6 fam durgdgda 6 tamra  (Integrated DNA Technologies)


Bioz Verified Symbol Integrated DNA Technologies is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Name:
    RNA oligo
    Description:
    Long high quality RNA oligos up 120 bases Single stranded and duplexed RNA sequences are produced using proprietary technology that delivers industry leading RNA quality Specialized synthesis platforms deliver the highest fidelity guides for CRISPR duplexes for RNAi template switching oligos for NGS microRNAs aptamers and custom RNA oligos for other applications
    Catalog Number:
    ro-696512
    Price:
    None
    Category:
    Nucleic acids
    Buy from Supplier


    Structured Review

    Integrated DNA Technologies 6 fam durgdgda 6 tamra
    pH– k cat / K M profile for the cleavage of <t>6-FAM–dArUdGdA–6-TAMRA</t> by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted
    Long high quality RNA oligos up 120 bases Single stranded and duplexed RNA sequences are produced using proprietary technology that delivers industry leading RNA quality Specialized synthesis platforms deliver the highest fidelity guides for CRISPR duplexes for RNAi template switching oligos for NGS microRNAs aptamers and custom RNA oligos for other applications
    https://www.bioz.com/result/6 fam durgdgda 6 tamra/product/Integrated DNA Technologies
    Average 85 stars, based on 213 article reviews
    Price from $9.99 to $1999.99
    6 fam durgdgda 6 tamra - by Bioz Stars, 2020-09
    85/100 stars

    Images

    1) Product Images from "Structural Basis for Catalysis by Onconase"

    Article Title: Structural Basis for Catalysis by Onconase

    Journal:

    doi: 10.1016/j.jmb.2007.09.089

    pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted
    Figure Legend Snippet: pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted

    Techniques Used:

    Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).
    Figure Legend Snippet: Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).

    Techniques Used:

    2) Product Images from "The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases"

    Article Title: The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases

    Journal: Nature structural & molecular biology

    doi: 10.1038/s41594-019-0227-9

    Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).
    Figure Legend Snippet: Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).

    Techniques Used: Recombinant, Labeling, Sequencing, Standard Deviation

    Nucleotide base stacking is required for Pan2 and Caf1 deadenylase activity. Denaturing RNA gels showing deadenylation by ( a-d ) S. cerevisiae Pan2 UCH-Exo or ( e-h ) S. pombe Ccr4-inactive Ccr4–Not on 5′ 6-FAM-labeled (green star) RNAs consisting of a 20mer non-poly(A) sequence (see Fig. 1a ) followed by the indicated tail sequence. RNAs either had no additional nucleotides ( a , e ), two guanosines ( b , f ), two uracils ( c, g ), or two dihydrouracils (abbreviated D, panels d , h ) in the middle of the poly(A) tail. Red asterisks indicate the point of inhibition. Both Pan2 and Caf1 were strongly inhibited by guanosines and dihydrouracils interrupting a poly(A) tail. These gels are representative of identical experiments performed 2 times. Uncropped gel images are shown in Supplementary Data Set 1.
    Figure Legend Snippet: Nucleotide base stacking is required for Pan2 and Caf1 deadenylase activity. Denaturing RNA gels showing deadenylation by ( a-d ) S. cerevisiae Pan2 UCH-Exo or ( e-h ) S. pombe Ccr4-inactive Ccr4–Not on 5′ 6-FAM-labeled (green star) RNAs consisting of a 20mer non-poly(A) sequence (see Fig. 1a ) followed by the indicated tail sequence. RNAs either had no additional nucleotides ( a , e ), two guanosines ( b , f ), two uracils ( c, g ), or two dihydrouracils (abbreviated D, panels d , h ) in the middle of the poly(A) tail. Red asterisks indicate the point of inhibition. Both Pan2 and Caf1 were strongly inhibited by guanosines and dihydrouracils interrupting a poly(A) tail. These gels are representative of identical experiments performed 2 times. Uncropped gel images are shown in Supplementary Data Set 1.

    Techniques Used: Activity Assay, Labeling, Sequencing, Inhibition

    3′ guanosines inhibit the Pan2 exonuclease. a, Denaturing RNA gels showing deadenylation by recombinant S. cerevisiae Pan2–Pan3 on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (shown above) followed by a poly(A) tail of 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-e, Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for full-length S. cerevisiae Pan2–Pan3 ( b, e ); H. sapiens PAN2–PAN3∆N278 ( c ); and S. cerevisiae Pan2 UCH-Exo (residues 461-1115) ( d ).
    Figure Legend Snippet: 3′ guanosines inhibit the Pan2 exonuclease. a, Denaturing RNA gels showing deadenylation by recombinant S. cerevisiae Pan2–Pan3 on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (shown above) followed by a poly(A) tail of 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-e, Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for full-length S. cerevisiae Pan2–Pan3 ( b, e ); H. sapiens PAN2–PAN3∆N278 ( c ); and S. cerevisiae Pan2 UCH-Exo (residues 461-1115) ( d ).

    Techniques Used: Recombinant, Labeling, Sequencing, Standard Deviation

    3) Product Images from "Multidomain architecture of estrogen receptor reveals interfacial cross-talk between its DNA-binding and ligand-binding domains"

    Article Title: Multidomain architecture of estrogen receptor reveals interfacial cross-talk between its DNA-binding and ligand-binding domains

    Journal: Nature Communications

    doi: 10.1038/s41467-018-06034-2

    Overall architecture of the hERα homodimer revealed by data integration. a Fitting against experimental data. The fit of computationally generated conformations (dot) is simultaneously assessed against hydroxyl radical protein footprinting ( φ 2 ) and small-angle X-ray scattering ( χ 2 ). Lower χ 2 and φ 2 values are better in fitting. The best-fit ensemble structures lie at the bottom corner of the fit plot, below the red dashed line. b Ensemble of best-fit hERα structures. It contains both LBD monomers (light/dark green) and DBD monomers (light/dark blue). The C-terminal helix H12 of the LBD is in red, and ERE–DNA is in gray. The LBD–DBD connecting loops are shown as light green ribbons. The structure models (within the red circle) are within 3 Å Cα-RMSD of the best-fit structure. c A rotated view of the best-fit hERα structures. d Goodness of fit to measured SAXS data. Theoretical SAXS data were the ensemble average of the set of hERα structures above. The scattering intensity, log 10 I ( q ), is plotted as a function of the scattering angle ( q ). The goodness of fit χ 2 = 1.2. Inserted is the Guinier plot with a linear fit, yielding the radius of gyration R g = 38.0 ± 0.3 Å. The bottom graph shows residuals from subtraction between calculated and experimental profiles. A total of six scattering images were used and standard deviations were indicated. e Goodness of fit to footprinting data. Measured footprinting protection factors (logPF) are plotted against average accessible surface areas (SA) derived from the ensemble structures. Linear correlation coefficient is ρ = −0.95. A total of seven structures were used for ensemble calculations and standard deviations were indicated
    Figure Legend Snippet: Overall architecture of the hERα homodimer revealed by data integration. a Fitting against experimental data. The fit of computationally generated conformations (dot) is simultaneously assessed against hydroxyl radical protein footprinting ( φ 2 ) and small-angle X-ray scattering ( χ 2 ). Lower χ 2 and φ 2 values are better in fitting. The best-fit ensemble structures lie at the bottom corner of the fit plot, below the red dashed line. b Ensemble of best-fit hERα structures. It contains both LBD monomers (light/dark green) and DBD monomers (light/dark blue). The C-terminal helix H12 of the LBD is in red, and ERE–DNA is in gray. The LBD–DBD connecting loops are shown as light green ribbons. The structure models (within the red circle) are within 3 Å Cα-RMSD of the best-fit structure. c A rotated view of the best-fit hERα structures. d Goodness of fit to measured SAXS data. Theoretical SAXS data were the ensemble average of the set of hERα structures above. The scattering intensity, log 10 I ( q ), is plotted as a function of the scattering angle ( q ). The goodness of fit χ 2 = 1.2. Inserted is the Guinier plot with a linear fit, yielding the radius of gyration R g = 38.0 ± 0.3 Å. The bottom graph shows residuals from subtraction between calculated and experimental profiles. A total of six scattering images were used and standard deviations were indicated. e Goodness of fit to footprinting data. Measured footprinting protection factors (logPF) are plotted against average accessible surface areas (SA) derived from the ensemble structures. Linear correlation coefficient is ρ = −0.95. A total of seven structures were used for ensemble calculations and standard deviations were indicated

    Techniques Used: Generated, Protein Footprinting, Footprinting, Derivative Assay

    Contact residues between the DBD and LBD identified by footprinting. a Structural domains of hERα. Human ERα contains a DNA-binding domain (DBD; blue), a ligand-binding domain (LBD; green), and functions as a homodimer. b , c The crystal structures of DBD dimer ( b light/dark blue) in complex with ERE–DNA (gray) (1HCQ.pdb), and of LBD dimer ( c light/dark green) in complex with estradiol and a coactivator TIF2 peptide (1GWR.pdb). The C-terminal helix H12 of the LBD is highlighted (red). d Hydroxyl radical footprinting of hERα. High logPF values of six residues (red asterisks) indicate their involvement in domain contacts. Duplicates were performed and standard deviations were indicated. e Solvent accessibility surface area (SA) values of residue side chains calculated from the crystal structure of individual domains. f Correlation between logPF and SA values. Differentiation of the six contact residues (red dots) is shown from the rest of 14 residues (black dots). The latter have a Pearson’s correlation coefficient −0.77 ( p -value = 0.001). g , h Structural mapping of contact residues. Contact residues (red) are Y191/Y195/W200 on the surface of the DBD (blue blobs) and I326/W393/L409 on the LBD (green blobs)
    Figure Legend Snippet: Contact residues between the DBD and LBD identified by footprinting. a Structural domains of hERα. Human ERα contains a DNA-binding domain (DBD; blue), a ligand-binding domain (LBD; green), and functions as a homodimer. b , c The crystal structures of DBD dimer ( b light/dark blue) in complex with ERE–DNA (gray) (1HCQ.pdb), and of LBD dimer ( c light/dark green) in complex with estradiol and a coactivator TIF2 peptide (1GWR.pdb). The C-terminal helix H12 of the LBD is highlighted (red). d Hydroxyl radical footprinting of hERα. High logPF values of six residues (red asterisks) indicate their involvement in domain contacts. Duplicates were performed and standard deviations were indicated. e Solvent accessibility surface area (SA) values of residue side chains calculated from the crystal structure of individual domains. f Correlation between logPF and SA values. Differentiation of the six contact residues (red dots) is shown from the rest of 14 residues (black dots). The latter have a Pearson’s correlation coefficient −0.77 ( p -value = 0.001). g , h Structural mapping of contact residues. Contact residues (red) are Y191/Y195/W200 on the surface of the DBD (blue blobs) and I326/W393/L409 on the LBD (green blobs)

    Techniques Used: Footprinting, Binding Assay, Ligand Binding Assay

    4) Product Images from "Synthesis and Evaluation of a Rationally Designed Click-Based Library for G-Quadruplex Selective DNA Photocleavage"

    Article Title: Synthesis and Evaluation of a Rationally Designed Click-Based Library for G-Quadruplex Selective DNA Photocleavage

    Journal: Molecules

    doi: 10.3390/molecules200916446

    Photochemical cleavage of F21T by control compound 14 (black bars) compared with cleavage by TMPyP4 (gray bars) after 120 min of UVA irradiation.
    Figure Legend Snippet: Photochemical cleavage of F21T by control compound 14 (black bars) compared with cleavage by TMPyP4 (gray bars) after 120 min of UVA irradiation.

    Techniques Used: Irradiation

    Changes in T m upon formation of the DNA-compound complex ( A ) Average melt data for representative compounds incubated with FcMycT; ( B ) Average melt data for representative compounds incubated with F21T, Black, blue, green, and red bars represent positive control, benzophenone-incorporated, naphthalimide-incorporated, and anthraquinone-incorporated compounds respectively.
    Figure Legend Snippet: Changes in T m upon formation of the DNA-compound complex ( A ) Average melt data for representative compounds incubated with FcMycT; ( B ) Average melt data for representative compounds incubated with F21T, Black, blue, green, and red bars represent positive control, benzophenone-incorporated, naphthalimide-incorporated, and anthraquinone-incorporated compounds respectively.

    Techniques Used: Incubation, Positive Control

    ( A ) Effect of photoreactive group on the photochemical cleavage of G-quadruplex DNA by click-based compound library members. ( A ) Example polyacrylamide gel of photocleavage reactions of F21T after 30 min UV irradiation in the presence of 500 nM click-based compound library members 11a , b ; 12a – d ; and 13a , b ; ( B ) Quantification of G-quadruplex photochemical cleavage from gel electrophoresis analysis after irradiation and piperidine/heat treatment. Unless indicated, F21T was employed as the G-quadruplex substrate. Red, green, and blue bars correspond to compounds incorporating anthraquinone, naphthalimide, and benzophenone respectively. * FcMycT photocleavage data for comparison.
    Figure Legend Snippet: ( A ) Effect of photoreactive group on the photochemical cleavage of G-quadruplex DNA by click-based compound library members. ( A ) Example polyacrylamide gel of photocleavage reactions of F21T after 30 min UV irradiation in the presence of 500 nM click-based compound library members 11a , b ; 12a – d ; and 13a , b ; ( B ) Quantification of G-quadruplex photochemical cleavage from gel electrophoresis analysis after irradiation and piperidine/heat treatment. Unless indicated, F21T was employed as the G-quadruplex substrate. Red, green, and blue bars correspond to compounds incorporating anthraquinone, naphthalimide, and benzophenone respectively. * FcMycT photocleavage data for comparison.

    Techniques Used: Irradiation, Nucleic Acid Electrophoresis

    5) Product Images from "HlyU Is a Positive Regulator of Hemolysin Expression in Vibrio anguillarum ▿"

    Article Title: HlyU Is a Positive Regulator of Hemolysin Expression in Vibrio anguillarum ▿

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.01033-10

    Capillary electrophoresis of 6-FAM-labeled DNA fragments b (A) and f (B) from DNase protection assays in the presence (gray traces) and absence (black traces) of HlyU, demonstrating that HlyU binds to specific sequences in fragments b and f of the rtxACHBDE
    Figure Legend Snippet: Capillary electrophoresis of 6-FAM-labeled DNA fragments b (A) and f (B) from DNase protection assays in the presence (gray traces) and absence (black traces) of HlyU, demonstrating that HlyU binds to specific sequences in fragments b and f of the rtxACHBDE

    Techniques Used: Electrophoresis, Labeling

    6) Product Images from "HlyU Is a Positive Regulator of Hemolysin Expression in Vibrio anguillarum ▿"

    Article Title: HlyU Is a Positive Regulator of Hemolysin Expression in Vibrio anguillarum ▿

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.01033-10

    DNase I protection assay.
    Figure Legend Snippet: DNase I protection assay.

    Techniques Used:

    7) Product Images from "A Continuous Fluorometric Assay for the Assessment of MazF Ribonuclease Activity"

    Article Title: A Continuous Fluorometric Assay for the Assessment of MazF Ribonuclease Activity

    Journal:

    doi: 10.1016/j.ab.2007.07.017

    Substrate design. A chimeric DNA/RNA oligonucleotide (5′-AAGTCrGACATCAG-3′) previously shown to be cleaved by MazF was labeled with 6-carboxyfluorescein (6-FAM) on the 5′-end and with Black Hole Quencher 1 (BHQ1) on the 3′-end.
    Figure Legend Snippet: Substrate design. A chimeric DNA/RNA oligonucleotide (5′-AAGTCrGACATCAG-3′) previously shown to be cleaved by MazF was labeled with 6-carboxyfluorescein (6-FAM) on the 5′-end and with Black Hole Quencher 1 (BHQ1) on the 3′-end.

    Techniques Used: Labeling

    8) Product Images from "Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities"

    Article Title: Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities

    Journal: Nature Communications

    doi: 10.1038/s41467-017-00484-w

    Usb1 processing influences RNP formation. a Fluorescence polarization binding data comparing Lhp1 binding to U6 95-112 with a cis -diol ( black , filled circles ), U6 95-112+1U with a cis -diol ( black , open circles ), U6 95–112 with a 3′ phosphate ( gray , filled circles ), and U6 95–112+1U with a 3′ phosphate ( gray , open circles ). Plotted data points represent the average of three technical replicates ± s.d. for ( a – d ). b Fluorescence polarization binding data comparing Lsm2–8 binding to U6 95–112 with a cis -diol ( black , filled circles ), U6 95–112+1U with a cis -diol ( black , open circles ), U6 95–112 with a 3′ phosphate ( gray , filled circles ) and U6 95–112+1U with a 3′ phosphate ( gray , open circles ). c Fluorescence polarization binding data comparing Lhp1 binding to U6 95–112+1U before ( black ) and after ( gray ) Usb1 processing. d Fluorescence polarization binding data comparing Lsm2–8 binding to U6 95–112+1U before ( black ) and after ( gray ) Usb1 processing. e Denaturing gel comparing RNAs used in c , d . f The affinities of Lsm2–8 and Lhp1 for full-length U6 are influenced by Usb1 processing. Native gel analysis comparing Lsm2–8, Lhp1 and Prp24 affinity for U6 RNA before and after treatment with Usb1. Usb1 processing does not change the mobility of U6 on a native gel (lanes 1 vs. 2). Lsm2–8 binds similarly before (lanes 3–5) and after (lanes 6–8) Usb1 processing. Lhp1 binding (lanes 9–11) is negligible after Usb1 processing (lanes 12–14). Prp24 binding is unchanged before (lanes 15–17) and after Usb1 processing (lanes 18–20)
    Figure Legend Snippet: Usb1 processing influences RNP formation. a Fluorescence polarization binding data comparing Lhp1 binding to U6 95-112 with a cis -diol ( black , filled circles ), U6 95-112+1U with a cis -diol ( black , open circles ), U6 95–112 with a 3′ phosphate ( gray , filled circles ), and U6 95–112+1U with a 3′ phosphate ( gray , open circles ). Plotted data points represent the average of three technical replicates ± s.d. for ( a – d ). b Fluorescence polarization binding data comparing Lsm2–8 binding to U6 95–112 with a cis -diol ( black , filled circles ), U6 95–112+1U with a cis -diol ( black , open circles ), U6 95–112 with a 3′ phosphate ( gray , filled circles ) and U6 95–112+1U with a 3′ phosphate ( gray , open circles ). c Fluorescence polarization binding data comparing Lhp1 binding to U6 95–112+1U before ( black ) and after ( gray ) Usb1 processing. d Fluorescence polarization binding data comparing Lsm2–8 binding to U6 95–112+1U before ( black ) and after ( gray ) Usb1 processing. e Denaturing gel comparing RNAs used in c , d . f The affinities of Lsm2–8 and Lhp1 for full-length U6 are influenced by Usb1 processing. Native gel analysis comparing Lsm2–8, Lhp1 and Prp24 affinity for U6 RNA before and after treatment with Usb1. Usb1 processing does not change the mobility of U6 on a native gel (lanes 1 vs. 2). Lsm2–8 binds similarly before (lanes 3–5) and after (lanes 6–8) Usb1 processing. Lhp1 binding (lanes 9–11) is negligible after Usb1 processing (lanes 12–14). Prp24 binding is unchanged before (lanes 15–17) and after Usb1 processing (lanes 18–20)

    Techniques Used: Fluorescence, Binding Assay

    The U6 snRNP assembly pathway. a Native gel analysis of U6 binding partners. Lhp1 and Prp24 bind U6 1–112 with a cis -diol tightly (lanes 2–6 and 7–11). Inclusion of equimolar amounts of Lhp1 and Prp24 does not promote formation of a ternary complex except at the highest concentration (lanes 12–16). In contrast, Lsm2–8 binds U6 relatively weakly (17–21), but upon inclusion of Prp24 (lanes 22–26), Lsm2–8 efficiently forms a co-complex of U6, Lsm2–8 and Prp24. b Prp24 binds naked U6 1–112 with a cis -diol (lanes 2–7) and U6 pre-saturated withLhp1 (lanes 9–14) tightly. Prp24 abstracts U6 from U6-Lhp1 much more efficiently than it forms a U6/Prp24/Lhp1 complex. Lhp1 binds naked U6 (lane 21), but cannot bind or release U6 from pre-formed U6-Prp24. c Model of U6 snRNP assembly. U6 is synthesized by RNA polymerase III and initially bound by Lhp1. Binding of Prp24 weakens Lhp1 affinity for the 3′ tail of U6, allowing Usb1 to remove a uridine and leave a 3′ phosphate modified tail. Lsm2–8 recognizes the 3′ tail of U6 and interacts with Prp24 to form the U6 snRNP, which can then be assembled into the spliceosome via the U4/U6 di-snRNP
    Figure Legend Snippet: The U6 snRNP assembly pathway. a Native gel analysis of U6 binding partners. Lhp1 and Prp24 bind U6 1–112 with a cis -diol tightly (lanes 2–6 and 7–11). Inclusion of equimolar amounts of Lhp1 and Prp24 does not promote formation of a ternary complex except at the highest concentration (lanes 12–16). In contrast, Lsm2–8 binds U6 relatively weakly (17–21), but upon inclusion of Prp24 (lanes 22–26), Lsm2–8 efficiently forms a co-complex of U6, Lsm2–8 and Prp24. b Prp24 binds naked U6 1–112 with a cis -diol (lanes 2–7) and U6 pre-saturated withLhp1 (lanes 9–14) tightly. Prp24 abstracts U6 from U6-Lhp1 much more efficiently than it forms a U6/Prp24/Lhp1 complex. Lhp1 binds naked U6 (lane 21), but cannot bind or release U6 from pre-formed U6-Prp24. c Model of U6 snRNP assembly. U6 is synthesized by RNA polymerase III and initially bound by Lhp1. Binding of Prp24 weakens Lhp1 affinity for the 3′ tail of U6, allowing Usb1 to remove a uridine and leave a 3′ phosphate modified tail. Lsm2–8 recognizes the 3′ tail of U6 and interacts with Prp24 to form the U6 snRNP, which can then be assembled into the spliceosome via the U4/U6 di-snRNP

