Structured Review

Bio-Rad c1000 thermal cycler
C1000 Thermal Cycler, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1129 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c1000 thermal cycler/product/Bio-Rad
Average 99 stars, based on 1129 article reviews
Price from $9.99 to $1999.99
c1000 thermal cycler - by Bioz Stars, 2020-08
99/100 stars

Images

Related Articles

SYBR Green Assay:

Article Title: Preclinical Development of siRNA Therapeutics for AL Amyloidosis
Article Snippet: .. Subsequently, cDNA was synthesized using the iScript™ cDNA Synthesis Kit (Bio-Rad) following the manufacturer’s instructions. qPCR was performed on a BioRad C1000 Thermocycler using Sybr green (BioRad) with primers for AL-009-κ1 LC (forward primer: CACCCTGACGCTGAGCAAA, reverse: TGACTTCGCAGGCGTAGACTT, product size 59 nt), GAPDH, used as a housekeeping gene control (forward primer: CAACGGGAAGCCCATCAC, reverse: GCCTCACCCCATTTGATGTTA, product size 63 nt), and mouse Blimp1, used as a plasma cell specific control (primers: AAAGGACATGGATGGCTTTCG and GTGCCCGGATAGGATAAACCA, product size 80 nt). .. LC primers were designed by Primer Express (Applied Biosystems); GAPDH and Blimp1 primers were designed using Primer Blast (NCBI).

Article Title: Transcription Factor KLF5 Binds a Cyclin E1 Polymorphic Intronic Enhancer to Confer Increased Bladder Cancer Risk
Article Snippet: .. qPCR and qRT-PCR were performed using the iQ SYBR Green Supermix (BioRad) and analyzed on a C1000 Thermal Cycler (BioRad) using the BioRad CFX Manager 2.0 software. .. Due to the high GC content within the CCNE1 intronic region, PCR was performed using HotStarTaq DNA Polymerase (Qiagen).

Amplification:

Article Title: Quantitative molecular diagnostic assays of grain washes for Claviceps purpurea are correlated with visual determinations of ergot contamination
Article Snippet: .. Amplification was carried out using a CFX96 real-time system with a C1000 base (Bio-Rad) and reactions were quantified using BioRad CFX manager software (v.3.1). .. The slope of the line resulting from plotting threshold cycle (Cq ) values vs. log10 copy number was used to determine PCR efficiency according to E = 10(-1/slope) , where 2.0 is theoretical [ ].

RNA Sequencing Assay:

Article Title: ZMYM2 inhibits NANOG-mediated reprogramming
Article Snippet: .. Depletion of ribosomal RNA was performed on 2-5 μg of total RNA using the Ribo-Zero rRNA Removal Kit (Illumina) and libraries were produced from 10-100ng of ribosomal-depleted RNA using NextFlex Rapid Directional RNA-seq Kit (5138-07; Bioo Scientific), a Biorad C1000 thermocycler, and standard Illumina primers. .. Libraries were pooled in equimolar quantities and sequenced on the HiSeq4000 platform (Illumina), using V4 chemistry.

Synthesized:

Article Title: Preclinical Development of siRNA Therapeutics for AL Amyloidosis
Article Snippet: .. Subsequently, cDNA was synthesized using the iScript™ cDNA Synthesis Kit (Bio-Rad) following the manufacturer’s instructions. qPCR was performed on a BioRad C1000 Thermocycler using Sybr green (BioRad) with primers for AL-009-κ1 LC (forward primer: CACCCTGACGCTGAGCAAA, reverse: TGACTTCGCAGGCGTAGACTT, product size 59 nt), GAPDH, used as a housekeeping gene control (forward primer: CAACGGGAAGCCCATCAC, reverse: GCCTCACCCCATTTGATGTTA, product size 63 nt), and mouse Blimp1, used as a plasma cell specific control (primers: AAAGGACATGGATGGCTTTCG and GTGCCCGGATAGGATAAACCA, product size 80 nt). .. LC primers were designed by Primer Express (Applied Biosystems); GAPDH and Blimp1 primers were designed using Primer Blast (NCBI).

