Structured Review

Addgene inc cas9 nickase
<t>Cas9</t> <t>nickase</t> shows lower off-target activity with loss of target editing efficiency. Schematic of RAG1A, RAG1B, RAG1C, and RAG1G target site positions. Purple arrows indicated the biotinylated primers used for primer-extension-mediated sequencing. Yellow boxes represented guide RNA target sites and red bars indicated Cas9 cleavage site. In the lower panels, pie graph showed the compositions of germline, indels, and translocation for indicated Cas9 treatment in HEK293T cells. Mean ± SD
Cas9 Nickase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cas9 nickase/product/Addgene inc
Average 94 stars, based on 10 article reviews
Price from $9.99 to $1999.99
cas9 nickase - by Bioz Stars, 2020-04
94/100 stars

Images

1) Product Images from "Optimizing genome editing strategy by primer-extension-mediated sequencing"

Article Title: Optimizing genome editing strategy by primer-extension-mediated sequencing

Journal: Cell Discovery

doi: 10.1038/s41421-019-0088-8

Cas9 nickase shows lower off-target activity with loss of target editing efficiency. Schematic of RAG1A, RAG1B, RAG1C, and RAG1G target site positions. Purple arrows indicated the biotinylated primers used for primer-extension-mediated sequencing. Yellow boxes represented guide RNA target sites and red bars indicated Cas9 cleavage site. In the lower panels, pie graph showed the compositions of germline, indels, and translocation for indicated Cas9 treatment in HEK293T cells. Mean ± SD
Figure Legend Snippet: Cas9 nickase shows lower off-target activity with loss of target editing efficiency. Schematic of RAG1A, RAG1B, RAG1C, and RAG1G target site positions. Purple arrows indicated the biotinylated primers used for primer-extension-mediated sequencing. Yellow boxes represented guide RNA target sites and red bars indicated Cas9 cleavage site. In the lower panels, pie graph showed the compositions of germline, indels, and translocation for indicated Cas9 treatment in HEK293T cells. Mean ± SD

Techniques Used: Activity Assay, Sequencing, Translocation Assay

2) Product Images from "CRISPR/Cas9-mediated genome editing in naïve human embryonic stem cells"

Article Title: CRISPR/Cas9-mediated genome editing in naïve human embryonic stem cells

Journal: Scientific Reports

doi: 10.1038/s41598-017-16932-y

Majority of indels is present between both cleavage sites after editing with Cas9 nickase. Distance of the start position of each insertion or deletion to the theoretical cleavage site (=3 bp upstream of the PAM sequence) is presented on the x-axis, while the relative frequency of the indel is presented on the y-axis after editing with the Cas9 nickase. Length of indels are represented by the different colors. Only 1 replicate is shown. The majority of indels is present between the two theoretical cleavage sites (indicated by the black lines at position 0 (sgRNA1) and at positions 44 bp ( TUNA ), 25 bp ( EMX1 ) and 38 bp ( MEG3 ). Percentages of indels 1) within or spanning both the two cleavage sites and 2) indels spanning at least one of the two sites are shown below the graph. Replicate 2 of EMX1 has an editing efficiency of 2.7% (compared to 5% for replicate 1), which can explain the lower percentage of indels located between the two cleavage sites.
Figure Legend Snippet: Majority of indels is present between both cleavage sites after editing with Cas9 nickase. Distance of the start position of each insertion or deletion to the theoretical cleavage site (=3 bp upstream of the PAM sequence) is presented on the x-axis, while the relative frequency of the indel is presented on the y-axis after editing with the Cas9 nickase. Length of indels are represented by the different colors. Only 1 replicate is shown. The majority of indels is present between the two theoretical cleavage sites (indicated by the black lines at position 0 (sgRNA1) and at positions 44 bp ( TUNA ), 25 bp ( EMX1 ) and 38 bp ( MEG3 ). Percentages of indels 1) within or spanning both the two cleavage sites and 2) indels spanning at least one of the two sites are shown below the graph. Replicate 2 of EMX1 has an editing efficiency of 2.7% (compared to 5% for replicate 1), which can explain the lower percentage of indels located between the two cleavage sites.

Techniques Used: Sequencing

3) Product Images from "Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9"

Article Title: Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9

Journal: Cell stem cell

doi: 10.1016/j.stem.2015.06.001

Generation of FRT knock-in hPSC lines using Cas9 nickase
Figure Legend Snippet: Generation of FRT knock-in hPSC lines using Cas9 nickase

Techniques Used: Knock-In

Related Articles

Clone Assay:

Article Title: Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression
Article Snippet: Commonly used plasmids for expression of Cas9 or Cas9-nickase (D10A) and single gRNA are available from the Zhang laboratory and can be obtained through the Addgene plasmid repository. .. Importantly, generation of a unique customized gRNA of interest can be performed easily as the gRNA cloning site contains BbsI restriction sites, allowing a one-step golden gate cloning approach for insertion of a pair of annealed oligonucleotides containing the specific ~20 bp guide sequence [ , ].

Article Title: Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9
Article Snippet: Human codon-optimized Streptococcus pyogenes wild-type Cas9 (Cas9-2A-GFP) and Cas9 nickase (Cas9D10A-2A-GFP) were obtained from Addgene (plasmid #44719 and plasmid #44720) ( ). .. A previously described chimeric guide RNA expression cassette was ordered as gBlocks and cloned into the gRNA cloning vector (Addgene plasmid #41824) ( ).

Article Title: Embryonic Stem Cells Derived Kidney Organoids as Faithful Models to Target Programmed Nephrogenesis
Article Snippet: Cas9 nickase was used for editing the second exon of the Wnt4 ). pSpCas9n (BB)-2A-GFP (AddGene: PX461) was modified by replacing 2A-GFP with 2A-mCherry. .. Paired oligoes corresponding to Wnt4 gRNA1 (5′-TCGAGGAGTGCCAATACCAG-3′) were cloned into pSpCas9n (BB)-2A-GFP vector.

