levels in Peft-3::gfp animals expressing gfp -dsRNA in an otherwise wild type background (+/+), mut-16(-) background (no silencing) or rrf-1(-) background (partial silencing). Levels of GFP are normalized to αα -tubulin and the median ratios of 3 technical replicates are shown.

    Techniques Used: Fluorescence, Generated, Western Blot, Expressing

    32) Product Images from "Interferon priming is essential for human CD34+ cell-derived plasmacytoid dendritic cell maturation and function"

    Article Title: Interferon priming is essential for human CD34+ cell-derived plasmacytoid dendritic cell maturation and function

    Journal: Nature Communications

    doi: 10.1038/s41467-018-05816-y

    HSPC-pDCs are amenable to genetic modifications. a Graphical illustration of the protocol for CRISPR/Cas9-mediated gene editing using Cas9 RNP. CD34 + HSPCs were initially cultured in CD34 + HSPC medium at low density for 3 days before being electroporated with Cas9 RNP complexes. After a 3-day recovery phase, pDC differentiation was initiated. b Expansion of cells during differentiation from HSPCs into HSPC-pDCs. c Indel frequencies after the 3-day recovery phase quantified by TIDE analysis for cells targeted at MyD88 , IFNAR1 , and CCR5 (control). d Numbers of HSPC-pDCs at day 21 for gene-edited HSPC-pDCs. e Western blot analysis showing induction of pSTAT1 upon 3 h IFN-β stimulation (upper panel) and protein levels of MyD88 (lower panel) in HSPC-pDCs targeted at IFNAR1 and MyD88 , respectively (detection Ab for STAT1: CST 9172). Indel frequencies at the respective targets are listed below the western blot. f , g Surface expression levels (MFI) of CD123 ( f ) and CD304 ( g ) in IFN-primed and unprimed HSPC-pDCs with gene editing at MyD88 , IFNAR1, and CCR5 . h Functional levels of type I IFN after stimulation with R837 (TLR7) or CpG-A (TLR9) in unprimed and IFN-primed HSPC-pDCs gene-edited at CCR5 , MyD88 , or CCR5 . i Levels of IL-6 after stimulation with R837 (TLR7) or CpG-A (TLR9) in unprimed and IFN-primed HSPC-pDCs targeted at CCR5, MyD88, or IFNAR1 . Data are ±SEM of five ( b – d ) or three ( f – i ) donors. Statistical analysis was performed using regular two-way ANOVA followed by Bonferroni post hoc test. Two additional donors are shown in Supplementary Fig. 17
    Figure Legend Snippet: HSPC-pDCs are amenable to genetic modifications. a Graphical illustration of the protocol for CRISPR/Cas9-mediated gene editing using Cas9 RNP. CD34 + HSPCs were initially cultured in CD34 + HSPC medium at low density for 3 days before being electroporated with Cas9 RNP complexes. After a 3-day recovery phase, pDC differentiation was initiated. b Expansion of cells during differentiation from HSPCs into HSPC-pDCs. c Indel frequencies after the 3-day recovery phase quantified by TIDE analysis for cells targeted at MyD88 , IFNAR1 , and CCR5 (control). d Numbers of HSPC-pDCs at day 21 for gene-edited HSPC-pDCs. e Western blot analysis showing induction of pSTAT1 upon 3 h IFN-β stimulation (upper panel) and protein levels of MyD88 (lower panel) in HSPC-pDCs targeted at IFNAR1 and MyD88 , respectively (detection Ab for STAT1: CST 9172). Indel frequencies at the respective targets are listed below the western blot. f , g Surface expression levels (MFI) of CD123 ( f ) and CD304 ( g ) in IFN-primed and unprimed HSPC-pDCs with gene editing at MyD88 , IFNAR1, and CCR5 . h Functional levels of type I IFN after stimulation with R837 (TLR7) or CpG-A (TLR9) in unprimed and IFN-primed HSPC-pDCs gene-edited at CCR5 , MyD88 , or CCR5 . i Levels of IL-6 after stimulation with R837 (TLR7) or CpG-A (TLR9) in unprimed and IFN-primed HSPC-pDCs targeted at CCR5, MyD88, or IFNAR1 . Data are ±SEM of five ( b – d ) or three ( f – i ) donors. Statistical analysis was performed using regular two-way ANOVA followed by Bonferroni post hoc test. Two additional donors are shown in Supplementary Fig. 17

    Techniques Used: CRISPR, Cell Culture, Western Blot, Expressing, Functional Assay

    33) Product Images from "Gene correction for SCID-X1 in long-term hematopoietic stem cells"

    Article Title: Gene correction for SCID-X1 in long-term hematopoietic stem cells

    Journal: Nature Communications

    doi: 10.1038/s41467-019-09614-y

    Genome specificity of IL2RG sgRNA guide. a Heat map of on-target INDEL frequencies quantied by NexGen-Seq at COSMID identified putative on-target locations from healthy CD34 + HSPCs. Levels of NHEJ induced by 20 nt IL2RG sgRNA and truncated 19 nt, 18 nt and 17 nt pre-complexed with WT Cas9 protein at 5:1 molar ratio. b Heat map as in ( a ) of on-target INDEL frequencies derived from 19 nt IL2RG sg-1 in the genome of CD34 + HSPCs SCID-X1 patient 1 derived cells. c Percent viability at day 4 of SCID-X1 patient-derived CD34 + HSPCs nucleofected with either wild-type (WT) or high-fidelity (HiFi) SpCas9 protein pre-complexed with either the 20 nt or the 19 nt IL2RG sg-1 ( n = 1). d Percent INDELs measured by TIDE at day 4 in cells as in ( c ) using WT or HiFi Cas9 protein pre-complexed with the 20 nt IL2RG sg-1 (green bars) or 19 nt IL2RG sg-1 (blue bars). e Percent IL2RG cDNA targeting (% HR) as measured by ddPCR at day 4 in cells as in ( c ) generated by either WT or HiFi Cas9 protein pre-complexed with the 20 nt IL2RG sg-1 or ( f ) 19 nt IL2RG sg-1. Source data are available in the Source Data file
    Figure Legend Snippet: Genome specificity of IL2RG sgRNA guide. a Heat map of on-target INDEL frequencies quantied by NexGen-Seq at COSMID identified putative on-target locations from healthy CD34 + HSPCs. Levels of NHEJ induced by 20 nt IL2RG sgRNA and truncated 19 nt, 18 nt and 17 nt pre-complexed with WT Cas9 protein at 5:1 molar ratio. b Heat map as in ( a ) of on-target INDEL frequencies derived from 19 nt IL2RG sg-1 in the genome of CD34 + HSPCs SCID-X1 patient 1 derived cells. c Percent viability at day 4 of SCID-X1 patient-derived CD34 + HSPCs nucleofected with either wild-type (WT) or high-fidelity (HiFi) SpCas9 protein pre-complexed with either the 20 nt or the 19 nt IL2RG sg-1 ( n = 1). d Percent INDELs measured by TIDE at day 4 in cells as in ( c ) using WT or HiFi Cas9 protein pre-complexed with the 20 nt IL2RG sg-1 (green bars) or 19 nt IL2RG sg-1 (blue bars). e Percent IL2RG cDNA targeting (% HR) as measured by ddPCR at day 4 in cells as in ( c ) generated by either WT or HiFi Cas9 protein pre-complexed with the 20 nt IL2RG sg-1 or ( f ) 19 nt IL2RG sg-1. Source data are available in the Source Data file

    Techniques Used: Non-Homologous End Joining, Derivative Assay, Generated

    34) Product Images from "ER-to-Golgi transport and SEC23-dependent COPII vesicles regulate T cell alloimmunity"

    Article Title: ER-to-Golgi transport and SEC23-dependent COPII vesicles regulate T cell alloimmunity