Quantitative RT-PCR:

Article Title: Transcription Factor KLF5 Binds a Cyclin E1 Polymorphic Intronic Enhancer to Confer Increased Bladder Cancer Risk
Article Snippet: .. qPCR and qRT-PCR were performed using the iQ SYBR Green Supermix (BioRad) and analyzed on a C1000 Thermal Cycler (BioRad) using the BioRad CFX Manager 2.0 software. .. Due to the high GC content within the CCNE1 intronic region, PCR was performed using HotStarTaq DNA Polymerase (Qiagen).

Real-time Polymerase Chain Reaction:

Article Title: Preclinical Development of siRNA Therapeutics for AL Amyloidosis
Article Snippet: .. Subsequently, cDNA was synthesized using the iScript™ cDNA Synthesis Kit (Bio-Rad) following the manufacturer’s instructions. qPCR was performed on a BioRad C1000 Thermocycler using Sybr green (BioRad) with primers for AL-009-κ1 LC (forward primer: CACCCTGACGCTGAGCAAA, reverse: TGACTTCGCAGGCGTAGACTT, product size 59 nt), GAPDH, used as a housekeeping gene control (forward primer: CAACGGGAAGCCCATCAC, reverse: GCCTCACCCCATTTGATGTTA, product size 63 nt), and mouse Blimp1, used as a plasma cell specific control (primers: AAAGGACATGGATGGCTTTCG and GTGCCCGGATAGGATAAACCA, product size 80 nt). .. LC primers were designed by Primer Express (Applied Biosystems); GAPDH and Blimp1 primers were designed using Primer Blast (NCBI).

Article Title: Transcription Factor KLF5 Binds a Cyclin E1 Polymorphic Intronic Enhancer to Confer Increased Bladder Cancer Risk
Article Snippet: .. qPCR and qRT-PCR were performed using the iQ SYBR Green Supermix (BioRad) and analyzed on a C1000 Thermal Cycler (BioRad) using the BioRad CFX Manager 2.0 software. .. Due to the high GC content within the CCNE1 intronic region, PCR was performed using HotStarTaq DNA Polymerase (Qiagen).

Article Title: Yeast heterochromatin regulators Sir2 and Sir3 act directly at euchromatic DNA replication origins
Article Snippet: .. rDNA copy number determination Quantitative PCR reactions were carried out in sealed 200 ul microplates in a BioRad C1000 Thermocycler, CFX96 Real-Time System. ..

Reverse Transcription Polymerase Chain Reaction:

Article Title: Comprehensive identification of the full-length transcripts and alternative splicing related to the secondary metabolism pathways in the tea plant (Camellia sinensis)
Article Snippet: .. The RT-PCR reactions were performed in a BIO-RAD C1000 PCR System, and the PCR amplifications were performed in 20 μl reaction mixtures, which contained 10 μl of Premix Taq (TaKaRa), 1 μl of template cDNA, 1 μl of each primer and 7 µl of sterile double distilled water. .. The PCR products were examined on 2.0% agarose gels.

Polymerase Chain Reaction:

Article Title: Comprehensive identification of the full-length transcripts and alternative splicing related to the secondary metabolism pathways in the tea plant (Camellia sinensis)
Article Snippet: .. The RT-PCR reactions were performed in a BIO-RAD C1000 PCR System, and the PCR amplifications were performed in 20 μl reaction mixtures, which contained 10 μl of Premix Taq (TaKaRa), 1 μl of template cDNA, 1 μl of each primer and 7 µl of sterile double distilled water. .. The PCR products were examined on 2.0% agarose gels.

Article Title: CD4 is expressed on a heterogeneous subset of hematopoietic progenitors, which persistently harbor CXCR4 and CCR5-tropic HIV proviral genomes in vivo
Article Snippet: .. PCR assays were performed using a BioRad C1000 thermocycler as described in . .. Amplicons were sequenced directly from the purified gel band.