Article Title: The Dual NOD1/NOD2 Agonism of Muropeptides Containing a Meso-Diaminopimelic Acid Residue
Article Snippet: The plasmid pcDNA3.3-Cas9n, encoding Cas9 nickase (Cas9n), was derived from the pcDNA3.3-Cas9 plasmid (Addgene #41815) [ ] by introducing a D(10)A mutation into Cas9 coding sequence. .. The pKS-gRNA-BB vector, designed for custom sgRNA expression, was generated as described [ ]. pKS-gRNA-BB contains a U6 RNA polymerase III promoter required for sgRNA transcription, two BbsI restriction sites for cloning of a synthetic double-stranded oligodeoxynucleotide (dsODN) encoding the gene-specific part of sgRNA, and a sequence encoding the constant part of sgRNA [ ]. sgRNA target sites in the 5’-most regions of the NOD1 and NOD2 coding sequences were selected according to the published rules [ ] using an online tool at http://crispr.mit.edu/ .

Article Title: The bipartite TAD organization of the X-inactivation center ensures opposing developmental regulation of Tsix and Xist
Article Snippet: .. Plasmids sgRNAs were designed at each side of the region to be deleted or inverted, and cloned by annealing oligo pairs in pX330 for Cas9 nuclease, pX335 for Cas9 nickase and pX459 for Cas9 nuclease with Puromycin selection marker, according to the protocol described in . pX330, pX335 and pX459 plasmids were a gift from Feng Zhang, respectively Addgene #42230 , Addgene #42335 and Addgene #48139 . .. For Xite mutants a pair of TALENs was designed on each side of the region to be deleted or inverted.

Article Title: CRISPR/Cas9-mediated genome editing in naïve human embryonic stem cells
Article Snippet: .. Cas9 nuclease The two sgRNAs used with the Cas9 nickase were individually cloned into the pX330 plasmid (Addgene Plasmid #42230). .. The vector was digested with BbsI (R0539S, Bioké) and annealed oligonucleotides were ligated into the digested plasmid with the DNA ligation kit (TB6023, Westburg) according manufacturer’s instructions.

Amplification:

Article Title: Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9
Article Snippet: Human codon-optimized Streptococcus pyogenes wild-type Cas9 (Cas9-2A-GFP) and Cas9 nickase (Cas9D10A-2A-GFP) were obtained from Addgene (plasmid #44719 and plasmid #44720) ( ). .. Cas9-2A-Cre was constructed by replacing GFP in the Cas9-2A-GFP with the Cre cDNA amplified from pCAG-Cre (Addgene plasmid #13775) ( ). sgRNA T2 was obtained from Addgene (plasmid #41818) ( ).

DNA Ligation:

Article Title: CRISPR/Cas9-mediated genome editing in naïve human embryonic stem cells
Article Snippet: Cas9 nuclease The two sgRNAs used with the Cas9 nickase were individually cloned into the pX330 plasmid (Addgene Plasmid #42230). .. The vector was digested with BbsI (R0539S, Bioké) and annealed oligonucleotides were ligated into the digested plasmid with the DNA ligation kit (TB6023, Westburg) according manufacturer’s instructions.

Synthesized:

Article Title: The Dual NOD1/NOD2 Agonism of Muropeptides Containing a Meso-Diaminopimelic Acid Residue
Article Snippet: The plasmid pcDNA3.3-Cas9n, encoding Cas9 nickase (Cas9n), was derived from the pcDNA3.3-Cas9 plasmid (Addgene #41815) [ ] by introducing a D(10)A mutation into Cas9 coding sequence. .. Single-stranded, 5’-phosphorylated ODNs corresponding to the gene-specific parts of sgRNAs ( ) were synthesized at Syntol (Moscow, Russia).

Article Title: Human SHMT inhibitors reveal defective glycine import as a targetable metabolic vulnerability of diffuse large B-cell lymphoma
Article Snippet: Cas9 nickase and guide RNA expression plasmid pSpCasn(BB)-2A-Puro (48141) was purchased from Addgene. .. All primers were synthesized by IDT.

Construct:

Article Title: Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9
Article Snippet: Human codon-optimized Streptococcus pyogenes wild-type Cas9 (Cas9-2A-GFP) and Cas9 nickase (Cas9D10A-2A-GFP) were obtained from Addgene (plasmid #44719 and plasmid #44720) ( ). .. Cas9-2A-Cre was constructed by replacing GFP in the Cas9-2A-GFP with the Cre cDNA amplified from pCAG-Cre (Addgene plasmid #13775) ( ). sgRNA T2 was obtained from Addgene (plasmid #41818) ( ).

Article Title: Embryonic Stem Cells Derived Kidney Organoids as Faithful Models to Target Programmed Nephrogenesis
Article Snippet: Cas9 nickase was used for editing the second exon of the Wnt4 ). pSpCas9n (BB)-2A-GFP (AddGene: PX461) was modified by replacing 2A-GFP with 2A-mCherry. .. Paired GFP and mCherry constructs were co-electroporated into mESCs.

Article Title: Human SHMT inhibitors reveal defective glycine import as a targetable metabolic vulnerability of diffuse large B-cell lymphoma
Article Snippet: Paragraph title: Cell Lines, Reagents, Constructs, and Antibodies. ... Cas9 nickase and guide RNA expression plasmid pSpCasn(BB)-2A-Puro (48141) was purchased from Addgene.

Luciferase:

Article Title: The Dual NOD1/NOD2 Agonism of Muropeptides Containing a Meso-Diaminopimelic Acid Residue
Article Snippet: Plasmids The pGL4.32[luc2P/NF-kB-RE/Hygro] plasmid, which encodes a human-codon-optimized luciferase gene (luc2P) under an NF-κB-dependent promoter, was purchased from Promega (Madison, WI). .. The plasmid pcDNA3.3-Cas9n, encoding Cas9 nickase (Cas9n), was derived from the pcDNA3.3-Cas9 plasmid (Addgene #41815) [ ] by introducing a D(10)A mutation into Cas9 coding sequence.

Activity Assay:

Article Title: Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression
Article Snippet: CRISPR/Cas9 offers several advantages over preexisting genome editing technologies including ease of use, relatively low cost and high activity [ – ]. .. Commonly used plasmids for expression of Cas9 or Cas9-nickase (D10A) and single gRNA are available from the Zhang laboratory and can be obtained through the Addgene plasmid repository.