    Techniques Used: Binding Assay, Concentration Assay, Synthesized, Modification

    yUsb1 acts as a 3′–5′exonuclease and CPDase in vitro. a U6 snRNA is synthesized by RNA Polymerase III. Transcription termination produces a heterogeneous U6 with a 4–8 nucleotide U-tail. Processing by yUsb1 shortens the U-tail and leaves a phosphoryl group. b Usb1 removes nucleotides from the 3′ end of RNAs. The 5′-labeled U6 95–112+3U oligonucleotide cis -diol substrate (lane 2) is insensitive to CIP (lane 3) or T4 PNK (lane 4) treatment. Incubation with yUsb1 for 1 h results in a shorter product (lane 5). Similar reactivity of the product to both CIP (lane 6) and T4 PNK (lane 7) indicates that the product is a noncyclic phosphate. An alkaline hydrolysis ladder (lane 1) shows the mobility of oligonucleotide products of different lengths. ( c , top ) One-dimensional 31 P NMR spectra of 2′,3′-cUMP shows a single peak at 20 ppm. A 3′ UMP standard has a single peak at 3.4 ppm. When 2′,3′-cUMP is incubated with AtRNL, which leaves a 2′ phosphate 8 , there is a single peak at 3.2 ppm. Incubation of 2′,3′-cUMP with yUsb1 produces a new signal at 3.4 ppm ( c , bottom ) Zoom of dashed region in top panel. d Time course of Usb1 processing on RNAs with different 3′ end modifications. yUsb1 is most active on RNA substrates with a cis -diol (lanes 1–4), less active on those with a 2′,3′-cyclic phosphate ( > p; lanes 5–8) or 2′ phosphates (2′P; lanes 9–12), and is inactive on 3′ phosphate ends (3′P; lanes 13–16). e Model describing the dual activities of yUsb1
    Figure Legend Snippet: yUsb1 acts as a 3′–5′exonuclease and CPDase in vitro. a U6 snRNA is synthesized by RNA Polymerase III. Transcription termination produces a heterogeneous U6 with a 4–8 nucleotide U-tail. Processing by yUsb1 shortens the U-tail and leaves a phosphoryl group. b Usb1 removes nucleotides from the 3′ end of RNAs. The 5′-labeled U6 95–112+3U oligonucleotide cis -diol substrate (lane 2) is insensitive to CIP (lane 3) or T4 PNK (lane 4) treatment. Incubation with yUsb1 for 1 h results in a shorter product (lane 5). Similar reactivity of the product to both CIP (lane 6) and T4 PNK (lane 7) indicates that the product is a noncyclic phosphate. An alkaline hydrolysis ladder (lane 1) shows the mobility of oligonucleotide products of different lengths. ( c , top ) One-dimensional 31 P NMR spectra of 2′,3′-cUMP shows a single peak at 20 ppm. A 3′ UMP standard has a single peak at 3.4 ppm. When 2′,3′-cUMP is incubated with AtRNL, which leaves a 2′ phosphate 8 , there is a single peak at 3.2 ppm. Incubation of 2′,3′-cUMP with yUsb1 produces a new signal at 3.4 ppm ( c , bottom ) Zoom of dashed region in top panel. d Time course of Usb1 processing on RNAs with different 3′ end modifications. yUsb1 is most active on RNA substrates with a cis -diol (lanes 1–4), less active on those with a 2′,3′-cyclic phosphate ( > p; lanes 5–8) or 2′ phosphates (2′P; lanes 9–12), and is inactive on 3′ phosphate ends (3′P; lanes 13–16). e Model describing the dual activities of yUsb1

    Techniques Used: In Vitro, Synthesized, Labeling, Incubation, Nuclear Magnetic Resonance

    9) Product Images from "Rapid RNA Exchange in Aqueous Two-Phase System and Coacervate Droplets"

    Article Title: Rapid RNA Exchange in Aqueous Two-Phase System and Coacervate Droplets

    Journal: Origins of Life and Evolution of the Biosphere

    doi: 10.1007/s11084-014-9355-8

    Oleic acid vesicles do not exchange RNA with the surrounding fluid. Representative confocal microscope images of a sample (a) before photobleaching and (b) 590 s after photobleaching of the indicated non-gel-filtered oleic acid vesicle in 200 mM Bicine-NaOH pH 8.5 containing 5′-6-FAM labeled RNA 15-mer (5′-CCAGUCAGUCUACGC-3′) at room temperature ( Methods ). The vesicle samples were not gel filtered in order to maintain a high RNA concentration outside of the vesicles in order to simulate conditions similar to the ATPS and coacervate systems. After the entire window was photobleached, fluorescence outside of the vesicles recovered due to rapid RNA diffusion, but fluorescence inside vesicles did not recover due to lack of transport of RNA across the membrane. Scale bars, 10 μm. See Movie S5 for full movie of photobleaching and recovery
    Figure Legend Snippet: Oleic acid vesicles do not exchange RNA with the surrounding fluid. Representative confocal microscope images of a sample (a) before photobleaching and (b) 590 s after photobleaching of the indicated non-gel-filtered oleic acid vesicle in 200 mM Bicine-NaOH pH 8.5 containing 5′-6-FAM labeled RNA 15-mer (5′-CCAGUCAGUCUACGC-3′) at room temperature ( Methods ). The vesicle samples were not gel filtered in order to maintain a high RNA concentration outside of the vesicles in order to simulate conditions similar to the ATPS and coacervate systems. After the entire window was photobleached, fluorescence outside of the vesicles recovered due to rapid RNA diffusion, but fluorescence inside vesicles did not recover due to lack of transport of RNA across the membrane. Scale bars, 10 μm. See Movie S5 for full movie of photobleaching and recovery

    Techniques Used: Microscopy, Labeling, Concentration Assay, Fluorescence, Diffusion-based Assay

    Rapid exchange of RNA oligomers between ATPS and coacervate droplets and the surrounding bulk phase. Representative confocal fluorescence images showing RNA enriched droplets ( green ) are shown at left. Normalized fluorescence recovery after photobleaching (FRAP) recovery curves are shown at right. All samples contained 5 μM 5′-6-FAM-labeled RNA 15-mer (5′-CCAGUCAGUCUACGC-3′) in: (a) 16 % w/v dextran 9-11 kDa/10 % w/v PEG 8 kDa in 50 mM Tris-Cl pH 8 and 100 mM NaCl (indicated droplet 25 μm diameter), (b) 25 % w/v DEAE-dextran > 500 kDa/25 % w/v PEG 8 kDa in 100 mM Tris-Cl pH 8 with the GODCAT (glucose oxidase/catalase) system ( Methods ) (indicated droplet 9.5 μm diameter), (c) 16 % w/v dextran-sulfate 9-20 kDa/10 % w/v PEG 8 kDa in 50 mM Tris-Cl pH 8 and 100 mM NaCl (indicated droplet 44 μm diameter), (d) 30 mM ATP/2 % w/v pLys 4-15 kDa in 100 mM Tris-Cl pH 8 with the GODCAT system ( Methods ) (indicated droplet 7.5 μm diameter). See Movies S1 - S4 for respective FRAP movies. Each curve was normalized to the intensities of a non-bleached droplet and the background within the same frame, to correct for photobleaching during sampling, as well as to its initial intensity, to account for variable photobleaching before the recovery step across runs ( Supplementary Information ). Data were fit to a single exponential to determine time constants (τ) and half-lives (t 1/2 ) for fluorescence recovery ( Supplementary Information ). Further details and data in Table S3 . Scale bars for (a) and (c) are 100 μm; scale bars for (b) and (d) are 10 μm. See Movies S1 - S4 for full movies of photobleaching and recovery for each of the indicated droplets in (a) - (d) , respectively
    Figure Legend Snippet: Rapid exchange of RNA oligomers between ATPS and coacervate droplets and the surrounding bulk phase. Representative confocal fluorescence images showing RNA enriched droplets ( green ) are shown at left. Normalized fluorescence recovery after photobleaching (FRAP) recovery curves are shown at right. All samples contained 5 μM 5′-6-FAM-labeled RNA 15-mer (5′-CCAGUCAGUCUACGC-3′) in: (a) 16 % w/v dextran 9-11 kDa/10 % w/v PEG 8 kDa in 50 mM Tris-Cl pH 8 and 100 mM NaCl (indicated droplet 25 μm diameter), (b) 25 % w/v DEAE-dextran > 500 kDa/25 % w/v PEG 8 kDa in 100 mM Tris-Cl pH 8 with the GODCAT (glucose oxidase/catalase) system ( Methods ) (indicated droplet 9.5 μm diameter), (c) 16 % w/v dextran-sulfate 9-20 kDa/10 % w/v PEG 8 kDa in 50 mM Tris-Cl pH 8 and 100 mM NaCl (indicated droplet 44 μm diameter), (d) 30 mM ATP/2 % w/v pLys 4-15 kDa in 100 mM Tris-Cl pH 8 with the GODCAT system ( Methods ) (indicated droplet 7.5 μm diameter). See Movies S1 - S4 for respective FRAP movies. Each curve was normalized to the intensities of a non-bleached droplet and the background within the same frame, to correct for photobleaching during sampling, as well as to its initial intensity, to account for variable photobleaching before the recovery step across runs ( Supplementary Information ). Data were fit to a single exponential to determine time constants (τ) and half-lives (t 1/2 ) for fluorescence recovery ( Supplementary Information ). Further details and data in Table S3 . Scale bars for (a) and (c) are 100 μm; scale bars for (b) and (d) are 10 μm. See Movies S1 - S4 for full movies of photobleaching and recovery for each of the indicated droplets in (a) - (d) , respectively

    Techniques Used: Fluorescence, Labeling, Sampling

    10) Product Images from "ATP-binding cassette protein ABCF1 couples gene transcription with maintenance of genome integrity in embryonic stem cells"

    Article Title: ATP-binding cassette protein ABCF1 couples gene transcription with maintenance of genome integrity in embryonic stem cells

    Journal: bioRxiv

    doi: 10.1101/2020.05.28.122184

    Intracellular DNAs modulate pluripotency gene expressions through ABCF1. (A) V5-ABCF1 D3 mouse ES cell WCEs are incubated with three different 5’ biotinylated 98mer oligonucleotides: single-stranded (ss), double-stranded (ds) with SOX2-binding motif (Matched, ds-M), or ds without the motif (Unmatched, ds-UM). These DNA sequences are derived from Listeria monocytogenes genome. Input WCEs (IN) and streptavidin-beads captured, DNA-bound ABCF1 proteins are analyzed by western blotting. α-tubulin (TUBA) is used as control for binding specificity. (B) Genomic DNA purified from nuclear extracts prepared from DMSO and etoposide-treated (ETO, 20 μM) V5-ABCF1 knock-in (KI) D3 ES cells were analyzed on agarose gel and stained with ethidium bromide. (C) WCEs prepared from ETO-treated (20 μM) V5-ABCF1 KI D3 ES cells are incubated with IgGs or anti-V5 antibodies. Co-purified nucleic acids are treated with RNase A, separated on urea-PAGE, and stained with SYBR Gold. Vertical bar denotes DNAs specifically bound by ABCF1. (D) DNA damage disrupts ABCF1-SOX2 interaction. Input (IN) and SOX2 IPs from WCEs of DMSO or ETO-treated (20 μM) V5-ABCF1 KI D3 ES cells are analyzed by western blotting. (E) MNase-ChIP of ABCF1 in DMSO and ETO-treated (80 μM) V5-ABCF1 KI D3 ES cells. Enrichment of ABCF1 on OCT4/SOX2-targeted regions of Oct4, Sox2 , and Nanog gene promoters is analyzed by qPCR as in Figure 4 . (F) Colony formation assays in control and ABCF1 gain-of-function D3 cells. 200 D3 ES cells stably expressing RFP or V5-ABCF1 are plated on 24-well plates, treated with DMSO (left) or ETO (1 μM, right) for indicated period of time (hr), and let recover for 6 days before staining for AP activity. AP-positive colonies are counted. Error bars represent SEM of three independent experiments. n = 3. (*) P
    Figure Legend Snippet: Intracellular DNAs modulate pluripotency gene expressions through ABCF1. (A) V5-ABCF1 D3 mouse ES cell WCEs are incubated with three different 5’ biotinylated 98mer oligonucleotides: single-stranded (ss), double-stranded (ds) with SOX2-binding motif (Matched, ds-M), or ds without the motif (Unmatched, ds-UM). These DNA sequences are derived from Listeria monocytogenes genome. Input WCEs (IN) and streptavidin-beads captured, DNA-bound ABCF1 proteins are analyzed by western blotting. α-tubulin (TUBA) is used as control for binding specificity. (B) Genomic DNA purified from nuclear extracts prepared from DMSO and etoposide-treated (ETO, 20 μM) V5-ABCF1 knock-in (KI) D3 ES cells were analyzed on agarose gel and stained with ethidium bromide. (C) WCEs prepared from ETO-treated (20 μM) V5-ABCF1 KI D3 ES cells are incubated with IgGs or anti-V5 antibodies. Co-purified nucleic acids are treated with RNase A, separated on urea-PAGE, and stained with SYBR Gold. Vertical bar denotes DNAs specifically bound by ABCF1. (D) DNA damage disrupts ABCF1-SOX2 interaction. Input (IN) and SOX2 IPs from WCEs of DMSO or ETO-treated (20 μM) V5-ABCF1 KI D3 ES cells are analyzed by western blotting. (E) MNase-ChIP of ABCF1 in DMSO and ETO-treated (80 μM) V5-ABCF1 KI D3 ES cells. Enrichment of ABCF1 on OCT4/SOX2-targeted regions of Oct4, Sox2 , and Nanog gene promoters is analyzed by qPCR as in Figure 4 . (F) Colony formation assays in control and ABCF1 gain-of-function D3 cells. 200 D3 ES cells stably expressing RFP or V5-ABCF1 are plated on 24-well plates, treated with DMSO (left) or ETO (1 μM, right) for indicated period of time (hr), and let recover for 6 days before staining for AP activity. AP-positive colonies are counted. Error bars represent SEM of three independent experiments. n = 3. (*) P

    Techniques Used: Incubation, Binding Assay, Derivative Assay, Western Blot, Purification, Knock-In, Agarose Gel Electrophoresis, Staining, Polyacrylamide Gel Electrophoresis, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Stable Transfection, Expressing, Activity Assay

    11) Product Images from "Multidomain architecture of estrogen receptor reveals interfacial cross-talk between its DNA-binding and ligand-binding domains"

    Article Title: Multidomain architecture of estrogen receptor reveals interfacial cross-talk between its DNA-binding and ligand-binding domains

    Journal: Nature Communications

    doi: 10.1038/s41467-018-06034-2

    Contact residues between the DBD and LBD identified by footprinting. a Structural domains of hERα. Human ERα contains a DNA-binding domain (DBD; blue), a ligand-binding domain (LBD; green), and functions as a homodimer. b , c The crystal structures of DBD dimer ( b light/dark blue) in complex with ERE–DNA (gray) (1HCQ.pdb), and of LBD dimer ( c light/dark green) in complex with estradiol and a coactivator TIF2 peptide (1GWR.pdb). The C-terminal helix H12 of the LBD is highlighted (red). d Hydroxyl radical footprinting of hERα. High logPF values of six residues (red asterisks) indicate their involvement in domain contacts. Duplicates were performed and standard deviations were indicated. e Solvent accessibility surface area (SA) values of residue side chains calculated from the crystal structure of individual domains. f Correlation between logPF and SA values. Differentiation of the six contact residues (red dots) is shown from the rest of 14 residues (black dots). The latter have a Pearson’s correlation coefficient −0.77 ( p -value = 0.001). g , h Structural mapping of contact residues. Contact residues (red) are Y191/Y195/W200 on the surface of the DBD (blue blobs) and I326/W393/L409 on the LBD (green blobs)
    Figure Legend Snippet: Contact residues between the DBD and LBD identified by footprinting. a Structural domains of hERα. Human ERα contains a DNA-binding domain (DBD; blue), a ligand-binding domain (LBD; green), and functions as a homodimer. b , c The crystal structures of DBD dimer ( b light/dark blue) in complex with ERE–DNA (gray) (1HCQ.pdb), and of LBD dimer ( c light/dark green) in complex with estradiol and a coactivator TIF2 peptide (1GWR.pdb). The C-terminal helix H12 of the LBD is highlighted (red). d Hydroxyl radical footprinting of hERα. High logPF values of six residues (red asterisks) indicate their involvement in domain contacts. Duplicates were performed and standard deviations were indicated. e Solvent accessibility surface area (SA) values of residue side chains calculated from the crystal structure of individual domains. f Correlation between logPF and SA values. Differentiation of the six contact residues (red dots) is shown from the rest of 14 residues (black dots). The latter have a Pearson’s correlation coefficient −0.77 ( p -value = 0.001). g , h Structural mapping of contact residues. Contact residues (red) are Y191/Y195/W200 on the surface of the DBD (blue blobs) and I326/W393/L409 on the LBD (green blobs)

    Techniques Used: Footprinting, Binding Assay, Ligand Binding Assay

    Overall architecture of the hERα homodimer revealed by data integration. a Fitting against experimental data. The fit of computationally generated conformations (dot) is simultaneously assessed against hydroxyl radical protein footprinting ( φ 2 ) and small-angle X-ray scattering ( χ 2 ). Lower χ 2 and φ 2 values are better in fitting. The best-fit ensemble structures lie at the bottom corner of the fit plot, below the red dashed line. b Ensemble of best-fit hERα structures. It contains both LBD monomers (light/dark green) and DBD monomers (light/dark blue). The C-terminal helix H12 of the LBD is in red, and ERE–DNA is in gray. The LBD–DBD connecting loops are shown as light green ribbons. The structure models (within the red circle) are within 3 Å Cα-RMSD of the best-fit structure. c A rotated view of the best-fit hERα structures. d Goodness of fit to measured SAXS data. Theoretical SAXS data were the ensemble average of the set of hERα structures above. The scattering intensity, log 10 I ( q ), is plotted as a function of the scattering angle ( q ). The goodness of fit χ 2 = 1.2. Inserted is the Guinier plot with a linear fit, yielding the radius of gyration R g = 38.0 ± 0.3 Å. The bottom graph shows residuals from subtraction between calculated and experimental profiles. A total of six scattering images were used and standard deviations were indicated. e Goodness of fit to footprinting data. Measured footprinting protection factors (logPF) are plotted against average accessible surface areas (SA) derived from the ensemble structures. Linear correlation coefficient is ρ = −0.95. A total of seven structures were used for ensemble calculations and standard deviations were indicated
    Figure Legend Snippet: Overall architecture of the hERα homodimer revealed by data integration. a Fitting against experimental data. The fit of computationally generated conformations (dot) is simultaneously assessed against hydroxyl radical protein footprinting ( φ 2 ) and small-angle X-ray scattering ( χ 2 ). Lower χ 2 and φ 2 values are better in fitting. The best-fit ensemble structures lie at the bottom corner of the fit plot, below the red dashed line. b Ensemble of best-fit hERα structures. It contains both LBD monomers (light/dark green) and DBD monomers (light/dark blue). The C-terminal helix H12 of the LBD is in red, and ERE–DNA is in gray. The LBD–DBD connecting loops are shown as light green ribbons. The structure models (within the red circle) are within 3 Å Cα-RMSD of the best-fit structure. c A rotated view of the best-fit hERα structures. d Goodness of fit to measured SAXS data. Theoretical SAXS data were the ensemble average of the set of hERα structures above. The scattering intensity, log 10 I ( q ), is plotted as a function of the scattering angle ( q ). The goodness of fit χ 2 = 1.2. Inserted is the Guinier plot with a linear fit, yielding the radius of gyration R g = 38.0 ± 0.3 Å. The bottom graph shows residuals from subtraction between calculated and experimental profiles. A total of six scattering images were used and standard deviations were indicated. e Goodness of fit to footprinting data. Measured footprinting protection factors (logPF) are plotted against average accessible surface areas (SA) derived from the ensemble structures. Linear correlation coefficient is ρ = −0.95. A total of seven structures were used for ensemble calculations and standard deviations were indicated

    Techniques Used: Generated, Protein Footprinting, Footprinting, Derivative Assay

    12) Product Images from "Multidomain architecture of estrogen receptor reveals interfacial cross-talk between its DNA-binding and ligand-binding domains"

    Article Title: Multidomain architecture of estrogen receptor reveals interfacial cross-talk between its DNA-binding and ligand-binding domains

    Journal: Nature Communications

    doi: 10.1038/s41467-018-06034-2

    Contact residues between the DBD and LBD identified by footprinting. a Structural domains of hERα. Human ERα contains a DNA-binding domain (DBD; blue), a ligand-binding domain (LBD; green), and functions as a homodimer. b , c The crystal structures of DBD dimer ( b light/dark blue) in complex with ERE–DNA (gray) (1HCQ.pdb), and of LBD dimer ( c light/dark green) in complex with estradiol and a coactivator TIF2 peptide (1GWR.pdb). The C-terminal helix H12 of the LBD is highlighted (red). d Hydroxyl radical footprinting of hERα. High logPF values of six residues (red asterisks) indicate their involvement in domain contacts. Duplicates were performed and standard deviations were indicated. e Solvent accessibility surface area (SA) values of residue side chains calculated from the crystal structure of individual domains. f Correlation between logPF and SA values. Differentiation of the six contact residues (red dots) is shown from the rest of 14 residues (black dots). The latter have a Pearson’s correlation coefficient −0.77 ( p -value = 0.001). g , h Structural mapping of contact residues. Contact residues (red) are Y191/Y195/W200 on the surface of the DBD (blue blobs) and I326/W393/L409 on the LBD (green blobs)
    Figure Legend Snippet: Contact residues between the DBD and LBD identified by footprinting. a Structural domains of hERα. Human ERα contains a DNA-binding domain (DBD; blue), a ligand-binding domain (LBD; green), and functions as a homodimer. b , c The crystal structures of DBD dimer ( b light/dark blue) in complex with ERE–DNA (gray) (1HCQ.pdb), and of LBD dimer ( c light/dark green) in complex with estradiol and a coactivator TIF2 peptide (1GWR.pdb). The C-terminal helix H12 of the LBD is highlighted (red). d Hydroxyl radical footprinting of hERα. High logPF values of six residues (red asterisks) indicate their involvement in domain contacts. Duplicates were performed and standard deviations were indicated. e Solvent accessibility surface area (SA) values of residue side chains calculated from the crystal structure of individual domains. f Correlation between logPF and SA values. Differentiation of the six contact residues (red dots) is shown from the rest of 14 residues (black dots). The latter have a Pearson’s correlation coefficient −0.77 ( p -value = 0.001). g , h Structural mapping of contact residues. Contact residues (red) are Y191/Y195/W200 on the surface of the DBD (blue blobs) and I326/W393/L409 on the LBD (green blobs)

    Techniques Used: Footprinting, Binding Assay, Ligand Binding Assay

    Overall architecture of the hERα homodimer revealed by data integration. a Fitting against experimental data. The fit of computationally generated conformations (dot) is simultaneously assessed against hydroxyl radical protein footprinting ( φ 2 ) and small-angle X-ray scattering ( χ 2 ). Lower χ 2 and φ 2 values are better in fitting. The best-fit ensemble structures lie at the bottom corner of the fit plot, below the red dashed line. b Ensemble of best-fit hERα structures. It contains both LBD monomers (light/dark green) and DBD monomers (light/dark blue). The C-terminal helix H12 of the LBD is in red, and ERE–DNA is in gray. The LBD–DBD connecting loops are shown as light green ribbons. The structure models (within the red circle) are within 3 Å Cα-RMSD of the best-fit structure. c A rotated view of the best-fit hERα structures. d Goodness of fit to measured SAXS data. Theoretical SAXS data were the ensemble average of the set of hERα structures above. The scattering intensity, log 10 I ( q ), is plotted as a function of the scattering angle ( q ). The goodness of fit χ 2 = 1.2. Inserted is the Guinier plot with a linear fit, yielding the radius of gyration R g = 38.0 ± 0.3 Å. The bottom graph shows residuals from subtraction between calculated and experimental profiles. A total of six scattering images were used and standard deviations were indicated. e Goodness of fit to footprinting data. Measured footprinting protection factors (logPF) are plotted against average accessible surface areas (SA) derived from the ensemble structures. Linear correlation coefficient is ρ = −0.95. A total of seven structures were used for ensemble calculations and standard deviations were indicated
    Figure Legend Snippet: Overall architecture of the hERα homodimer revealed by data integration. a Fitting against experimental data. The fit of computationally generated conformations (dot) is simultaneously assessed against hydroxyl radical protein footprinting ( φ 2 ) and small-angle X-ray scattering ( χ 2 ). Lower χ 2 and φ 2 values are better in fitting. The best-fit ensemble structures lie at the bottom corner of the fit plot, below the red dashed line. b Ensemble of best-fit hERα structures. It contains both LBD monomers (light/dark green) and DBD monomers (light/dark blue). The C-terminal helix H12 of the LBD is in red, and ERE–DNA is in gray. The LBD–DBD connecting loops are shown as light green ribbons. The structure models (within the red circle) are within 3 Å Cα-RMSD of the best-fit structure. c A rotated view of the best-fit hERα structures. d Goodness of fit to measured SAXS data. Theoretical SAXS data were the ensemble average of the set of hERα structures above. The scattering intensity, log 10 I ( q ), is plotted as a function of the scattering angle ( q ). The goodness of fit χ 2 = 1.2. Inserted is the Guinier plot with a linear fit, yielding the radius of gyration R g = 38.0 ± 0.3 Å. The bottom graph shows residuals from subtraction between calculated and experimental profiles. A total of six scattering images were used and standard deviations were indicated. e Goodness of fit to footprinting data. Measured footprinting protection factors (logPF) are plotted against average accessible surface areas (SA) derived from the ensemble structures. Linear correlation coefficient is ρ = −0.95. A total of seven structures were used for ensemble calculations and standard deviations were indicated