    Journal: The Journal of Clinical Investigation

    doi: 10.1172/JCI136574

    Characterizing the role of SEC23 paralogs in human T cells. ( A ) Normalized expression levels of SEC23B and SEC23A in naive T cells isolated from healthy humans relative to β-actin by Western blot ( n = 4/group). ( B ) Experimental steps in CRISPR/Cas9-mediated KO by Cas9/RNP nucleofection in healthy human T cells. ( C ) qRT-PCR and Western blot analysis of knock-out efficiency of T cells that underwent CRISPR/Cas9-mediated Sec23b KO. T cells were analyzed 3 days following nucleofection with control or Sec23b-targeting crRNA-tracrRNA duplexes complexed with Cas9 ( n = 5/group). ( D ) ELISA measuring IL-2 secreted by control or KO T cells ( n = 5/group). ( C and D ) Data represent mean ± SEM, with * P
    Figure Legend Snippet: Characterizing the role of SEC23 paralogs in human T cells. ( A ) Normalized expression levels of SEC23B and SEC23A in naive T cells isolated from healthy humans relative to β-actin by Western blot ( n = 4/group). ( B ) Experimental steps in CRISPR/Cas9-mediated KO by Cas9/RNP nucleofection in healthy human T cells. ( C ) qRT-PCR and Western blot analysis of knock-out efficiency of T cells that underwent CRISPR/Cas9-mediated Sec23b KO. T cells were analyzed 3 days following nucleofection with control or Sec23b-targeting crRNA-tracrRNA duplexes complexed with Cas9 ( n = 5/group). ( D ) ELISA measuring IL-2 secreted by control or KO T cells ( n = 5/group). ( C and D ) Data represent mean ± SEM, with * P

    Techniques Used: Expressing, Isolation, Western Blot, CRISPR, Quantitative RT-PCR, Knock-Out, Enzyme-linked Immunosorbent Assay

    35) Product Images from "A simple and effective F0 knockout method for rapid screening of behaviour and other complex phenotypes"

    Article Title: A simple and effective F0 knockout method for rapid screening of behaviour and other complex phenotypes

    Journal: eLife

    doi: 10.7554/eLife.59683

    Technical considerations for headloop PCR. ( A ) Comparison between results obtained with a proofreading (Phusion Hot Start II) or a non-proofreading (REDTaq) DNA polymerase for three target loci (A, B, C) of slc24a5 amplified with the PCR primers used for sequencing (std, standard) or when one is replaced by a headloop primer (HL). Samples were uninjected controls. Orange arrowheads mark the 300 bp ladder band. ( B ) Headloop primer designs, using slc24a5 locus G as an example. To perform headloop PCR, the forward or reverse primer from a previously verified primer pair is modified with a 5’ tag sequence and used in conjunction with its unmodified partner. The sequence of the headloop tag is selected so that the predicted Cas9 cleavage site (dashed line) is located towards the 5’-end of the tag. (left) If the modified primer and the gRNA binding site are in the same direction (headloop tag is added to the forward primer and gRNA binding site is on the 5’–3’ genomic strand), the reverse-complement of the gRNA binding site is sufficient (grey underlay). (right) If the modified primer and the gRNA binding site are in opposite directions (headloop tag is added to the reverse primer while gRNA binding site is on the 5’–3’ genomic strand), a sequence that includes the protospacer adjacent motif (PAM, orange font) and shifted from the gRNA binding site is sufficient. In both cases, after second strand elongation, the tag is able to bind the target sequence and direct elongation (hatched sequences) to form a hairpin, suppressing exponential amplification of the wild-type haplotype. Framed: headloop tag; grey font: gRNA binding site; grey underlay: headloop tag binding site.
    Figure Legend Snippet: Technical considerations for headloop PCR. ( A ) Comparison between results obtained with a proofreading (Phusion Hot Start II) or a non-proofreading (REDTaq) DNA polymerase for three target loci (A, B, C) of slc24a5 amplified with the PCR primers used for sequencing (std, standard) or when one is replaced by a headloop primer (HL). Samples were uninjected controls. Orange arrowheads mark the 300 bp ladder band. ( B ) Headloop primer designs, using slc24a5 locus G as an example. To perform headloop PCR, the forward or reverse primer from a previously verified primer pair is modified with a 5’ tag sequence and used in conjunction with its unmodified partner. The sequence of the headloop tag is selected so that the predicted Cas9 cleavage site (dashed line) is located towards the 5’-end of the tag. (left) If the modified primer and the gRNA binding site are in the same direction (headloop tag is added to the forward primer and gRNA binding site is on the 5’–3’ genomic strand), the reverse-complement of the gRNA binding site is sufficient (grey underlay). (right) If the modified primer and the gRNA binding site are in opposite directions (headloop tag is added to the reverse primer while gRNA binding site is on the 5’–3’ genomic strand), a sequence that includes the protospacer adjacent motif (PAM, orange font) and shifted from the gRNA binding site is sufficient. In both cases, after second strand elongation, the tag is able to bind the target sequence and direct elongation (hatched sequences) to form a hairpin, suppressing exponential amplification of the wild-type haplotype. Framed: headloop tag; grey font: gRNA binding site; grey underlay: headloop tag binding site.

    Techniques Used: Polymerase Chain Reaction, Amplification, Sequencing, Modification, Binding Assay

    Cas9 and gRNA achieve highest phenotypic penetrance at 1-to-1 ratio. ( A–B ) (top) Phenotypic penetrance as gradually more Cas9 was injected; 1:6: 4.75 fmol Cas9, 1:3: 9.5 fmol Cas9, 1:2: 14.25 fmol Cas9, 1:1: 28.5 fmol Cas9. gRNA was kept constant at 28.5 fmol. Pictures of the eye at 2 dpf are examples of the scoring method (reproduced from Figure 1C,D ). (bottom) Unviability as percentage of 1-dpf embryos.
    Figure Legend Snippet: Cas9 and gRNA achieve highest phenotypic penetrance at 1-to-1 ratio. ( A–B ) (top) Phenotypic penetrance as gradually more Cas9 was injected; 1:6: 4.75 fmol Cas9, 1:3: 9.5 fmol Cas9, 1:2: 14.25 fmol Cas9, 1:1: 28.5 fmol Cas9. gRNA was kept constant at 28.5 fmol. Pictures of the eye at 2 dpf are examples of the scoring method (reproduced from Figure 1C,D ). (bottom) Unviability as percentage of 1-dpf embryos.

    Techniques Used: Injection

    36) Product Images from "Gene-teratogen interactions influence the penetrance of birth defects by altering Hedgehog signaling strength"

    Article Title: Gene-teratogen interactions influence the penetrance of birth defects by altering Hedgehog signaling strength

    Journal: bioRxiv

    doi: 10.1101/2021.06.23.449683

    Construction of Mosmo -/- mice using CRISPR/Cas9 mediated genome editing (A) Mosmo knockout (KO) strategy in NIH/3T3 cells and mice. Schematic of the Mosmo gene with exons represented as boxes, introns represented as a line, and the coding regions shaded in gray (top). Exon 1 is enlarged (below) with arrows marking the sgRNA guide targets. Guide sequences, targets, and deleted regions in NIH/3T3 cells and mouse embryos are shown in blue and red respectively. (B) PCR genotyping strategy to distinguish between wild-type and KO alleles. The Mosmo -/- mouse has a 386 bp deletion (red line) that includes a removal of the entire first exon (white and gray box). Exon 1 is GC rich and thus a combination of four genotyping primers (located within and outside of the deleted region) were used to determine if the allele has the 386 bp deletion. Representative images of the genotyping PCR are shown below.
    Figure Legend Snippet: Construction of Mosmo -/- mice using CRISPR/Cas9 mediated genome editing (A) Mosmo knockout (KO) strategy in NIH/3T3 cells and mice. Schematic of the Mosmo gene with exons represented as boxes, introns represented as a line, and the coding regions shaded in gray (top). Exon 1 is enlarged (below) with arrows marking the sgRNA guide targets. Guide sequences, targets, and deleted regions in NIH/3T3 cells and mouse embryos are shown in blue and red respectively. (B) PCR genotyping strategy to distinguish between wild-type and KO alleles. The Mosmo -/- mouse has a 386 bp deletion (red line) that includes a removal of the entire first exon (white and gray box). Exon 1 is GC rich and thus a combination of four genotyping primers (located within and outside of the deleted region) were used to determine if the allele has the 386 bp deletion. Representative images of the genotyping PCR are shown below.

