c1000 touch cfx96 real time system thermal cycler  (Bio-Rad)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Bio-Rad c1000 touch cfx96 real time system thermal cycler
    C1000 Touch Cfx96 Real Time System Thermal Cycler, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c1000 touch cfx96 real time system thermal cycler/product/Bio-Rad
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    c1000 touch cfx96 real time system thermal cycler - by Bioz Stars, 2021-04
    86/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Transfer of Functional Cargo in Exomeres
    Article Snippet: Quantitative RT-PCR SW948 cells were either not treated or treated with DiFi exosomes and harvested at the indicated times as described in “Treatment of recipient cells with exosomes.” Total RNA was isolated and purified with RNeasy Mini Kit (QIAGEN, Germantown, MD) with on-column DNase treatment according to the manufacturer’s instructions. cDNA synthesis was performed using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA). .. Quantitative real-time PCR was performed on Bio-Rad CFX96 C1000 Touch Thermal cycler by using iQ SYBR Green supermix (Bio-Rad). .. Relative measurement of gene expression was calculated following manufacturer’s instructions using the ΔΔCt method.

    Article Title: Cytoplasmic Citrate Flux Modulates the Immune Stimulatory NKG2D Ligand MICA in Cancer Cells
    Article Snippet: Following primer sequences were used for quantitative RT-PCR with Brilliant SYBR Green qPCR Master Mix Kit: MICA (MICA_F: TGGCAGACATTCCATGTTTCTG, MICA_R: CTCGTCCCAACTGGGTGTTG), ULBP2 (ULBP 2_F: CAGAGCAACTGCGTGACATT, ULBP2_R: GGCCAC AACCTTGTCATTCT), IDH1 (IDH1_F: CTATGATGGTGA CGTGCAGTCG, IDH1_R: CCTCTGCTTCTACTGTCTTGCC), IDH2 (IDH2_F: AGATGGCAGTGGTGTCAAGGAG, IDH 2_R: CTGGATGGCATACTGGAAGCAG), GLUT1 (GLUT1_F: CTGCTCATCAACCGCAAC, GLUT1_R: CTTCTTCTCCCG CATCATCT), GLUT2 (GLUT2_F: TACATTGCGGACTTCTG TGG, GLUT2_R: AGACTTTCCTTTGGTTTCTGG), GLUT3 (GLUT3_F: CAGCGAGACCCAGAGATG, GLUT3_R: TTGG AAAGAGCCGATTGTAG), GLUT4 (GLUT4_F: TGGGCTT CTTCATCTTCACC, GLUT4_R: GTGCTGGGTTTCACCTC CT), and RPLP0 as housekeeping gene (RPLP0_F: CCTCGTGGAAGTGACATCGT, RPLP0_R: CATTCCCCC GGATATGAGGC). .. Real-time qPCR was performed on Bio-Rad CFX96 Real-time Thermal Cycler C1000 Touch, and all transcripts were normalized to housekeeping RPLP0 transcript. .. Luciferase Reporter Assay Cells were transiently transfected, using calcium-phosphate transfection as described above, with firefly luciferase promoter vectors (1 μg) and an SV40-promoter driven renilla luciferase vector (0.5 μg).

    Article Title: Local and Systemic IKKε and NF-κB Signaling Associated with Sjögren's Syndrome Immunopathogenesis
    Article Snippet: Total RNA was extracted. cDNA was prepared from 1 μ g of RNA using oligo(dT) primers, dNTP, and SuperScript II reverse transcriptase (Life Technologies, Grand Island, NY). .. The resulting cDNA was amplified by real-time PCR using a BioRad CFX96 C1000 thermal cycler. .. Amplification was performed using SYBR Green expression assays for IKKα (forward: 5′-GCAGTAACCCCTCAGACATCAG-3′; reverse: 5′-GGGACAGTGAACAAGTGACAAC-3′), IKKβ (forward: 5′-CAAGAGCCCAAGAGGAATCTC-3′; reverse: 5′-GGATGCTGGTTTTGAAGAAATC-3′), IKKγ (forward: 5′-GACCCCGCAGACTATCAATC-3′; reverse: 5′-CATCTCACACAGTTGGCTCTTC-3′), IKKε (forward: 5′-CCGAGTTGCCTCTGTCTCTTTA-3′; reverse: 5′-GTGTTCTTAGCCTCCTGGTAGC-3′), Iκ Bα (forward: 5′-GGAGTTCACAGAGGACGAGC-3′; reverse: 5′-CTGGGGTCAGTCACTCGAAG-3′), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (forward: 5′-GAAGGTGAAGGTCGGAGTC-3′; reverse: 5′-GAAGATAGGTGATGGGATTTC-3′) as a normalization control.