    Techniques Used: Generated, Protein Footprinting, Footprinting, Derivative Assay

    13) Product Images from "Ezrin Binds to DEAD-Box RNA Helicase DDX3 and Regulates Its Function and Protein Level"

    Article Title: Ezrin Binds to DEAD-Box RNA Helicase DDX3 and Regulates Its Function and Protein Level

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.00332-15

    Wild-type ezrin inhibits RNA helicase activity of DDX3 more effectively than the phosphomimicking ezrin T567D mutant in a concentration-dependent manner. (A) The effect of ezrin on DDX3 helicase activity was tested by a FRET-based reporter assay in real
    Figure Legend Snippet: Wild-type ezrin inhibits RNA helicase activity of DDX3 more effectively than the phosphomimicking ezrin T567D mutant in a concentration-dependent manner. (A) The effect of ezrin on DDX3 helicase activity was tested by a FRET-based reporter assay in real

    Techniques Used: Activity Assay, Mutagenesis, Concentration Assay, Reporter Assay

    14) Product Images from "Endonuclease Activity Inhibition of the NS1 Protein of Parvovirus B19 as a Novel Target for Antiviral Drug Development"

    Article Title: Endonuclease Activity Inhibition of the NS1 Protein of Parvovirus B19 as a Novel Target for Antiviral Drug Development

    Journal: Antimicrobial Agents and Chemotherapy

    doi: 10.1128/AAC.01879-18

    Establishment of a 6-carboxyfluorescein (FAM)-based in vitro nicking assay. (A) Diagram of the FAM-labeled oligonucleotides. The sequences of Ori20 are shown with FAM and the Iowa Black FQ quencher (Q) at the 5′ and 3′ ends, respectively. After incubation with NS1N, Ori20 is cleaved into two shorter oligonucleotides, and then a FAM-linked short oligonucleotide of 9 nt is released for fluorescence detection. (B) FAM Ori20 Q -based nicking assay. FAM Ori20 Q (200 nM) was incubated with 2 µM NS1N protein in the nicking buffer. The fluorescence intensity of each sample was detected on a microplate reader. FAM Ori20 Q without NS1N and FAM Ori20 without a quencher were used as controls. (C) Optimization of the probe concentration. Various concentrations of the FAM Ori20 Q probe were used in the nicking assay. Fluorescence intensity was determined with or without NS1N, as indicated. The fold changes in fluorescence intensity in the presence of NS1N from the fluorescence intensity with no NS1N are shown.
    Figure Legend Snippet: Establishment of a 6-carboxyfluorescein (FAM)-based in vitro nicking assay. (A) Diagram of the FAM-labeled oligonucleotides. The sequences of Ori20 are shown with FAM and the Iowa Black FQ quencher (Q) at the 5′ and 3′ ends, respectively. After incubation with NS1N, Ori20 is cleaved into two shorter oligonucleotides, and then a FAM-linked short oligonucleotide of 9 nt is released for fluorescence detection. (B) FAM Ori20 Q -based nicking assay. FAM Ori20 Q (200 nM) was incubated with 2 µM NS1N protein in the nicking buffer. The fluorescence intensity of each sample was detected on a microplate reader. FAM Ori20 Q without NS1N and FAM Ori20 without a quencher were used as controls. (C) Optimization of the probe concentration. Various concentrations of the FAM Ori20 Q probe were used in the nicking assay. Fluorescence intensity was determined with or without NS1N, as indicated. The fold changes in fluorescence intensity in the presence of NS1N from the fluorescence intensity with no NS1N are shown.

    Techniques Used: In Vitro, Labeling, Incubation, Fluorescence, Concentration Assay

    15) Product Images from "Structural and functional analysis of an OB-fold in human Ctc1 implicated in telomere maintenance and bone marrow syndromes"

    Article Title: Structural and functional analysis of an OB-fold in human Ctc1 implicated in telomere maintenance and bone marrow syndromes

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx1213

    Oligomerization and substrate binding assays of hCtc1. ( A ) The oligomeric state of hCtc1(OB) was analyzed by SEC-MALS. The blue line corresponds to the Refractive Index (RI) of the hCtc1(OB) eluting from the SEC column. The red circles correspond to the molecular mass of hCtc1(OB) measured by multi-angle, light scattering (MALS: red). The data suggest that hCtc1(OB) is monomeric in solution. ( B ) Cross linking experiments of WT hCtc1(OB) using formaldehyde or glutaraldehyde also shows that this domain hCtc1 is monomeric in solution. ( C ) FP assays of hCtc1(OB) with 5′ 6-FAM (Fluorescein) labeled, single-stranded telomeric DNA (two or three repeats) shows that this domain of hCtc1 is not involved in DNA binding. ( D ) ITC assay of hCtc1(OB) with the full length Stn1–Ten1 complex show no measurable interaction.
    Figure Legend Snippet: Oligomerization and substrate binding assays of hCtc1. ( A ) The oligomeric state of hCtc1(OB) was analyzed by SEC-MALS. The blue line corresponds to the Refractive Index (RI) of the hCtc1(OB) eluting from the SEC column. The red circles correspond to the molecular mass of hCtc1(OB) measured by multi-angle, light scattering (MALS: red). The data suggest that hCtc1(OB) is monomeric in solution. ( B ) Cross linking experiments of WT hCtc1(OB) using formaldehyde or glutaraldehyde also shows that this domain hCtc1 is monomeric in solution. ( C ) FP assays of hCtc1(OB) with 5′ 6-FAM (Fluorescein) labeled, single-stranded telomeric DNA (two or three repeats) shows that this domain of hCtc1 is not involved in DNA binding. ( D ) ITC assay of hCtc1(OB) with the full length Stn1–Ten1 complex show no measurable interaction.

    Techniques Used: Binding Assay, Size-exclusion Chromatography, Labeling, Isothermal Titration Calorimetry

    16) Product Images from "The Effect of Autologous Protein Solution on the Inflammatory Cascade in Stimulated Equine Chondrocytes"

    Article Title: The Effect of Autologous Protein Solution on the Inflammatory Cascade in Stimulated Equine Chondrocytes

    Journal: Frontiers in Veterinary Science

    doi: 10.3389/fvets.2019.00064

    Relative mRNA expression of (A) IL-1β, (B) IL-6, (C) MMP-3, (D) MMP-13, and (E) TNF-α in control, ACS-treated, or APS-treated chondrocytes with or without IL 1β/TNF-α stimulation after a 48-h culture period. Different letters denote significant differences between groups, p
    Figure Legend Snippet: Relative mRNA expression of (A) IL-1β, (B) IL-6, (C) MMP-3, (D) MMP-13, and (E) TNF-α in control, ACS-treated, or APS-treated chondrocytes with or without IL 1β/TNF-α stimulation after a 48-h culture period. Different letters denote significant differences between groups, p

    Techniques Used: Expressing

    Supernatant concentrations of quantified cytokines (A) IL-1β, (B) IL-6, (C) MMP-3, (D) MMP13, and (E) TNF-α in control, ACS-treated, or APS-treated chondrocytes either with or without IL-1β/TNF-α stimulation after a 48 h culture period. Lines and p -values denote differences between unstimulated and stimulated chondrocytes only. Mean (±SD) for n = 6 horses shown. Different letters denote significant differences between all groups, p
    Figure Legend Snippet: Supernatant concentrations of quantified cytokines (A) IL-1β, (B) IL-6, (C) MMP-3, (D) MMP13, and (E) TNF-α in control, ACS-treated, or APS-treated chondrocytes either with or without IL-1β/TNF-α stimulation after a 48 h culture period. Lines and p -values denote differences between unstimulated and stimulated chondrocytes only. Mean (±SD) for n = 6 horses shown. Different letters denote significant differences between all groups, p

    Techniques Used:

    17) Product Images from "25-Hydroxycholesterol Inhibition of Lassa Virus Infection through Aberrant GP1 Glycosylation"

    Article Title: 25-Hydroxycholesterol Inhibition of Lassa Virus Infection through Aberrant GP1 Glycosylation

    Journal: mBio

    doi: 10.1128/mBio.01808-16

    Effects of CH25H overexpression and knockdown on LASV infectivity and GP1. (A) Huh7 cells were transfected with empty vector or plasmid expressing Myc-tagged cholesterol 25-hydroxylase (CH25H) or Myc-tagged IFITM3. After 24 h, the cells were transfected with LASV GPC. Transfected cells were harvested 48 h later, and GP1 was detected by Western blotting. The membranes were stripped and reprobed, first with anti-Myc antibody and then with antiactin antibody. ns, nonspecific binding. (B) Huh7 cells transfected with CH25H or IFITM3 were infected with LASV at an MOI of 0.1 24 h posttransfection. Cell lysates and supernatants were collected at 72 hpi. Western blotting was used to detect GP1, NP, and actin. (C) Huh7 cells were transfected with plasmid expressing CH25H or IFITM3 and infected with LASV. Cell supernatants were collected at indicated times after infection, and LASV titers were determined by TCID 50 assays in Vero-E6 cells. (D) Huh7 cells were transfected with the indicated siRNAs and then either mock infected or infected with LASV at an MOI of 1.0 in medium containing 5% lipoprotein-deficient serum. After 24 h, lysates were prepared, and CH25H expression was analyzed by qRT-PCR. CH25H levels were normalized to levels of GAPDH in each sample. (E) Huh7 cells were transfected with indicated siRNAs and infected with LASV. After 24 h, lysates were collected, and Western blotting was used to detect GP1, NP, and actin. (F) Huh7 cells were transfected and infected with LASV as described for panel E. After 24 h, supernatants of infected cells were collected, and LASV titers were determined by TCID 50 assays in Vero-E6 cells. *, P
    Figure Legend Snippet: Effects of CH25H overexpression and knockdown on LASV infectivity and GP1. (A) Huh7 cells were transfected with empty vector or plasmid expressing Myc-tagged cholesterol 25-hydroxylase (CH25H) or Myc-tagged IFITM3. After 24 h, the cells were transfected with LASV GPC. Transfected cells were harvested 48 h later, and GP1 was detected by Western blotting. The membranes were stripped and reprobed, first with anti-Myc antibody and then with antiactin antibody. ns, nonspecific binding. (B) Huh7 cells transfected with CH25H or IFITM3 were infected with LASV at an MOI of 0.1 24 h posttransfection. Cell lysates and supernatants were collected at 72 hpi. Western blotting was used to detect GP1, NP, and actin. (C) Huh7 cells were transfected with plasmid expressing CH25H or IFITM3 and infected with LASV. Cell supernatants were collected at indicated times after infection, and LASV titers were determined by TCID 50 assays in Vero-E6 cells. (D) Huh7 cells were transfected with the indicated siRNAs and then either mock infected or infected with LASV at an MOI of 1.0 in medium containing 5% lipoprotein-deficient serum. After 24 h, lysates were prepared, and CH25H expression was analyzed by qRT-PCR. CH25H levels were normalized to levels of GAPDH in each sample. (E) Huh7 cells were transfected with indicated siRNAs and infected with LASV. After 24 h, lysates were collected, and Western blotting was used to detect GP1, NP, and actin. (F) Huh7 cells were transfected and infected with LASV as described for panel E. After 24 h, supernatants of infected cells were collected, and LASV titers were determined by TCID 50 assays in Vero-E6 cells. *, P

    Techniques Used: Over Expression, Infection, Transfection, Plasmid Preparation, Expressing, Gel Permeation Chromatography, Western Blot, Binding Assay, Quantitative RT-PCR

    18) Product Images from "FRET-Enabled Optical modulation for High Sensitivity Fluorescence Imaging"

    Article Title: FRET-Enabled Optical modulation for High Sensitivity Fluorescence Imaging

    Journal: Journal of the American Chemical Society

    doi: 10.1021/ja100175r

    A. Schematic model enabling donor fluorescence enhancement and modulation through dual laser excitation. Bold arrows show the transitions giving enhanced fluorescence. The arrow connecting D*A d to DA d is the primary enhancement pathway in the Cy3-Cy5
    Figure Legend Snippet: A. Schematic model enabling donor fluorescence enhancement and modulation through dual laser excitation. Bold arrows show the transitions giving enhanced fluorescence. The arrow connecting D*A d to DA d is the primary enhancement pathway in the Cy3-Cy5

    Techniques Used: Fluorescence

    A. Average frame of Cy3-Cy5 hairpin structure in solution with 496 nm cw defocused excitation (700 W/cm 2 ) and more tightly focused 633 nm cw laser (10 kW/cm 2 ). Secondary excitation was chopped at 4 Hz; synchronous ccd detection was at 40 Hz. B. Whole
    Figure Legend Snippet: A. Average frame of Cy3-Cy5 hairpin structure in solution with 496 nm cw defocused excitation (700 W/cm 2 ) and more tightly focused 633 nm cw laser (10 kW/cm 2 ). Secondary excitation was chopped at 4 Hz; synchronous ccd detection was at 40 Hz. B. Whole

    Techniques Used:

    A. Cy3 fluorescence enhancement within the Cy3-Cy5 hairpin (1μM, aqueous), calculated from the 50-μs-binned time trace modulation depth, versus modulation frequency (red ▲, varied from 500 Hz to 3900 Hz). Cy3 emission was excited
    Figure Legend Snippet: A. Cy3 fluorescence enhancement within the Cy3-Cy5 hairpin (1μM, aqueous), calculated from the 50-μs-binned time trace modulation depth, versus modulation frequency (red ▲, varied from 500 Hz to 3900 Hz). Cy3 emission was excited

    Techniques Used: Fluorescence

    19) Product Images from "Genome-wide binding and mechanistic analyses of Smchd1-mediated epigenetic regulation"

    Article Title: Genome-wide binding and mechanistic analyses of Smchd1-mediated epigenetic regulation

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1504232112

    ( A ) Distribution profiles for the Smchd1 hinge domain R1867G mutant with unmethylated 20-mer dsDNA (annealed with ssDNA containing the Ctcf consensus sequence in sense and antisense orientations) containing either one or two 5′ 6-FAM molecules.
    Figure Legend Snippet: ( A ) Distribution profiles for the Smchd1 hinge domain R1867G mutant with unmethylated 20-mer dsDNA (annealed with ssDNA containing the Ctcf consensus sequence in sense and antisense orientations) containing either one or two 5′ 6-FAM molecules.

    Techniques Used: Mutagenesis, Sequencing

    20) Product Images from "The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases"

    Article Title: The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases

    Journal: Nature structural & molecular biology

    doi: 10.1038/s41594-019-0227-9

    Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).
    Figure Legend Snippet: Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).

    Techniques Used: Recombinant, Labeling, Sequencing, Standard Deviation

    Nucleotide base stacking is required for Pan2 and Caf1 deadenylase activity. Denaturing RNA gels showing deadenylation by ( a-d ) S. cerevisiae Pan2 UCH-Exo or ( e-h ) S. pombe Ccr4-inactive Ccr4–Not on 5′ 6-FAM-labeled (green star) RNAs consisting of a 20mer non-poly(A) sequence (see Fig. 1a ) followed by the indicated tail sequence. RNAs either had no additional nucleotides ( a , e ), two guanosines ( b , f ), two uracils ( c, g ), or two dihydrouracils (abbreviated D, panels d , h ) in the middle of the poly(A) tail. Red asterisks indicate the point of inhibition. Both Pan2 and Caf1 were strongly inhibited by guanosines and dihydrouracils interrupting a poly(A) tail. These gels are representative of identical experiments performed 2 times. Uncropped gel images are shown in Supplementary Data Set 1.
    Figure Legend Snippet: Nucleotide base stacking is required for Pan2 and Caf1 deadenylase activity. Denaturing RNA gels showing deadenylation by ( a-d ) S. cerevisiae Pan2 UCH-Exo or ( e-h ) S. pombe Ccr4-inactive Ccr4–Not on 5′ 6-FAM-labeled (green star) RNAs consisting of a 20mer non-poly(A) sequence (see Fig. 1a ) followed by the indicated tail sequence. RNAs either had no additional nucleotides ( a , e ), two guanosines ( b , f ), two uracils ( c, g ), or two dihydrouracils (abbreviated D, panels d , h ) in the middle of the poly(A) tail. Red asterisks indicate the point of inhibition. Both Pan2 and Caf1 were strongly inhibited by guanosines and dihydrouracils interrupting a poly(A) tail. These gels are representative of identical experiments performed 2 times. Uncropped gel images are shown in Supplementary Data Set 1.

    Techniques Used: Activity Assay, Labeling, Sequencing, Inhibition

    3′ guanosines inhibit the Pan2 exonuclease. a, Denaturing RNA gels showing deadenylation by recombinant S. cerevisiae Pan2–Pan3 on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (shown above) followed by a poly(A) tail of 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-e, Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for full-length S. cerevisiae Pan2–Pan3 ( b, e ); H. sapiens PAN2–PAN3∆N278 ( c ); and S. cerevisiae Pan2 UCH-Exo (residues 461-1115) ( d ).
    Figure Legend Snippet: 3′ guanosines inhibit the Pan2 exonuclease. a, Denaturing RNA gels showing deadenylation by recombinant S. cerevisiae Pan2–Pan3 on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (shown above) followed by a poly(A) tail of 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-e, Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for full-length S. cerevisiae Pan2–Pan3 ( b, e ); H. sapiens PAN2–PAN3∆N278 ( c ); and S. cerevisiae Pan2 UCH-Exo (residues 461-1115) ( d ).

    Techniques Used: Recombinant, Labeling, Sequencing, Standard Deviation

    21) Product Images from "Structural and mechanistic basis for preferential deadenylation of U6 snRNA by Usb1"

    Article Title: Structural and mechanistic basis for preferential deadenylation of U6 snRNA by Usb1

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky812

    In vitro analyses of Usb1 activity. ( A ) A minimal substrate analog was used to monitor Usb1 3′ exoribonuclease activity (lanes 2–5). Substitution of the penultimate ( n–1 ) uridine with 2′-deoxyuridine (dU) prevents Usb1 processing (lanes 6–9). Substitution of the antepenultimate ( n–2 ) uridine with 2′-deoxyuridine results in formation of a single product (lanes 10–13). ( B ) Analysis of the n–1 nucleotide preference for Usb1 processing, showing that the enzyme is mostly insensitive to the identity of the n–1 nucleotide. ( C ) Analysis of the n nucleotide preference. The amount of product (%) in the presence of 0.1 and 1.0 μM Usb1 is indicated below the lane numbers. ( D ) Plots of steady-state kinetic analysis with adenosine or uridine at the n–1 and n positions. Rates were measured for seven different substrate concentrations (see ‘Materials and Methods’ section) and error bars represent standard deviations obtained from two biological replicates for each of the seven substrate concentrations. Rate as a function of substrate concentration shows Michaelis–Menten kinetics for all substrates and fits to the Michaelis–Menten equation yielded k cat and K m (cf. Table 1 ).
    Figure Legend Snippet: In vitro analyses of Usb1 activity. ( A ) A minimal substrate analog was used to monitor Usb1 3′ exoribonuclease activity (lanes 2–5). Substitution of the penultimate ( n–1 ) uridine with 2′-deoxyuridine (dU) prevents Usb1 processing (lanes 6–9). Substitution of the antepenultimate ( n–2 ) uridine with 2′-deoxyuridine results in formation of a single product (lanes 10–13). ( B ) Analysis of the n–1 nucleotide preference for Usb1 processing, showing that the enzyme is mostly insensitive to the identity of the n–1 nucleotide. ( C ) Analysis of the n nucleotide preference. The amount of product (%) in the presence of 0.1 and 1.0 μM Usb1 is indicated below the lane numbers. ( D ) Plots of steady-state kinetic analysis with adenosine or uridine at the n–1 and n positions. Rates were measured for seven different substrate concentrations (see ‘Materials and Methods’ section) and error bars represent standard deviations obtained from two biological replicates for each of the seven substrate concentrations. Rate as a function of substrate concentration shows Michaelis–Menten kinetics for all substrates and fits to the Michaelis–Menten equation yielded k cat and K m (cf. Table 1 ).

    Techniques Used: In Vitro, Activity Assay, Concentration Assay

    22) Product Images from "A Suite of Therapeutically-Inspired Nucleic Acid Logic Systems for Conditional Generation of Single-Stranded and Double-Stranded Oligonucleotides"

    Article Title: A Suite of Therapeutically-Inspired Nucleic Acid Logic Systems for Conditional Generation of Single-Stranded and Double-Stranded Oligonucleotides

    Journal: Nanomaterials

    doi: 10.3390/nano9040615

    An RNA/DNA cognate pair system was designed to undergo conditional strand exchange by hybridizing to neighboring sites on an RNA trigger. ( A ) “Traditional” RNA/DNA hybrid pairs act as an 2-input AND gate. Hybridization between the single stranded toeholds of a sense hybrid ( sH ) and antisense hybrid ( aH ) initiates a thermodynamically driven strand exchange that generates a dsRNA duplex and DNA waste byproduct. ( B ) The “adjacent targeting” RNA/DNA hybrid system functions as a 3-input AND gate, requiring a hybrid pair as well as a specific RNA trigger sequence. The hybrid pair’s respective toeholds bind to regions of the trigger that are immediately upstream and downstream from one another. Anchoring the cognate hybrids in close proximity leads to initiation of the thermodynamically favorable strand exchange reaction and dsRNA release. ( C ) Five different cognate pairs of adjacent targeting hybrids were analyzed by 12% acrylamide non-denaturing PAGE for their ability to release a DsiRNA product. Each sense hybrid and the DsiRNA control assembly contained a 3′ 6-carboxyfluorescein (6-FAM) labeled sense RNA strand for visualization. The pairs of constructs differ in the number of DNA nucleotides inserted between the single-strand toehold and the RNA/DNA hybrid duplex. These inserted nucleotides were complementary between cognate hybrids, resulting in either 0, +1, +2, +3 or +4 DNA bp that can seed the strand exchange (colored orange). The presence or absence of each component is indicated above each lane. The samples in the gel depicted were all incubated for 180 min at 37 °C. ( D ) Analysis of the fraction of dsRNA released by hybrid pairs in the presence and absence of the RNA trigger following 30, 90 or 180 min incubations at 37 °C. Error bars indicate standard deviation of three replicate experiments. Indication of statistical significance between samples is reported in the supporting information.
    Figure Legend Snippet: An RNA/DNA cognate pair system was designed to undergo conditional strand exchange by hybridizing to neighboring sites on an RNA trigger. ( A ) “Traditional” RNA/DNA hybrid pairs act as an 2-input AND gate. Hybridization between the single stranded toeholds of a sense hybrid ( sH ) and antisense hybrid ( aH ) initiates a thermodynamically driven strand exchange that generates a dsRNA duplex and DNA waste byproduct. ( B ) The “adjacent targeting” RNA/DNA hybrid system functions as a 3-input AND gate, requiring a hybrid pair as well as a specific RNA trigger sequence. The hybrid pair’s respective toeholds bind to regions of the trigger that are immediately upstream and downstream from one another. Anchoring the cognate hybrids in close proximity leads to initiation of the thermodynamically favorable strand exchange reaction and dsRNA release. ( C ) Five different cognate pairs of adjacent targeting hybrids were analyzed by 12% acrylamide non-denaturing PAGE for their ability to release a DsiRNA product. Each sense hybrid and the DsiRNA control assembly contained a 3′ 6-carboxyfluorescein (6-FAM) labeled sense RNA strand for visualization. The pairs of constructs differ in the number of DNA nucleotides inserted between the single-strand toehold and the RNA/DNA hybrid duplex. These inserted nucleotides were complementary between cognate hybrids, resulting in either 0, +1, +2, +3 or +4 DNA bp that can seed the strand exchange (colored orange). The presence or absence of each component is indicated above each lane. The samples in the gel depicted were all incubated for 180 min at 37 °C. ( D ) Analysis of the fraction of dsRNA released by hybrid pairs in the presence and absence of the RNA trigger following 30, 90 or 180 min incubations at 37 °C. Error bars indicate standard deviation of three replicate experiments. Indication of statistical significance between samples is reported in the supporting information.