Expressing:

Article Title: Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression
Article Snippet: .. Commonly used plasmids for expression of Cas9 or Cas9-nickase (D10A) and single gRNA are available from the Zhang laboratory and can be obtained through the Addgene plasmid repository. .. These plasmids contain both gRNA and Cas9 expression cassettes in a single plasmid with optional selection markers such as puromycin or GFP to facilitate screening.

Article Title: Bone morphogenetic protein and retinoic acid synergistically specify female germ‐cell fate in mice
Article Snippet: .. The vector expressing the Cas9 nickase (Addgene #42335) fused in frame with a reporter gene GSG‐p2A‐mCherry was created (the mCherry used contained a silent mutation, 432G > A). .. Two pairs of oligonucleotides ( ) for targeting exon 6 of Stra8 were annealed, phosphorylated, and ligated separately to the above‐mentioned vector digested by Bbsl (NEB), according to the reported protocols (Ran et al , , ).

Article Title: The Dual NOD1/NOD2 Agonism of Muropeptides Containing a Meso-Diaminopimelic Acid Residue
Article Snippet: The plasmids pUNO1-hNOD1 and pUNO-hNOD2a for the expression of human NOD1 and NOD2, respectively, under a constitutive promoter, were purchased from Invivogen (San Diego, CA). pcDNA3.1 was from Life Technologies (Paisley, UK). .. The plasmid pcDNA3.3-Cas9n, encoding Cas9 nickase (Cas9n), was derived from the pcDNA3.3-Cas9 plasmid (Addgene #41815) [ ] by introducing a D(10)A mutation into Cas9 coding sequence.

Article Title: Bone morphogenetic protein and retinoic acid synergistically specify female germ‐cell fate in mice
Article Snippet: .. The ESCs were dissociated 2 days after the transfection, and single cells expressing high levels of mCherry, which are expected to also express high levels of the Cas9 nickase, were sorted by FACS and seeded onto MEFs in single wells of 96‐well plates so that each well contained a single clone. .. The clones were cultured and expanded, and the disruption of the Stra8 loci in the clones was assessed by Sanger sequencing of the PCR products of the relevant region ( ).

Modification:

Article Title: Embryonic Stem Cells Derived Kidney Organoids as Faithful Models to Target Programmed Nephrogenesis
Article Snippet: .. Cas9 nickase was used for editing the second exon of the Wnt4 ). pSpCas9n (BB)-2A-GFP (AddGene: PX461) was modified by replacing 2A-GFP with 2A-mCherry. .. Paired oligoes corresponding to Wnt4 gRNA1 (5′-TCGAGGAGTGCCAATACCAG-3′) were cloned into pSpCas9n (BB)-2A-GFP vector.

Article Title: The bipartite TAD organization of the X-inactivation center ensures opposing developmental regulation of Tsix and Xist
Article Snippet: Plasmids sgRNAs were designed at each side of the region to be deleted or inverted, and cloned by annealing oligo pairs in pX330 for Cas9 nuclease, pX335 for Cas9 nickase and pX459 for Cas9 nuclease with Puromycin selection marker, according to the protocol described in . pX330, pX335 and pX459 plasmids were a gift from Feng Zhang, respectively Addgene #42230 , Addgene #42335 and Addgene #48139 . .. TALEN backbones were modified to contain a CAGGS promoter instead of the default CMV promoter . sgRNA and TALEN sequences and Cas9 plasmids for each cell line were used as listed in Supplementary Table 1.

Derivative Assay:

Article Title: The Dual NOD1/NOD2 Agonism of Muropeptides Containing a Meso-Diaminopimelic Acid Residue
Article Snippet: .. The plasmid pcDNA3.3-Cas9n, encoding Cas9 nickase (Cas9n), was derived from the pcDNA3.3-Cas9 plasmid (Addgene #41815) [ ] by introducing a D(10)A mutation into Cas9 coding sequence. .. The pKS-gRNA-BB vector, designed for custom sgRNA expression, was generated as described [ ]. pKS-gRNA-BB contains a U6 RNA polymerase III promoter required for sgRNA transcription, two BbsI restriction sites for cloning of a synthetic double-stranded oligodeoxynucleotide (dsODN) encoding the gene-specific part of sgRNA, and a sequence encoding the constant part of sgRNA [ ]. sgRNA target sites in the 5’-most regions of the NOD1 and NOD2 coding sequences were selected according to the published rules [ ] using an online tool at http://crispr.mit.edu/ .

Electroporation:

Article Title: Bone morphogenetic protein and retinoic acid synergistically specify female germ‐cell fate in mice
Article Snippet: The vector expressing the Cas9 nickase (Addgene #42335) fused in frame with a reporter gene GSG‐p2A‐mCherry was created (the mCherry used contained a silent mutation, 432G > A). .. The pair of nickase plasmids (200 ng each) was introduced into the BDF1‐2‐1 BVSC ESCs by electroporation using the NEPA21 type II electroporator.

Transfection:

Article Title: Bone morphogenetic protein and retinoic acid synergistically specify female germ‐cell fate in mice
Article Snippet: .. The ESCs were dissociated 2 days after the transfection, and single cells expressing high levels of mCherry, which are expected to also express high levels of the Cas9 nickase, were sorted by FACS and seeded onto MEFs in single wells of 96‐well plates so that each well contained a single clone. .. The clones were cultured and expanded, and the disruption of the Stra8 loci in the clones was assessed by Sanger sequencing of the PCR products of the relevant region ( ).

Cell Culture:

Article Title: Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression
Article Snippet: Introduction CRISPR/Cas9 technology is a powerful genome editing tool that has become widely used by researchers to generate targeted genetic modifications in many contexts including cultured cell lines and zygotes. .. Commonly used plasmids for expression of Cas9 or Cas9-nickase (D10A) and single gRNA are available from the Zhang laboratory and can be obtained through the Addgene plasmid repository.

Generated:

Article Title: Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9
Article Snippet: Human codon-optimized Streptococcus pyogenes wild-type Cas9 (Cas9-2A-GFP) and Cas9 nickase (Cas9D10A-2A-GFP) were obtained from Addgene (plasmid #44719 and plasmid #44720) ( ). .. To facilitate the sgRNA construction, we generated Cas9 sgRNA vector.