    Techniques Used: Mouse Assay, CRISPR, Knock-Out, Polymerase Chain Reaction

    37) Product Images from "Gene silencing by double-stranded RNA from C. elegans neurons reveals functional mosaicism of RNA interference"

    Article Title: Gene silencing by double-stranded RNA from C. elegans neurons reveals functional mosaicism of RNA interference

    Journal: bioRxiv

    doi: 10.1101/393074

    Schematic of genomic changes made using Cas9-based genome editing. Genomic changes introduced into the rde-11 , gtbp-1 , rrf-2 , rrf-3 , ego-1 , mut-16 , unc-22 , and sur-5 loci in this study are indicated. The sgRNA target site is indicated (blue for insertions and orange for point mutations and deletions) on the gene structure (exons = grey boxes, introns = grey lines, stop codon = black). Homology-directed repair templates were used to either insert gfp sequences (B, G and H), create point mutations (A, E and F) or to delete the region between two target sites (C and D). Asterisks indicate stop codons and scale bars are as indicated.
    Figure Legend Snippet: Schematic of genomic changes made using Cas9-based genome editing. Genomic changes introduced into the rde-11 , gtbp-1 , rrf-2 , rrf-3 , ego-1 , mut-16 , unc-22 , and sur-5 loci in this study are indicated. The sgRNA target site is indicated (blue for insertions and orange for point mutations and deletions) on the gene structure (exons = grey boxes, introns = grey lines, stop codon = black). Homology-directed repair templates were used to either insert gfp sequences (B, G and H), create point mutations (A, E and F) or to delete the region between two target sites (C and D). Asterisks indicate stop codons and scale bars are as indicated.

    Techniques Used:

    Silencing in the absence of RRF-1 can occur at multiple gfp targets expressed under the control of different regulatory elements. (A) Silencing in the absence of RRF-1 does not depend on chromosomal location of target sequences. Effect of Prgef-1::gfp -dsRNA and loss of rrf-1 on GFP fluorescence in animals with Peft-3::gfp transgenes located on different chromosomes was quantified as in Figure 2B . Grey boxes, cyan boxes, red bars, n, and asterisks are as in Figure 2B . (B-C) A single-copy gene fusion generated using Cas9-based genome editing can be silenced by neuronal dsRNA in rrf-1(-) animals. Representative L4-staged animals that express GFP in all tissues ( Pgtbp-1::gtbp-1::gfp , top ) and animals that in addition express Prgef-1::gfp -dsRNA in rrf-1(+) or rrf-1(-) backgrounds ( middle or bottom , respectively) are shown (B). Insets are representative of the region quantified in multiple animals. Quantification of silencing for GFP expressed from Pgtbp-1::gtbp-1::gfp is shown (C). Grey boxes, cyan boxes, red bars, n, and asterisks are as in Figure 2B . Scale bar = 50 µm. (D) Silencing in the absence of RRF-1 is associated with a detectable decrease in protein levels. Western blot of GFP protein levels in Peft-3::gfp animals expressing gfp -dsRNA in an otherwise wild type background (+/+), mut-16(-) background (no silencing) or rrf-1(-) background (partial silencing). Levels of GFP are normalized to αα -tubulin and the median ratios of 3 technical replicates are shown.
    Figure Legend Snippet: Silencing in the absence of RRF-1 can occur at multiple gfp targets expressed under the control of different regulatory elements. (A) Silencing in the absence of RRF-1 does not depend on chromosomal location of target sequences. Effect of Prgef-1::gfp -dsRNA and loss of rrf-1 on GFP fluorescence in animals with Peft-3::gfp transgenes located on different chromosomes was quantified as in Figure 2B . Grey boxes, cyan boxes, red bars, n, and asterisks are as in Figure 2B . (B-C) A single-copy gene fusion generated using Cas9-based genome editing can be silenced by neuronal dsRNA in rrf-1(-) animals. Representative L4-staged animals that express GFP in all tissues ( Pgtbp-1::gtbp-1::gfp , top ) and animals that in addition express Prgef-1::gfp -dsRNA in rrf-1(+) or rrf-1(-) backgrounds ( middle or bottom , respectively) are shown (B). Insets are representative of the region quantified in multiple animals. Quantification of silencing for GFP expressed from Pgtbp-1::gtbp-1::gfp is shown (C). Grey boxes, cyan boxes, red bars, n, and asterisks are as in Figure 2B . Scale bar = 50 µm. (D) Silencing in the absence of RRF-1 is associated with a detectable decrease in protein levels. Western blot of GFP protein levels in Peft-3::gfp animals expressing gfp -dsRNA in an otherwise wild type background (+/+), mut-16(-) background (no silencing) or rrf-1(-) background (partial silencing). Levels of GFP are normalized to αα -tubulin and the median ratios of 3 technical replicates are shown.

    Techniques Used: Fluorescence, Generated, Western Blot, Expressing

    38) Product Images from "Plasmodium falciparum Guanylyl Cyclase-Alpha and the Activity of Its Appended P4-ATPase Domain Are Essential for cGMP Synthesis and Blood-Stage Egress"

    Article Title: Plasmodium falciparum Guanylyl Cyclase-Alpha and the Activity of Its Appended P4-ATPase Domain Are Essential for cGMP Synthesis and Blood-Stage Egress

    Journal: mBio

    doi: 10.1128/mBio.02694-20

    Key functional domains of the ATPase domain of GCα and strategy for substitution of the phosphorylation site aspartate. (A) Cartoon showing details of the predicted ATPase topology of P. falciparum GCα. (B) Amino acid alignment of the phosphorylation site within the P-domain of P4-ATPases. The aligned sequences are as follows: GCα (PlasmoDB identifier PF3D7_1138400 ), human ATP8A1 ( Q9Y2Q0 -2), human ATP8B1 ( O43520 ), yeast Drs2p ( P39524 ), yeast Dnf1 ( P32660 ), T. gondii GC ( EPT31724 ), P. falciparum GCβ (PlasmoDB identifier PF3D7_1360500 ), rabbit SERCA Ca 2+ -ATPase isoform 1a ( P04191 ), and dogfish Na + /K + -ATPase ( Q4H132 ). (C) Schematic representation of the marker-free CRISPR/Cas9-mediated approach used to introduce synonymous or nonsynonymous mutations into the ATPase domain of GC α in the GCα:HA line. Arrows with numbers represent the relative position of oligonucleotide primers used for diagnostic PCR. A pool of three Cas9 plasmids harboring different gRNA cassettes was transfected, along with a linearized plasmid containing synonymous mutations (D756 control) or mutations resulting in an amino acid change (D756N), flanked by recodonized (rGCα) and endogenous GCα sequences serving as the template for homology-directed repair. Promoters/5′ UTRs and 3′ UTRs/terminators are indicated by arrows and lollipops, respectively. (D) Diagnostic PCR evidencing modification of the GCα locus by integration of the D756 control construct in two independent transfections. The PCR primers used are indicated on the right, and their respective binding sites are shown in panel C.
    Figure Legend Snippet: Key functional domains of the ATPase domain of GCα and strategy for substitution of the phosphorylation site aspartate. (A) Cartoon showing details of the predicted ATPase topology of P. falciparum GCα. (B) Amino acid alignment of the phosphorylation site within the P-domain of P4-ATPases. The aligned sequences are as follows: GCα (PlasmoDB identifier PF3D7_1138400 ), human ATP8A1 ( Q9Y2Q0 -2), human ATP8B1 ( O43520 ), yeast Drs2p ( P39524 ), yeast Dnf1 ( P32660 ), T. gondii GC ( EPT31724 ), P. falciparum GCβ (PlasmoDB identifier PF3D7_1360500 ), rabbit SERCA Ca 2+ -ATPase isoform 1a ( P04191 ), and dogfish Na + /K + -ATPase ( Q4H132 ). (C) Schematic representation of the marker-free CRISPR/Cas9-mediated approach used to introduce synonymous or nonsynonymous mutations into the ATPase domain of GC α in the GCα:HA line. Arrows with numbers represent the relative position of oligonucleotide primers used for diagnostic PCR. A pool of three Cas9 plasmids harboring different gRNA cassettes was transfected, along with a linearized plasmid containing synonymous mutations (D756 control) or mutations resulting in an amino acid change (D756N), flanked by recodonized (rGCα) and endogenous GCα sequences serving as the template for homology-directed repair. Promoters/5′ UTRs and 3′ UTRs/terminators are indicated by arrows and lollipops, respectively. (D) Diagnostic PCR evidencing modification of the GCα locus by integration of the D756 control construct in two independent transfections. The PCR primers used are indicated on the right, and their respective binding sites are shown in panel C.