Produced:

Article Title: ZMYM2 inhibits NANOG-mediated reprogramming
Article Snippet: .. Depletion of ribosomal RNA was performed on 2-5 μg of total RNA using the Ribo-Zero rRNA Removal Kit (Illumina) and libraries were produced from 10-100ng of ribosomal-depleted RNA using NextFlex Rapid Directional RNA-seq Kit (5138-07; Bioo Scientific), a Biorad C1000 thermocycler, and standard Illumina primers. .. Libraries were pooled in equimolar quantities and sequenced on the HiSeq4000 platform (Illumina), using V4 chemistry.

Software:

Article Title: Quantitative molecular diagnostic assays of grain washes for Claviceps purpurea are correlated with visual determinations of ergot contamination
Article Snippet: .. Amplification was carried out using a CFX96 real-time system with a C1000 base (Bio-Rad) and reactions were quantified using BioRad CFX manager software (v.3.1). .. The slope of the line resulting from plotting threshold cycle (Cq ) values vs. log10 copy number was used to determine PCR efficiency according to E = 10(-1/slope) , where 2.0 is theoretical [ ].

Article Title: Transcription Factor KLF5 Binds a Cyclin E1 Polymorphic Intronic Enhancer to Confer Increased Bladder Cancer Risk
Article Snippet: .. qPCR and qRT-PCR were performed using the iQ SYBR Green Supermix (BioRad) and analyzed on a C1000 Thermal Cycler (BioRad) using the BioRad CFX Manager 2.0 software. .. Due to the high GC content within the CCNE1 intronic region, PCR was performed using HotStarTaq DNA Polymerase (Qiagen).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Bio-Rad benchtop thermal cycler
    Nucleic acid amplification using cavity PCR. a) Results from 2% agarose gel demonstrating a clear trend of increased PCR byproduct with an increase in PCR cycle numbers. b) Image of 2% agarose gel with different heights of cavity PCR chamber. For the comparison, the same volume (2 μL) of PCR byproduct was used for gel electrophoresis. c) Summary of total amplification time for the <t>benchtop</t> and cavity PCR. The reaction time for the benchtop is based on the cycling protocol recommended by the manufacturer. A 70%–85% reduction in total reaction time can be achieved. d) Results from 2% agarose gel demonstrating a trend in band intensity with different concentrations of initial c‐MET cDNA. The lowest concentration of template DNA is 10 −8 ng μL −1 (two copies per μL). e) Results from 2% agarose gel showing the amplification of c‐MET cDNA prepared from NSCLC cell for the heterogeneous biological sample. (Standard: c‐MET cDNA purchased from Sino Biological Inc.) f) Success rate (%) of the cavity PCR with different concentrations of c‐MET cDNA ( n = 7 for 10 −5 , 10 −6 , 10 −7 ng μL −1 , n = 19 for 10 −8 ng μL −1 ).
    Benchtop Thermal Cycler, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/benchtop thermal cycler/product/Bio-Rad
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    benchtop thermal cycler - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    97
    Bio-Rad dna thermal cycler
    Agarose gel Electrophoresis of the coa Gene PCR Amplification Products and the PCR Amplified <t>aroA</t> Gene Amplification products. Left to right lanes 1 and 8: 100 bp digested. Left to right lane 1: 100 bp <t>DNA</t> ladder, DNA ladder. Lane 2: negative control. Lanes 3 - 7: 490 bp, Lane 2: aroA gene PCR 1153 bp. Lane 3: aroA gene 650, 740, 770, 810 bp. Digestion: 850 and 300 bp, Lane 4: negative control.
    Dna Thermal Cycler, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 44 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna thermal cycler/product/Bio-Rad
    Average 97 stars, based on 44 article reviews
    Price from $9.99 to $1999.99
    dna thermal cycler - by Bioz Stars, 2020-08
    97/100 stars
      Buy from Supplier