    Techniques Used: Activated Clotting Time Assay, Hybridization, Sequencing, Polyacrylamide Gel Electrophoresis, Labeling, Construct, Incubation, Standard Deviation

    Effects of DNA structural alteration on the degree of trigger-inducible dsRNA release. ( A ) Four different sense hybrids that are responsive to the connective tissue growth factor (CTGF) trigger were designed, each having different features within the structured DNA hairpin. The hairpins differed in the size of their loop or the length of their stem. Two different cognate antisense hybrids were designed and differ in the length of their single-stranded toehold. Sequence regions are indicated by lowercase letters and different colors to convey sequence identity or sequence complementarity. ( B , D ) DsiRNA release in the presence and absence of trigger was assessed by 10% acrylamide non-denaturing PAGE for each sense hybrid paired with a cognate antisense hybrid exhibiting either ( B ) a 12 nt toehold ( aH ^CTGF-cgnt.12 ) or ( D ) a 16 nt toehold ( aH ^CTGF-cgnt.16 ). Each sense hybrid and the DsiRNA control contained a 3′ 6-carboxyfluorescein (6-FAM) labeled sense RNA strand for visualization and quantification. Gels in both ( B ) and ( D ) depict samples that were incubated for 30 min at 37 °C. ( C , E ) Analysis of the fraction of dsRNA released by the four sense hybrids paired with ( C ) aH ^CTGF-cgnt.12 or ( E ) aH ^CTGF-cgnt.16 , in the presence and absence of the RNA trigger following 30, 90, or 180 min incubations at 37 °C. Error bars indicate standard deviation of three replicate experiments. Indication of statistical significance between samples is reported in the supporting information.
    Figure Legend Snippet: Effects of DNA structural alteration on the degree of trigger-inducible dsRNA release. ( A ) Four different sense hybrids that are responsive to the connective tissue growth factor (CTGF) trigger were designed, each having different features within the structured DNA hairpin. The hairpins differed in the size of their loop or the length of their stem. Two different cognate antisense hybrids were designed and differ in the length of their single-stranded toehold. Sequence regions are indicated by lowercase letters and different colors to convey sequence identity or sequence complementarity. ( B , D ) DsiRNA release in the presence and absence of trigger was assessed by 10% acrylamide non-denaturing PAGE for each sense hybrid paired with a cognate antisense hybrid exhibiting either ( B ) a 12 nt toehold ( aH ^CTGF-cgnt.12 ) or ( D ) a 16 nt toehold ( aH ^CTGF-cgnt.16 ). Each sense hybrid and the DsiRNA control contained a 3′ 6-carboxyfluorescein (6-FAM) labeled sense RNA strand for visualization and quantification. Gels in both ( B ) and ( D ) depict samples that were incubated for 30 min at 37 °C. ( C , E ) Analysis of the fraction of dsRNA released by the four sense hybrids paired with ( C ) aH ^CTGF-cgnt.12 or ( E ) aH ^CTGF-cgnt.16 , in the presence and absence of the RNA trigger following 30, 90, or 180 min incubations at 37 °C. Error bars indicate standard deviation of three replicate experiments. Indication of statistical significance between samples is reported in the supporting information.

    Techniques Used: Sequencing, Polyacrylamide Gel Electrophoresis, Labeling, Incubation, Standard Deviation

    Incorporation of a structured responsive element can generate a trigger-inducible RNA/DNA hybrid system. ( A ) The inducible hybrid system functions as a three-input AND gate. The sense hybrid sH ^CTGF.12/8 contains a responsive DNA hairpin composed of a 12 bp stem and an 8 nt loop, and is flanked by an extended 5′ single strand that acts as a diagnostic toehold. Trigger hybridization to the diagnostic toehold progresses through the hairpin stem and unzips the hairpin (sequence regions colored blue). This liberates a previously sequestered toehold within sH ^CTGF.12/8 which can then hybridize with the complementary toehold of the cognate antisense hybrid, aH ^CTGF-cgnt.12 . Hybridization of these exchange toeholds (sequence regions colored orange) initiates strand exchange and releases a dsRNA product. ( B ) The function of this conditional system was assessed by 8% acrylamide non-denaturing PAGE and total staining with ethidium bromide. DsiRNA release is observed when the sense and antisense hybrids are co-incubated in the presence of trigger (red box). Formation of the expected waste product is observed by comparison to a control assembly of the s’ and a’ DNA strands with the trigger molecule. All samples were incubated for 30 min at 37 °C. ( C ) Förster resonance energy transfer (FRET) analysis was performed as another method to verify conditional dsRNA formation. sH ^CTGF.12/8 was assembled using a 3′ 6-carboxyfluorescein (6-FAM) (ex/em 495/520 nm) labeled sense RNA strand. aH ^CTGF-cgnt.12 was assembled using a 5′-AlexaFluor546 (ex/em 555/570 nm) labeled antisense RNA strand. The hybrids were mixed and incubated at 37 °C for one hour in the presence or absence of the RNA trigger. Fluorescence emission spectra were recorded at t = 0 and t = 60 min using excitation at 475 nm.
    Figure Legend Snippet: Incorporation of a structured responsive element can generate a trigger-inducible RNA/DNA hybrid system. ( A ) The inducible hybrid system functions as a three-input AND gate. The sense hybrid sH ^CTGF.12/8 contains a responsive DNA hairpin composed of a 12 bp stem and an 8 nt loop, and is flanked by an extended 5′ single strand that acts as a diagnostic toehold. Trigger hybridization to the diagnostic toehold progresses through the hairpin stem and unzips the hairpin (sequence regions colored blue). This liberates a previously sequestered toehold within sH ^CTGF.12/8 which can then hybridize with the complementary toehold of the cognate antisense hybrid, aH ^CTGF-cgnt.12 . Hybridization of these exchange toeholds (sequence regions colored orange) initiates strand exchange and releases a dsRNA product. ( B ) The function of this conditional system was assessed by 8% acrylamide non-denaturing PAGE and total staining with ethidium bromide. DsiRNA release is observed when the sense and antisense hybrids are co-incubated in the presence of trigger (red box). Formation of the expected waste product is observed by comparison to a control assembly of the s’ and a’ DNA strands with the trigger molecule. All samples were incubated for 30 min at 37 °C. ( C ) Förster resonance energy transfer (FRET) analysis was performed as another method to verify conditional dsRNA formation. sH ^CTGF.12/8 was assembled using a 3′ 6-carboxyfluorescein (6-FAM) (ex/em 495/520 nm) labeled sense RNA strand. aH ^CTGF-cgnt.12 was assembled using a 5′-AlexaFluor546 (ex/em 555/570 nm) labeled antisense RNA strand. The hybrids were mixed and incubated at 37 °C for one hour in the presence or absence of the RNA trigger. Fluorescence emission spectra were recorded at t = 0 and t = 60 min using excitation at 475 nm.

    Techniques Used: Diagnostic Assay, Hybridization, Sequencing, Polyacrylamide Gel Electrophoresis, Staining, Incubation, Förster Resonance Energy Transfer, Labeling, Fluorescence

    23) Product Images from "DNA–RNA interactions are critical for chromosome condensation in Escherichia coli"

    Article Title: DNA–RNA interactions are critical for chromosome condensation in Escherichia coli

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1711285114

    IP-FM analysis of naRNA4- and HU-mediated DNA condensation using syn- cr DNA. ( A ) An expected secondary structure of syn- cr DNA. The DNA was synthesized and labeled with 6-FAM at 5′. ( B ) Fluorescence polarization and HU binding to syn- cr DNA. Different concentrations of HU protein (0–640 nM) were added to 1 nM 6-FAM–syn- cr DNA. After incubation at room temperature for 10 min, fluorescence polarization (in units of mP) was obtained and plotted as a function of HU concentration. Data analysis was carried out with Prism 7. Error bars show SD of triplicate experiments. The determined K d is 7.9 nM. ( C ) Typical FM images. The components in different assays are in the margins. The fluorescent images were processed by ImageJ. The images are representative of three experiments. (Scale bar: 1 μm.)
    Figure Legend Snippet: IP-FM analysis of naRNA4- and HU-mediated DNA condensation using syn- cr DNA. ( A ) An expected secondary structure of syn- cr DNA. The DNA was synthesized and labeled with 6-FAM at 5′. ( B ) Fluorescence polarization and HU binding to syn- cr DNA. Different concentrations of HU protein (0–640 nM) were added to 1 nM 6-FAM–syn- cr DNA. After incubation at room temperature for 10 min, fluorescence polarization (in units of mP) was obtained and plotted as a function of HU concentration. Data analysis was carried out with Prism 7. Error bars show SD of triplicate experiments. The determined K d is 7.9 nM. ( C ) Typical FM images. The components in different assays are in the margins. The fluorescent images were processed by ImageJ. The images are representative of three experiments. (Scale bar: 1 μm.)

    Techniques Used: Synthesized, Labeling, Fluorescence, Binding Assay, Incubation, Concentration Assay

    Confirmation of a chaperone role of HU in naRNA4/HU-mediated DNA condensation. ( A ) IP-Western blot analysis of HU in condensation complexes. M, Molecular weight protein markers. Different concentrations of HU (5, 10, 20, and 40 ng, lanes 1–4, respectively) were loaded as positive controls. S (lanes 5, 7, and 9) and E (lanes 6, 8, and 10) represent the supernatants and eluates from the beads, respectively. The components of the assays are labeled at the top. ( B ) IP/IP-PCR analysis of plasmid DNA in condensation complexes. The reaction mixtures of condensation assays were incubated with anti-HU antibody, resulting in supernatants (S) and eluates (E). Supernatants (S) were further incubated with S9.6 antibody, resulting in supernatants (S/S) and eluates (S/E). DNA was extracted and purified from the solutions and analyzed by 1.5% agarose gel after PCR using pSA508-targeted primers. ( C ) IP/IP FM analysis of Cy-3–naRNA4 and 6-FAM–syn- cr DNA in condensation complexes. The components are in the left margins. Beads were washed with buffer three times before imaging. Images were processed by ImageJ. The images are representative of triplicate experiments. n/a, not applicable. (Scale bar: 1 μm.) ( D ). Among them are the formation of kissing DNA–RNA loops, parallel DNA–RNA heteroduplexes, Watson/Crick base pairing between some parts of the DNA and naRNA4 hairpin stems and hook-like connections between cruciform DNA loops and single-stranded naRNA4 loops. We are currently investigating the possible presence of any of these complexes in the DNA condensates.
    Figure Legend Snippet: Confirmation of a chaperone role of HU in naRNA4/HU-mediated DNA condensation. ( A ) IP-Western blot analysis of HU in condensation complexes. M, Molecular weight protein markers. Different concentrations of HU (5, 10, 20, and 40 ng, lanes 1–4, respectively) were loaded as positive controls. S (lanes 5, 7, and 9) and E (lanes 6, 8, and 10) represent the supernatants and eluates from the beads, respectively. The components of the assays are labeled at the top. ( B ) IP/IP-PCR analysis of plasmid DNA in condensation complexes. The reaction mixtures of condensation assays were incubated with anti-HU antibody, resulting in supernatants (S) and eluates (E). Supernatants (S) were further incubated with S9.6 antibody, resulting in supernatants (S/S) and eluates (S/E). DNA was extracted and purified from the solutions and analyzed by 1.5% agarose gel after PCR using pSA508-targeted primers. ( C ) IP/IP FM analysis of Cy-3–naRNA4 and 6-FAM–syn- cr DNA in condensation complexes. The components are in the left margins. Beads were washed with buffer three times before imaging. Images were processed by ImageJ. The images are representative of triplicate experiments. n/a, not applicable. (Scale bar: 1 μm.) ( D ). Among them are the formation of kissing DNA–RNA loops, parallel DNA–RNA heteroduplexes, Watson/Crick base pairing between some parts of the DNA and naRNA4 hairpin stems and hook-like connections between cruciform DNA loops and single-stranded naRNA4 loops. We are currently investigating the possible presence of any of these complexes in the DNA condensates.

    Techniques Used: Western Blot, Molecular Weight, Labeling, Polymerase Chain Reaction, Plasmid Preparation, Incubation, Purification, Agarose Gel Electrophoresis, Imaging

    Flowchart of IP in combination with PCR ( A ) and IP in combination with FM ( B ). ( A ) In an IPP assay, Cy-3–labeled RNA (naRNA4 or its variants) was mixed with HU and plasmid DNA. Following condensation, the solution was incubated with S9.6 antibody-coated beads. After collecting the supernatant (S), the beads were then washed with buffer. Eluate (E) from beads was collected. DNA was extracted from both S and E by the phenol and ethanol method. PCR was carried out using specific primers targeted to plasmid DNA. Finally, the amplification products were separated by agarose gel and examined. ( B ) In IPFM assay, Cy-3–labeled RNA (naRNA4 or its variants) was mixed with HU and DNA (either plasmid DNA or 6-FAM–labeled cruciform DNA). Following condensation, the solution was incubated with S9.6 antibody-coated silica beads. The supernatant was discarded. The beads washed with buffer were then delivered to FM for imaging.
    Figure Legend Snippet: Flowchart of IP in combination with PCR ( A ) and IP in combination with FM ( B ). ( A ) In an IPP assay, Cy-3–labeled RNA (naRNA4 or its variants) was mixed with HU and plasmid DNA. Following condensation, the solution was incubated with S9.6 antibody-coated beads. After collecting the supernatant (S), the beads were then washed with buffer. Eluate (E) from beads was collected. DNA was extracted from both S and E by the phenol and ethanol method. PCR was carried out using specific primers targeted to plasmid DNA. Finally, the amplification products were separated by agarose gel and examined. ( B ) In IPFM assay, Cy-3–labeled RNA (naRNA4 or its variants) was mixed with HU and DNA (either plasmid DNA or 6-FAM–labeled cruciform DNA). Following condensation, the solution was incubated with S9.6 antibody-coated silica beads. The supernatant was discarded. The beads washed with buffer were then delivered to FM for imaging.

    Techniques Used: Polymerase Chain Reaction, Labeling, Plasmid Preparation, Incubation, Amplification, Agarose Gel Electrophoresis, Imaging

    24) Product Images from "ATP-binding cassette protein ABCF1 couples gene transcription with maintenance of genome integrity in embryonic stem cells"

    Article Title: ATP-binding cassette protein ABCF1 couples gene transcription with maintenance of genome integrity in embryonic stem cells

    Journal: bioRxiv

    doi: 10.1101/2020.05.28.122184

    (A) Single cell suspensions of D3 mouse ES cells transfected with 5’ 6-carboxyfluorescein (6-FAM) labeled ss, ds-M, or ds-UM on the sense strand are analyzed by flow cytometry. 6-FAM-positive cells (blue) are gated by comparing to untransfected cells (Negative). 6-FAM-positive cells are purified for further analyses. (B) Expression levels of pluripotency and differentiation genes in mouse ES cells as sorted in (A) are analyzed by qPCR. (C) Western blot analysis of nuclear and cytoplasmic fractions prepared from V5-ABCF1 knock-in mouse ES cells using antibodies against OCT4, SOX2, and TUBA. Effective nuclear-cytoplasmic fractionation is demonstrated by enrichment of OCT4 and SOX2 in nuclear extracts and TUBA in cytoplasmic fraction. (D) DNAs purified from DMSO or ETO-treated (80 μM) V5-ABCF1 KI mouse ES cells grown in 2i/LIF medium are separated on an agarose gel and visualized by ethidium bromide staining. (E) Crosslinked nuclear chromatin from DMSO or ETO-treated (80 μM) mouse cells are fragmented by MNase digestion. Digested DNAs are purified, separated on an agarose gel, and stained with ethidium bromide. Both DMSO and ETO-treated chromatins are digested to a similar degree. (F) Expression levels of pluripotency and differentiation genes in DMSO or ETO-treated (80 μM) V5-ABCF1 KI mouse ES cells are analyzed by qPCR, normalized to Actb . Error bars present SEM. n = 3. (*) P
    Figure Legend Snippet: (A) Single cell suspensions of D3 mouse ES cells transfected with 5’ 6-carboxyfluorescein (6-FAM) labeled ss, ds-M, or ds-UM on the sense strand are analyzed by flow cytometry. 6-FAM-positive cells (blue) are gated by comparing to untransfected cells (Negative). 6-FAM-positive cells are purified for further analyses. (B) Expression levels of pluripotency and differentiation genes in mouse ES cells as sorted in (A) are analyzed by qPCR. (C) Western blot analysis of nuclear and cytoplasmic fractions prepared from V5-ABCF1 knock-in mouse ES cells using antibodies against OCT4, SOX2, and TUBA. Effective nuclear-cytoplasmic fractionation is demonstrated by enrichment of OCT4 and SOX2 in nuclear extracts and TUBA in cytoplasmic fraction. (D) DNAs purified from DMSO or ETO-treated (80 μM) V5-ABCF1 KI mouse ES cells grown in 2i/LIF medium are separated on an agarose gel and visualized by ethidium bromide staining. (E) Crosslinked nuclear chromatin from DMSO or ETO-treated (80 μM) mouse cells are fragmented by MNase digestion. Digested DNAs are purified, separated on an agarose gel, and stained with ethidium bromide. Both DMSO and ETO-treated chromatins are digested to a similar degree. (F) Expression levels of pluripotency and differentiation genes in DMSO or ETO-treated (80 μM) V5-ABCF1 KI mouse ES cells are analyzed by qPCR, normalized to Actb . Error bars present SEM. n = 3. (*) P

    Techniques Used: Transfection, Labeling, Flow Cytometry, Purification, Expressing, Real-time Polymerase Chain Reaction, Western Blot, Knock-In, Fractionation, Agarose Gel Electrophoresis, Staining

    25) Product Images from "Homogeneous Polymerase Chain Reaction Nucleobase Quenching Assay to Detect the 1-kbp Deletion in CLN3 That Causes Batten Disease"

    Article Title: Homogeneous Polymerase Chain Reaction Nucleobase Quenching Assay to Detect the 1-kbp Deletion in CLN3 That Causes Batten Disease

    Journal: The Journal of molecular diagnostics : JMD

    doi:

    Strategy. A: The positions of the primers ( arrows ) and probe on the wild-type and mutant CLN3 gene are shown. The fluorophore on the probe is indicated with an asterisk ; not drawn to scale. B: The sequence of the probe is shown in between the complementary sequences of the wild-type and deletion alleles, with vertical lines connecting the base-paired residues. The –F on the 3′ end of the probe indicates the 6-FAM fluorophore and shows its position with respect to the G residues on the opposite strand. The probe is fully base-paired with the mutant sequence, but has three unmatched nucleotides at the 5′ end when annealed to a wild-type amplicon. The G residues that contribute to the quenching of the fluorescent signal are underlined in the normal and mutant sequences.
    Figure Legend Snippet: Strategy. A: The positions of the primers ( arrows ) and probe on the wild-type and mutant CLN3 gene are shown. The fluorophore on the probe is indicated with an asterisk ; not drawn to scale. B: The sequence of the probe is shown in between the complementary sequences of the wild-type and deletion alleles, with vertical lines connecting the base-paired residues. The –F on the 3′ end of the probe indicates the 6-FAM fluorophore and shows its position with respect to the G residues on the opposite strand. The probe is fully base-paired with the mutant sequence, but has three unmatched nucleotides at the 5′ end when annealed to a wild-type amplicon. The G residues that contribute to the quenching of the fluorescent signal are underlined in the normal and mutant sequences.

    Techniques Used: Mutagenesis, Sequencing, Amplification

    26) Product Images from "A Continuous Fluorometric Assay for the Assessment of MazF Ribonuclease Activity"

    Article Title: A Continuous Fluorometric Assay for the Assessment of MazF Ribonuclease Activity

    Journal:

    doi: 10.1016/j.ab.2007.07.017

    Substrate design. A chimeric DNA/RNA oligonucleotide (5′-AAGTCrGACATCAG-3′) previously shown to be cleaved by MazF was labeled with 6-carboxyfluorescein (6-FAM) on the 5′-end and with Black Hole Quencher 1 (BHQ1) on the 3′-end.
    Figure Legend Snippet: Substrate design. A chimeric DNA/RNA oligonucleotide (5′-AAGTCrGACATCAG-3′) previously shown to be cleaved by MazF was labeled with 6-carboxyfluorescein (6-FAM) on the 5′-end and with Black Hole Quencher 1 (BHQ1) on the 3′-end.

    Techniques Used: Labeling

    27) Product Images from "Structural Basis for Catalysis by Onconase"

    Article Title: Structural Basis for Catalysis by Onconase

    Journal:

    doi: 10.1016/j.jmb.2007.09.089

    pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted
    Figure Legend Snippet: pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted

    Techniques Used:

    Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).
    Figure Legend Snippet: Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).

    Techniques Used:

    28) Product Images from "Purification and Characterization of the RecA Protein from Neisseria gonorrhoeae"

    Article Title: Purification and Characterization of the RecA Protein from Neisseria gonorrhoeae

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0017101

    DNA strand exchange activity of RecA Ng and RecA Ec proteins. Reactions were carried out as described in the Materials and Methods and Results sections using cognate SSB proteins and the described substrates. Aliquots of the strand exchange reactions were removed and stopped at each indicated time point. The substrate linear dsDNA, joint molecule reaction intermediates, and nicked circular products are denoted LDS, JM, and NC, respectively. All ssDNAs (circular or linear), migrate identically under these gel conditions. A. RecA Ng promotes faster strand exchange than RecA Ec using homologous substrates. Representative gel of strand exchange reactions performed using homologous pGEM cssDNA and linear dsDNA and the cognate SSB proteins. B. Nicked circular product formation plotted versus time. Error bars represent the standard error of the mean of 4 separate experiments. * P
    Figure Legend Snippet: DNA strand exchange activity of RecA Ng and RecA Ec proteins. Reactions were carried out as described in the Materials and Methods and Results sections using cognate SSB proteins and the described substrates. Aliquots of the strand exchange reactions were removed and stopped at each indicated time point. The substrate linear dsDNA, joint molecule reaction intermediates, and nicked circular products are denoted LDS, JM, and NC, respectively. All ssDNAs (circular or linear), migrate identically under these gel conditions. A. RecA Ng promotes faster strand exchange than RecA Ec using homologous substrates. Representative gel of strand exchange reactions performed using homologous pGEM cssDNA and linear dsDNA and the cognate SSB proteins. B. Nicked circular product formation plotted versus time. Error bars represent the standard error of the mean of 4 separate experiments. * P

    Techniques Used: Activity Assay

    ATP hydrolysis by RecA Ng and RecA Ec during strand exchange. Reactions (510 µl) were carried out as described in Experimental Procedures and contained 4 µMnt M13mp18 cssDNA, 2.67 µM RecA Ng or RecA Ec , 3 mM ATP, 0.4 µM SSB Ng or SSB Ng and 8 µMnt M13mp18 ldsDNA cut with Pst I. A) ATP hydrolysis during DNA strand exchange. Time t = 0 indicates the addition of ATP and SSB. Either ldsDNA or compensating TE storage buffer were added at t = 30 as indicated by the arrow. One representative graph of three reproducible experiments is shown. B) Nicked circular product formation plotted versus time. Time point 0 minutes represents the addition of ldsDNA to initiate strand exchange. The error bars are one standard deviation from the mean calculated from three independent experiments.
    Figure Legend Snippet: ATP hydrolysis by RecA Ng and RecA Ec during strand exchange. Reactions (510 µl) were carried out as described in Experimental Procedures and contained 4 µMnt M13mp18 cssDNA, 2.67 µM RecA Ng or RecA Ec , 3 mM ATP, 0.4 µM SSB Ng or SSB Ng and 8 µMnt M13mp18 ldsDNA cut with Pst I. A) ATP hydrolysis during DNA strand exchange. Time t = 0 indicates the addition of ATP and SSB. Either ldsDNA or compensating TE storage buffer were added at t = 30 as indicated by the arrow. One representative graph of three reproducible experiments is shown. B) Nicked circular product formation plotted versus time. Time point 0 minutes represents the addition of ldsDNA to initiate strand exchange. The error bars are one standard deviation from the mean calculated from three independent experiments.