    Techniques Used: Functional Assay, Marker, CRISPR, Introduce, Diagnostic Assay, Polymerase Chain Reaction, Transfection, Plasmid Preparation, Modification, Construct, Binding Assay

    39) Product Images from "Efficient Peptide-Mediated In Vitro Delivery of Cas9 RNP"

    Article Title: Efficient Peptide-Mediated In Vitro Delivery of Cas9 RNP

    Journal: Pharmaceutics

    doi: 10.3390/pharmaceutics13060878

    Storage capabilities of PF14-Cas9 RNP complexes. Comparison of 50 ng Cas9 complexed with either PF14 (MR 1:150) or RNAiMAX and subsequent editing efficiency after different storage conditions. The Cas9 RNP-PF14 was formulated in DMEM/PVA-PEG buffer. n = 2.
    Figure Legend Snippet: Storage capabilities of PF14-Cas9 RNP complexes. Comparison of 50 ng Cas9 complexed with either PF14 (MR 1:150) or RNAiMAX and subsequent editing efficiency after different storage conditions. The Cas9 RNP-PF14 was formulated in DMEM/PVA-PEG buffer. n = 2.

    Techniques Used:

    Ratio and dose testing of Cas9 RNP complexed with PF14 in a DMEM/PVA-PEG buffer. ( A ) Ratio testing, RNP: PF14, using 10 and 50 ng Cas9 (0.61 or 2.8 nM Cas9) per well in HEK293T SL cells. n = 3 for 10 ng, n = 2 for 50 ng. There was no statistical difference ( p > 0.05) of MR between 1:50 to 1:200 for the 10 ng dose as analysed by analysis of variance (ANOVA), followed by Tukey’s post-hoc test. ( B ) Dose titration of RNP-PF14 (MR 1:100 RNP: PF14) plotted together with RNAiMAX. Doses ranging from 1 ng (0.06 nM) to 100 ng (5.18 nM) per well of HEK293T SL cells. Linear y -axis against log 10 x -axis. There was a significant difference (*, p = 0.0101) between RNAiMAX and PF14 at 2.5 ng per well, the remaining doses showed no significant difference, as analysed by two-way ANOVA followed by Bonferroni’s multiple comparison test, n = 3.
    Figure Legend Snippet: Ratio and dose testing of Cas9 RNP complexed with PF14 in a DMEM/PVA-PEG buffer. ( A ) Ratio testing, RNP: PF14, using 10 and 50 ng Cas9 (0.61 or 2.8 nM Cas9) per well in HEK293T SL cells. n = 3 for 10 ng, n = 2 for 50 ng. There was no statistical difference ( p > 0.05) of MR between 1:50 to 1:200 for the 10 ng dose as analysed by analysis of variance (ANOVA), followed by Tukey’s post-hoc test. ( B ) Dose titration of RNP-PF14 (MR 1:100 RNP: PF14) plotted together with RNAiMAX. Doses ranging from 1 ng (0.06 nM) to 100 ng (5.18 nM) per well of HEK293T SL cells. Linear y -axis against log 10 x -axis. There was a significant difference (*, p = 0.0101) between RNAiMAX and PF14 at 2.5 ng per well, the remaining doses showed no significant difference, as analysed by two-way ANOVA followed by Bonferroni’s multiple comparison test, n = 3.

    Techniques Used: Titration

    Visualization of representative flow cytometry data and microscopy. HEK293T SL cells were used for Figure 3 A–D. ( A ) Dot plots of mC ( y -axis) plotted against eGFP ( x -axis). In the order left to right, non-treated, 10 ng Cas9 RNP-PF14 (MR 1:100, RNP: PF14), and RNAiMAX 10 ng Cas9 RNP. ( B ) Histogram visualizing the eGFP signal in RNP-PF14 treated cells, added text displays Cas9 (ng)/well. ( C , D ) Fluorescence microscopy (10×) displaying the mC and eGFP of cells treated with Cas9 RNP-PF14, 50 ng/well in an increasing MR ratio ( C ) or 100 ng Cas9/well (MR 1:100) ( D ).
    Figure Legend Snippet: Visualization of representative flow cytometry data and microscopy. HEK293T SL cells were used for Figure 3 A–D. ( A ) Dot plots of mC ( y -axis) plotted against eGFP ( x -axis). In the order left to right, non-treated, 10 ng Cas9 RNP-PF14 (MR 1:100, RNP: PF14), and RNAiMAX 10 ng Cas9 RNP. ( B ) Histogram visualizing the eGFP signal in RNP-PF14 treated cells, added text displays Cas9 (ng)/well. ( C , D ) Fluorescence microscopy (10×) displaying the mC and eGFP of cells treated with Cas9 RNP-PF14, 50 ng/well in an increasing MR ratio ( C ) or 100 ng Cas9/well (MR 1:100) ( D ).

    Techniques Used: Flow Cytometry, Microscopy, Fluorescence

    Ratio and dose testing in MDA-MB-231 SL and MCF-7 SL. ( A , B ) Ratio optimization of Cas9 RNP-PF14 (50 ng Cas9/well, formulated in DMEM/PVA-PEG (2.5 w/v %)) given to MDA SL and MCF SL cells. Means of n = 2. ( C , D ) Dose titration of RNP-PF14 (MR 1:150 RNP to PF14 formulated in DMEM/PVA-PEG (2.5 w/v %)) and RNAiMAX on ( C ) MDA SL and ( D ) MCF SL cells, respectively. Linear y -axis against log 10 x -axis. n = 3 for PF14-RNP and n = 2 for RNAiMAX.
    Figure Legend Snippet: Ratio and dose testing in MDA-MB-231 SL and MCF-7 SL. ( A , B ) Ratio optimization of Cas9 RNP-PF14 (50 ng Cas9/well, formulated in DMEM/PVA-PEG (2.5 w/v %)) given to MDA SL and MCF SL cells. Means of n = 2. ( C , D ) Dose titration of RNP-PF14 (MR 1:150 RNP to PF14 formulated in DMEM/PVA-PEG (2.5 w/v %)) and RNAiMAX on ( C ) MDA SL and ( D ) MCF SL cells, respectively. Linear y -axis against log 10 x -axis. n = 3 for PF14-RNP and n = 2 for RNAiMAX.

    Techniques Used: Multiple Displacement Amplification, Titration

    Overview of the experimental setup and PF14 delivery of Cas9 RNP to reporter cells. ( A ) Outline of the general experimental setup. 1. PF14 is complexed with Cas9 RNP and added to cells. 2. The PF14 enables RNP to escape into the cytoplasm, where the nuclear localization signal relocates the RNP to the nucleus, where it cleaves the DNA in the SL construct. 3. The cells are incubated for 72 h after transfection and then analyzed by flow cytometry. ( B ) Flow cytometry results from the HEK293T SL cells treated with the 200 ng Cas9 RNP complexed with PF14 in increasing MR (RNP: PF14). The complexes were formed in HBG buffer. n = 3. ( C ) Size and zeta potential of the HBG-formulated RNP: PF14 complexes in increasing MR, as analyzed by DLS.
    Figure Legend Snippet: Overview of the experimental setup and PF14 delivery of Cas9 RNP to reporter cells. ( A ) Outline of the general experimental setup. 1. PF14 is complexed with Cas9 RNP and added to cells. 2. The PF14 enables RNP to escape into the cytoplasm, where the nuclear localization signal relocates the RNP to the nucleus, where it cleaves the DNA in the SL construct. 3. The cells are incubated for 72 h after transfection and then analyzed by flow cytometry. ( B ) Flow cytometry results from the HEK293T SL cells treated with the 200 ng Cas9 RNP complexed with PF14 in increasing MR (RNP: PF14). The complexes were formed in HBG buffer. n = 3. ( C ) Size and zeta potential of the HBG-formulated RNP: PF14 complexes in increasing MR, as analyzed by DLS.