Article Title: A High-Throughput functional genomics workflow based on CRISPR/Cas9-mediated targeted mutagenesis in zebrafish
Article Snippet: .. We have generated a zebrafish codon optimized version of the Cas9 nickase (pT3TS-nls-zCas9-nlsD10A) (addgene # 78634) plasmid, however, we have not systematically compared its on-target and off-target mutagenic activities to wild-type Cas9. .. Recently, two different versions of spCas9 were developed with reported higher specificity than the wild-type Cas9 , , we have generated zebrafish codon optimized versions of spCas9 VQR (addgene #78662) and spCas9 EQR (addgene#78663), but we have not yet tested their efficacy in zebrafish.

Article Title: The Dual NOD1/NOD2 Agonism of Muropeptides Containing a Meso-Diaminopimelic Acid Residue
Article Snippet: The plasmid pcDNA3.3-Cas9n, encoding Cas9 nickase (Cas9n), was derived from the pcDNA3.3-Cas9 plasmid (Addgene #41815) [ ] by introducing a D(10)A mutation into Cas9 coding sequence. .. The pKS-gRNA-BB vector, designed for custom sgRNA expression, was generated as described [ ]. pKS-gRNA-BB contains a U6 RNA polymerase III promoter required for sgRNA transcription, two BbsI restriction sites for cloning of a synthetic double-stranded oligodeoxynucleotide (dsODN) encoding the gene-specific part of sgRNA, and a sequence encoding the constant part of sgRNA [ ]. sgRNA target sites in the 5’-most regions of the NOD1 and NOD2 coding sequences were selected according to the published rules [ ] using an online tool at http://crispr.mit.edu/ .

Article Title: Optimizing genome editing strategy by primer-extension-mediated sequencing
Article Snippet: Cas9 targeting gRNAs used the pX330 backbone (Addgene 42230) and the Cas9 nickase using pX335 (Addgene 42335). .. Cas9 variants, Sa Cas9 were inserted into pX330 backbone as follows: Cas9 variants cDNAs (D1135E, eCas9(1.1), and FeCas9) were generated by mutation-overlap PCR and then inserted into pX330 plasmid through Age I/Eco RI.

Polymerase Chain Reaction:

Article Title: Optimizing genome editing strategy by primer-extension-mediated sequencing
Article Snippet: Cas9 targeting gRNAs used the pX330 backbone (Addgene 42230) and the Cas9 nickase using pX335 (Addgene 42335). .. Cas9 variants, Sa Cas9 were inserted into pX330 backbone as follows: Cas9 variants cDNAs (D1135E, eCas9(1.1), and FeCas9) were generated by mutation-overlap PCR and then inserted into pX330 plasmid through Age I/Eco RI.

Mutagenesis:

Article Title: A High-Throughput functional genomics workflow based on CRISPR/Cas9-mediated targeted mutagenesis in zebrafish
Article Snippet: We previously detected a germline mutation in one off-target site out of 25 predicted off-target sites tested . .. We have generated a zebrafish codon optimized version of the Cas9 nickase (pT3TS-nls-zCas9-nlsD10A) (addgene # 78634) plasmid, however, we have not systematically compared its on-target and off-target mutagenic activities to wild-type Cas9.

Article Title: Bone morphogenetic protein and retinoic acid synergistically specify female germ‐cell fate in mice
Article Snippet: .. The vector expressing the Cas9 nickase (Addgene #42335) fused in frame with a reporter gene GSG‐p2A‐mCherry was created (the mCherry used contained a silent mutation, 432G > A). .. Two pairs of oligonucleotides ( ) for targeting exon 6 of Stra8 were annealed, phosphorylated, and ligated separately to the above‐mentioned vector digested by Bbsl (NEB), according to the reported protocols (Ran et al , , ).

Article Title: The Dual NOD1/NOD2 Agonism of Muropeptides Containing a Meso-Diaminopimelic Acid Residue
Article Snippet: .. The plasmid pcDNA3.3-Cas9n, encoding Cas9 nickase (Cas9n), was derived from the pcDNA3.3-Cas9 plasmid (Addgene #41815) [ ] by introducing a D(10)A mutation into Cas9 coding sequence. .. The pKS-gRNA-BB vector, designed for custom sgRNA expression, was generated as described [ ]. pKS-gRNA-BB contains a U6 RNA polymerase III promoter required for sgRNA transcription, two BbsI restriction sites for cloning of a synthetic double-stranded oligodeoxynucleotide (dsODN) encoding the gene-specific part of sgRNA, and a sequence encoding the constant part of sgRNA [ ]. sgRNA target sites in the 5’-most regions of the NOD1 and NOD2 coding sequences were selected according to the published rules [ ] using an online tool at http://crispr.mit.edu/ .

Article Title: Optimizing genome editing strategy by primer-extension-mediated sequencing
Article Snippet: Cas9 targeting gRNAs used the pX330 backbone (Addgene 42230) and the Cas9 nickase using pX335 (Addgene 42335). .. Cas9 variants, Sa Cas9 were inserted into pX330 backbone as follows: Cas9 variants cDNAs (D1135E, eCas9(1.1), and FeCas9) were generated by mutation-overlap PCR and then inserted into pX330 plasmid through Age I/Eco RI.

Purification:

Article Title: Optimizing genome editing strategy by primer-extension-mediated sequencing
Article Snippet: Cas9 targeting gRNAs used the pX330 backbone (Addgene 42230) and the Cas9 nickase using pX335 (Addgene 42335). .. Sa Cas9 cDNA was purified with Age I/Eco RI from pX601 (Addgene 61591) and then directly ligated to Age I/Eco RI-digested pX330 plasmid, and the U6 promoter-Sa Cas9 gRNA scaffold DNA from pX601 was inserted into pX330-Sa Cas9 between Afl III and Xba I. AcrIIA4 plasmid PJH376 was obtained from Addgene (Addgene 86842).