    Techniques Used: Standard Deviation

    29) Product Images from "Structural basis for DNA 3′-end processing by human tyrosyl-DNA phosphodiesterase 1"

    Article Title: Structural basis for DNA 3′-end processing by human tyrosyl-DNA phosphodiesterase 1

    Journal: Nature Communications

    doi: 10.1038/s41467-017-02530-z

    Tdp1(Δ148) nucleosidase activity and analysis of the DNA content of Tdp1(Δ148):DNA crystals. Reaction schemes depicting a 32 P-labelling of a 12-mer DNA duplex with PNK, followed by removal of the 3′-nucleoside by Tdp1(Δ148) (star denotes 32 P). b Denaturing PAGE of the products of the reactions shown in A (lane 2) and B (lane 3). The four distinct species in the PNK-treated dissolved crystals (lane 9) are labelled from w to z. Lanes 4–8 contain a 32 P-labelled marker of length 11 nts to 7 nts, respectively. c 3′-nucleoside removal by Tdp1(Δ148), followed by 5′- 32 P-labelling with PNK, which also removes the 3′-phosphate created by Tdp1 cleavage. d Proposed reaction of Tdp1(Δ148) in the crystals, followed by 32 P-labelling of dissolved crystals with PNK
    Figure Legend Snippet: Tdp1(Δ148) nucleosidase activity and analysis of the DNA content of Tdp1(Δ148):DNA crystals. Reaction schemes depicting a 32 P-labelling of a 12-mer DNA duplex with PNK, followed by removal of the 3′-nucleoside by Tdp1(Δ148) (star denotes 32 P). b Denaturing PAGE of the products of the reactions shown in A (lane 2) and B (lane 3). The four distinct species in the PNK-treated dissolved crystals (lane 9) are labelled from w to z. Lanes 4–8 contain a 32 P-labelled marker of length 11 nts to 7 nts, respectively. c 3′-nucleoside removal by Tdp1(Δ148), followed by 5′- 32 P-labelling with PNK, which also removes the 3′-phosphate created by Tdp1 cleavage. d Proposed reaction of Tdp1(Δ148) in the crystals, followed by 32 P-labelling of dissolved crystals with PNK

    Techniques Used: Activity Assay, Polyacrylamide Gel Electrophoresis, Marker

    Crystal structures of Tdp1(Δ148)–DNA. a Quaternary transition-state complex of Tdp1(Δ148), ssDNA (orange), a Top1-derived peptide (pink) and vanadate (PDB ID: 1NOP). b Tdp1(Δ148) in complex with the −2G DNA duplex (PDB ID: 5NW9). c Tdp1(Δ148) in complex with the −2T DNA duplex (PDB ID: 5NWA). For a – c , Tdp1(Δ148) is displayed as an electrostatic surface (blue indicates positive charge and red negative charge). The sequence of the DNA in each structure that is clearly defined by the electron density is shown below. The scissile strand is orange and the complementary strand is green. d Tdp1(Δ148) contacts with the complementary strand in the −2T Tdp1(Δ148) DNA complex. Tdp1(Δ148) is shown as an electrostatic surface with underlying structure. The side chains of N528, K527, R361, K231 and R232 are shown as sticks, and interactions with the complementary DNA strand as dotted lines (distances in Ångstrom). e Close-up view of complementary strand interactions with β−turn residues K527 and N528. The structure of Tdp1(Δ148) bound to ssDNA (PDB ID: 1NOP) is superimposed. Loop residues between β15 and β16 are rainbow coloured according to B-factors, with blue indicating the minimum and red the maximum B-factor. f Alignments of Tdp1 sequences from diverse species, with K527 (blue star) marked and the secondary structure elements shown above the alignment
    Figure Legend Snippet: Crystal structures of Tdp1(Δ148)–DNA. a Quaternary transition-state complex of Tdp1(Δ148), ssDNA (orange), a Top1-derived peptide (pink) and vanadate (PDB ID: 1NOP). b Tdp1(Δ148) in complex with the −2G DNA duplex (PDB ID: 5NW9). c Tdp1(Δ148) in complex with the −2T DNA duplex (PDB ID: 5NWA). For a – c , Tdp1(Δ148) is displayed as an electrostatic surface (blue indicates positive charge and red negative charge). The sequence of the DNA in each structure that is clearly defined by the electron density is shown below. The scissile strand is orange and the complementary strand is green. d Tdp1(Δ148) contacts with the complementary strand in the −2T Tdp1(Δ148) DNA complex. Tdp1(Δ148) is shown as an electrostatic surface with underlying structure. The side chains of N528, K527, R361, K231 and R232 are shown as sticks, and interactions with the complementary DNA strand as dotted lines (distances in Ångstrom). e Close-up view of complementary strand interactions with β−turn residues K527 and N528. The structure of Tdp1(Δ148) bound to ssDNA (PDB ID: 1NOP) is superimposed. Loop residues between β15 and β16 are rainbow coloured according to B-factors, with blue indicating the minimum and red the maximum B-factor. f Alignments of Tdp1 sequences from diverse species, with K527 (blue star) marked and the secondary structure elements shown above the alignment

    Techniques Used: Derivative Assay, Sequencing

    Tdp1 is a DNA 3′-end processing enzyme. Schematic representation of Tdp1 activity (represented by scissors) on biologically and medically relevant substrates. All Tdp1 reactions result in DNA with a 3′-phosphorylated end. a Hydrolysis of the phosphotyrosyl linkage between a proteolytic topoisomerase 1 fragment and the 3′-end of the DNA at a nick. b Removal of glycolate from 3′ overhangs with a phosphoglycolate (PG) adduct. c Tdp1 nucleosidase activity on unmodified DNA with a 3′-hydroxyl end. d Removal of chain-terminating nucleoside analogues (CTNAs), such as AZT (zidovudine) from a recessed 3′ end
    Figure Legend Snippet: Tdp1 is a DNA 3′-end processing enzyme. Schematic representation of Tdp1 activity (represented by scissors) on biologically and medically relevant substrates. All Tdp1 reactions result in DNA with a 3′-phosphorylated end. a Hydrolysis of the phosphotyrosyl linkage between a proteolytic topoisomerase 1 fragment and the 3′-end of the DNA at a nick. b Removal of glycolate from 3′ overhangs with a phosphoglycolate (PG) adduct. c Tdp1 nucleosidase activity on unmodified DNA with a 3′-hydroxyl end. d Removal of chain-terminating nucleoside analogues (CTNAs), such as AZT (zidovudine) from a recessed 3′ end

    Techniques Used: Activity Assay

    PD-XLMS method for site-specific protein–DNA cross-linking with mass spectrometry. Tdp1(Δ148) protein (blue, H263A inactive mutant) is cross-linked to DNA (black line) containing 5-Iodouracil (5IdU) and a 3′-Biotin-TEG (depicted as B in a red circle). Small blue circles represent Tdp1 amino acids (after trypsin digestion) and the red star indicates the site of the cross-link
    Figure Legend Snippet: PD-XLMS method for site-specific protein–DNA cross-linking with mass spectrometry. Tdp1(Δ148) protein (blue, H263A inactive mutant) is cross-linked to DNA (black line) containing 5-Iodouracil (5IdU) and a 3′-Biotin-TEG (depicted as B in a red circle). Small blue circles represent Tdp1 amino acids (after trypsin digestion) and the red star indicates the site of the cross-link

    Techniques Used: Mass Spectrometry, Mutagenesis

    Tdp1(Δ148) cross-links via F259 to −2 and −3 modified nucleobases. a Schematic of the single-stranded DNA 20-mers used in cross-linking experiments. Modified oligonucleotides have 5-Iodouracil (5IdU) at the −2 or −3 position. b Eight per cent SDS-PAGE of DNA oligonucleotides, containing a 32 P-label (star), cross-linked to catalytically inactive Tdp1(Δ148) H263A, visualised by phosphorimaging (upper) and SimplyBlue TM staining (lower). c LC elution chromatograms (at 260 nm) of samples cross-linked to the −3 5IdU (blue), −2 5IdU (red) and unmodified control (black) oligonucleotides. d Negative-mode mass spectra showing the charge-state distribution of cross-linked Tdp1(Δ148) peptide–DNA heteroconjugates (cross-linked to the −3 5IdU (blue), −2 5IdU (red) and unmodified control (black) oligonucleotides) eluting from the LC between 15 and 17 min after injection. e Positive-mode mass spectra of −3 5IdU (blue), −2 5IdU (red) and control (black) cross-linked, trypsin and nuclease digested samples. Unique [M+2H] 2+ ions (marked by arrows) are observed at m/z 740.33269 with both 5IdU cross-linked samples. f Collision-induced dissociation fragmentation (CID) mass spectrum of the [M+2H] 2+ ion at m/z 740.33 at 20 V (for the −2 cross-link sample) and the sequence of the cross-linked Tdp1 peptide. The position of the DNA cross-link (F, shaded in red) is determined by the presence of modified fragment ions (annotated in red) containing a single deoxyuracil monophosphate (dUMP, annotated with ##) or a uracil base (annotated by #), which arises from fragmentation of the glycosidic ribose–base bond during CID. Identified peptide b and y fragment ions are annotated in black
    Figure Legend Snippet: Tdp1(Δ148) cross-links via F259 to −2 and −3 modified nucleobases. a Schematic of the single-stranded DNA 20-mers used in cross-linking experiments. Modified oligonucleotides have 5-Iodouracil (5IdU) at the −2 or −3 position. b Eight per cent SDS-PAGE of DNA oligonucleotides, containing a 32 P-label (star), cross-linked to catalytically inactive Tdp1(Δ148) H263A, visualised by phosphorimaging (upper) and SimplyBlue TM staining (lower). c LC elution chromatograms (at 260 nm) of samples cross-linked to the −3 5IdU (blue), −2 5IdU (red) and unmodified control (black) oligonucleotides. d Negative-mode mass spectra showing the charge-state distribution of cross-linked Tdp1(Δ148) peptide–DNA heteroconjugates (cross-linked to the −3 5IdU (blue), −2 5IdU (red) and unmodified control (black) oligonucleotides) eluting from the LC between 15 and 17 min after injection. e Positive-mode mass spectra of −3 5IdU (blue), −2 5IdU (red) and control (black) cross-linked, trypsin and nuclease digested samples. Unique [M+2H] 2+ ions (marked by arrows) are observed at m/z 740.33269 with both 5IdU cross-linked samples. f Collision-induced dissociation fragmentation (CID) mass spectrum of the [M+2H] 2+ ion at m/z 740.33 at 20 V (for the −2 cross-link sample) and the sequence of the cross-linked Tdp1 peptide. The position of the DNA cross-link (F, shaded in red) is determined by the presence of modified fragment ions (annotated in red) containing a single deoxyuracil monophosphate (dUMP, annotated with ##) or a uracil base (annotated by #), which arises from fragmentation of the glycosidic ribose–base bond during CID. Identified peptide b and y fragment ions are annotated in black

    Techniques Used: Modification, SDS Page, Staining, Injection, Sequencing

    30) Product Images from "Seven Novel Probe Systems for Real-Time PCR Provide Absolute Single-Base Discrimination, Higher Signaling, and Generic Components"

    Article Title: Seven Novel Probe Systems for Real-Time PCR Provide Absolute Single-Base Discrimination, Higher Signaling, and Generic Components

    Journal: The Journal of Molecular Diagnostics : JMD

    doi: 10.1016/j.jmoldx.2014.06.008

    G-Force probes. A: G-Force probes consist of complementary C- and G-rich regions that self-hybridize in the quenched state to juxtapose the fluorophore and the G-rich region, or separate during amplification to activate detection. B: A flanking G-Force probe targeting a conserved site in the human VKORC1 gene shows comparable detection of ultramer templates encoding the WT and SNP variant rs9923231 C . C: iDDS probe detection of the WT VKORC1 template, using mixed WT and SNP variant templates ranging from 100% to 0% WT. D: Multiplex detection of the WT MTB inhA gene with mixed WT/mutant templates. qPCR was performed using a reference G-Force probe and an iDDS probe targeting the WT sequence at a site that confers isoniazid resistance when mutated. With the 75% WT sample, the iDDS signaling curve drops about 25% relative to the G-Force curve, and with the 25% WT sample, the iDDS curve drops another 50% relative to the G-Force curve, providing semiquantitative mutant frequency analysis. w/m, WT/mutant.
    Figure Legend Snippet: G-Force probes. A: G-Force probes consist of complementary C- and G-rich regions that self-hybridize in the quenched state to juxtapose the fluorophore and the G-rich region, or separate during amplification to activate detection. B: A flanking G-Force probe targeting a conserved site in the human VKORC1 gene shows comparable detection of ultramer templates encoding the WT and SNP variant rs9923231 C . C: iDDS probe detection of the WT VKORC1 template, using mixed WT and SNP variant templates ranging from 100% to 0% WT. D: Multiplex detection of the WT MTB inhA gene with mixed WT/mutant templates. qPCR was performed using a reference G-Force probe and an iDDS probe targeting the WT sequence at a site that confers isoniazid resistance when mutated. With the 75% WT sample, the iDDS signaling curve drops about 25% relative to the G-Force curve, and with the 25% WT sample, the iDDS curve drops another 50% relative to the G-Force curve, providing semiquantitative mutant frequency analysis. w/m, WT/mutant.

    Techniques Used: Amplification, Variant Assay, Multiplex Assay, Mutagenesis, Real-time Polymerase Chain Reaction, Sequencing

    MacMan probes. A: In the absence of target, free-floating MacMan probes are quenched by generic antiprobes that bind generic 3′ tails. Target detection occurs during qPCR as the MacMan probe anneals to the template, separating the probe from the quencher. B: MacMan probe detection of the S gene of hepatitis B virus DNA (BBI Diagnostics) versus two negative controls (HIV-1 pNL4-3 plasmid and an MTB ultramer template). C: Comparison of detection of the hepatitis S gene with MacMan versus TaqMan probes for the same target sequence.
    Figure Legend Snippet: MacMan probes. A: In the absence of target, free-floating MacMan probes are quenched by generic antiprobes that bind generic 3′ tails. Target detection occurs during qPCR as the MacMan probe anneals to the template, separating the probe from the quencher. B: MacMan probe detection of the S gene of hepatitis B virus DNA (BBI Diagnostics) versus two negative controls (HIV-1 pNL4-3 plasmid and an MTB ultramer template). C: Comparison of detection of the hepatitis S gene with MacMan versus TaqMan probes for the same target sequence.

    Techniques Used: Real-time Polymerase Chain Reaction, Plasmid Preparation, Sequencing

    31) Product Images from "FRET-Enabled Optical modulation for High Sensitivity Fluorescence Imaging"

    Article Title: FRET-Enabled Optical modulation for High Sensitivity Fluorescence Imaging

    Journal: Journal of the American Chemical Society

    doi: 10.1021/ja100175r

    A. Schematic model enabling donor fluorescence enhancement and modulation through dual laser excitation. Bold arrows show the transitions giving enhanced fluorescence. The arrow connecting D*A d to DA d is the primary enhancement pathway in the Cy3-Cy5
    Figure Legend Snippet: A. Schematic model enabling donor fluorescence enhancement and modulation through dual laser excitation. Bold arrows show the transitions giving enhanced fluorescence. The arrow connecting D*A d to DA d is the primary enhancement pathway in the Cy3-Cy5

    Techniques Used: Fluorescence

    A. Average frame of Cy3-Cy5 hairpin structure in solution with 496 nm cw defocused excitation (700 W/cm 2 ) and more tightly focused 633 nm cw laser (10 kW/cm 2 ). Secondary excitation was chopped at 4 Hz; synchronous ccd detection was at 40 Hz. B. Whole
    Figure Legend Snippet: A. Average frame of Cy3-Cy5 hairpin structure in solution with 496 nm cw defocused excitation (700 W/cm 2 ) and more tightly focused 633 nm cw laser (10 kW/cm 2 ). Secondary excitation was chopped at 4 Hz; synchronous ccd detection was at 40 Hz. B. Whole

    Techniques Used:

    A. Cy3 fluorescence enhancement within the Cy3-Cy5 hairpin (1μM, aqueous), calculated from the 50-μs-binned time trace modulation depth, versus modulation frequency (red ▲, varied from 500 Hz to 3900 Hz). Cy3 emission was excited
    Figure Legend Snippet: A. Cy3 fluorescence enhancement within the Cy3-Cy5 hairpin (1μM, aqueous), calculated from the 50-μs-binned time trace modulation depth, versus modulation frequency (red ▲, varied from 500 Hz to 3900 Hz). Cy3 emission was excited

    Techniques Used: Fluorescence

    32) Product Images from "HlyU Is a Positive Regulator of Hemolysin Expression in Vibrio anguillarum ▿"

    Article Title: HlyU Is a Positive Regulator of Hemolysin Expression in Vibrio anguillarum ▿

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.01033-10

    The degenerate PCR product was amplified from V. anguillarum M93Sm genomic DNA using primer pair Pm301/Pm302. The PCR product was separated and visualized in a 1% agarose gel using a Promega 1-kb DNA ladder as the size standard and was 1.6 kbp long. The
    Figure Legend Snippet: The degenerate PCR product was amplified from V. anguillarum M93Sm genomic DNA using primer pair Pm301/Pm302. The PCR product was separated and visualized in a 1% agarose gel using a Promega 1-kb DNA ladder as the size standard and was 1.6 kbp long. The

    Techniques Used: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis

    33) Product Images from "Homogeneous Polymerase Chain Reaction Nucleobase Quenching Assay to Detect the 1-kbp Deletion in CLN3 That Causes Batten Disease"

    Article Title: Homogeneous Polymerase Chain Reaction Nucleobase Quenching Assay to Detect the 1-kbp Deletion in CLN3 That Causes Batten Disease

    Journal: The Journal of molecular diagnostics : JMD

    doi:

    Strategy. A: The positions of the primers ( arrows ) and probe on the wild-type and mutant CLN3 gene are shown. The fluorophore on the probe is indicated with an asterisk ; not drawn to scale. B: The sequence of the probe is shown in between the complementary sequences of the wild-type and deletion alleles, with vertical lines connecting the base-paired residues. The –F on the 3′ end of the probe indicates the 6-FAM fluorophore and shows its position with respect to the G residues on the opposite strand. The probe is fully base-paired with the mutant sequence, but has three unmatched nucleotides at the 5′ end when annealed to a wild-type amplicon. The G residues that contribute to the quenching of the fluorescent signal are underlined in the normal and mutant sequences.
    Figure Legend Snippet: Strategy. A: The positions of the primers ( arrows ) and probe on the wild-type and mutant CLN3 gene are shown. The fluorophore on the probe is indicated with an asterisk ; not drawn to scale. B: The sequence of the probe is shown in between the complementary sequences of the wild-type and deletion alleles, with vertical lines connecting the base-paired residues. The –F on the 3′ end of the probe indicates the 6-FAM fluorophore and shows its position with respect to the G residues on the opposite strand. The probe is fully base-paired with the mutant sequence, but has three unmatched nucleotides at the 5′ end when annealed to a wild-type amplicon. The G residues that contribute to the quenching of the fluorescent signal are underlined in the normal and mutant sequences.

    Techniques Used: Mutagenesis, Sequencing, Amplification

    34) Product Images from "Endonuclease Activity Inhibition of the NS1 Protein of Parvovirus B19 as a Novel Target for Antiviral Drug Development"

    Article Title: Endonuclease Activity Inhibition of the NS1 Protein of Parvovirus B19 as a Novel Target for Antiviral Drug Development

    Journal: Antimicrobial Agents and Chemotherapy

    doi: 10.1128/AAC.01879-18

    Establishment of a 6-carboxyfluorescein (FAM)-based in vitro nicking assay. (A) Diagram of the FAM-labeled oligonucleotides. The sequences of Ori20 are shown with FAM and the Iowa Black FQ quencher (Q) at the 5′ and 3′ ends, respectively. After incubation with NS1N, Ori20 is cleaved into two shorter oligonucleotides, and then a FAM-linked short oligonucleotide of 9 nt is released for fluorescence detection. (B) FAM Ori20 Q -based nicking assay. FAM Ori20 Q (200 nM) was incubated with 2 µM NS1N protein in the nicking buffer. The fluorescence intensity of each sample was detected on a microplate reader. FAM Ori20 Q without NS1N and FAM Ori20 without a quencher were used as controls. (C) Optimization of the probe concentration. Various concentrations of the FAM Ori20 Q probe were used in the nicking assay. Fluorescence intensity was determined with or without NS1N, as indicated. The fold changes in fluorescence intensity in the presence of NS1N from the fluorescence intensity with no NS1N are shown.
    Figure Legend Snippet: Establishment of a 6-carboxyfluorescein (FAM)-based in vitro nicking assay. (A) Diagram of the FAM-labeled oligonucleotides. The sequences of Ori20 are shown with FAM and the Iowa Black FQ quencher (Q) at the 5′ and 3′ ends, respectively. After incubation with NS1N, Ori20 is cleaved into two shorter oligonucleotides, and then a FAM-linked short oligonucleotide of 9 nt is released for fluorescence detection. (B) FAM Ori20 Q -based nicking assay. FAM Ori20 Q (200 nM) was incubated with 2 µM NS1N protein in the nicking buffer. The fluorescence intensity of each sample was detected on a microplate reader. FAM Ori20 Q without NS1N and FAM Ori20 without a quencher were used as controls. (C) Optimization of the probe concentration. Various concentrations of the FAM Ori20 Q probe were used in the nicking assay. Fluorescence intensity was determined with or without NS1N, as indicated. The fold changes in fluorescence intensity in the presence of NS1N from the fluorescence intensity with no NS1N are shown.