    Techniques Used: Construct, Incubation, Transfection, Flow Cytometry

    Validation of the flow cytometry data by RFLP analysis. ( A ) The DNA sequence at the Cas9 cleavage site in SL cells. ( B ) Expected RFLP outcome at 0 and 100% XhoI disruption. ( C ) An agarose gel was used for intensity quantification for RFLP analysis of HEK293T SL cells treated with increasing amounts of RNP: PF14 (MR 1:100). The dose of Cas9 per well (ng) and the mean quantified editing is superimposed on the gel image. ( D ) Comparison of a dose titration between flow cytometry quantification and RFLP quantification. Linear y -axis against log 10 x -axis. Flow cytometry quantification was done in triplicate, n = 1. Gel quantification was done in duplicate, n = 1. The cells in ( C , D ) were HEK293T SL cells treated with an increasing dose of Cas9/well (MR 1:100 RNP: PF14, formulated in DMEM/PVA-PEG (5 w/v %)).
    Figure Legend Snippet: Validation of the flow cytometry data by RFLP analysis. ( A ) The DNA sequence at the Cas9 cleavage site in SL cells. ( B ) Expected RFLP outcome at 0 and 100% XhoI disruption. ( C ) An agarose gel was used for intensity quantification for RFLP analysis of HEK293T SL cells treated with increasing amounts of RNP: PF14 (MR 1:100). The dose of Cas9 per well (ng) and the mean quantified editing is superimposed on the gel image. ( D ) Comparison of a dose titration between flow cytometry quantification and RFLP quantification. Linear y -axis against log 10 x -axis. Flow cytometry quantification was done in triplicate, n = 1. Gel quantification was done in duplicate, n = 1. The cells in ( C , D ) were HEK293T SL cells treated with an increasing dose of Cas9/well (MR 1:100 RNP: PF14, formulated in DMEM/PVA-PEG (5 w/v %)).

    Techniques Used: Flow Cytometry, Sequencing, Agarose Gel Electrophoresis, Titration

    Related Articles

    Recombinant:

    Article Title: Efficient Delivery and Nuclear Uptake Is Not Sufficient to Detect Gene Editing in CD34+ Cells Directed by a Ribonucleoprotein Complex
    Article Snippet: .. Assembly of Cas9 RNP Complex The recombinant Cas9 protein, ATTO647-labeled tracrRNA, ATTO550-labeled tracrRNA, HBB gene targeting custom-made crRNAs (G5 and G10), ATTO550-labeled crRNA, and EGFP crRNA were a gift from IDT (Integrated DNA Technologies, Coralville, IA). ..

    Sequencing:

    Article Title: Chromosome counting in the mouse and human zygote using low-invasive super-resolution live-cell imaging
    Article Snippet: .. Preparation of the dCas/gRNA complex The target sequence of minor satellites of mouse was 5’-ACACTGAAAAACACATTCGT -3’while target sequences of alpha satellites of human were 5’-TTCGTTGGAAAC-3’ and 5’-TTCGTTGGAAGC-3’. crRNA and tracrRNA-ATTO550 (Integrated DNA Technologies, Redwood City, CA) hybridized using a T100 thermal cycler (Bio-Rad Laboratories, Hercules, CA, USA) (94 °C: 5 min, 60 °C: 5 min) were mixed with dCas protein (Integrated DNA Technologies, Redwood City, CA). ..

    Article Title: Development of a Facile Approach for Generating Chemically Modified CRISPR/Cas9 RNA
    Article Snippet: .. Generation of Chemically Modified tracrRNAs The templates for the tracrRNA transcription were ordered as complementary oligomers (250-μmol scale, PAGE purified; IDT, CA, USA) and contained a T7 promoter at the 5′ end of the tracrRNA sequence ( ). ..

    In Vitro:

    Article Title: A Simple and Universal System for Gene Manipulation in Aspergillus fumigatus: In Vitro-Assembled Cas9-Guide RNA Ribonucleoproteins Coupled with Microhomology Repair Templates
    Article Snippet: .. Cas9 ribonucleoproteins (RNPs), composed of crRNA, tracrRNA, and the Cas9 protein, were assembled in vitro using commercially available Alt-R-CRISPR-Cas9 components from Integrated DNA Technologies (IDT). ..

    CRISPR:

    Article Title: Vaccine elicitation of HIV broadly neutralizing antibodies from engineered B cells
    Article Snippet: .. CRISPR-Cas9 tracrRNA and HiFi Cas9 nuclease V3 were purchased from IDT (#1072534, #1081061). ..

    Modification:

    Article Title: Development of a Facile Approach for Generating Chemically Modified CRISPR/Cas9 RNA
    Article Snippet: .. Generation of Chemically Modified tracrRNAs The templates for the tracrRNA transcription were ordered as complementary oligomers (250-μmol scale, PAGE purified; IDT, CA, USA) and contained a T7 promoter at the 5′ end of the tracrRNA sequence ( ). ..

    Polyacrylamide Gel Electrophoresis:

    Article Title: Development of a Facile Approach for Generating Chemically Modified CRISPR/Cas9 RNA
    Article Snippet: .. Generation of Chemically Modified tracrRNAs The templates for the tracrRNA transcription were ordered as complementary oligomers (250-μmol scale, PAGE purified; IDT, CA, USA) and contained a T7 promoter at the 5′ end of the tracrRNA sequence ( ). ..

    Purification:

    Article Title: Development of a Facile Approach for Generating Chemically Modified CRISPR/Cas9 RNA
    Article Snippet: .. Generation of Chemically Modified tracrRNAs The templates for the tracrRNA transcription were ordered as complementary oligomers (250-μmol scale, PAGE purified; IDT, CA, USA) and contained a T7 promoter at the 5′ end of the tracrRNA sequence ( ). ..

    other:

    Article Title: Incorporation of bridged nucleic acids into CRISPR RNAs improves Cas9 endonuclease specificity
    Article Snippet: DNA oligonucleotides and tracrRNA were purchased from Integrated DNA Technologies (IDT).

    Labeling:

    Article Title: Somatic gene editing ameliorates skeletal and cardiac muscle failure in pig and human models of Duchenne muscular dystrophy
    Article Snippet: .. Briefly, crRNA oligonucleotides targeting the human DMD exon 51 locus (5’ TAATTTGAAGCTGGACCCTA and 5’ GTCTAGGAGAGTAAAGTGAT) were purchased from IDT and duplexed with fluorescently labeled tracrRNA (IDT 1075927). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Integrated DNA Technologies recombinant cas9 protein
    Model System for Gene Editing of the Mutant EGFP Gene (A) Appropriate segments of the wild-type and mutated EGFP gene with the targeted codon, located in the center of the sequence, are displayed in green and red. The nucleotide targeted for exchange is bolded and underlined. The highlighted bases in blue represent the 2C CRISPR protospacer sequence, and the orange bases highlight the protospacer adjacent motif (PAM) site. The oligonucleotide used in these experiments is 180 bases in length, bearing phosphorothioate-modified linkages at the three terminal bases; the 180-mer targets the non-transcribed (NT) strand (180NT). In the <t>CRISPR/Cas9</t> ribonucleoprotein assembly reaction, crRNA provides target specificity (20 bases, red section), corresponding to the 2C protospacer sequence, and an interaction domain (blue) with the tracrRNA (green), which has an ATTO647 fluorescent dye attached to the 5′ end. crRNA and tracrRNA are annealed in equimolar concentrations. Cas9 protein (gray) is added to complete RNP assembly. Guide RNAs (gRNAs) direct and activate the Cas9 endonuclease, which then cleaves the target DNA. The lower section of the figure shows the 2C seed sequence and the tracrRNA sequence. (B) Synchronized and released HCT116-19 cells were electroporated with 0.1–0.75 μM at equimolar amounts of CRISPR/Cas9 RNP and 180NT. The tracrRNA used for these experiments has ATTO647 fluorescent dye attached to the 5′ end, which permitted the measurement of RNP transfection. After a 72-hr recovery period, transfection was measured using a FACSAria II flow cytometer. Quadrant 3 shows the cells that were not transfected. Quadrant 4 shows the cells that were positive for CRISPR/Cas9 RNP (ATTO647 fluorescent dye positive). (C) Representative z stack images of HCT116-19 cells transfected with ATTO550-labeled RNP complex 16 hr post-transfection. The z stack top view images show a group of cells with gradual increment of the confocal slices. The green cell in the field of view exhibited gene editing due to a corrected EGFP gene. Blue represents DAPI-stained nuclei, and red represents ATTO550-labeled RNP. (D) Top panel shows the sequence for the HBB gene and the G5 CRISPR seed sequences used in these studies. The oligonucleotide used in these experiments is 72 bases in length, bearing phosphorothioate-modified linkages at the three terminal bases. The 72-mer is used to create a mismatch to produce the sickle cell sequence. Unsynchronized HCT116-19 cells were electroporated with 3 μM RNP with HBB ALT-R G5 CRISPR and 72-mer oligonucleotides (Oligos), both at equimolar amounts. After a 72-hr recovery period, cells were collected. DNA was then isolated, and the HBB gene was amplified and subjected to Sanger sequencing and TIDE analyses to investigate the gene editing activity around the target site.
    Recombinant Cas9 Protein, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant cas9 protein/product/Integrated DNA Technologies
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    recombinant cas9 protein - by Bioz Stars, 2021-08
    86/100 stars
      Buy from Supplier