Sequencing:

Article Title: Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression
Article Snippet: Commonly used plasmids for expression of Cas9 or Cas9-nickase (D10A) and single gRNA are available from the Zhang laboratory and can be obtained through the Addgene plasmid repository. .. Importantly, generation of a unique customized gRNA of interest can be performed easily as the gRNA cloning site contains BbsI restriction sites, allowing a one-step golden gate cloning approach for insertion of a pair of annealed oligonucleotides containing the specific ~20 bp guide sequence [ , ].

Article Title: A High-Throughput functional genomics workflow based on CRISPR/Cas9-mediated targeted mutagenesis in zebrafish
Article Snippet: The PAM sequence requirement can be relaxed by using alternative Cas9s from different bacteria with different PAM requirements, and the 5′ GG or GA requirement can be addressed using different lengths of targets (19nt, 18nt) , , chemically synthesizing the sgRNA, or using Csy4 to trim off leader sequences . .. We have generated a zebrafish codon optimized version of the Cas9 nickase (pT3TS-nls-zCas9-nlsD10A) (addgene # 78634) plasmid, however, we have not systematically compared its on-target and off-target mutagenic activities to wild-type Cas9.

Article Title: The Dual NOD1/NOD2 Agonism of Muropeptides Containing a Meso-Diaminopimelic Acid Residue
Article Snippet: .. The plasmid pcDNA3.3-Cas9n, encoding Cas9 nickase (Cas9n), was derived from the pcDNA3.3-Cas9 plasmid (Addgene #41815) [ ] by introducing a D(10)A mutation into Cas9 coding sequence. .. The pKS-gRNA-BB vector, designed for custom sgRNA expression, was generated as described [ ]. pKS-gRNA-BB contains a U6 RNA polymerase III promoter required for sgRNA transcription, two BbsI restriction sites for cloning of a synthetic double-stranded oligodeoxynucleotide (dsODN) encoding the gene-specific part of sgRNA, and a sequence encoding the constant part of sgRNA [ ]. sgRNA target sites in the 5’-most regions of the NOD1 and NOD2 coding sequences were selected according to the published rules [ ] using an online tool at http://crispr.mit.edu/ .

Selection:

Article Title: Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression
Article Snippet: Commonly used plasmids for expression of Cas9 or Cas9-nickase (D10A) and single gRNA are available from the Zhang laboratory and can be obtained through the Addgene plasmid repository. .. These plasmids contain both gRNA and Cas9 expression cassettes in a single plasmid with optional selection markers such as puromycin or GFP to facilitate screening.

Article Title: The bipartite TAD organization of the X-inactivation center ensures opposing developmental regulation of Tsix and Xist
Article Snippet: .. Plasmids sgRNAs were designed at each side of the region to be deleted or inverted, and cloned by annealing oligo pairs in pX330 for Cas9 nuclease, pX335 for Cas9 nickase and pX459 for Cas9 nuclease with Puromycin selection marker, according to the protocol described in . pX330, pX335 and pX459 plasmids were a gift from Feng Zhang, respectively Addgene #42230 , Addgene #42335 and Addgene #48139 . .. For Xite mutants a pair of TALENs was designed on each side of the region to be deleted or inverted.

CRISPR:

Article Title: Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression
Article Snippet: CRISPR/Cas9 offers several advantages over preexisting genome editing technologies including ease of use, relatively low cost and high activity [ – ]. .. Commonly used plasmids for expression of Cas9 or Cas9-nickase (D10A) and single gRNA are available from the Zhang laboratory and can be obtained through the Addgene plasmid repository.

Article Title: A High-Throughput functional genomics workflow based on CRISPR/Cas9-mediated targeted mutagenesis in zebrafish
Article Snippet: A generally-recognized limitation of CRISPR/Cas9-based genome editing is off-target cleavage. .. We have generated a zebrafish codon optimized version of the Cas9 nickase (pT3TS-nls-zCas9-nlsD10A) (addgene # 78634) plasmid, however, we have not systematically compared its on-target and off-target mutagenic activities to wild-type Cas9.

Article Title: Embryonic Stem Cells Derived Kidney Organoids as Faithful Models to Target Programmed Nephrogenesis
Article Snippet: Paragraph title: CRISPR/Cas9 genome editing ... Cas9 nickase was used for editing the second exon of the Wnt4 ). pSpCas9n (BB)-2A-GFP (AddGene: PX461) was modified by replacing 2A-GFP with 2A-mCherry.

Article Title: Human SHMT inhibitors reveal defective glycine import as a targetable metabolic vulnerability of diffuse large B-cell lymphoma
Article Snippet: SHMT2 was knocked out in HCT-116 lines using CRISPR/Cas9 nickase method using the following PAM sequences in exon 2: GGACAGGCAGTGTCGTGGCCTGG, TCTCAGGATCACTGTCCGACAGG ( ). .. Cas9 nickase and guide RNA expression plasmid pSpCasn(BB)-2A-Puro (48141) was purchased from Addgene.

Plasmid Preparation:

Article Title: Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression
Article Snippet: .. Commonly used plasmids for expression of Cas9 or Cas9-nickase (D10A) and single gRNA are available from the Zhang laboratory and can be obtained through the Addgene plasmid repository. .. These plasmids contain both gRNA and Cas9 expression cassettes in a single plasmid with optional selection markers such as puromycin or GFP to facilitate screening.

Article Title: Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9
Article Snippet: .. Human codon-optimized Streptococcus pyogenes wild-type Cas9 (Cas9-2A-GFP) and Cas9 nickase (Cas9D10A-2A-GFP) were obtained from Addgene (plasmid #44719 and plasmid #44720) ( ). .. Cas9-2A-Cre was constructed by replacing GFP in the Cas9-2A-GFP with the Cre cDNA amplified from pCAG-Cre (Addgene plasmid #13775) ( ). sgRNA T2 was obtained from Addgene (plasmid #41818) ( ).

Article Title: A High-Throughput functional genomics workflow based on CRISPR/Cas9-mediated targeted mutagenesis in zebrafish
Article Snippet: .. We have generated a zebrafish codon optimized version of the Cas9 nickase (pT3TS-nls-zCas9-nlsD10A) (addgene # 78634) plasmid, however, we have not systematically compared its on-target and off-target mutagenic activities to wild-type Cas9. .. Recently, two different versions of spCas9 were developed with reported higher specificity than the wild-type Cas9 , , we have generated zebrafish codon optimized versions of spCas9 VQR (addgene #78662) and spCas9 EQR (addgene#78663), but we have not yet tested their efficacy in zebrafish.