    Techniques Used: In Vitro, Labeling, Incubation, Fluorescence, Concentration Assay

    35) Product Images from "Glutamine antagonist-mediated immune suppression decreases pathology but delays virus clearance in mice during nonfatal alphavirus encephalomyelitis"

    Article Title: Glutamine antagonist-mediated immune suppression decreases pathology but delays virus clearance in mice during nonfatal alphavirus encephalomyelitis

    Journal: Virology

    doi: 10.1016/j.virol.2017.05.013

    Effect of DON treatment on SINV-specific antibody and IFN-γ production ( A-D ) SINV-specific IgM ( A, C ) and IgG ( B, D) levels were measured by ELISA in the serum ( A, B ) and brain ( C, D ) of SINV-infected mice receiving no treatment, low (0.3mg/kg) dose DON, or high (0.6mg/kg) dose DON at 5, 7, 9 and 11 DPI. ( E, F ) Ifng mRNA expression ( E ) was measured by RT-qPCR and IFN-γ protein levels ( F ) were measured by ELISA in the brains of SINV-infected mice receiving no treatment, low (0.3mg/kg) dose DON, or high (0.6mg/kg) dose DON at 5, 7, 9 and 11 DPI (n = 3-5 mice per group per time point; data presented as the mean ± SEM; double-headed arrows indicate the period of DON treatment; dotted line indicates lowest point in assay standard curve; * p
    Figure Legend Snippet: Effect of DON treatment on SINV-specific antibody and IFN-γ production ( A-D ) SINV-specific IgM ( A, C ) and IgG ( B, D) levels were measured by ELISA in the serum ( A, B ) and brain ( C, D ) of SINV-infected mice receiving no treatment, low (0.3mg/kg) dose DON, or high (0.6mg/kg) dose DON at 5, 7, 9 and 11 DPI. ( E, F ) Ifng mRNA expression ( E ) was measured by RT-qPCR and IFN-γ protein levels ( F ) were measured by ELISA in the brains of SINV-infected mice receiving no treatment, low (0.3mg/kg) dose DON, or high (0.6mg/kg) dose DON at 5, 7, 9 and 11 DPI (n = 3-5 mice per group per time point; data presented as the mean ± SEM; double-headed arrows indicate the period of DON treatment; dotted line indicates lowest point in assay standard curve; * p

    Techniques Used: Enzyme-linked Immunosorbent Assay, Infection, Mouse Assay, Expressing, Quantitative RT-PCR

    36) Product Images from "Human DNA polymerase α in binary complex with a DNA:DNA template-primer"

    Article Title: Human DNA polymerase α in binary complex with a DNA:DNA template-primer

    Journal: Scientific Reports

    doi: 10.1038/srep23784

    Polα/primase mediated assembly of RNA-DNA primers during DNA replication. ( A ) Because DNA synthesis proceeds in the 5′ to 3, direction, the replication fork is asymmetrical, with continuous DNA synthesis on the leading strand and discontinuous DNA synthesis (via Okazaki fragments) on the lagging strand. ( B ) The Polα/primase complex is composed of four subunits (p180, p70, p49 and p58 in humans). ( C ) The Polα/primase complex assembles RNA-DNA primers required to initiate DNA synthesis on leading and lagging strands in eukaryotes.
    Figure Legend Snippet: Polα/primase mediated assembly of RNA-DNA primers during DNA replication. ( A ) Because DNA synthesis proceeds in the 5′ to 3, direction, the replication fork is asymmetrical, with continuous DNA synthesis on the leading strand and discontinuous DNA synthesis (via Okazaki fragments) on the lagging strand. ( B ) The Polα/primase complex is composed of four subunits (p180, p70, p49 and p58 in humans). ( C ) The Polα/primase complex assembles RNA-DNA primers required to initiate DNA synthesis on leading and lagging strands in eukaryotes.

    Techniques Used: DNA Synthesis

    Comparison between binary and ternary structures of hPolα. ( A ) The hPolα binary complex bound to DNA:DNA is colored yellow and the ternary complex bound to RNA:DNA (PDB code 4 QCL) is colored gray. The palm, fingers, thumb, exonuclease and N-terminal domains are labeled. ( B ) Close-up view of the hPolα active site. Side chains for residues Arg784, Asp860 and Asp1004 are shown with oxygen atoms in red and nitrogen atoms in blue. The incoming nucleotide (dCTP) from the ternary structure is shown in red.
    Figure Legend Snippet: Comparison between binary and ternary structures of hPolα. ( A ) The hPolα binary complex bound to DNA:DNA is colored yellow and the ternary complex bound to RNA:DNA (PDB code 4 QCL) is colored gray. The palm, fingers, thumb, exonuclease and N-terminal domains are labeled. ( B ) Close-up view of the hPolα active site. Side chains for residues Arg784, Asp860 and Asp1004 are shown with oxygen atoms in red and nitrogen atoms in blue. The incoming nucleotide (dCTP) from the ternary structure is shown in red.

    Techniques Used: Labeling

    Conformation of nucleic acid. ( A ) Comparison of the DNA conformations of the hPolα binary complex (yellow) and the hPolα ternary complex (gray). The bound and unbound regions are marked in the figure. ( B ) Scatter plot of Z p , the mean z-coordinate of the backbone phosphorous atoms with respect to individual dinucleotide reference frames, against the mean value for the four χ torsion angles at each dinucleotide step. The values for 7 DNA:DNA base steps bound to hPolα in the binary complex are shown as yellow circles. The 7 RNA:DNA base steps bound to hPolα in the ternary complex (PDB code 4 QCL) are shown as gray triangles. The values for RNA:DNA steps bound to yPolα (red squares), DNA:DNA steps bound to yPolδ (blue diamonds) and DNA:DNA steps bound to yPolε (orange diamonds) are also plotted. ( C ) Binding affinities of hPolα for DNA/DNA and RNA/DNA measured by a fluorescence anisotropy assay. The fraction of DNA/DNA or RNA/DNA bound is plotted versus hPolα concentration (logarithmic scale) in order to determine the dissociation constants. ( D ) Distribution of the pseudorotational phase angle P and puckering amplitude v max of the base steps in contact with hPolα in the binary complex (yellow circles), with hPolα in the ternary complex (gray triangles) and with yPolα in the ternary complex (red squares).
    Figure Legend Snippet: Conformation of nucleic acid. ( A ) Comparison of the DNA conformations of the hPolα binary complex (yellow) and the hPolα ternary complex (gray). The bound and unbound regions are marked in the figure. ( B ) Scatter plot of Z p , the mean z-coordinate of the backbone phosphorous atoms with respect to individual dinucleotide reference frames, against the mean value for the four χ torsion angles at each dinucleotide step. The values for 7 DNA:DNA base steps bound to hPolα in the binary complex are shown as yellow circles. The 7 RNA:DNA base steps bound to hPolα in the ternary complex (PDB code 4 QCL) are shown as gray triangles. The values for RNA:DNA steps bound to yPolα (red squares), DNA:DNA steps bound to yPolδ (blue diamonds) and DNA:DNA steps bound to yPolε (orange diamonds) are also plotted. ( C ) Binding affinities of hPolα for DNA/DNA and RNA/DNA measured by a fluorescence anisotropy assay. The fraction of DNA/DNA or RNA/DNA bound is plotted versus hPolα concentration (logarithmic scale) in order to determine the dissociation constants. ( D ) Distribution of the pseudorotational phase angle P and puckering amplitude v max of the base steps in contact with hPolα in the binary complex (yellow circles), with hPolα in the ternary complex (gray triangles) and with yPolα in the ternary complex (red squares).

    Techniques Used: Binding Assay, Fluorescence, Concentration Assay

    37) Product Images from "An orally bioavailable broad-spectrum antiviral inhibits SARS-CoV-2 in human airway epithelial cell cultures and multiple coronaviruses in mice"

    Article Title: An orally bioavailable broad-spectrum antiviral inhibits SARS-CoV-2 in human airway epithelial cell cultures and multiple coronaviruses in mice

    Journal: Science Translational Medicine

    doi: 10.1126/scitranslmed.abb5883

    NHC potently inhibits MERS-CoV and newly emerging SARS-CoV-2 replication. (A) Percent inhibition of MERS-CoV replication and NHC cytotoxicity in Calu-3 cells. Calu-3 cells were infected in triplicate with MERS-CoV nanoluciferase (nLUC) at a multiplicity of infection (MOI) of 0.08 in the presence of a range of drug for 48 hours, after which replication was measured through quantitation of MERS-CoV–expressed nLUC. Cytotoxicity was measured in similarly treated but uninfected cultures via Cell-Titer-Glo assay. Data are combined from 3 independent experiments. (B) NHC antiviral activity and cytotoxicity in Vero E6 cells infected with SARS-CoV-2. Vero E6 cells were infected in duplicate with SARS-CoV-2 clinical isolate 2019-nCoV/USA-WA1/2020 virus at an MOI of 0.05 in the presence of a range of drug for 48 hours, after which replication was measured through quantitation of cell viability by Cell-Titer-Glo assay. Cytotoxicity was measured as in A . Data are combined from 2 independent experiments. ( C) SARS-CoV-2 titer reduction (left) and percent inhibition (right) in Calu-3 cells. Cells were infected with at an MOI of 0.1 for 30 min, washed and exposed to a dose response of NHC in triplicate per condition. 72 hours post infection, virus production was measured by plaque assay. (D) SARS-CoV-2 genomic RNA reduction (left) and percent inhibition (right) in Calu-3 cells. Viral RNA was isolated from clarified supernatants from the study in panel C . Genome copy numbers were quantitated by qRT-PCR with primer/probes targeting the N gene. For A-D , the symbol is at the mean and the error bars represent the standard deviation.
    Figure Legend Snippet: NHC potently inhibits MERS-CoV and newly emerging SARS-CoV-2 replication. (A) Percent inhibition of MERS-CoV replication and NHC cytotoxicity in Calu-3 cells. Calu-3 cells were infected in triplicate with MERS-CoV nanoluciferase (nLUC) at a multiplicity of infection (MOI) of 0.08 in the presence of a range of drug for 48 hours, after which replication was measured through quantitation of MERS-CoV–expressed nLUC. Cytotoxicity was measured in similarly treated but uninfected cultures via Cell-Titer-Glo assay. Data are combined from 3 independent experiments. (B) NHC antiviral activity and cytotoxicity in Vero E6 cells infected with SARS-CoV-2. Vero E6 cells were infected in duplicate with SARS-CoV-2 clinical isolate 2019-nCoV/USA-WA1/2020 virus at an MOI of 0.05 in the presence of a range of drug for 48 hours, after which replication was measured through quantitation of cell viability by Cell-Titer-Glo assay. Cytotoxicity was measured as in A . Data are combined from 2 independent experiments. ( C) SARS-CoV-2 titer reduction (left) and percent inhibition (right) in Calu-3 cells. Cells were infected with at an MOI of 0.1 for 30 min, washed and exposed to a dose response of NHC in triplicate per condition. 72 hours post infection, virus production was measured by plaque assay. (D) SARS-CoV-2 genomic RNA reduction (left) and percent inhibition (right) in Calu-3 cells. Viral RNA was isolated from clarified supernatants from the study in panel C . Genome copy numbers were quantitated by qRT-PCR with primer/probes targeting the N gene. For A-D , the symbol is at the mean and the error bars represent the standard deviation.

    Techniques Used: Inhibition, Infection, Quantitation Assay, Glo Assay, Activity Assay, Plaque Assay, Isolation, Quantitative RT-PCR, Standard Deviation

    NHC is highly active against SARS-CoV-2, MERS-CoV, and SARS-CoV in primary human airway epithelial cell cultures. (A) HAE were infected at an MOI of 0.5 with clinical isolate SARS-CoV-2 for 2 hours in the presence of NHC in duplicate after which virus was removed and cultures were washed in incubated in NHC for 48 hours when apical washes were collected for virus titration by plaque assay. The line is at the mean. Each symbol represents the titer from a single well. (B) HAE cells were infected with MERS-CoV red fluorescent protein (RFP) at an MOI of 0.5 in triplicate and treated similarly to A . qRT-PCR for MERS-CoV ORF1 and ORFN mRNA. Total RNA was isolated from cultures in C for qRT-PCR analysis. Representative data from three separate experiments with three different cell donors are displayed. PFU, plaque-forming units. (C) Studies performed as in A but with SARS-CoV green fluorescent protein (GFP). Representative data from two separate experiments with two different cell donors are displayed. Each symbol represents the data from one HAE culture, the line is at the mean and the error bars represent the standard deviation.
    Figure Legend Snippet: NHC is highly active against SARS-CoV-2, MERS-CoV, and SARS-CoV in primary human airway epithelial cell cultures. (A) HAE were infected at an MOI of 0.5 with clinical isolate SARS-CoV-2 for 2 hours in the presence of NHC in duplicate after which virus was removed and cultures were washed in incubated in NHC for 48 hours when apical washes were collected for virus titration by plaque assay. The line is at the mean. Each symbol represents the titer from a single well. (B) HAE cells were infected with MERS-CoV red fluorescent protein (RFP) at an MOI of 0.5 in triplicate and treated similarly to A . qRT-PCR for MERS-CoV ORF1 and ORFN mRNA. Total RNA was isolated from cultures in C for qRT-PCR analysis. Representative data from three separate experiments with three different cell donors are displayed. PFU, plaque-forming units. (C) Studies performed as in A but with SARS-CoV green fluorescent protein (GFP). Representative data from two separate experiments with two different cell donors are displayed. Each symbol represents the data from one HAE culture, the line is at the mean and the error bars represent the standard deviation.

    Techniques Used: Infection, Incubation, Titration, Plaque Assay, Quantitative RT-PCR, Isolation, Standard Deviation

    Remdesivir (RDV) resistance mutations in the highly conserved RNA-dependent RNA polymerase increase susceptibility to NHC. (A) Neighbor-joining trees created with representatives from all four CoV genogroups showing the genetic similarity of CoV nsp12 (RdRp) and CoV spike glycoprotein, which mediates host tropism and entry into cells. Text color of the virus strain label corresponds to virus host species on the left. The heatmap adjacent to each neighbor-joining tree depicts percent amino acid identity (% A.A. similarity) against mouse hepatitis virus (MHV), SARS-CoV, or MERS-CoV. (B) The variation encompassed in panel A was modeled onto the RdRp structure of the SARS-CoV RdRp. (C) Amino acid sequence of CoV in panel A at known resistance alleles to antiviral drug RDV. (D) Virus titer reduction assay in DBT cells across a range of NHC with recombinant MHV bearing resistance mutations to RDV. Data shown are combined from three independent experiments performed with biological duplicates or triplicates per condition. Asterisks indicate statistically significant differences by Mann-Whitney test as indicated on the graph.
    Figure Legend Snippet: Remdesivir (RDV) resistance mutations in the highly conserved RNA-dependent RNA polymerase increase susceptibility to NHC. (A) Neighbor-joining trees created with representatives from all four CoV genogroups showing the genetic similarity of CoV nsp12 (RdRp) and CoV spike glycoprotein, which mediates host tropism and entry into cells. Text color of the virus strain label corresponds to virus host species on the left. The heatmap adjacent to each neighbor-joining tree depicts percent amino acid identity (% A.A. similarity) against mouse hepatitis virus (MHV), SARS-CoV, or MERS-CoV. (B) The variation encompassed in panel A was modeled onto the RdRp structure of the SARS-CoV RdRp. (C) Amino acid sequence of CoV in panel A at known resistance alleles to antiviral drug RDV. (D) Virus titer reduction assay in DBT cells across a range of NHC with recombinant MHV bearing resistance mutations to RDV. Data shown are combined from three independent experiments performed with biological duplicates or triplicates per condition. Asterisks indicate statistically significant differences by Mann-Whitney test as indicated on the graph.

    Techniques Used: Sequencing, Recombinant, MANN-WHITNEY

    NHC is effective against multiple genetically distinct Bat-CoV. Top: Antiviral efficacy of NHC in HAE cells against SARS-like (HKU3, SHC014, group 2b) and MERS-like (HKU5, group 2c) bat-CoV. HAE cells were infected at an MOI of 0.5 in the presence of NHC in duplicate. After 48 hours, virus produced was titrated via plaque assay. Each data point represents the titer per culture. Bottom: qRT-PCR for CoV ORF1 and ORFN mRNA in total RNA from cultures in the top panel. Mock, mock-treated. Representative data from two separate experiments with two different cell donors are displayed.
    Figure Legend Snippet: NHC is effective against multiple genetically distinct Bat-CoV. Top: Antiviral efficacy of NHC in HAE cells against SARS-like (HKU3, SHC014, group 2b) and MERS-like (HKU5, group 2c) bat-CoV. HAE cells were infected at an MOI of 0.5 in the presence of NHC in duplicate. After 48 hours, virus produced was titrated via plaque assay. Each data point represents the titer per culture. Bottom: qRT-PCR for CoV ORF1 and ORFN mRNA in total RNA from cultures in the top panel. Mock, mock-treated. Representative data from two separate experiments with two different cell donors are displayed.

    Techniques Used: Infection, Produced, Plaque Assay, Quantitative RT-PCR

    Prophylactic and therapeutic EIDD-2801 reduces MERS-CoV replication and pathogenesis coincident with increased viral mutation rates . Equivalent numbers of 10-14 week old male and female C57BL/6 hDPP4 mice were administered vehicle (10% PEG, 2.5% Cremophor RH40 in water) or NHC prodrug EIDD-2801 beginning at -2 hours, +12, +24 or +48 hours post infection and every 12 hours thereafter by oral gavage (n = 10/group). Mice were intranasally infected with 5E+04 PFU mouse-adapted MERS-CoV M35C4 strain. ( A) Percent starting weight. Asterisks indicate differences between -2 hours and +12 hours group from vehicle by two-way ANOVA with Tukey’s multiple comparison test. ( B) Lung hemorrhage in mice from panel A scored on a scale of 0-4 where 0 is a normal pink healthy lung and 4 is a diffusely discolored dark red lung. (C) Virus lung titer in mice from panel A as determined by plaque assay. Asterisks in both panel B and C indicate differences from vehicle by Kruskal-Wallis with Dunn’s multiple comparison test. (D) MERS-CoV genomic RNA in lung tissue by qRT-PCR. Asterisks indicate differences by one-way ANOVA with a Dunnett’s multiple comparison test. (E) Pulmonary function by whole body plethysmography was performed daily on four animals per group. Asterisks indicate differences from vehicle by two-way ANOVA with Tukey’s multiple comparison test. (F) Workflow to measure mutation rate in MERS-CoV RNA and host transcript ISG15 by Primer ID in mouse lung tissue. (G) Number of template consensus sequences (TCS) for MERS-CoV nsp10 and ISG15. (H) Total error rate in MERS-CoV nsp10 and ISG15. (I) The cytosine to uridine transition rate in MERS-CoV nsp10 and ISG15. In panels G-I, asterisks indicate differences from vehicle by two-way ANOVA with Tukey’s multiple comparison test. (J) Codon change frequency in MERS-CoV nsp10. Asterisks indicate differences from vehicle by Kruskal-Wallis with Dunn’s multiple comparison test. For all panels, the boxes encompass the 25th to 75th percentile, the line is at the median, while the whiskers represent the range.
    Figure Legend Snippet: Prophylactic and therapeutic EIDD-2801 reduces MERS-CoV replication and pathogenesis coincident with increased viral mutation rates . Equivalent numbers of 10-14 week old male and female C57BL/6 hDPP4 mice were administered vehicle (10% PEG, 2.5% Cremophor RH40 in water) or NHC prodrug EIDD-2801 beginning at -2 hours, +12, +24 or +48 hours post infection and every 12 hours thereafter by oral gavage (n = 10/group). Mice were intranasally infected with 5E+04 PFU mouse-adapted MERS-CoV M35C4 strain. ( A) Percent starting weight. Asterisks indicate differences between -2 hours and +12 hours group from vehicle by two-way ANOVA with Tukey’s multiple comparison test. ( B) Lung hemorrhage in mice from panel A scored on a scale of 0-4 where 0 is a normal pink healthy lung and 4 is a diffusely discolored dark red lung. (C) Virus lung titer in mice from panel A as determined by plaque assay. Asterisks in both panel B and C indicate differences from vehicle by Kruskal-Wallis with Dunn’s multiple comparison test. (D) MERS-CoV genomic RNA in lung tissue by qRT-PCR. Asterisks indicate differences by one-way ANOVA with a Dunnett’s multiple comparison test. (E) Pulmonary function by whole body plethysmography was performed daily on four animals per group. Asterisks indicate differences from vehicle by two-way ANOVA with Tukey’s multiple comparison test. (F) Workflow to measure mutation rate in MERS-CoV RNA and host transcript ISG15 by Primer ID in mouse lung tissue. (G) Number of template consensus sequences (TCS) for MERS-CoV nsp10 and ISG15. (H) Total error rate in MERS-CoV nsp10 and ISG15. (I) The cytosine to uridine transition rate in MERS-CoV nsp10 and ISG15. In panels G-I, asterisks indicate differences from vehicle by two-way ANOVA with Tukey’s multiple comparison test. (J) Codon change frequency in MERS-CoV nsp10. Asterisks indicate differences from vehicle by Kruskal-Wallis with Dunn’s multiple comparison test. For all panels, the boxes encompass the 25th to 75th percentile, the line is at the median, while the whiskers represent the range.

    Techniques Used: Mutagenesis, Mouse Assay, Infection, Plaque Assay, Quantitative RT-PCR

    NHC antiviral activity is associated with increased viral mutation rates . ( A ) HAE cultures were infected with MERS-CoV red fluorescent protein (RFP) at an MOI of 0.5 in duplicate in the presence of vehicle, RDV, or NHC for 48 hours, after which apical washes were collected for virus titration. Data are combined from two independent studies. The boxes encompass the 25th to 75th percentile, the line is at the median, while the whiskers represent the range. (B) Schematic of Primer ID deep sequencing for single RNA genomes of MERS-CoV. (C) The total error rate for MERS-CoV RNA isolated from cultures in panel A as determined by Primer ID. Error rate values are # mutations per 10,000 bases. Asterisks indicate significant differences as compared to untreated group by two-way ANOVA with a Dunnett’s multiple comparison test. (D) Description of potential NHC mutational spectra on both positive and negative sense viral RNA. (E) Nucleotide transitions in cDNA derived from MERS-CoV genomic RNA.
    Figure Legend Snippet: NHC antiviral activity is associated with increased viral mutation rates . ( A ) HAE cultures were infected with MERS-CoV red fluorescent protein (RFP) at an MOI of 0.5 in duplicate in the presence of vehicle, RDV, or NHC for 48 hours, after which apical washes were collected for virus titration. Data are combined from two independent studies. The boxes encompass the 25th to 75th percentile, the line is at the median, while the whiskers represent the range. (B) Schematic of Primer ID deep sequencing for single RNA genomes of MERS-CoV. (C) The total error rate for MERS-CoV RNA isolated from cultures in panel A as determined by Primer ID. Error rate values are # mutations per 10,000 bases. Asterisks indicate significant differences as compared to untreated group by two-way ANOVA with a Dunnett’s multiple comparison test. (D) Description of potential NHC mutational spectra on both positive and negative sense viral RNA. (E) Nucleotide transitions in cDNA derived from MERS-CoV genomic RNA.

    Techniques Used: Activity Assay, Mutagenesis, Infection, Titration, Sequencing, Isolation, Derivative Assay

    38) Product Images from "DNA cytosine and methylcytosine deamination by APOBEC3B: enhancing methylcytosine deamination by engineering APOBEC3B"

    Article Title: DNA cytosine and methylcytosine deamination by APOBEC3B: enhancing methylcytosine deamination by engineering APOBEC3B

    Journal: Biochemical Journal

    doi: 10.1042/BJ20150382

    Dissecting loop-1 residues important for increasing mC deamination Error bars represent S.D. from the mean for three independent experiments. ( A ) Design of the mutants on A3BCD2 WT. Sequence alignment of A3BCD2 and A3A showed four groups (M1–M4) around loop-1 that are not conserved (left). A3BCD2 was mutated to contain the corresponding residues of A3A individually to generated mutant M1–M4. A3BCD2 M3 was combined with others to generate three additional combined mutants. ( B ) Gel image showing the different mC deamination activities by the mutants. Each protein (0.5 μM and 2 μM) was incubated with 600 nM 30 nt ssDNA substrates at 37°C for 2 h. ( C ) Quantification of the activity on mC. The activity of the mutants at the concentration of 2 μM was quantified. ( D ) Dose-response of mC deamination activity by A3BCD2 WT, M3, M4, M3M4 and Mt0 constructs. ( E ) Dose-response of C deamination activity by A3BCD2 WT, M3, M4, M3M4 and Mt0 constructs.
    Figure Legend Snippet: Dissecting loop-1 residues important for increasing mC deamination Error bars represent S.D. from the mean for three independent experiments. ( A ) Design of the mutants on A3BCD2 WT. Sequence alignment of A3BCD2 and A3A showed four groups (M1–M4) around loop-1 that are not conserved (left). A3BCD2 was mutated to contain the corresponding residues of A3A individually to generated mutant M1–M4. A3BCD2 M3 was combined with others to generate three additional combined mutants. ( B ) Gel image showing the different mC deamination activities by the mutants. Each protein (0.5 μM and 2 μM) was incubated with 600 nM 30 nt ssDNA substrates at 37°C for 2 h. ( C ) Quantification of the activity on mC. The activity of the mutants at the concentration of 2 μM was quantified. ( D ) Dose-response of mC deamination activity by A3BCD2 WT, M3, M4, M3M4 and Mt0 constructs. ( E ) Dose-response of C deamination activity by A3BCD2 WT, M3, M4, M3M4 and Mt0 constructs.