    99
    Bio-Rad qrt pcr analysis
    Relative mRNA levels of EDNs and EDNRs in E18 chicken retina, primary chicken Müller cells and the human MIO-M1 Müller cell line. <t>qRT-PCR</t> analysis of mRNA levels. Bar graphs showing the relative mRNA levels normalized to ß-actin for (A) EDNRA, EDNRB, EDNRB2 and SOX2, and for (B) EDN1, EDN2, EDN3 in chicken E18 retina (Chicken retina), primary chicken Müller cells (Chicken Müller cell) and the human MIO-M1 Müller cell line. Note that EDNRB2 is not found in human. For the MIO-M1 cells the relative mRNA levels of EDNRA and EDNRB are shown. Sox2 is included as an expression reference for the chicken cells. Bar graphs are mean ± SEM, n = 5 (*P
    Qrt Pcr Analysis, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 498 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr analysis/product/Bio-Rad
    Average 99 stars, based on 498 article reviews
    Price from $9.99 to $1999.99
    qrt pcr analysis - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    gfp  (Bio-Rad)
    93
    Bio-Rad gfp
    EBOV uAUGs attenuate translation at primary open reading frames (pORFs). A . Diagram depicting the location of each mutated uAUG codon (to UUG) in the indicated EBOV 5′-UTRs. B . Equal copies of mRNA (determined by real time <t>PCR)</t> encoding <t>GFP</t> downstream of individual 5′-UTRs described in 3A were transfected into 293T cells. At 2.5 hours post transfection, cells were harvested and analyzed by flow cytometry. The fold difference in GFP mean fluorescence intensity (M.F.I.) between the paired samples (with and without the uAUG) is indicated. Each bar represents the mean of triplicate samples. Data for the L 5′-UTR are represented with gray bars. C . A real time PCR measurement of GFP mRNA levels present in the transfected cells described in B was determined for each sample. Each sample was normalized to 18s rRNA. D . The same experiment was performed in parallel as in B, but in primary human dendritic cells. Data are values of single transfections. E and F . Select, representative flow cytometry data from experiments 2B and D; depicted in histogram format showing GFP fluorescence of 293T and dendritic cells which were mock transfected (dashed line), transfected with GFP downstream of the WT L 5′-UTR (solid line) or the mutated L 5′-UTR (dotted line). The data are representative of three independent experiments.
    Gfp, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gfp/product/Bio-Rad
    Average 93 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    gfp - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    Image Search Results


    Nucleic acid amplification using cavity PCR. a) Results from 2% agarose gel demonstrating a clear trend of increased PCR byproduct with an increase in PCR cycle numbers. b) Image of 2% agarose gel with different heights of cavity PCR chamber. For the comparison, the same volume (2 μL) of PCR byproduct was used for gel electrophoresis. c) Summary of total amplification time for the benchtop and cavity PCR. The reaction time for the benchtop is based on the cycling protocol recommended by the manufacturer. A 70%–85% reduction in total reaction time can be achieved. d) Results from 2% agarose gel demonstrating a trend in band intensity with different concentrations of initial c‐MET cDNA. The lowest concentration of template DNA is 10 −8 ng μL −1 (two copies per μL). e) Results from 2% agarose gel showing the amplification of c‐MET cDNA prepared from NSCLC cell for the heterogeneous biological sample. (Standard: c‐MET cDNA purchased from Sino Biological Inc.) f) Success rate (%) of the cavity PCR with different concentrations of c‐MET cDNA ( n = 7 for 10 −5 , 10 −6 , 10 −7 ng μL −1 , n = 19 for 10 −8 ng μL −1 ).