    99
    Integrated DNA Technologies cas9 protein
    Selection of dual crRNA protospacer sequences. (A) Schematic diagram of pksP coding sequence and the flanking regions that are targeted by dual in vitro -assembled <t>Cas9</t> RNPs. Designing the protospacers is described in Results. (B and C) Sequence alignment of pksP upstream (B) and downstream (C) regions of three distinct genetic backgrounds of A. fumigatus . The consensus sequence (highlighted in orange) was manually generated based on sequence alignment. The 5′ crRNA and 3′ crRNA protospacer sequences are marked by red open boxes. The protospacer-adjacent motif (PAM) sequences are marked by blue open boxes. Start and stop codons are highlighted in gray. The additional adenine in the pksP downstream region of the Δ akuB strain and the clinical isolate DI15-102 is shown in red font. Cas9 DSB sites (i.e., 3 nucleotides upstream of the PAM site [ 1 , 9 , 57 ]) are marked by a vertical line in the sequence. The sequences of the 35-bp and 50-bp regions that are used for microhomology-mediated integration are marked by a line above the sequence.
    Cas9 Protein, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cas9 protein/product/Integrated DNA Technologies
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cas9 protein - by Bioz Stars, 2021-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    Model System for Gene Editing of the Mutant EGFP Gene (A) Appropriate segments of the wild-type and mutated EGFP gene with the targeted codon, located in the center of the sequence, are displayed in green and red. The nucleotide targeted for exchange is bolded and underlined. The highlighted bases in blue represent the 2C CRISPR protospacer sequence, and the orange bases highlight the protospacer adjacent motif (PAM) site. The oligonucleotide used in these experiments is 180 bases in length, bearing phosphorothioate-modified linkages at the three terminal bases; the 180-mer targets the non-transcribed (NT) strand (180NT). In the CRISPR/Cas9 ribonucleoprotein assembly reaction, crRNA provides target specificity (20 bases, red section), corresponding to the 2C protospacer sequence, and an interaction domain (blue) with the tracrRNA (green), which has an ATTO647 fluorescent dye attached to the 5′ end. crRNA and tracrRNA are annealed in equimolar concentrations. Cas9 protein (gray) is added to complete RNP assembly. Guide RNAs (gRNAs) direct and activate the Cas9 endonuclease, which then cleaves the target DNA. The lower section of the figure shows the 2C seed sequence and the tracrRNA sequence. (B) Synchronized and released HCT116-19 cells were electroporated with 0.1–0.75 μM at equimolar amounts of CRISPR/Cas9 RNP and 180NT. The tracrRNA used for these experiments has ATTO647 fluorescent dye attached to the 5′ end, which permitted the measurement of RNP transfection. After a 72-hr recovery period, transfection was measured using a FACSAria II flow cytometer. Quadrant 3 shows the cells that were not transfected. Quadrant 4 shows the cells that were positive for CRISPR/Cas9 RNP (ATTO647 fluorescent dye positive). (C) Representative z stack images of HCT116-19 cells transfected with ATTO550-labeled RNP complex 16 hr post-transfection. The z stack top view images show a group of cells with gradual increment of the confocal slices. The green cell in the field of view exhibited gene editing due to a corrected EGFP gene. Blue represents DAPI-stained nuclei, and red represents ATTO550-labeled RNP. (D) Top panel shows the sequence for the HBB gene and the G5 CRISPR seed sequences used in these studies. The oligonucleotide used in these experiments is 72 bases in length, bearing phosphorothioate-modified linkages at the three terminal bases. The 72-mer is used to create a mismatch to produce the sickle cell sequence. Unsynchronized HCT116-19 cells were electroporated with 3 μM RNP with HBB ALT-R G5 CRISPR and 72-mer oligonucleotides (Oligos), both at equimolar amounts. After a 72-hr recovery period, cells were collected. DNA was then isolated, and the HBB gene was amplified and subjected to Sanger sequencing and TIDE analyses to investigate the gene editing activity around the target site.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: Efficient Delivery and Nuclear Uptake Is Not Sufficient to Detect Gene Editing in CD34+ Cells Directed by a Ribonucleoprotein Complex

    doi: 10.1016/j.omtn.2018.01.013

    Figure Lengend Snippet: Model System for Gene Editing of the Mutant EGFP Gene (A) Appropriate segments of the wild-type and mutated EGFP gene with the targeted codon, located in the center of the sequence, are displayed in green and red. The nucleotide targeted for exchange is bolded and underlined. The highlighted bases in blue represent the 2C CRISPR protospacer sequence, and the orange bases highlight the protospacer adjacent motif (PAM) site. The oligonucleotide used in these experiments is 180 bases in length, bearing phosphorothioate-modified linkages at the three terminal bases; the 180-mer targets the non-transcribed (NT) strand (180NT). In the CRISPR/Cas9 ribonucleoprotein assembly reaction, crRNA provides target specificity (20 bases, red section), corresponding to the 2C protospacer sequence, and an interaction domain (blue) with the tracrRNA (green), which has an ATTO647 fluorescent dye attached to the 5′ end. crRNA and tracrRNA are annealed in equimolar concentrations. Cas9 protein (gray) is added to complete RNP assembly. Guide RNAs (gRNAs) direct and activate the Cas9 endonuclease, which then cleaves the target DNA. The lower section of the figure shows the 2C seed sequence and the tracrRNA sequence. (B) Synchronized and released HCT116-19 cells were electroporated with 0.1–0.75 μM at equimolar amounts of CRISPR/Cas9 RNP and 180NT. The tracrRNA used for these experiments has ATTO647 fluorescent dye attached to the 5′ end, which permitted the measurement of RNP transfection. After a 72-hr recovery period, transfection was measured using a FACSAria II flow cytometer. Quadrant 3 shows the cells that were not transfected. Quadrant 4 shows the cells that were positive for CRISPR/Cas9 RNP (ATTO647 fluorescent dye positive). (C) Representative z stack images of HCT116-19 cells transfected with ATTO550-labeled RNP complex 16 hr post-transfection. The z stack top view images show a group of cells with gradual increment of the confocal slices. The green cell in the field of view exhibited gene editing due to a corrected EGFP gene. Blue represents DAPI-stained nuclei, and red represents ATTO550-labeled RNP. (D) Top panel shows the sequence for the HBB gene and the G5 CRISPR seed sequences used in these studies. The oligonucleotide used in these experiments is 72 bases in length, bearing phosphorothioate-modified linkages at the three terminal bases. The 72-mer is used to create a mismatch to produce the sickle cell sequence. Unsynchronized HCT116-19 cells were electroporated with 3 μM RNP with HBB ALT-R G5 CRISPR and 72-mer oligonucleotides (Oligos), both at equimolar amounts. After a 72-hr recovery period, cells were collected. DNA was then isolated, and the HBB gene was amplified and subjected to Sanger sequencing and TIDE analyses to investigate the gene editing activity around the target site.

    Article Snippet: Assembly of Cas9 RNP Complex The recombinant Cas9 protein, ATTO647-labeled tracrRNA, ATTO550-labeled tracrRNA, HBB gene targeting custom-made crRNAs (G5 and G10), ATTO550-labeled crRNA, and EGFP crRNA were a gift from IDT (Integrated DNA Technologies, Coralville, IA).