Article Title: Bone morphogenetic protein and retinoic acid synergistically specify female germ‐cell fate in mice
Article Snippet: .. The vector expressing the Cas9 nickase (Addgene #42335) fused in frame with a reporter gene GSG‐p2A‐mCherry was created (the mCherry used contained a silent mutation, 432G > A). .. Two pairs of oligonucleotides ( ) for targeting exon 6 of Stra8 were annealed, phosphorylated, and ligated separately to the above‐mentioned vector digested by Bbsl (NEB), according to the reported protocols (Ran et al , , ).

Article Title: Embryonic Stem Cells Derived Kidney Organoids as Faithful Models to Target Programmed Nephrogenesis
Article Snippet: Cas9 nickase was used for editing the second exon of the Wnt4 ). pSpCas9n (BB)-2A-GFP (AddGene: PX461) was modified by replacing 2A-GFP with 2A-mCherry. .. Paired oligoes corresponding to Wnt4 gRNA1 (5′-TCGAGGAGTGCCAATACCAG-3′) were cloned into pSpCas9n (BB)-2A-GFP vector.

Article Title: The Dual NOD1/NOD2 Agonism of Muropeptides Containing a Meso-Diaminopimelic Acid Residue
Article Snippet: .. The plasmid pcDNA3.3-Cas9n, encoding Cas9 nickase (Cas9n), was derived from the pcDNA3.3-Cas9 plasmid (Addgene #41815) [ ] by introducing a D(10)A mutation into Cas9 coding sequence. .. The pKS-gRNA-BB vector, designed for custom sgRNA expression, was generated as described [ ]. pKS-gRNA-BB contains a U6 RNA polymerase III promoter required for sgRNA transcription, two BbsI restriction sites for cloning of a synthetic double-stranded oligodeoxynucleotide (dsODN) encoding the gene-specific part of sgRNA, and a sequence encoding the constant part of sgRNA [ ]. sgRNA target sites in the 5’-most regions of the NOD1 and NOD2 coding sequences were selected according to the published rules [ ] using an online tool at http://crispr.mit.edu/ .

Article Title: Optimizing genome editing strategy by primer-extension-mediated sequencing
Article Snippet: Paragraph title: Plasmid construction ... Cas9 targeting gRNAs used the pX330 backbone (Addgene 42230) and the Cas9 nickase using pX335 (Addgene 42335).

Article Title: CRISPR/Cas9-mediated genome editing in naïve human embryonic stem cells
Article Snippet: .. Cas9 nuclease The two sgRNAs used with the Cas9 nickase were individually cloned into the pX330 plasmid (Addgene Plasmid #42230). .. The vector was digested with BbsI (R0539S, Bioké) and annealed oligonucleotides were ligated into the digested plasmid with the DNA ligation kit (TB6023, Westburg) according manufacturer’s instructions.

Article Title: Human SHMT inhibitors reveal defective glycine import as a targetable metabolic vulnerability of diffuse large B-cell lymphoma
Article Snippet: .. Cas9 nickase and guide RNA expression plasmid pSpCasn(BB)-2A-Puro (48141) was purchased from Addgene. .. All primers were synthesized by IDT.

RNA Expression:

Article Title: Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9
Article Snippet: Human codon-optimized Streptococcus pyogenes wild-type Cas9 (Cas9-2A-GFP) and Cas9 nickase (Cas9D10A-2A-GFP) were obtained from Addgene (plasmid #44719 and plasmid #44720) ( ). .. A previously described chimeric guide RNA expression cassette was ordered as gBlocks and cloned into the gRNA cloning vector (Addgene plasmid #41824) ( ).

Article Title: Human SHMT inhibitors reveal defective glycine import as a targetable metabolic vulnerability of diffuse large B-cell lymphoma
Article Snippet: .. Cas9 nickase and guide RNA expression plasmid pSpCasn(BB)-2A-Puro (48141) was purchased from Addgene. .. All primers were synthesized by IDT.

Knock-Out:

Article Title: Bone morphogenetic protein and retinoic acid synergistically specify female germ‐cell fate in mice
Article Snippet: Paragraph title: Establishment of Stra8 ‐knockout ESCs ... The vector expressing the Cas9 nickase (Addgene #42335) fused in frame with a reporter gene GSG‐p2A‐mCherry was created (the mCherry used contained a silent mutation, 432G > A).

SSA Assay:

Article Title: Bone morphogenetic protein and retinoic acid synergistically specify female germ‐cell fate in mice
Article Snippet: The vector expressing the Cas9 nickase (Addgene #42335) fused in frame with a reporter gene GSG‐p2A‐mCherry was created (the mCherry used contained a silent mutation, 432G > A). .. The activities of the nickases were evaluated by the SSA assay.

Marker:

Article Title: The bipartite TAD organization of the X-inactivation center ensures opposing developmental regulation of Tsix and Xist
Article Snippet: .. Plasmids sgRNAs were designed at each side of the region to be deleted or inverted, and cloned by annealing oligo pairs in pX330 for Cas9 nuclease, pX335 for Cas9 nickase and pX459 for Cas9 nuclease with Puromycin selection marker, according to the protocol described in . pX330, pX335 and pX459 plasmids were a gift from Feng Zhang, respectively Addgene #42230 , Addgene #42335 and Addgene #48139 . .. For Xite mutants a pair of TALENs was designed on each side of the region to be deleted or inverted.

FACS:

Article Title: Bone morphogenetic protein and retinoic acid synergistically specify female germ‐cell fate in mice
Article Snippet: .. The ESCs were dissociated 2 days after the transfection, and single cells expressing high levels of mCherry, which are expected to also express high levels of the Cas9 nickase, were sorted by FACS and seeded onto MEFs in single wells of 96‐well plates so that each well contained a single clone. .. The clones were cultured and expanded, and the disruption of the Stra8 loci in the clones was assessed by Sanger sequencing of the PCR products of the relevant region ( ).