    Journal: Advanced Healthcare Materials

    Article Title: Rapid Optical Cavity PCR

    doi: 10.1002/adhm.201500708

    Figure Lengend Snippet: Nucleic acid amplification using cavity PCR. a) Results from 2% agarose gel demonstrating a clear trend of increased PCR byproduct with an increase in PCR cycle numbers. b) Image of 2% agarose gel with different heights of cavity PCR chamber. For the comparison, the same volume (2 μL) of PCR byproduct was used for gel electrophoresis. c) Summary of total amplification time for the benchtop and cavity PCR. The reaction time for the benchtop is based on the cycling protocol recommended by the manufacturer. A 70%–85% reduction in total reaction time can be achieved. d) Results from 2% agarose gel demonstrating a trend in band intensity with different concentrations of initial c‐MET cDNA. The lowest concentration of template DNA is 10 −8 ng μL −1 (two copies per μL). e) Results from 2% agarose gel showing the amplification of c‐MET cDNA prepared from NSCLC cell for the heterogeneous biological sample. (Standard: c‐MET cDNA purchased from Sino Biological Inc.) f) Success rate (%) of the cavity PCR with different concentrations of c‐MET cDNA ( n = 7 for 10 −5 , 10 −6 , 10 −7 ng μL −1 , n = 19 for 10 −8 ng μL −1 ).

    Article Snippet: Figure a shows an image of the 2% agarose gel from the benchtop thermal cycler (Bio‐Rad C1000 thermal cycler with CFX96 real‐time PCR detection system) and the cavity PCR (750 μm thick PCR chamber) with different cycle numbers from 95 °C to 68 °C.

    Techniques: Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Nucleic Acid Electrophoresis, Concentration Assay

    Agarose gel Electrophoresis of the coa Gene PCR Amplification Products and the PCR Amplified aroA Gene Amplification products. Left to right lanes 1 and 8: 100 bp digested. Left to right lane 1: 100 bp DNA ladder, DNA ladder. Lane 2: negative control. Lanes 3 - 7: 490 bp, Lane 2: aroA gene PCR 1153 bp. Lane 3: aroA gene 650, 740, 770, 810 bp. Digestion: 850 and 300 bp, Lane 4: negative control.

    Journal: Jundishapur Journal of Microbiology

    Article Title: Genotyping of coa and aroA Genes of Methicillin-Resistant Staphylococcus aureus Strains Isolated From Nasal Samples in Western Iran

    doi: 10.5812/jjm.26460

    Figure Lengend Snippet: Agarose gel Electrophoresis of the coa Gene PCR Amplification Products and the PCR Amplified aroA Gene Amplification products. Left to right lanes 1 and 8: 100 bp digested. Left to right lane 1: 100 bp DNA ladder, DNA ladder. Lane 2: negative control. Lanes 3 - 7: 490 bp, Lane 2: aroA gene PCR 1153 bp. Lane 3: aroA gene 650, 740, 770, 810 bp. Digestion: 850 and 300 bp, Lane 4: negative control.

    Article Snippet: After optimizing PCR reactions for the amplification of the aroA gene, the reaction was carried out in a DNA thermal cycler (BioRad C1000, USA) for obtaining a single amplicon with an anticipated size of 1153 bp.

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Negative Control

    Relative mRNA levels of EDNs and EDNRs in E18 chicken retina, primary chicken Müller cells and the human MIO-M1 Müller cell line. qRT-PCR analysis of mRNA levels. Bar graphs showing the relative mRNA levels normalized to ß-actin for (A) EDNRA, EDNRB, EDNRB2 and SOX2, and for (B) EDN1, EDN2, EDN3 in chicken E18 retina (Chicken retina), primary chicken Müller cells (Chicken Müller cell) and the human MIO-M1 Müller cell line. Note that EDNRB2 is not found in human. For the MIO-M1 cells the relative mRNA levels of EDNRA and EDNRB are shown. Sox2 is included as an expression reference for the chicken cells. Bar graphs are mean ± SEM, n = 5 (*P