    Techniques: Mutagenesis, Sequencing, CRISPR, Modification, Transfection, Flow Cytometry, Cytometry, Labeling, Staining, Isolation, Amplification, Activity Assay

    Selection of dual crRNA protospacer sequences. (A) Schematic diagram of pksP coding sequence and the flanking regions that are targeted by dual in vitro -assembled Cas9 RNPs. Designing the protospacers is described in Results. (B and C) Sequence alignment of pksP upstream (B) and downstream (C) regions of three distinct genetic backgrounds of A. fumigatus . The consensus sequence (highlighted in orange) was manually generated based on sequence alignment. The 5′ crRNA and 3′ crRNA protospacer sequences are marked by red open boxes. The protospacer-adjacent motif (PAM) sequences are marked by blue open boxes. Start and stop codons are highlighted in gray. The additional adenine in the pksP downstream region of the Δ akuB strain and the clinical isolate DI15-102 is shown in red font. Cas9 DSB sites (i.e., 3 nucleotides upstream of the PAM site [ 1 , 9 , 57 ]) are marked by a vertical line in the sequence. The sequences of the 35-bp and 50-bp regions that are used for microhomology-mediated integration are marked by a line above the sequence.

    Journal: mSphere

    Article Title: A Simple and Universal System for Gene Manipulation in Aspergillus fumigatus: In Vitro-Assembled Cas9-Guide RNA Ribonucleoproteins Coupled with Microhomology Repair Templates

    doi: 10.1128/mSphere.00446-17

    Figure Lengend Snippet: Selection of dual crRNA protospacer sequences. (A) Schematic diagram of pksP coding sequence and the flanking regions that are targeted by dual in vitro -assembled Cas9 RNPs. Designing the protospacers is described in Results. (B and C) Sequence alignment of pksP upstream (B) and downstream (C) regions of three distinct genetic backgrounds of A. fumigatus . The consensus sequence (highlighted in orange) was manually generated based on sequence alignment. The 5′ crRNA and 3′ crRNA protospacer sequences are marked by red open boxes. The protospacer-adjacent motif (PAM) sequences are marked by blue open boxes. Start and stop codons are highlighted in gray. The additional adenine in the pksP downstream region of the Δ akuB strain and the clinical isolate DI15-102 is shown in red font. Cas9 DSB sites (i.e., 3 nucleotides upstream of the PAM site [ 1 , 9 , 57 ]) are marked by a vertical line in the sequence. The sequences of the 35-bp and 50-bp regions that are used for microhomology-mediated integration are marked by a line above the sequence.

    Article Snippet: Cas9 ribonucleoproteins (RNPs), composed of crRNA, tracrRNA, and the Cas9 protein, were assembled in vitro using commercially available Alt-R-CRISPR-Cas9 components from Integrated DNA Technologies (IDT).

    Techniques: Selection, Sequencing, In Vitro, Generated

    High efficiency of gene deletion in all tested genetic backgrounds of A. fumigatus . In vitro -assembled Cas9 RNPs coupled with microhomology-mediated integration of the HygR cassette were tested in Δ akuB (A), Af293 (B), and DI15-102 (C) strains. (Above) Representative transformation plates are shown for each strain using 2 µg of the HygR repair template that is flanked by 35-bp microhomology arms. (Below) The assessment of pksP deletion efficiency across different strains is plotted as the number of Δ pksP mutants out of the total number of transformation colonies. Deletion efficiencies were assessed based on the color of conidia. The Δ pksP mutant produces white colonies, while ectopic integrations result in green colonies. Deletion efficiencies represent the average from at least three independent transformations. Error bars represent the standard deviation calculated for each combination of strain, the size of HygR microhomology arms, and concentration of the HygR repair template for all experimental replicates.

    Journal: mSphere

    Article Title: A Simple and Universal System for Gene Manipulation in Aspergillus fumigatus: In Vitro-Assembled Cas9-Guide RNA Ribonucleoproteins Coupled with Microhomology Repair Templates

    doi: 10.1128/mSphere.00446-17

    Figure Lengend Snippet: High efficiency of gene deletion in all tested genetic backgrounds of A. fumigatus . In vitro -assembled Cas9 RNPs coupled with microhomology-mediated integration of the HygR cassette were tested in Δ akuB (A), Af293 (B), and DI15-102 (C) strains. (Above) Representative transformation plates are shown for each strain using 2 µg of the HygR repair template that is flanked by 35-bp microhomology arms. (Below) The assessment of pksP deletion efficiency across different strains is plotted as the number of Δ pksP mutants out of the total number of transformation colonies. Deletion efficiencies were assessed based on the color of conidia. The Δ pksP mutant produces white colonies, while ectopic integrations result in green colonies. Deletion efficiencies represent the average from at least three independent transformations. Error bars represent the standard deviation calculated for each combination of strain, the size of HygR microhomology arms, and concentration of the HygR repair template for all experimental replicates.

    Article Snippet: Cas9 ribonucleoproteins (RNPs), composed of crRNA, tracrRNA, and the Cas9 protein, were assembled in vitro using commercially available Alt-R-CRISPR-Cas9 components from Integrated DNA Technologies (IDT).

    Techniques: In Vitro, Transformation Assay, Mutagenesis, Standard Deviation, Concentration Assay

    Southern blot analysis of Δ pksP mutant generated in the Af293 background. (A) Schematic representation of the genomic locus of the Af293 and Δ pksP strains. Deletion of the pksP gene was carried out using the HygR cassette. The cleavage sites of the dual in vitro -assembled Cas9 RNPs are marked by thick vertical lines. XhoI cutting sites are indicated in the pksP locus of the wild-type and Δ pksP strains. (B) Southern blot analysis of 6 arbitrarily selected colonies after digesting genomic DNA with the XhoI restriction enzyme. The wild type (WT) produced a 1.8-kb band that matches the expected wild-type banding pattern. Lanes 1, 2, 4, 5, and 6 displayed a 3.8-kb band which matches the expected pksP deletion banding pattern. The colony in lane 3 displayed a 7.6-kb band, likely containing a tandem integration of the HygR repair template at the pksP locus.

    Journal: mSphere

    Article Title: A Simple and Universal System for Gene Manipulation in Aspergillus fumigatus: In Vitro-Assembled Cas9-Guide RNA Ribonucleoproteins Coupled with Microhomology Repair Templates

    doi: 10.1128/mSphere.00446-17

    Figure Lengend Snippet: Southern blot analysis of Δ pksP mutant generated in the Af293 background. (A) Schematic representation of the genomic locus of the Af293 and Δ pksP strains. Deletion of the pksP gene was carried out using the HygR cassette. The cleavage sites of the dual in vitro -assembled Cas9 RNPs are marked by thick vertical lines. XhoI cutting sites are indicated in the pksP locus of the wild-type and Δ pksP strains. (B) Southern blot analysis of 6 arbitrarily selected colonies after digesting genomic DNA with the XhoI restriction enzyme. The wild type (WT) produced a 1.8-kb band that matches the expected wild-type banding pattern. Lanes 1, 2, 4, 5, and 6 displayed a 3.8-kb band which matches the expected pksP deletion banding pattern. The colony in lane 3 displayed a 7.6-kb band, likely containing a tandem integration of the HygR repair template at the pksP locus.

    Article Snippet: Cas9 ribonucleoproteins (RNPs), composed of crRNA, tracrRNA, and the Cas9 protein, were assembled in vitro using commercially available Alt-R-CRISPR-Cas9 components from Integrated DNA Technologies (IDT).

    Techniques: Southern Blot, Mutagenesis, Generated, In Vitro, Produced

    The concentration of Cas9 directly correlates with the efficiency of gene deletion. The analysis was carried out in the Af293 strain using 2 µg of the HygR repair template flanked by 35 bp of microhomology regions. Dilution of Cas9 is described in Materials and Methods. The effect of Cas9 concentration on pksP deletion rates was assessed based on the color of conidia. Deletion efficiencies represent the average from at least three independent transformations. Error bars represent the standard deviation calculated for each concentration of Cas9.