TALENs:

Article Title: The bipartite TAD organization of the X-inactivation center ensures opposing developmental regulation of Tsix and Xist
Article Snippet: Plasmids sgRNAs were designed at each side of the region to be deleted or inverted, and cloned by annealing oligo pairs in pX330 for Cas9 nuclease, pX335 for Cas9 nickase and pX459 for Cas9 nuclease with Puromycin selection marker, according to the protocol described in . pX330, pX335 and pX459 plasmids were a gift from Feng Zhang, respectively Addgene #42230 , Addgene #42335 and Addgene #48139 . .. For Xite mutants a pair of TALENs was designed on each side of the region to be deleted or inverted.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    Addgene inc crispr cas9 nickase system cas9 d10a coding plasmid
    4E-BP3 limits cap-dependent translation during mTORC1 inhibition. ( a ) MiaPaCa-2 cells were treated with mTOR inhibitors (Rapa 100 nM and PP242 1 μM) for the indicated time. Lysates were subjected to m 7 GDP pull-down assay. A representative result of two independent experiments is shown. ( b ) Exon 1 of human EIF4EBP3 targeted by the <t>Crispr-Cas9</t> <t>nickase</t> system. Targeted sequences are shown in blue. Protospacer adjacent motif (PAM) is highlighted in red. Protein coding region is underlined. ( c ) Internal deletion induced by two sgRNAs targeting EIF4EBP3 . Protein coding region is underlined. ( d ) Protein synthesis was measured by a non-radioactive puromycin labelling (SUnSET) assay (see the method). ** P
    Crispr Cas9 Nickase System Cas9 D10a Coding Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/crispr cas9 nickase system cas9 d10a coding plasmid/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    crispr cas9 nickase system cas9 d10a coding plasmid - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    94
    Addgene inc crispr cas9 nickase
    Lentiviral <t>CRISPR/Cas9</t> <t>nickase</t> vector-mediated MTF1 gene editing resulted in inhibition of EMT in ovarian cancer cells. A. MTF1 and EMT marker expression was examined in MTF1 KO and control SKOV3 and OVCAR3 cells by Western blot. B. Immunofluorescent staining of MTF1 expression in SKOV3 MTF1 KO and control cells. C. Mesenchymal marker β-catenin was stained in SKOV3 MTF1 KO and control cells. D. Epithelial marker cytokeratin 7 was stained in SKOV3 MTF1 KO and control cells.
    Crispr Cas9 Nickase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/crispr cas9 nickase/product/Addgene inc
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    crispr cas9 nickase - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    94
    Addgene inc cas9 d10a nickase
    CRISPR-mediated knock-in of GFP transgene into the PRNP locus. ( A ) Schematic of the targeting vector showing targeting homology arms (HA) to the pig PRNP locus and strategy for knock-in. In the targeting vector, the upper arm is 1000 bp and the lower arm 500 bp in length. The linearized targeting vector, <t>Cas9</t> mRNA and sgRNA targeting PRNP were co-injected into the cytoplasm of porcine zygotes. As shown in the schematic, Cas9 induces double strand break in exon 3 of PRNP gene. The cut DNA is then repaired by HDR using the targeting vector, resulting in the targeted allele. The use of Cas9D10A <t>(nickase)</t> introduced a single stranded nick as compared to DSB by Cas9, triggering HDR mediated knock-in into the PRNP locus. Dark grey boxes represent exons of the PRNP gene. ( B ) PCR amplification using primers one within the targeting vector and another outside of the targeting vector produced specific bands of 1050 bp confirming targeting to the intended locus. In the figure, the 1000 bp and 500 bp markers with corresponding bright bands on the ladder are shown as a reference. ( C ) Representative knock-in embryos that have developed to the blastocyst stage showed varied GFP expression in both Cas9D10A and Cas9 injections.
    Cas9 D10a Nickase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cas9 d10a nickase/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cas9 d10a nickase - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    4E-BP3 limits cap-dependent translation during mTORC1 inhibition. ( a ) MiaPaCa-2 cells were treated with mTOR inhibitors (Rapa 100 nM and PP242 1 μM) for the indicated time. Lysates were subjected to m 7 GDP pull-down assay. A representative result of two independent experiments is shown. ( b ) Exon 1 of human EIF4EBP3 targeted by the Crispr-Cas9 nickase system. Targeted sequences are shown in blue. Protospacer adjacent motif (PAM) is highlighted in red. Protein coding region is underlined. ( c ) Internal deletion induced by two sgRNAs targeting EIF4EBP3 . Protein coding region is underlined. ( d ) Protein synthesis was measured by a non-radioactive puromycin labelling (SUnSET) assay (see the method). ** P

    Journal: Nature Communications

    Article Title: Translation control during prolonged mTORC1 inhibition mediated by 4E-BP3

    doi: 10.1038/ncomms11776

    Figure Lengend Snippet: 4E-BP3 limits cap-dependent translation during mTORC1 inhibition. ( a ) MiaPaCa-2 cells were treated with mTOR inhibitors (Rapa 100 nM and PP242 1 μM) for the indicated time. Lysates were subjected to m 7 GDP pull-down assay. A representative result of two independent experiments is shown. ( b ) Exon 1 of human EIF4EBP3 targeted by the Crispr-Cas9 nickase system. Targeted sequences are shown in blue. Protospacer adjacent motif (PAM) is highlighted in red. Protein coding region is underlined. ( c ) Internal deletion induced by two sgRNAs targeting EIF4EBP3 . Protein coding region is underlined. ( d ) Protein synthesis was measured by a non-radioactive puromycin labelling (SUnSET) assay (see the method). ** P

    Article Snippet: Generating human EIF4EBP3 KO cells using Crispr-Cas9 nickase system Cas9 D10A coding plasmid (Addgene: pX461) was digested with BbsI and ligated with annealed oligonucleotides corresponding to small guide RNAs (sgRNAs) targeting specific genomic loci.