    Journal: PLoS ONE

    Article Title: Endothelin B Receptors on Primary Chicken Müller Cells and the Human MIO-M1 Müller Cell Line Activate ERK Signaling via Transactivation of Epidermal Growth Factor Receptors

    doi: 10.1371/journal.pone.0167778

    Figure Lengend Snippet: Relative mRNA levels of EDNs and EDNRs in E18 chicken retina, primary chicken Müller cells and the human MIO-M1 Müller cell line. qRT-PCR analysis of mRNA levels. Bar graphs showing the relative mRNA levels normalized to ß-actin for (A) EDNRA, EDNRB, EDNRB2 and SOX2, and for (B) EDN1, EDN2, EDN3 in chicken E18 retina (Chicken retina), primary chicken Müller cells (Chicken Müller cell) and the human MIO-M1 Müller cell line. Note that EDNRB2 is not found in human. For the MIO-M1 cells the relative mRNA levels of EDNRA and EDNRB are shown. Sox2 is included as an expression reference for the chicken cells. Bar graphs are mean ± SEM, n = 5 (*P

    Article Snippet: QRT-PCR analysis (IQ SyBr Green Supermix and a C1000 Thermal Cycler; Bio-Rad, Hercules, CA, USA) was performed as previously described [ , ].

    Techniques: Quantitative RT-PCR, Expressing

    Expression of HB-EGF in chicken Müller cells and in human MIO-M1 cell line. QRT-PCR analysis of heparin binding epidermal growth factor (HB-EGF), transcription factor SOX2 and cellular retinaldehyde-binding protein (CRALBP) mRNA levels in primary chicken Müller cell and in human MIO-M1 cell cultures. SOX2 and CRALBP were included as expression references known to be expressed in Müller cells. Bar graph showing the relative mRNA levels in relation to β-actin mRNA levels. Bar graph is mean ±SEM, n > 5.

    Journal: PLoS ONE

    Article Title: Endothelin B Receptors on Primary Chicken Müller Cells and the Human MIO-M1 Müller Cell Line Activate ERK Signaling via Transactivation of Epidermal Growth Factor Receptors

    doi: 10.1371/journal.pone.0167778

    Figure Lengend Snippet: Expression of HB-EGF in chicken Müller cells and in human MIO-M1 cell line. QRT-PCR analysis of heparin binding epidermal growth factor (HB-EGF), transcription factor SOX2 and cellular retinaldehyde-binding protein (CRALBP) mRNA levels in primary chicken Müller cell and in human MIO-M1 cell cultures. SOX2 and CRALBP were included as expression references known to be expressed in Müller cells. Bar graph showing the relative mRNA levels in relation to β-actin mRNA levels. Bar graph is mean ±SEM, n > 5.

    Article Snippet: QRT-PCR analysis (IQ SyBr Green Supermix and a C1000 Thermal Cycler; Bio-Rad, Hercules, CA, USA) was performed as previously described [ , ].

    Techniques: Expressing, Quantitative RT-PCR, Binding Assay

    Endothelins and their receptors in retina after excitotoxic injury. (A) Schematic tree depicting orthologs and paralogs of the endothelin receptors (EDNRs) in Aves and Mammalia. EDNR2B has only been found in non-mammalian species. The tree is based on Ensembl Gene tree ID: ENSGT00760000119177. (B) Interactions between the endothelins (EDNs), the EDNRB agonist IRL1620 and the EDNRs. (C) Experimental outline. QRT-PCR analysis of (D) EDNRA, EDNRB, EDNRB2 and (E) EDN1, EDN2 and EDN3 mRNA levels in NMDA- or vehicle- (Control) treated eyes. Bar graphs show the relative mRNA levels normalized to ß-actin. Bar graphs are mean ± SEM, n = 6 (control 2 h), n = 5 (NMDA 2 h), n = 6 (control 12 h), n = 5 (NMDA 12 h), n = 6 (control 24 h), n = 6 (NMDA 24 h, (*P