    Article Title: Members of the methanotrophic genus Methylomarinum inhabit inland mud pots
    Article Snippet: .. Quantitative PCR was performed using the Power SYBR Universal mastermix (Thermo Fisher Scientific, Grand Island, NY, USA) and a Biorad CFX96 Real time C1000 Touch Thermal Cycler System. ..

    SYBR Green Assay:

    Article Title: Transfer of Functional Cargo in Exomeres
    Article Snippet: Quantitative RT-PCR SW948 cells were either not treated or treated with DiFi exosomes and harvested at the indicated times as described in “Treatment of recipient cells with exosomes.” Total RNA was isolated and purified with RNeasy Mini Kit (QIAGEN, Germantown, MD) with on-column DNase treatment according to the manufacturer’s instructions. cDNA synthesis was performed using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA). .. Quantitative real-time PCR was performed on Bio-Rad CFX96 C1000 Touch Thermal cycler by using iQ SYBR Green supermix (Bio-Rad). .. Relative measurement of gene expression was calculated following manufacturer’s instructions using the ΔΔCt method.

    Amplification:

    Article Title: Local and Systemic IKKε and NF-κB Signaling Associated with Sjögren's Syndrome Immunopathogenesis
    Article Snippet: Total RNA was extracted. cDNA was prepared from 1 μ g of RNA using oligo(dT) primers, dNTP, and SuperScript II reverse transcriptase (Life Technologies, Grand Island, NY). .. The resulting cDNA was amplified by real-time PCR using a BioRad CFX96 C1000 thermal cycler. .. Amplification was performed using SYBR Green expression assays for IKKα (forward: 5′-GCAGTAACCCCTCAGACATCAG-3′; reverse: 5′-GGGACAGTGAACAAGTGACAAC-3′), IKKβ (forward: 5′-CAAGAGCCCAAGAGGAATCTC-3′; reverse: 5′-GGATGCTGGTTTTGAAGAAATC-3′), IKKγ (forward: 5′-GACCCCGCAGACTATCAATC-3′; reverse: 5′-CATCTCACACAGTTGGCTCTTC-3′), IKKε (forward: 5′-CCGAGTTGCCTCTGTCTCTTTA-3′; reverse: 5′-GTGTTCTTAGCCTCCTGGTAGC-3′), Iκ Bα (forward: 5′-GGAGTTCACAGAGGACGAGC-3′; reverse: 5′-CTGGGGTCAGTCACTCGAAG-3′), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (forward: 5′-GAAGGTGAAGGTCGGAGTC-3′; reverse: 5′-GAAGATAGGTGATGGGATTTC-3′) as a normalization control.

    Quantitative RT-PCR:

    Article Title: Characterization of Dedifferentiating Human Mature Adipocytes from the Visceral and Subcutaneous Fat Compartments: Fibroblast-Activation Protein Alpha and Dipeptidyl Peptidase 4 as Major Components of Matrix Remodeling
    Article Snippet: The following sequences were used for quantitative PCR (forward/reverse): ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit (ATP5o): 5’-AACGACTCCTTGGGTATTGCTTAA-3’/5’-ATTGAAGGTCGCTATGC-CACAG-3’, Glucose-6-phosphate dehydrogenase (G6PD): 5’ GCAGGGCATTGAGGTTGG-GAG-3’/5’-GATGTCCCCTGTCCCACCAACTCTG3’, Peroxysome Proliferator-Activated Receptor gamma 2 (PPARγ2): 5’-TTGCAGACAGTGTATCAGTGAAGGAAT-3’/5’-ATTACAGCAAACCCCTATTCCA-TG-3’, CCAAT Enhanced Binding Protein alpha (C/EBPα): 5’-TTCACATTGCACAAGGCACT-3’/5’-GAGGGACCGGAGTTATGACA-3’, Lipoprotein Lipase (LPL): 5’-ATTCAGAGACTTG-TCATGGCATTTC-3’/5’-TCGCCATTCAGAAGATCAGAGTAAA-3’ Adiponectin (ADIPOQ): 5’-TAGAACAGCTCCCAGCAACA-3’/5’-CCATCTCCTCCTCACTTCCA-3’, Fibroblast Activation Protein alpha (FAP): 5’-TGTCCTGAAATCCAGTTTGG-3’/5’-GTGCATTGTCTTACGCCCTT -3’, Dipeptidyl Peptidase IV (DPP4): 5’-GCGACTGTCAGCTGTAGCAT-3’/5’-TGAAGACA-CCGTGGAAGGTT-3’, Matrix-Metalloproteinase 1 (MMP1): 5’-TTGTGGCCAGAAAACAGAAA-3’/5’-TTCGGGGAGAAGTGATGTTC-3’, Transforming Growth Factor β1 (TGFβ1): 5’-AAGTT-GGCATGGTAGCCCTT-3’/5’-CCCTGGACACCAACTATTGC-3’. .. Real-time RT-PCR was performed using SYBERGreen RT2 kit (QIAGEN) and a Biorad CFX96 C1000 Thermal Cycler. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Bio-Rad benchtop thermal cycler
    Nucleic acid amplification using cavity PCR. a) Results from 2% agarose gel demonstrating a clear trend of increased PCR byproduct with an increase in PCR cycle numbers. b) Image of 2% agarose gel with different heights of cavity PCR chamber. For the comparison, the same volume (2 μL) of PCR byproduct was used for gel electrophoresis. c) Summary of total amplification time for the <t>benchtop</t> and cavity PCR. The reaction time for the benchtop is based on the cycling protocol recommended by the manufacturer. A 70%–85% reduction in total reaction time can be achieved. d) Results from 2% agarose gel demonstrating a trend in band intensity with different concentrations of initial c‐MET cDNA. The lowest concentration of template DNA is 10 −8 ng μL −1 (two copies per μL). e) Results from 2% agarose gel showing the amplification of c‐MET cDNA prepared from NSCLC cell for the heterogeneous biological sample. (Standard: c‐MET cDNA purchased from Sino Biological Inc.) f) Success rate (%) of the cavity PCR with different concentrations of c‐MET cDNA ( n = 7 for 10 −5 , 10 −6 , 10 −7 ng μL −1 , n = 19 for 10 −8 ng μL −1 ).
    Benchtop Thermal Cycler, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/benchtop thermal cycler/product/Bio-Rad
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    benchtop thermal cycler - by Bioz Stars, 2021-04
    99/100 stars
      Buy from Supplier

    98
    Bio-Rad real time system cfx96
    Nucleic acid amplification using cavity PCR. a) Results from 2% agarose gel demonstrating a clear trend of increased PCR byproduct with an increase in PCR cycle numbers. b) Image of 2% agarose gel with different heights of cavity PCR chamber. For the comparison, the same volume (2 μL) of PCR byproduct was used for gel electrophoresis. c) Summary of total amplification time for the <t>benchtop</t> and cavity PCR. The reaction time for the benchtop is based on the cycling protocol recommended by the manufacturer. A 70%–85% reduction in total reaction time can be achieved. d) Results from 2% agarose gel demonstrating a trend in band intensity with different concentrations of initial c‐MET cDNA. The lowest concentration of template DNA is 10 −8 ng μL −1 (two copies per μL). e) Results from 2% agarose gel showing the amplification of c‐MET cDNA prepared from NSCLC cell for the heterogeneous biological sample. (Standard: c‐MET cDNA purchased from Sino Biological Inc.) f) Success rate (%) of the cavity PCR with different concentrations of c‐MET cDNA ( n = 7 for 10 −5 , 10 −6 , 10 −7 ng μL −1 , n = 19 for 10 −8 ng μL −1 ).
    Real Time System Cfx96, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time system cfx96/product/Bio-Rad
    Average 98 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    real time system cfx96 - by Bioz Stars, 2021-04
    98/100 stars
      Buy from Supplier