    Techniques: Inhibition, Pull Down Assay, CRISPR

    Lentiviral CRISPR/Cas9 nickase vector-mediated MTF1 gene editing resulted in inhibition of EMT in ovarian cancer cells. A. MTF1 and EMT marker expression was examined in MTF1 KO and control SKOV3 and OVCAR3 cells by Western blot. B. Immunofluorescent staining of MTF1 expression in SKOV3 MTF1 KO and control cells. C. Mesenchymal marker β-catenin was stained in SKOV3 MTF1 KO and control cells. D. Epithelial marker cytokeratin 7 was stained in SKOV3 MTF1 KO and control cells.

    Journal: Journal of Cancer

    Article Title: Knockout of MTF1 Inhibits the Epithelial to Mesenchymal Transition in Ovarian Cancer Cells

    doi: 10.7150/jca.28040

    Figure Lengend Snippet: Lentiviral CRISPR/Cas9 nickase vector-mediated MTF1 gene editing resulted in inhibition of EMT in ovarian cancer cells. A. MTF1 and EMT marker expression was examined in MTF1 KO and control SKOV3 and OVCAR3 cells by Western blot. B. Immunofluorescent staining of MTF1 expression in SKOV3 MTF1 KO and control cells. C. Mesenchymal marker β-catenin was stained in SKOV3 MTF1 KO and control cells. D. Epithelial marker cytokeratin 7 was stained in SKOV3 MTF1 KO and control cells.

    Article Snippet: CRISPR/cas9 nickase was driven by EF1a promoter in LentiCas9-blast vector (#52962, Addgene).

    Techniques: CRISPR, Plasmid Preparation, Inhibition, Marker, Expressing, Western Blot, Staining

    Lentiviral CRISPR/Cas9 nickase vector-mediated MTF1 gene editing resulted in inhibition of EMT in ovarian cancer cells. A. MTF1 and EMT marker expression was examined in MTF1 KO and control SKOV3 and OVCAR3 cells by Western blot. B. Immunofluorescent staining of MTF1 expression in SKOV3 MTF1 KO and control cells. C. Mesenchymal marker β-catenin was stained in SKOV3 MTF1 KO and control cells. D. Epithelial marker cytokeratin 7 was stained in SKOV3 MTF1 KO and control cells.

    Journal: Journal of Cancer

    Article Title: Knockout of MTF1 Inhibits the Epithelial to Mesenchymal Transition in Ovarian Cancer Cells

    doi: 10.7150/jca.28040

    Figure Lengend Snippet: Lentiviral CRISPR/Cas9 nickase vector-mediated MTF1 gene editing resulted in inhibition of EMT in ovarian cancer cells. A. MTF1 and EMT marker expression was examined in MTF1 KO and control SKOV3 and OVCAR3 cells by Western blot. B. Immunofluorescent staining of MTF1 expression in SKOV3 MTF1 KO and control cells. C. Mesenchymal marker β-catenin was stained in SKOV3 MTF1 KO and control cells. D. Epithelial marker cytokeratin 7 was stained in SKOV3 MTF1 KO and control cells.

    Article Snippet: CRISPR/cas9 nickase was driven by EF1a promoter in LentiCas9-blast vector (#52962, Addgene).

    Techniques: CRISPR, Plasmid Preparation, Inhibition, Marker, Expressing, Western Blot, Staining

    CRISPR-mediated knock-in of GFP transgene into the PRNP locus. ( A ) Schematic of the targeting vector showing targeting homology arms (HA) to the pig PRNP locus and strategy for knock-in. In the targeting vector, the upper arm is 1000 bp and the lower arm 500 bp in length. The linearized targeting vector, Cas9 mRNA and sgRNA targeting PRNP were co-injected into the cytoplasm of porcine zygotes. As shown in the schematic, Cas9 induces double strand break in exon 3 of PRNP gene. The cut DNA is then repaired by HDR using the targeting vector, resulting in the targeted allele. The use of Cas9D10A (nickase) introduced a single stranded nick as compared to DSB by Cas9, triggering HDR mediated knock-in into the PRNP locus. Dark grey boxes represent exons of the PRNP gene. ( B ) PCR amplification using primers one within the targeting vector and another outside of the targeting vector produced specific bands of 1050 bp confirming targeting to the intended locus. In the figure, the 1000 bp and 500 bp markers with corresponding bright bands on the ladder are shown as a reference. ( C ) Representative knock-in embryos that have developed to the blastocyst stage showed varied GFP expression in both Cas9D10A and Cas9 injections.

    Journal: Scientific Reports

    Article Title: Targeted gene knock-in by CRISPR/Cas ribonucleoproteins in porcine zygotes

    doi: 10.1038/srep42458

    Figure Lengend Snippet: CRISPR-mediated knock-in of GFP transgene into the PRNP locus. ( A ) Schematic of the targeting vector showing targeting homology arms (HA) to the pig PRNP locus and strategy for knock-in. In the targeting vector, the upper arm is 1000 bp and the lower arm 500 bp in length. The linearized targeting vector, Cas9 mRNA and sgRNA targeting PRNP were co-injected into the cytoplasm of porcine zygotes. As shown in the schematic, Cas9 induces double strand break in exon 3 of PRNP gene. The cut DNA is then repaired by HDR using the targeting vector, resulting in the targeted allele. The use of Cas9D10A (nickase) introduced a single stranded nick as compared to DSB by Cas9, triggering HDR mediated knock-in into the PRNP locus. Dark grey boxes represent exons of the PRNP gene. ( B ) PCR amplification using primers one within the targeting vector and another outside of the targeting vector produced specific bands of 1050 bp confirming targeting to the intended locus. In the figure, the 1000 bp and 500 bp markers with corresponding bright bands on the ladder are shown as a reference. ( C ) Representative knock-in embryos that have developed to the blastocyst stage showed varied GFP expression in both Cas9D10A and Cas9 injections.

    Article Snippet: Production of Cas9 mRNA and sg RNA Expression plasmid for Cas9 nuclease (pMJ920) was a gift from Jennifer Doudna (Addgene plasmid # 42234) , and Cas9_D10A nickase was a gift from George Church (Addgene plasmid # 41816) .

    Techniques: CRISPR, Knock-In, Plasmid Preparation, Injection, Polymerase Chain Reaction, Amplification, Produced, Expressing