    Techniques Used: Sequencing, Generated, Mutagenesis, Incubation, Activity Assay, Concentration Assay, Construct

    An engineered A3BCD2 mutant with much higher mC deamination activity ( A ) Gel image showing the mC deamination activity by A3BCD2 WT construct. A3BCD2 at various concentrations was incubated with 600 nM 30 nt ssDNA substrate containing mC at 37°C for 2 h. ( B ) Design of A3BCD2 Mt0 construct. Sequence alignment of A3BCD2 and A3A shows the difference around the loop-1 region (see Supplementary Figure S4 for a full alignment). The 15-amino-acid sequence in the loop-1 region of A3A was inserted into the corresponding region in A3BCD2 to make A3BCD2 Mt0. ( C ) Gel image showing the mC deamination activity by A3BCD2 Mt0. A3BCD2 Mt0 at various concentrations was incubated with 600 nM 30 nt ssDNA substrate at 37°C for 2 h. ( D ) Quantification of the mC deamination by A3BCD2 WT and Mt0, showing significantly increased activity on mC by Mt0 mutant.
    Figure Legend Snippet: An engineered A3BCD2 mutant with much higher mC deamination activity ( A ) Gel image showing the mC deamination activity by A3BCD2 WT construct. A3BCD2 at various concentrations was incubated with 600 nM 30 nt ssDNA substrate containing mC at 37°C for 2 h. ( B ) Design of A3BCD2 Mt0 construct. Sequence alignment of A3BCD2 and A3A shows the difference around the loop-1 region (see Supplementary Figure S4 for a full alignment). The 15-amino-acid sequence in the loop-1 region of A3A was inserted into the corresponding region in A3BCD2 to make A3BCD2 Mt0. ( C ) Gel image showing the mC deamination activity by A3BCD2 Mt0. A3BCD2 Mt0 at various concentrations was incubated with 600 nM 30 nt ssDNA substrate at 37°C for 2 h. ( D ) Quantification of the mC deamination by A3BCD2 WT and Mt0, showing significantly increased activity on mC by Mt0 mutant.

    Techniques Used: Mutagenesis, Activity Assay, Construct, Incubation, Sequencing

    Superimposition of the known APOBEC structures around the Zn active site A3A (green, PDB: 2M65), A3C (red, PDB: 3VOW), A3FCD2 (purple, PDB: 4J4J and 4IOU), A3GCD2 (yellow, PDB: 3IQS and 3IR2), A3BCD2 (pink, modelled structure). ( A ) A view of the superimposition of loop-1, loop-3 and loop-7 around the Zn active site. The conserved Tyr 130 in A3A can adopt a conformation different from its equivalent tyrosine residues in other APOBECs (in sticks), which is probably permitted by the different loop-1 conformation in A3A (green). The loop-1 conformations in other APOBECs should prevent their tyrosine residues to assume the conformation of Tyr 130 in A3A. ( B ) A closer view of the active site for the non-A3A APOBECs, showing the conserved tyrosine residue as a partial ‘lid’ on the edge of the mC at the active site pocket. ( C ) A closer view of the active site for A3A and the modelled A3BCD2, showing the different conformation for loop-1, and for the conserved tyrosine residue (Tyr 130 for A3A, Tyr 313 for A3BCD2) next to the mC at the active site. Tyr 313 of A3BCD2 is closer to the mC, causing some clashes with the methyl group.
    Figure Legend Snippet: Superimposition of the known APOBEC structures around the Zn active site A3A (green, PDB: 2M65), A3C (red, PDB: 3VOW), A3FCD2 (purple, PDB: 4J4J and 4IOU), A3GCD2 (yellow, PDB: 3IQS and 3IR2), A3BCD2 (pink, modelled structure). ( A ) A view of the superimposition of loop-1, loop-3 and loop-7 around the Zn active site. The conserved Tyr 130 in A3A can adopt a conformation different from its equivalent tyrosine residues in other APOBECs (in sticks), which is probably permitted by the different loop-1 conformation in A3A (green). The loop-1 conformations in other APOBECs should prevent their tyrosine residues to assume the conformation of Tyr 130 in A3A. ( B ) A closer view of the active site for the non-A3A APOBECs, showing the conserved tyrosine residue as a partial ‘lid’ on the edge of the mC at the active site pocket. ( C ) A closer view of the active site for A3A and the modelled A3BCD2, showing the different conformation for loop-1, and for the conserved tyrosine residue (Tyr 130 for A3A, Tyr 313 for A3BCD2) next to the mC at the active site. Tyr 313 of A3BCD2 is closer to the mC, causing some clashes with the methyl group.

    Techniques Used:

    The flexibility of loop-1 conformation in A3BCD2 Mt0 affects mC deamination activity Error bars represent S.D. from the mean for three independent experiments. ( A ) Structure of A3A loop-1 and Tyr 130 on loop-7 around the Zn active site. Residues–G 25 I 26 G 27 –and–H 29 K 30 –on loop-1 are drawn as sticks. The mC modelled into the active site is shown as dots. In the NMR structure of A3A (PDB: 2M65), Tyr 130 is close to–GIG–. ( B ) Design of four mutants on loop-1 of A3BCD2 Mt0. ( C ) Gel image showing the mC deamination activity of the mutants. Each protein (0.5 μM and 2 μM) was incubated with 600 nM 30 nt ssDNA substrates at 37°C for 2 h. ( D ) Quantification of the mC deamination activity at a protein concentration of 2 μM. ( E ) Gel image showing the C deamination activity of the mutants. Each protein (0.5 μM and 2 μM) was incubated with 600 nM 30 nt ssDNA substrates at 37°C for 2 h. ( F ) Quantification of the C deamination activity at a protein concentration of 2 μM.
    Figure Legend Snippet: The flexibility of loop-1 conformation in A3BCD2 Mt0 affects mC deamination activity Error bars represent S.D. from the mean for three independent experiments. ( A ) Structure of A3A loop-1 and Tyr 130 on loop-7 around the Zn active site. Residues–G 25 I 26 G 27 –and–H 29 K 30 –on loop-1 are drawn as sticks. The mC modelled into the active site is shown as dots. In the NMR structure of A3A (PDB: 2M65), Tyr 130 is close to–GIG–. ( B ) Design of four mutants on loop-1 of A3BCD2 Mt0. ( C ) Gel image showing the mC deamination activity of the mutants. Each protein (0.5 μM and 2 μM) was incubated with 600 nM 30 nt ssDNA substrates at 37°C for 2 h. ( D ) Quantification of the mC deamination activity at a protein concentration of 2 μM. ( E ) Gel image showing the C deamination activity of the mutants. Each protein (0.5 μM and 2 μM) was incubated with 600 nM 30 nt ssDNA substrates at 37°C for 2 h. ( F ) Quantification of the C deamination activity at a protein concentration of 2 μM.

    Techniques Used: Activity Assay, Nuclear Magnetic Resonance, Incubation, Protein Concentration

    39) Product Images from "DNA capture-probe based separation of double-stranded polymerase chain reaction amplification products in poly(dimethylsiloxane) microfluidic channels"

    Article Title: DNA capture-probe based separation of double-stranded polymerase chain reaction amplification products in poly(dimethylsiloxane) microfluidic channels

    Journal: Biomicrofluidics

    doi: 10.1063/1.4729131

    (a) fluorescent image (left) and fluorescent intensity distribution (right, the distance from the Y-junction to the cross-section is around 500 μm), respectively, of the hybridization of AMEL-CP and CSF1PO-CP immobilized onto the upper and lower inlet microchannels, with ss-tailed AMEL and CSF1PO amplification products labelled with Cy5 and FAM dyes, respectively. (b) fluorescent image (left) and fluorescent intensity distribution (right), respectively, of the hybridization of AMEL-CP and CSF1PO-CP immobilized onto the upper and lower inlet microchannels with AMEL and CSF1PO amplification products labelled with FAM and Cy5 dyes, respectively. Arrows indicate the direction at which the fluorescent signal intensity distribution was measured across.
    Figure Legend Snippet: (a) fluorescent image (left) and fluorescent intensity distribution (right, the distance from the Y-junction to the cross-section is around 500 μm), respectively, of the hybridization of AMEL-CP and CSF1PO-CP immobilized onto the upper and lower inlet microchannels, with ss-tailed AMEL and CSF1PO amplification products labelled with Cy5 and FAM dyes, respectively. (b) fluorescent image (left) and fluorescent intensity distribution (right), respectively, of the hybridization of AMEL-CP and CSF1PO-CP immobilized onto the upper and lower inlet microchannels with AMEL and CSF1PO amplification products labelled with FAM and Cy5 dyes, respectively. Arrows indicate the direction at which the fluorescent signal intensity distribution was measured across.

    Techniques Used: Hybridization, Amplification

    (a1)-(a3) and (b1-b3) refer to the upper and lower microchannels, respectively, within a single microfluidic devices were (a1)–(a3) show the fluorescent images (left) and fluorescent intensity distributions (the distance from the Y-junction to the cross-section is around 500 μm) across the channels (right) of AMEL-CP immobilized onto the upper inlet microchannel, after hybridization (a1) with complementary ss-tailed AMEL amplification products labelled with Cy5 dye, after denaturation (a2) and after rehybridization with the same amplification product. (a3). (b1)–(b3) show the fluorescent images and fluorescent intensity distributions across the channels (right) of CSF1PO-CP immobilized onto the lower inlet microchannel, after hybridization with complementary ss-tailed CSF1PO amplification products labelled with Cy5 dye (b1), after denaturation (b2) and hybridization with non-complementary ss-tailed AMEL amplification products labelled with Cy5 dye (b3). Arrows indicate the direction at which the fluorescent signal intensity distribution was measured across.
    Figure Legend Snippet: (a1)-(a3) and (b1-b3) refer to the upper and lower microchannels, respectively, within a single microfluidic devices were (a1)–(a3) show the fluorescent images (left) and fluorescent intensity distributions (the distance from the Y-junction to the cross-section is around 500 μm) across the channels (right) of AMEL-CP immobilized onto the upper inlet microchannel, after hybridization (a1) with complementary ss-tailed AMEL amplification products labelled with Cy5 dye, after denaturation (a2) and after rehybridization with the same amplification product. (a3). (b1)–(b3) show the fluorescent images and fluorescent intensity distributions across the channels (right) of CSF1PO-CP immobilized onto the lower inlet microchannel, after hybridization with complementary ss-tailed CSF1PO amplification products labelled with Cy5 dye (b1), after denaturation (b2) and hybridization with non-complementary ss-tailed AMEL amplification products labelled with Cy5 dye (b3). Arrows indicate the direction at which the fluorescent signal intensity distribution was measured across.

    Techniques Used: Hybridization, Amplification

    40) Product Images from "mRNA Deadenylation Is Coupled to Translation Rates by the Differential Activities of Ccr4-Not Nucleases"

    Article Title: mRNA Deadenylation Is Coupled to Translation Rates by the Differential Activities of Ccr4-Not Nucleases

    Journal: Molecular Cell

    doi: 10.1016/j.molcel.2018.05.033

    Ccr4-Not Releases Pab1 from Short Poly(A) Tails (A) Fluorescence polarization assay showing interaction of Pab1 with 5′ 6-FAM-labeled A22, 10-mer-A12, and A12 RNAs. Error bars are standard error (n = 3 for A12; n = 5 for A22 and 10-mer-A12). K D s are represented as the mean ± standard error. (B) Deadenylation of A30 and 23-mer-A30 RNAs by Ccr4-Not analyzed by both denaturing PAGE (upper gels) and native PAGE (lower gels). Samples were collected from the same reaction at the indicated time points after addition of Ccr4-Not to allow a direct comparison between RNA product sizes and Pab1 binding, respectively. Pab1-bound substrate was prepared with one Pab1 molecule per RNA. Upper right panel is reproduced from Figure 1 C for comparison. (C) Representative SwitchSENSE sensograms showing the dissociation of Pab1 from the indicated RNA sequences. Rate constants and half-lives for dissociation with standard error are shown for measurements performed in triplicate. See also Figures S4–S6 .
    Figure Legend Snippet: Ccr4-Not Releases Pab1 from Short Poly(A) Tails (A) Fluorescence polarization assay showing interaction of Pab1 with 5′ 6-FAM-labeled A22, 10-mer-A12, and A12 RNAs. Error bars are standard error (n = 3 for A12; n = 5 for A22 and 10-mer-A12). K D s are represented as the mean ± standard error. (B) Deadenylation of A30 and 23-mer-A30 RNAs by Ccr4-Not analyzed by both denaturing PAGE (upper gels) and native PAGE (lower gels). Samples were collected from the same reaction at the indicated time points after addition of Ccr4-Not to allow a direct comparison between RNA product sizes and Pab1 binding, respectively. Pab1-bound substrate was prepared with one Pab1 molecule per RNA. Upper right panel is reproduced from Figure 1 C for comparison. (C) Representative SwitchSENSE sensograms showing the dissociation of Pab1 from the indicated RNA sequences. Rate constants and half-lives for dissociation with standard error are shown for measurements performed in triplicate. See also Figures S4–S6 .

    Techniques Used: Fluorescence, Labeling, Polyacrylamide Gel Electrophoresis, Clear Native PAGE, Binding Assay

    Related Articles

    High Performance Liquid Chromatography:

    Article Title: A gating mechanism for Pi release governs the mRNA unwinding by eIF4AI during translation initiation
    Article Snippet: .. Helicase assay Fluorescent reporter and loading RNA oligonucleotides were chemically synthesized, modified and HPLC-purified by Integrated DNA Technologies (IDT). .. The reporter strand was modified with cyanine 3 (Cy3) on its 5′-end, and the loading strand was modified with a spectrally paired black hole quencher (BHQ) on its 3′-end.

    Helicase Assay:

    Article Title: A gating mechanism for Pi release governs the mRNA unwinding by eIF4AI during translation initiation
    Article Snippet: .. Helicase assay Fluorescent reporter and loading RNA oligonucleotides were chemically synthesized, modified and HPLC-purified by Integrated DNA Technologies (IDT). .. The reporter strand was modified with cyanine 3 (Cy3) on its 5′-end, and the loading strand was modified with a spectrally paired black hole quencher (BHQ) on its 3′-end.

    Modification:

    Article Title: A gating mechanism for Pi release governs the mRNA unwinding by eIF4AI during translation initiation
    Article Snippet: .. Helicase assay Fluorescent reporter and loading RNA oligonucleotides were chemically synthesized, modified and HPLC-purified by Integrated DNA Technologies (IDT). .. The reporter strand was modified with cyanine 3 (Cy3) on its 5′-end, and the loading strand was modified with a spectrally paired black hole quencher (BHQ) on its 3′-end.

    Synthesized:

    Article Title: Proximal disruptor aided ligation (ProDAL) of kilobase-long RNAs
    Article Snippet: .. All DNA and RNA oligonucleotides were synthesized by Integrated DNA Technologies. .. Oligonucleotides used for ProDAL of kb-long RNAs are listed in Supplementary Table 1.

    Article Title: A gating mechanism for Pi release governs the mRNA unwinding by eIF4AI during translation initiation
    Article Snippet: .. Helicase assay Fluorescent reporter and loading RNA oligonucleotides were chemically synthesized, modified and HPLC-purified by Integrated DNA Technologies (IDT). .. The reporter strand was modified with cyanine 3 (Cy3) on its 5′-end, and the loading strand was modified with a spectrally paired black hole quencher (BHQ) on its 3′-end.

    Construct:

    Article Title: A Suite of Therapeutically-Inspired Nucleic Acid Logic Systems for Conditional Generation of Single-Stranded and Double-Stranded Oligonucleotides
    Article Snippet: .. Oligonucleotide Synthesis and Purification The DNA and RNA oligonucleotides used to assemble the conditional RNA/DNA constructs, including those that were fluorescently labeled, were purchased from Integrated DNA Technologies (IDT, Coralville, IA, USA) and reconstituted in nuclease-free water (Quality Biological, Gaithersburg, MD, USA) for use. .. All AlexaFluor546, AlexaFluor488 and 6-carboxyfluorescein (6-FAM) fluorescently labeled oligonucleotides were purchased from IDT.

    Purification:

    Article Title: A Suite of Therapeutically-Inspired Nucleic Acid Logic Systems for Conditional Generation of Single-Stranded and Double-Stranded Oligonucleotides
    Article Snippet: .. Oligonucleotide Synthesis and Purification The DNA and RNA oligonucleotides used to assemble the conditional RNA/DNA constructs, including those that were fluorescently labeled, were purchased from Integrated DNA Technologies (IDT, Coralville, IA, USA) and reconstituted in nuclease-free water (Quality Biological, Gaithersburg, MD, USA) for use. .. All AlexaFluor546, AlexaFluor488 and 6-carboxyfluorescein (6-FAM) fluorescently labeled oligonucleotides were purchased from IDT.

    Article Title: Chromosome fusions triggered by noncoding RNA
    Article Snippet: .. Microinjection of synthetic oligonucleotides 27 nt DNA and RNA oligonucleotides were purchased from IDT DNA with standard desalting and used without further purification. .. Prior to each injection, 3μL of an oligonucleotide in nuclease free water (Ambion) (15μg /μL ) was heated at 65 °C for 2 min, and chilled on ice for at least 2 min, then injected (Narishige IM 300) into the cytoplasm of mating cells 10–15 hours post mixing of mating types.

    Oligonucleotide Synthesis:

    Article Title: A Suite of Therapeutically-Inspired Nucleic Acid Logic Systems for Conditional Generation of Single-Stranded and Double-Stranded Oligonucleotides
    Article Snippet: .. Oligonucleotide Synthesis and Purification The DNA and RNA oligonucleotides used to assemble the conditional RNA/DNA constructs, including those that were fluorescently labeled, were purchased from Integrated DNA Technologies (IDT, Coralville, IA, USA) and reconstituted in nuclease-free water (Quality Biological, Gaithersburg, MD, USA) for use. .. All AlexaFluor546, AlexaFluor488 and 6-carboxyfluorescein (6-FAM) fluorescently labeled oligonucleotides were purchased from IDT.

    Activity Assay:

    Article Title: Bioinspired Fabrication of DNA–Inorganic Hybrid Composites Using Synthetic DNA
    Article Snippet: .. RNase Activity Test The ribonucleotic activity of RNase A was evaluated using a synthetic RNA oligonucleotide, which has a fluorescein dye and quencher at both ends (RNase Alert substrate, Integrated DNA Technology). .. Before testing, the protein concentration of each sample was measured by Qubit protein reagent (Thermo Fisher Scientific), based on the standard curve using free RNase A with known concentrations (0, 200, and 400 ng μL–1 ).

    Labeling:

    Article Title: Crystal Structure of Human Nocturnin Catalytic Domain
    Article Snippet: .. Preparation of labeled oligonucleotides RNA oligonucleotides were purchased from Integrated DNA Technologies. .. 2 pmol of nucleic acid were 5′ radiolabeled with T4 polynucleotide kinase (New England BioLabs) and γ−32P ATP (Perkin Elmer) in 1 × T4 polynucleotide kinase buffer for 30 min at 37 °C.

    Article Title: A Suite of Therapeutically-Inspired Nucleic Acid Logic Systems for Conditional Generation of Single-Stranded and Double-Stranded Oligonucleotides
    Article Snippet: .. Oligonucleotide Synthesis and Purification The DNA and RNA oligonucleotides used to assemble the conditional RNA/DNA constructs, including those that were fluorescently labeled, were purchased from Integrated DNA Technologies (IDT, Coralville, IA, USA) and reconstituted in nuclease-free water (Quality Biological, Gaithersburg, MD, USA) for use. .. All AlexaFluor546, AlexaFluor488 and 6-carboxyfluorescein (6-FAM) fluorescently labeled oligonucleotides were purchased from IDT.

    Concentration Assay:

    Article Title: Biomolecular condensates amplify mRNA decapping by coupling protein interactions with conformational changes in Dcp1/Dcp2
    Article Snippet: .. 5’-phosphorylated oligo 30U RNA with 3’ 6-FAM was ordered from Integrated DNA Technologies and used at a final concentration of 5 nM. .. Reactions were performed in triplicate and incubated for ten minutes before measuring polarization on a LJL Biosystems Analyst AD plate reader.

    Binding Assay:

    Article Title: Identification of motifs that function in the splicing of non-canonical introns
    Article Snippet: .. U2AF65 binding RNA oligonucleotides (listed in Figure , IDT, Integrated DNA Technologies, San Diego, CA, USA) for U2AF65 binding assays were 5' end-labeled with γ-32 P ATP using T4 polynucleotide kinase (NEB, Ipswich, MA, USA) for 30 minutes at 37°C. .. The RNAs were then gel purified using an 8% denaturing gel, eluted from the gel in 0.3M Na acetate and ethanol precipitated.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Integrated DNA Technologies 6 fam fluorophore label
    Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ <t>6-FAM-labeled</t> (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).
    6 Fam Fluorophore Label, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam fluorophore label/product/Integrated DNA Technologies
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    6 fam fluorophore label - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    92
    Integrated DNA Technologies 6 fam label
    Oligomerization and substrate binding assays of hCtc1. ( A ) The oligomeric state of hCtc1(OB) was analyzed by SEC-MALS. The blue line corresponds to the Refractive Index (RI) of the hCtc1(OB) eluting from the SEC column. The red circles correspond to the molecular mass of hCtc1(OB) measured by multi-angle, light scattering (MALS: red). The data suggest that hCtc1(OB) is monomeric in solution. ( B ) Cross linking experiments of WT hCtc1(OB) using formaldehyde or glutaraldehyde also shows that this domain hCtc1 is monomeric in solution. ( C ) FP assays of hCtc1(OB) with 5′ <t>6-FAM</t> (Fluorescein) labeled, single-stranded telomeric DNA (two or three repeats) shows that this domain of hCtc1 is not involved in DNA binding. ( D ) ITC assay of hCtc1(OB) with the full length Stn1–Ten1 complex show no measurable interaction.
    6 Fam Label, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam label/product/Integrated DNA Technologies
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    6 fam label - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    92
    Integrated DNA Technologies 6 carboxyfluorescein
    An RNA/DNA cognate pair system was designed to undergo conditional strand exchange by hybridizing to neighboring sites on an RNA trigger. ( A ) “Traditional” RNA/DNA hybrid pairs act as an 2-input AND gate. Hybridization between the single stranded toeholds of a sense hybrid ( sH ) and antisense hybrid ( aH ) initiates a thermodynamically driven strand exchange that generates a dsRNA duplex and DNA waste byproduct. ( B ) The “adjacent targeting” RNA/DNA hybrid system functions as a 3-input AND gate, requiring a hybrid pair as well as a specific RNA trigger sequence. The hybrid pair’s respective toeholds bind to regions of the trigger that are immediately upstream and downstream from one another. Anchoring the cognate hybrids in close proximity leads to initiation of the thermodynamically favorable strand exchange reaction and dsRNA release. ( C ) Five different cognate pairs of adjacent targeting hybrids were analyzed by 12% acrylamide non-denaturing PAGE for their ability to release a DsiRNA product. Each sense hybrid and the DsiRNA control assembly contained a 3′ <t>6-carboxyfluorescein</t> (6-FAM) labeled sense RNA strand for visualization. The pairs of constructs differ in the number of DNA nucleotides inserted between the single-strand toehold and the RNA/DNA hybrid duplex. These inserted nucleotides were complementary between cognate hybrids, resulting in either 0, +1, +2, +3 or +4 DNA bp that can seed the strand exchange (colored orange). The presence or absence of each component is indicated above each lane. The samples in the gel depicted were all incubated for 180 min at 37 °C. ( D ) Analysis of the fraction of dsRNA released by hybrid pairs in the presence and absence of the RNA trigger following 30, 90 or 180 min incubations at 37 °C. Error bars indicate standard deviation of three replicate experiments. Indication of statistical significance between samples is reported in the supporting information.
    6 Carboxyfluorescein, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 92/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 carboxyfluorescein/product/Integrated DNA Technologies
    Average 92 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    6 carboxyfluorescein - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    Image Search Results


    Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).