    Journal: PLoS ONE

    Article Title: Endothelin B Receptors on Primary Chicken Müller Cells and the Human MIO-M1 Müller Cell Line Activate ERK Signaling via Transactivation of Epidermal Growth Factor Receptors

    doi: 10.1371/journal.pone.0167778

    Figure Lengend Snippet: Endothelins and their receptors in retina after excitotoxic injury. (A) Schematic tree depicting orthologs and paralogs of the endothelin receptors (EDNRs) in Aves and Mammalia. EDNR2B has only been found in non-mammalian species. The tree is based on Ensembl Gene tree ID: ENSGT00760000119177. (B) Interactions between the endothelins (EDNs), the EDNRB agonist IRL1620 and the EDNRs. (C) Experimental outline. QRT-PCR analysis of (D) EDNRA, EDNRB, EDNRB2 and (E) EDN1, EDN2 and EDN3 mRNA levels in NMDA- or vehicle- (Control) treated eyes. Bar graphs show the relative mRNA levels normalized to ß-actin. Bar graphs are mean ± SEM, n = 6 (control 2 h), n = 5 (NMDA 2 h), n = 6 (control 12 h), n = 5 (NMDA 12 h), n = 6 (control 24 h), n = 6 (NMDA 24 h, (*P

    Article Snippet: QRT-PCR analysis (IQ SyBr Green Supermix and a C1000 Thermal Cycler; Bio-Rad, Hercules, CA, USA) was performed as previously described [ , ].

    Techniques: Quantitative RT-PCR

    EBOV uAUGs attenuate translation at primary open reading frames (pORFs). A . Diagram depicting the location of each mutated uAUG codon (to UUG) in the indicated EBOV 5′-UTRs. B . Equal copies of mRNA (determined by real time PCR) encoding GFP downstream of individual 5′-UTRs described in 3A were transfected into 293T cells. At 2.5 hours post transfection, cells were harvested and analyzed by flow cytometry. The fold difference in GFP mean fluorescence intensity (M.F.I.) between the paired samples (with and without the uAUG) is indicated. Each bar represents the mean of triplicate samples. Data for the L 5′-UTR are represented with gray bars. C . A real time PCR measurement of GFP mRNA levels present in the transfected cells described in B was determined for each sample. Each sample was normalized to 18s rRNA. D . The same experiment was performed in parallel as in B, but in primary human dendritic cells. Data are values of single transfections. E and F . Select, representative flow cytometry data from experiments 2B and D; depicted in histogram format showing GFP fluorescence of 293T and dendritic cells which were mock transfected (dashed line), transfected with GFP downstream of the WT L 5′-UTR (solid line) or the mutated L 5′-UTR (dotted line). The data are representative of three independent experiments.

    Journal: PLoS Pathogens

    Article Title: An Upstream Open Reading Frame Modulates Ebola Virus Polymerase Translation and Virus Replication

    doi: 10.1371/journal.ppat.1003147

    Figure Lengend Snippet: EBOV uAUGs attenuate translation at primary open reading frames (pORFs). A . Diagram depicting the location of each mutated uAUG codon (to UUG) in the indicated EBOV 5′-UTRs. B . Equal copies of mRNA (determined by real time PCR) encoding GFP downstream of individual 5′-UTRs described in 3A were transfected into 293T cells. At 2.5 hours post transfection, cells were harvested and analyzed by flow cytometry. The fold difference in GFP mean fluorescence intensity (M.F.I.) between the paired samples (with and without the uAUG) is indicated. Each bar represents the mean of triplicate samples. Data for the L 5′-UTR are represented with gray bars. C . A real time PCR measurement of GFP mRNA levels present in the transfected cells described in B was determined for each sample. Each sample was normalized to 18s rRNA. D . The same experiment was performed in parallel as in B, but in primary human dendritic cells. Data are values of single transfections. E and F . Select, representative flow cytometry data from experiments 2B and D; depicted in histogram format showing GFP fluorescence of 293T and dendritic cells which were mock transfected (dashed line), transfected with GFP downstream of the WT L 5′-UTR (solid line) or the mutated L 5′-UTR (dotted line). The data are representative of three independent experiments.

    Article Snippet: Each cDNA was then subjected to real time quantitative PCR with primers specific for GFP (Bio-Rad C1000 Thermal Cycler).