    Journal: mSphere

    Article Title: A Simple and Universal System for Gene Manipulation in Aspergillus fumigatus: In Vitro-Assembled Cas9-Guide RNA Ribonucleoproteins Coupled with Microhomology Repair Templates

    doi: 10.1128/mSphere.00446-17

    Figure Lengend Snippet: The concentration of Cas9 directly correlates with the efficiency of gene deletion. The analysis was carried out in the Af293 strain using 2 µg of the HygR repair template flanked by 35 bp of microhomology regions. Dilution of Cas9 is described in Materials and Methods. The effect of Cas9 concentration on pksP deletion rates was assessed based on the color of conidia. Deletion efficiencies represent the average from at least three independent transformations. Error bars represent the standard deviation calculated for each concentration of Cas9.

    Article Snippet: Cas9 ribonucleoproteins (RNPs), composed of crRNA, tracrRNA, and the Cas9 protein, were assembled in vitro using commercially available Alt-R-CRISPR-Cas9 components from Integrated DNA Technologies (IDT).

    Techniques: Concentration Assay, Standard Deviation

    Overview of microhomology-mediated gene deletion coupled with in vitro -assembled dual Cas9 RNP cleavage. (A) (1) Cas9, tracrRNA, and dual crRNAs that cleave upstream and downstream of the pksP gene were purchased from a commercial vendor. The assembly of dual gRNA duplexes was performed by separately mixing each crRNA with equimolar amounts of tracrRNA to a final concentration of 33 μM. The two mixtures were boiled at 95°C for 5 min and then cooled to room temperature (20 to 25°C) for 10 to 15 min to allow hybridization of the crRNA to the tracrRNA. (2) For generation of dual Cas9 RNPs, each gRNA duplex was separately mixed with Cas9 (1 µg/µl) and incubated at room temperature for 5 min to allow for the formation of RNP complexes. (3) For generation of the repair template, the HygR cassette was PCR amplified using primer sets that insert 35 bp or 50 bp of flanking microhomology regions for targeting the pksP gene locus. The resulting PCR fragments were purified and utilized as repair templates. (4) The two RNP reaction mixtures were mixed with the HygR repair template and then added to A. fumigatus protoplast suspension (5 × 10 7 conidia/ml). The protoplasts were then transformed according to a standard protocol. (B) Inside the protoplasts, the dual Cas9 RNPs cleave upstream and downstream of pksP , resulting in complete removal of the pksP coding sequence. In the presence of the HygR repair template, the cleaved pksP gene is replaced by the HygR repair template mediated by 35 to 50 bp of microhomology regions. Deletion mutants of the pksP gene exhibit white conidia, which allow for simple assessment of gene deletion based on the conidial color of the colonies.

    Journal: mSphere

    Article Title: A Simple and Universal System for Gene Manipulation in Aspergillus fumigatus: In Vitro-Assembled Cas9-Guide RNA Ribonucleoproteins Coupled with Microhomology Repair Templates

    doi: 10.1128/mSphere.00446-17

    Figure Lengend Snippet: Overview of microhomology-mediated gene deletion coupled with in vitro -assembled dual Cas9 RNP cleavage. (A) (1) Cas9, tracrRNA, and dual crRNAs that cleave upstream and downstream of the pksP gene were purchased from a commercial vendor. The assembly of dual gRNA duplexes was performed by separately mixing each crRNA with equimolar amounts of tracrRNA to a final concentration of 33 μM. The two mixtures were boiled at 95°C for 5 min and then cooled to room temperature (20 to 25°C) for 10 to 15 min to allow hybridization of the crRNA to the tracrRNA. (2) For generation of dual Cas9 RNPs, each gRNA duplex was separately mixed with Cas9 (1 µg/µl) and incubated at room temperature for 5 min to allow for the formation of RNP complexes. (3) For generation of the repair template, the HygR cassette was PCR amplified using primer sets that insert 35 bp or 50 bp of flanking microhomology regions for targeting the pksP gene locus. The resulting PCR fragments were purified and utilized as repair templates. (4) The two RNP reaction mixtures were mixed with the HygR repair template and then added to A. fumigatus protoplast suspension (5 × 10 7 conidia/ml). The protoplasts were then transformed according to a standard protocol. (B) Inside the protoplasts, the dual Cas9 RNPs cleave upstream and downstream of pksP , resulting in complete removal of the pksP coding sequence. In the presence of the HygR repair template, the cleaved pksP gene is replaced by the HygR repair template mediated by 35 to 50 bp of microhomology regions. Deletion mutants of the pksP gene exhibit white conidia, which allow for simple assessment of gene deletion based on the conidial color of the colonies.

    Article Snippet: Cas9 ribonucleoproteins (RNPs), composed of crRNA, tracrRNA, and the Cas9 protein, were assembled in vitro using commercially available Alt-R-CRISPR-Cas9 components from Integrated DNA Technologies (IDT).

    Techniques: In Vitro, Concentration Assay, Hybridization, Incubation, Polymerase Chain Reaction, Amplification, Purification, Transformation Assay, Sequencing

    NanoString nCounter™ profiling identifies pronounced gene expression changes (including TXNIP upregulation) as a consequence of CRISPR/Cas9-based GLO1 deletion in human A375 malignant melanoma cells. NanoString™ analysis (using the nCounter™ PanCancer Progression Panel) was performed comparing gene expression between cultured human A375 malignant melanoma cells ( GLO1 _WT) and an isogenic variant ( GLO1 _KO [B40]). (a) Volcano plot [fold change (log2) versus p-value (log10)] depicting differential gene expression of 740 genes ( GLO1 _KO versus GLO1 _WT; cut-off criteria: fold change ≥ 2; p ≤ 0.05; upregulated: green dots; downregulated: red dots). (b) Left panel: heat map depiction of statistically significant expression changes; right panel: table summarizing numerical values of up- and downregulated genes; cut off criteria as specified in (a). (c) NanoString nCounter™ covariate plot of gene expression ‘pathway scores’ as a function of GLO1 genotype identifying GLO1 -responsive expression networks. (d) Volcano plots depicting individual expression pathways identified in panel (c) characterized by TXNIP upregulation representing the most pronounced expression change: ‘regulation of metabolism’ (out of 16 genes), ‘cellular growth’ (out of 97 genes), ‘cell cycle’ (out of 46 genes), and ‘metastasis suppression’ (out of 19 genes). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

    Journal: Redox Biology

    Article Title: Genomic GLO1 deletion modulates TXNIP expression, glucose metabolism, and redox homeostasis while accelerating human A375 malignant melanoma tumor growth

    doi: 10.1016/j.redox.2020.101838

    Figure Lengend Snippet: NanoString nCounter™ profiling identifies pronounced gene expression changes (including TXNIP upregulation) as a consequence of CRISPR/Cas9-based GLO1 deletion in human A375 malignant melanoma cells. NanoString™ analysis (using the nCounter™ PanCancer Progression Panel) was performed comparing gene expression between cultured human A375 malignant melanoma cells ( GLO1 _WT) and an isogenic variant ( GLO1 _KO [B40]). (a) Volcano plot [fold change (log2) versus p-value (log10)] depicting differential gene expression of 740 genes ( GLO1 _KO versus GLO1 _WT; cut-off criteria: fold change ≥ 2; p ≤ 0.05; upregulated: green dots; downregulated: red dots). (b) Left panel: heat map depiction of statistically significant expression changes; right panel: table summarizing numerical values of up- and downregulated genes; cut off criteria as specified in (a). (c) NanoString nCounter™ covariate plot of gene expression ‘pathway scores’ as a function of GLO1 genotype identifying GLO1 -responsive expression networks. (d) Volcano plots depicting individual expression pathways identified in panel (c) characterized by TXNIP upregulation representing the most pronounced expression change: ‘regulation of metabolism’ (out of 16 genes), ‘cellular growth’ (out of 97 genes), ‘cell cycle’ (out of 46 genes), and ‘metastasis suppression’ (out of 19 genes). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

    Article Snippet: Parental cells were transfected with Cas9 protein, crRNAs, and trans -activating crRNA (Integrated DNA Technologies, San Diego, CA) using the Lipofectamine RNAiMAX reagent (Thermo Fisher Scientific, Waltham, MA).

    Techniques: Expressing, CRISPR, Cell Culture, Variant Assay