    Journal: Nature structural & molecular biology

    Article Title: The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases

    doi: 10.1038/s41594-019-0227-9

    Figure Lengend Snippet: Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).

    Article Snippet: 20mer-A30 (20mer: CAGCUCCGCAUCCCUUUCCC) with varied 3′ ends and intervening nucleotides were synthesized with a 5′ 6-FAM fluorophore label (Integrated DNA Technologies or, for 20mer-A14 DDA14 , Dharmacon).

    Techniques: Recombinant, Labeling, Sequencing, Standard Deviation

    Nucleotide base stacking is required for Pan2 and Caf1 deadenylase activity. Denaturing RNA gels showing deadenylation by ( a-d ) S. cerevisiae Pan2 UCH-Exo or ( e-h ) S. pombe Ccr4-inactive Ccr4–Not on 5′ 6-FAM-labeled (green star) RNAs consisting of a 20mer non-poly(A) sequence (see Fig. 1a ) followed by the indicated tail sequence. RNAs either had no additional nucleotides ( a , e ), two guanosines ( b , f ), two uracils ( c, g ), or two dihydrouracils (abbreviated D, panels d , h ) in the middle of the poly(A) tail. Red asterisks indicate the point of inhibition. Both Pan2 and Caf1 were strongly inhibited by guanosines and dihydrouracils interrupting a poly(A) tail. These gels are representative of identical experiments performed 2 times. Uncropped gel images are shown in Supplementary Data Set 1.

    Journal: Nature structural & molecular biology

    Article Title: The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases

    doi: 10.1038/s41594-019-0227-9

    Figure Lengend Snippet: Nucleotide base stacking is required for Pan2 and Caf1 deadenylase activity. Denaturing RNA gels showing deadenylation by ( a-d ) S. cerevisiae Pan2 UCH-Exo or ( e-h ) S. pombe Ccr4-inactive Ccr4–Not on 5′ 6-FAM-labeled (green star) RNAs consisting of a 20mer non-poly(A) sequence (see Fig. 1a ) followed by the indicated tail sequence. RNAs either had no additional nucleotides ( a , e ), two guanosines ( b , f ), two uracils ( c, g ), or two dihydrouracils (abbreviated D, panels d , h ) in the middle of the poly(A) tail. Red asterisks indicate the point of inhibition. Both Pan2 and Caf1 were strongly inhibited by guanosines and dihydrouracils interrupting a poly(A) tail. These gels are representative of identical experiments performed 2 times. Uncropped gel images are shown in Supplementary Data Set 1.

    Article Snippet: 20mer-A30 (20mer: CAGCUCCGCAUCCCUUUCCC) with varied 3′ ends and intervening nucleotides were synthesized with a 5′ 6-FAM fluorophore label (Integrated DNA Technologies or, for 20mer-A14 DDA14 , Dharmacon).

    Techniques: Activity Assay, Labeling, Sequencing, Inhibition

    3′ guanosines inhibit the Pan2 exonuclease. a, Denaturing RNA gels showing deadenylation by recombinant S. cerevisiae Pan2–Pan3 on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (shown above) followed by a poly(A) tail of 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-e, Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for full-length S. cerevisiae Pan2–Pan3 ( b, e ); H. sapiens PAN2–PAN3∆N278 ( c ); and S. cerevisiae Pan2 UCH-Exo (residues 461-1115) ( d ).

    Journal: Nature structural & molecular biology

    Article Title: The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases

    doi: 10.1038/s41594-019-0227-9

    Figure Lengend Snippet: 3′ guanosines inhibit the Pan2 exonuclease. a, Denaturing RNA gels showing deadenylation by recombinant S. cerevisiae Pan2–Pan3 on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (shown above) followed by a poly(A) tail of 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-e, Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for full-length S. cerevisiae Pan2–Pan3 ( b, e ); H. sapiens PAN2–PAN3∆N278 ( c ); and S. cerevisiae Pan2 UCH-Exo (residues 461-1115) ( d ).

    Article Snippet: 20mer-A30 (20mer: CAGCUCCGCAUCCCUUUCCC) with varied 3′ ends and intervening nucleotides were synthesized with a 5′ 6-FAM fluorophore label (Integrated DNA Technologies or, for 20mer-A14 DDA14 , Dharmacon).

    Techniques: Recombinant, Labeling, Sequencing, Standard Deviation

    Oligomerization and substrate binding assays of hCtc1. ( A ) The oligomeric state of hCtc1(OB) was analyzed by SEC-MALS. The blue line corresponds to the Refractive Index (RI) of the hCtc1(OB) eluting from the SEC column. The red circles correspond to the molecular mass of hCtc1(OB) measured by multi-angle, light scattering (MALS: red). The data suggest that hCtc1(OB) is monomeric in solution. ( B ) Cross linking experiments of WT hCtc1(OB) using formaldehyde or glutaraldehyde also shows that this domain hCtc1 is monomeric in solution. ( C ) FP assays of hCtc1(OB) with 5′ 6-FAM (Fluorescein) labeled, single-stranded telomeric DNA (two or three repeats) shows that this domain of hCtc1 is not involved in DNA binding. ( D ) ITC assay of hCtc1(OB) with the full length Stn1–Ten1 complex show no measurable interaction.

    Journal: Nucleic Acids Research

    Article Title: Structural and functional analysis of an OB-fold in human Ctc1 implicated in telomere maintenance and bone marrow syndromes

    doi: 10.1093/nar/gkx1213

    Figure Lengend Snippet: Oligomerization and substrate binding assays of hCtc1. ( A ) The oligomeric state of hCtc1(OB) was analyzed by SEC-MALS. The blue line corresponds to the Refractive Index (RI) of the hCtc1(OB) eluting from the SEC column. The red circles correspond to the molecular mass of hCtc1(OB) measured by multi-angle, light scattering (MALS: red). The data suggest that hCtc1(OB) is monomeric in solution. ( B ) Cross linking experiments of WT hCtc1(OB) using formaldehyde or glutaraldehyde also shows that this domain hCtc1 is monomeric in solution. ( C ) FP assays of hCtc1(OB) with 5′ 6-FAM (Fluorescein) labeled, single-stranded telomeric DNA (two or three repeats) shows that this domain of hCtc1 is not involved in DNA binding. ( D ) ITC assay of hCtc1(OB) with the full length Stn1–Ten1 complex show no measurable interaction.

    Article Snippet: The 12mer DNA probe (TTAGGGTTAGGG) and 18mer DNA probe (TTAGGGTTAGGGTTAGGG) was purchased with a 5′ 6-FAM label from Integrated DNA Technologies.

    Techniques: Binding Assay, Size-exclusion Chromatography, Labeling, Isothermal Titration Calorimetry

    Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).

    Journal: Nature structural & molecular biology

    Article Title: The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases

    doi: 10.1038/s41594-019-0227-9

    Figure Lengend Snippet: Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).

    Article Snippet: For two-color deadenylation assays, 20mer-A30 was synthesized with a 5′ Alexa Fluor-647 fluorescent label and 20mer-A14 GA15 was synthesized with a 5′ 6-FAM label (Integrated DNA Technologies).

    Techniques: Recombinant, Labeling, Sequencing, Standard Deviation

    Nucleotide base stacking is required for Pan2 and Caf1 deadenylase activity. Denaturing RNA gels showing deadenylation by ( a-d ) S. cerevisiae Pan2 UCH-Exo or ( e-h ) S. pombe Ccr4-inactive Ccr4–Not on 5′ 6-FAM-labeled (green star) RNAs consisting of a 20mer non-poly(A) sequence (see Fig. 1a ) followed by the indicated tail sequence. RNAs either had no additional nucleotides ( a , e ), two guanosines ( b , f ), two uracils ( c, g ), or two dihydrouracils (abbreviated D, panels d , h ) in the middle of the poly(A) tail. Red asterisks indicate the point of inhibition. Both Pan2 and Caf1 were strongly inhibited by guanosines and dihydrouracils interrupting a poly(A) tail. These gels are representative of identical experiments performed 2 times. Uncropped gel images are shown in Supplementary Data Set 1.

    Journal: Nature structural & molecular biology

    Article Title: The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases

    doi: 10.1038/s41594-019-0227-9

    Figure Lengend Snippet: Nucleotide base stacking is required for Pan2 and Caf1 deadenylase activity. Denaturing RNA gels showing deadenylation by ( a-d ) S. cerevisiae Pan2 UCH-Exo or ( e-h ) S. pombe Ccr4-inactive Ccr4–Not on 5′ 6-FAM-labeled (green star) RNAs consisting of a 20mer non-poly(A) sequence (see Fig. 1a ) followed by the indicated tail sequence. RNAs either had no additional nucleotides ( a , e ), two guanosines ( b , f ), two uracils ( c, g ), or two dihydrouracils (abbreviated D, panels d , h ) in the middle of the poly(A) tail. Red asterisks indicate the point of inhibition. Both Pan2 and Caf1 were strongly inhibited by guanosines and dihydrouracils interrupting a poly(A) tail. These gels are representative of identical experiments performed 2 times. Uncropped gel images are shown in Supplementary Data Set 1.

    Article Snippet: For two-color deadenylation assays, 20mer-A30 was synthesized with a 5′ Alexa Fluor-647 fluorescent label and 20mer-A14 GA15 was synthesized with a 5′ 6-FAM label (Integrated DNA Technologies).

    Techniques: Activity Assay, Labeling, Sequencing, Inhibition

    3′ guanosines inhibit the Pan2 exonuclease. a, Denaturing RNA gels showing deadenylation by recombinant S. cerevisiae Pan2–Pan3 on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (shown above) followed by a poly(A) tail of 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-e, Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for full-length S. cerevisiae Pan2–Pan3 ( b, e ); H. sapiens PAN2–PAN3∆N278 ( c ); and S. cerevisiae Pan2 UCH-Exo (residues 461-1115) ( d ).

    Journal: Nature structural & molecular biology

    Article Title: The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases

    doi: 10.1038/s41594-019-0227-9

    Figure Lengend Snippet: 3′ guanosines inhibit the Pan2 exonuclease. a, Denaturing RNA gels showing deadenylation by recombinant S. cerevisiae Pan2–Pan3 on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (shown above) followed by a poly(A) tail of 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-e, Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for full-length S. cerevisiae Pan2–Pan3 ( b, e ); H. sapiens PAN2–PAN3∆N278 ( c ); and S. cerevisiae Pan2 UCH-Exo (residues 461-1115) ( d ).

    Article Snippet: For two-color deadenylation assays, 20mer-A30 was synthesized with a 5′ Alexa Fluor-647 fluorescent label and 20mer-A14 GA15 was synthesized with a 5′ 6-FAM label (Integrated DNA Technologies).

    Techniques: Recombinant, Labeling, Sequencing, Standard Deviation

    An RNA/DNA cognate pair system was designed to undergo conditional strand exchange by hybridizing to neighboring sites on an RNA trigger. ( A ) “Traditional” RNA/DNA hybrid pairs act as an 2-input AND gate. Hybridization between the single stranded toeholds of a sense hybrid ( sH ) and antisense hybrid ( aH ) initiates a thermodynamically driven strand exchange that generates a dsRNA duplex and DNA waste byproduct. ( B ) The “adjacent targeting” RNA/DNA hybrid system functions as a 3-input AND gate, requiring a hybrid pair as well as a specific RNA trigger sequence. The hybrid pair’s respective toeholds bind to regions of the trigger that are immediately upstream and downstream from one another. Anchoring the cognate hybrids in close proximity leads to initiation of the thermodynamically favorable strand exchange reaction and dsRNA release. ( C ) Five different cognate pairs of adjacent targeting hybrids were analyzed by 12% acrylamide non-denaturing PAGE for their ability to release a DsiRNA product. Each sense hybrid and the DsiRNA control assembly contained a 3′ 6-carboxyfluorescein (6-FAM) labeled sense RNA strand for visualization. The pairs of constructs differ in the number of DNA nucleotides inserted between the single-strand toehold and the RNA/DNA hybrid duplex. These inserted nucleotides were complementary between cognate hybrids, resulting in either 0, +1, +2, +3 or +4 DNA bp that can seed the strand exchange (colored orange). The presence or absence of each component is indicated above each lane. The samples in the gel depicted were all incubated for 180 min at 37 °C. ( D ) Analysis of the fraction of dsRNA released by hybrid pairs in the presence and absence of the RNA trigger following 30, 90 or 180 min incubations at 37 °C. Error bars indicate standard deviation of three replicate experiments. Indication of statistical significance between samples is reported in the supporting information.

    Journal: Nanomaterials

    Article Title: A Suite of Therapeutically-Inspired Nucleic Acid Logic Systems for Conditional Generation of Single-Stranded and Double-Stranded Oligonucleotides

    doi: 10.3390/nano9040615

    Figure Lengend Snippet: An RNA/DNA cognate pair system was designed to undergo conditional strand exchange by hybridizing to neighboring sites on an RNA trigger. ( A ) “Traditional” RNA/DNA hybrid pairs act as an 2-input AND gate. Hybridization between the single stranded toeholds of a sense hybrid ( sH ) and antisense hybrid ( aH ) initiates a thermodynamically driven strand exchange that generates a dsRNA duplex and DNA waste byproduct. ( B ) The “adjacent targeting” RNA/DNA hybrid system functions as a 3-input AND gate, requiring a hybrid pair as well as a specific RNA trigger sequence. The hybrid pair’s respective toeholds bind to regions of the trigger that are immediately upstream and downstream from one another. Anchoring the cognate hybrids in close proximity leads to initiation of the thermodynamically favorable strand exchange reaction and dsRNA release. ( C ) Five different cognate pairs of adjacent targeting hybrids were analyzed by 12% acrylamide non-denaturing PAGE for their ability to release a DsiRNA product. Each sense hybrid and the DsiRNA control assembly contained a 3′ 6-carboxyfluorescein (6-FAM) labeled sense RNA strand for visualization. The pairs of constructs differ in the number of DNA nucleotides inserted between the single-strand toehold and the RNA/DNA hybrid duplex. These inserted nucleotides were complementary between cognate hybrids, resulting in either 0, +1, +2, +3 or +4 DNA bp that can seed the strand exchange (colored orange). The presence or absence of each component is indicated above each lane. The samples in the gel depicted were all incubated for 180 min at 37 °C. ( D ) Analysis of the fraction of dsRNA released by hybrid pairs in the presence and absence of the RNA trigger following 30, 90 or 180 min incubations at 37 °C. Error bars indicate standard deviation of three replicate experiments. Indication of statistical significance between samples is reported in the supporting information.

    Article Snippet: All AlexaFluor546, AlexaFluor488 and 6-carboxyfluorescein (6-FAM) fluorescently labeled oligonucleotides were purchased from IDT.

    Techniques: Activated Clotting Time Assay, Hybridization, Sequencing, Polyacrylamide Gel Electrophoresis, Labeling, Construct, Incubation, Standard Deviation

    Effects of DNA structural alteration on the degree of trigger-inducible dsRNA release. ( A ) Four different sense hybrids that are responsive to the connective tissue growth factor (CTGF) trigger were designed, each having different features within the structured DNA hairpin. The hairpins differed in the size of their loop or the length of their stem. Two different cognate antisense hybrids were designed and differ in the length of their single-stranded toehold. Sequence regions are indicated by lowercase letters and different colors to convey sequence identity or sequence complementarity. ( B , D ) DsiRNA release in the presence and absence of trigger was assessed by 10% acrylamide non-denaturing PAGE for each sense hybrid paired with a cognate antisense hybrid exhibiting either ( B ) a 12 nt toehold ( aH ^CTGF-cgnt.12 ) or ( D ) a 16 nt toehold ( aH ^CTGF-cgnt.16 ). Each sense hybrid and the DsiRNA control contained a 3′ 6-carboxyfluorescein (6-FAM) labeled sense RNA strand for visualization and quantification. Gels in both ( B ) and ( D ) depict samples that were incubated for 30 min at 37 °C. ( C , E ) Analysis of the fraction of dsRNA released by the four sense hybrids paired with ( C ) aH ^CTGF-cgnt.12 or ( E ) aH ^CTGF-cgnt.16 , in the presence and absence of the RNA trigger following 30, 90, or 180 min incubations at 37 °C. Error bars indicate standard deviation of three replicate experiments. Indication of statistical significance between samples is reported in the supporting information.

    Journal: Nanomaterials

    Article Title: A Suite of Therapeutically-Inspired Nucleic Acid Logic Systems for Conditional Generation of Single-Stranded and Double-Stranded Oligonucleotides

    doi: 10.3390/nano9040615

    Figure Lengend Snippet: Effects of DNA structural alteration on the degree of trigger-inducible dsRNA release. ( A ) Four different sense hybrids that are responsive to the connective tissue growth factor (CTGF) trigger were designed, each having different features within the structured DNA hairpin. The hairpins differed in the size of their loop or the length of their stem. Two different cognate antisense hybrids were designed and differ in the length of their single-stranded toehold. Sequence regions are indicated by lowercase letters and different colors to convey sequence identity or sequence complementarity. ( B , D ) DsiRNA release in the presence and absence of trigger was assessed by 10% acrylamide non-denaturing PAGE for each sense hybrid paired with a cognate antisense hybrid exhibiting either ( B ) a 12 nt toehold ( aH ^CTGF-cgnt.12 ) or ( D ) a 16 nt toehold ( aH ^CTGF-cgnt.16 ). Each sense hybrid and the DsiRNA control contained a 3′ 6-carboxyfluorescein (6-FAM) labeled sense RNA strand for visualization and quantification. Gels in both ( B ) and ( D ) depict samples that were incubated for 30 min at 37 °C. ( C , E ) Analysis of the fraction of dsRNA released by the four sense hybrids paired with ( C ) aH ^CTGF-cgnt.12 or ( E ) aH ^CTGF-cgnt.16 , in the presence and absence of the RNA trigger following 30, 90, or 180 min incubations at 37 °C. Error bars indicate standard deviation of three replicate experiments. Indication of statistical significance between samples is reported in the supporting information.

    Article Snippet: All AlexaFluor546, AlexaFluor488 and 6-carboxyfluorescein (6-FAM) fluorescently labeled oligonucleotides were purchased from IDT.

    Techniques: Sequencing, Polyacrylamide Gel Electrophoresis, Labeling, Incubation, Standard Deviation

    Incorporation of a structured responsive element can generate a trigger-inducible RNA/DNA hybrid system. ( A ) The inducible hybrid system functions as a three-input AND gate. The sense hybrid sH ^CTGF.12/8 contains a responsive DNA hairpin composed of a 12 bp stem and an 8 nt loop, and is flanked by an extended 5′ single strand that acts as a diagnostic toehold. Trigger hybridization to the diagnostic toehold progresses through the hairpin stem and unzips the hairpin (sequence regions colored blue). This liberates a previously sequestered toehold within sH ^CTGF.12/8 which can then hybridize with the complementary toehold of the cognate antisense hybrid, aH ^CTGF-cgnt.12 . Hybridization of these exchange toeholds (sequence regions colored orange) initiates strand exchange and releases a dsRNA product. ( B ) The function of this conditional system was assessed by 8% acrylamide non-denaturing PAGE and total staining with ethidium bromide. DsiRNA release is observed when the sense and antisense hybrids are co-incubated in the presence of trigger (red box). Formation of the expected waste product is observed by comparison to a control assembly of the s’ and a’ DNA strands with the trigger molecule. All samples were incubated for 30 min at 37 °C. ( C ) Förster resonance energy transfer (FRET) analysis was performed as another method to verify conditional dsRNA formation. sH ^CTGF.12/8 was assembled using a 3′ 6-carboxyfluorescein (6-FAM) (ex/em 495/520 nm) labeled sense RNA strand. aH ^CTGF-cgnt.12 was assembled using a 5′-AlexaFluor546 (ex/em 555/570 nm) labeled antisense RNA strand. The hybrids were mixed and incubated at 37 °C for one hour in the presence or absence of the RNA trigger. Fluorescence emission spectra were recorded at t = 0 and t = 60 min using excitation at 475 nm.

    Journal: Nanomaterials

    Article Title: A Suite of Therapeutically-Inspired Nucleic Acid Logic Systems for Conditional Generation of Single-Stranded and Double-Stranded Oligonucleotides

    doi: 10.3390/nano9040615

    Figure Lengend Snippet: Incorporation of a structured responsive element can generate a trigger-inducible RNA/DNA hybrid system. ( A ) The inducible hybrid system functions as a three-input AND gate. The sense hybrid sH ^CTGF.12/8 contains a responsive DNA hairpin composed of a 12 bp stem and an 8 nt loop, and is flanked by an extended 5′ single strand that acts as a diagnostic toehold. Trigger hybridization to the diagnostic toehold progresses through the hairpin stem and unzips the hairpin (sequence regions colored blue). This liberates a previously sequestered toehold within sH ^CTGF.12/8 which can then hybridize with the complementary toehold of the cognate antisense hybrid, aH ^CTGF-cgnt.12 . Hybridization of these exchange toeholds (sequence regions colored orange) initiates strand exchange and releases a dsRNA product. ( B ) The function of this conditional system was assessed by 8% acrylamide non-denaturing PAGE and total staining with ethidium bromide. DsiRNA release is observed when the sense and antisense hybrids are co-incubated in the presence of trigger (red box). Formation of the expected waste product is observed by comparison to a control assembly of the s’ and a’ DNA strands with the trigger molecule. All samples were incubated for 30 min at 37 °C. ( C ) Förster resonance energy transfer (FRET) analysis was performed as another method to verify conditional dsRNA formation. sH ^CTGF.12/8 was assembled using a 3′ 6-carboxyfluorescein (6-FAM) (ex/em 495/520 nm) labeled sense RNA strand. aH ^CTGF-cgnt.12 was assembled using a 5′-AlexaFluor546 (ex/em 555/570 nm) labeled antisense RNA strand. The hybrids were mixed and incubated at 37 °C for one hour in the presence or absence of the RNA trigger. Fluorescence emission spectra were recorded at t = 0 and t = 60 min using excitation at 475 nm.

    Article Snippet: All AlexaFluor546, AlexaFluor488 and 6-carboxyfluorescein (6-FAM) fluorescently labeled oligonucleotides were purchased from IDT.

    Techniques: Diagnostic Assay, Hybridization, Sequencing, Polyacrylamide Gel Electrophoresis, Staining, Incubation, Förster Resonance Energy Transfer, Labeling, Fluorescence