c1000 touch cfx96 real time system thermal cycler (Bio-Rad)
Structured Review
C1000 Touch Cfx96 Real Time System Thermal Cycler, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c1000 touch cfx96 real time system thermal cycler/product/Bio-Rad
Average 86 stars, based on 1 article reviews
Price from $9.99 to $1999.99
Images
Related Articles
Real-time Polymerase Chain Reaction:Article Title: Transfer of Functional Cargo in Exomeres Article Snippet: Quantitative RT-PCR SW948 cells were either not treated or treated with DiFi exosomes and harvested at the indicated times as described in “Treatment of recipient cells with exosomes.” Total RNA was isolated and purified with RNeasy Mini Kit (QIAGEN, Germantown, MD) with on-column DNase treatment according to the manufacturer’s instructions. cDNA synthesis was performed using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA). .. Quantitative real-time PCR was performed on Bio-Rad Article Title: Cytoplasmic Citrate Flux Modulates the Immune Stimulatory NKG2D Ligand MICA in Cancer Cells Article Snippet: Following primer sequences were used for quantitative RT-PCR with Brilliant SYBR Green qPCR Master Mix Kit: MICA (MICA_F: TGGCAGACATTCCATGTTTCTG, MICA_R: CTCGTCCCAACTGGGTGTTG), ULBP2 (ULBP 2_F: CAGAGCAACTGCGTGACATT, ULBP2_R: GGCCAC AACCTTGTCATTCT), IDH1 (IDH1_F: CTATGATGGTGA CGTGCAGTCG, IDH1_R: CCTCTGCTTCTACTGTCTTGCC), IDH2 (IDH2_F: AGATGGCAGTGGTGTCAAGGAG, IDH 2_R: CTGGATGGCATACTGGAAGCAG), GLUT1 (GLUT1_F: CTGCTCATCAACCGCAAC, GLUT1_R: CTTCTTCTCCCG CATCATCT), GLUT2 (GLUT2_F: TACATTGCGGACTTCTG TGG, GLUT2_R: AGACTTTCCTTTGGTTTCTGG), GLUT3 (GLUT3_F: CAGCGAGACCCAGAGATG, GLUT3_R: TTGG AAAGAGCCGATTGTAG), GLUT4 (GLUT4_F: TGGGCTT CTTCATCTTCACC, GLUT4_R: GTGCTGGGTTTCACCTC CT), and RPLP0 as housekeeping gene (RPLP0_F: CCTCGTGGAAGTGACATCGT, RPLP0_R: CATTCCCCC GGATATGAGGC). .. Real-time qPCR was performed on Bio-Rad Article Title: Local and Systemic IKKε and NF-κB Signaling Associated with Sjögren's Syndrome Immunopathogenesis Article Snippet: Total RNA was extracted. cDNA was prepared from 1 μ g of RNA using oligo(dT) primers, dNTP, and SuperScript II reverse transcriptase (Life Technologies, Grand Island, NY). .. The resulting cDNA was amplified by real-time PCR using a BioRad Article Title: Members of the methanotrophic genus Methylomarinum inhabit inland mud pots Article Snippet: .. Quantitative PCR was performed using the Power SYBR Universal mastermix (Thermo Fisher Scientific, Grand Island, NY, USA) and a Biorad SYBR Green Assay:Article Title: Transfer of Functional Cargo in Exomeres Article Snippet: Quantitative RT-PCR SW948 cells were either not treated or treated with DiFi exosomes and harvested at the indicated times as described in “Treatment of recipient cells with exosomes.” Total RNA was isolated and purified with RNeasy Mini Kit (QIAGEN, Germantown, MD) with on-column DNase treatment according to the manufacturer’s instructions. cDNA synthesis was performed using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA). .. Quantitative real-time PCR was performed on Bio-Rad Amplification:Article Title: Local and Systemic IKKε and NF-κB Signaling Associated with Sjögren's Syndrome Immunopathogenesis Article Snippet: Total RNA was extracted. cDNA was prepared from 1 μ g of RNA using oligo(dT) primers, dNTP, and SuperScript II reverse transcriptase (Life Technologies, Grand Island, NY). .. The resulting cDNA was amplified by real-time PCR using a BioRad Quantitative RT-PCR:Article Title: Characterization of Dedifferentiating Human Mature Adipocytes from the Visceral and Subcutaneous Fat Compartments: Fibroblast-Activation Protein Alpha and Dipeptidyl Peptidase 4 as Major Components of Matrix Remodeling Article Snippet: The following sequences were used for quantitative PCR (forward/reverse): ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit (ATP5o): 5’-AACGACTCCTTGGGTATTGCTTAA-3’/5’-ATTGAAGGTCGCTATGC-CACAG-3’, Glucose-6-phosphate dehydrogenase (G6PD): 5’ GCAGGGCATTGAGGTTGG-GAG-3’/5’-GATGTCCCCTGTCCCACCAACTCTG3’, Peroxysome Proliferator-Activated Receptor gamma 2 (PPARγ2): 5’-TTGCAGACAGTGTATCAGTGAAGGAAT-3’/5’-ATTACAGCAAACCCCTATTCCA-TG-3’, CCAAT Enhanced Binding Protein alpha (C/EBPα): 5’-TTCACATTGCACAAGGCACT-3’/5’-GAGGGACCGGAGTTATGACA-3’, Lipoprotein Lipase (LPL): 5’-ATTCAGAGACTTG-TCATGGCATTTC-3’/5’-TCGCCATTCAGAAGATCAGAGTAAA-3’ Adiponectin (ADIPOQ): 5’-TAGAACAGCTCCCAGCAACA-3’/5’-CCATCTCCTCCTCACTTCCA-3’, Fibroblast Activation Protein alpha (FAP): 5’-TGTCCTGAAATCCAGTTTGG-3’/5’-GTGCATTGTCTTACGCCCTT -3’, Dipeptidyl Peptidase IV (DPP4): 5’-GCGACTGTCAGCTGTAGCAT-3’/5’-TGAAGACA-CCGTGGAAGGTT-3’, Matrix-Metalloproteinase 1 (MMP1): 5’-TTGTGGCCAGAAAACAGAAA-3’/5’-TTCGGGGAGAAGTGATGTTC-3’, Transforming Growth Factor β1 (TGFβ1): 5’-AAGTT-GGCATGGTAGCCCTT-3’/5’-CCCTGGACACCAACTATTGC-3’. .. Real-time RT-PCR was performed using SYBERGreen RT2 kit (QIAGEN) and a Biorad |