    97
    Bio-Rad c1000 thermal cycler
    Nucleic acid amplification using cavity PCR. a) Results from 2% agarose gel demonstrating a clear trend of increased PCR byproduct with an increase in PCR cycle numbers. b) Image of 2% agarose gel with different heights of cavity PCR chamber. For the comparison, the same volume (2 μL) of PCR byproduct was used for gel electrophoresis. c) Summary of total amplification time for the <t>benchtop</t> and cavity PCR. The reaction time for the benchtop is based on the cycling protocol recommended by the manufacturer. A 70%–85% reduction in total reaction time can be achieved. d) Results from 2% agarose gel demonstrating a trend in band intensity with different concentrations of initial c‐MET cDNA. The lowest concentration of template DNA is 10 −8 ng μL −1 (two copies per μL). e) Results from 2% agarose gel showing the amplification of c‐MET cDNA prepared from NSCLC cell for the heterogeneous biological sample. (Standard: c‐MET cDNA purchased from Sino Biological Inc.) f) Success rate (%) of the cavity PCR with different concentrations of c‐MET cDNA ( n = 7 for 10 −5 , 10 −6 , 10 −7 ng μL −1 , n = 19 for 10 −8 ng μL −1 ).
    C1000 Thermal Cycler, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c1000 thermal cycler/product/Bio-Rad
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    c1000 thermal cycler - by Bioz Stars, 2021-04
    97/100 stars
      Buy from Supplier

    Image Search Results


    Nucleic acid amplification using cavity PCR. a) Results from 2% agarose gel demonstrating a clear trend of increased PCR byproduct with an increase in PCR cycle numbers. b) Image of 2% agarose gel with different heights of cavity PCR chamber. For the comparison, the same volume (2 μL) of PCR byproduct was used for gel electrophoresis. c) Summary of total amplification time for the benchtop and cavity PCR. The reaction time for the benchtop is based on the cycling protocol recommended by the manufacturer. A 70%–85% reduction in total reaction time can be achieved. d) Results from 2% agarose gel demonstrating a trend in band intensity with different concentrations of initial c‐MET cDNA. The lowest concentration of template DNA is 10 −8 ng μL −1 (two copies per μL). e) Results from 2% agarose gel showing the amplification of c‐MET cDNA prepared from NSCLC cell for the heterogeneous biological sample. (Standard: c‐MET cDNA purchased from Sino Biological Inc.) f) Success rate (%) of the cavity PCR with different concentrations of c‐MET cDNA ( n = 7 for 10 −5 , 10 −6 , 10 −7 ng μL −1 , n = 19 for 10 −8 ng μL −1 ).

    Journal: Advanced Healthcare Materials

    Article Title: Rapid Optical Cavity PCR

    doi: 10.1002/adhm.201500708

    Figure Lengend Snippet: Nucleic acid amplification using cavity PCR. a) Results from 2% agarose gel demonstrating a clear trend of increased PCR byproduct with an increase in PCR cycle numbers. b) Image of 2% agarose gel with different heights of cavity PCR chamber. For the comparison, the same volume (2 μL) of PCR byproduct was used for gel electrophoresis. c) Summary of total amplification time for the benchtop and cavity PCR. The reaction time for the benchtop is based on the cycling protocol recommended by the manufacturer. A 70%–85% reduction in total reaction time can be achieved. d) Results from 2% agarose gel demonstrating a trend in band intensity with different concentrations of initial c‐MET cDNA. The lowest concentration of template DNA is 10 −8 ng μL −1 (two copies per μL). e) Results from 2% agarose gel showing the amplification of c‐MET cDNA prepared from NSCLC cell for the heterogeneous biological sample. (Standard: c‐MET cDNA purchased from Sino Biological Inc.) f) Success rate (%) of the cavity PCR with different concentrations of c‐MET cDNA ( n = 7 for 10 −5 , 10 −6 , 10 −7 ng μL −1 , n = 19 for 10 −8 ng μL −1 ).

    Article Snippet: Figure a shows an image of the 2% agarose gel from the benchtop thermal cycler (Bio‐Rad C1000 thermal cycler with CFX96 real‐time PCR detection system) and the cavity PCR (750 μm thick PCR chamber) with different cycle numbers from 95 °C to 68 °C.

    Techniques: Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Nucleic Acid Electrophoresis, Concentration Assay