    Techniques: Real-time Polymerase Chain Reaction, Transfection, Flow Cytometry, Cytometry, Fluorescence

    Efficiency of translation initiation at L uAUG is determined by its sequence context. A . L 5′-UTR GFP mRNA reporter constructs were generated such that the uORF is fused in frame to GFP. The nucleotide sequence immediately surrounding the uAUG of each construct is displayed. The first construct (uORF-GFP) includes the first 46 nucleotides of the L 5′-UTR up to the uAUG followed by the entire L uORF sequence placed in frame with the GFP ORF (labeled uORF-GFP). The middle construct (uORF-GFP SK) is identical to the first, but the uAUG is surrounded by a strong Kozak sequence (A at the −3 position and a G at the +4 position, where the A of the AUG is designated as +1). The bottom construct includes the L 5′-UTR, through the uAUG and the second codon of the uORF which was placed in frame with the GFP ORF, but lacks the rest of the uORF. In each case, the start codon for GFP was removed. The number of nucleotides in each construct is indicated and the features of each construct are summarized in the box above the diagram. B . Equal amounts of each in vitro transcribed mRNA were transfected into 293T cells. At 2.5 hours post transfection, cells were harvested and analyzed by flow cytometry. The experiment was performed in triplicate, and a representative sample is displayed for each group. C . GFP mRNA levels, as determined by real time PCR, present in the transfected cells described in B were determined for each sample.

    Journal: PLoS Pathogens

    Article Title: An Upstream Open Reading Frame Modulates Ebola Virus Polymerase Translation and Virus Replication

    doi: 10.1371/journal.ppat.1003147

    Figure Lengend Snippet: Efficiency of translation initiation at L uAUG is determined by its sequence context. A . L 5′-UTR GFP mRNA reporter constructs were generated such that the uORF is fused in frame to GFP. The nucleotide sequence immediately surrounding the uAUG of each construct is displayed. The first construct (uORF-GFP) includes the first 46 nucleotides of the L 5′-UTR up to the uAUG followed by the entire L uORF sequence placed in frame with the GFP ORF (labeled uORF-GFP). The middle construct (uORF-GFP SK) is identical to the first, but the uAUG is surrounded by a strong Kozak sequence (A at the −3 position and a G at the +4 position, where the A of the AUG is designated as +1). The bottom construct includes the L 5′-UTR, through the uAUG and the second codon of the uORF which was placed in frame with the GFP ORF, but lacks the rest of the uORF. In each case, the start codon for GFP was removed. The number of nucleotides in each construct is indicated and the features of each construct are summarized in the box above the diagram. B . Equal amounts of each in vitro transcribed mRNA were transfected into 293T cells. At 2.5 hours post transfection, cells were harvested and analyzed by flow cytometry. The experiment was performed in triplicate, and a representative sample is displayed for each group. C . GFP mRNA levels, as determined by real time PCR, present in the transfected cells described in B were determined for each sample.

    Article Snippet: Each cDNA was then subjected to real time quantitative PCR with primers specific for GFP (Bio-Rad C1000 Thermal Cycler).

    Techniques: Sequencing, Construct, Generated, Labeling, In Vitro, Transfection, Flow Cytometry, Cytometry, Real-time Polymerase Chain Reaction

    Suppression of pORF translation by the uAUG in the L 5′-UTR is position dependent. A . Diagram depicting wild-type and mutated L 5′-UTR-GFP reporter constructs in which the location of the uAUG was altered. For the L uORF, the black box represents the L uORF sequence, while the gray box depicts the remainder of the overlapping uORF that consists of GFP-derived sequences. Nucleotide changes that differ from the wildtype L 5′-UTR sequence are indicated in bold and the underlined sequences highlight the uORFs. Additional mutations were introduced to preserve the Kozak sequence at the −3 and +4 position such that they match that present in the wildtype L 5′-UTR. The reading frame of the uORF for each construct is indicated on the right. B . Equal amounts of in vitro transcribed mRNAs corresponding to the constructs depicted in panel A were transfected into 293T cells. At 2.5 hours post transfection, cells were harvested and analyzed by flow cytometry for GFP fluorescence. Each bar represents the mean of triplicate samples, and all values were calculated relative to the B-actin 5′-UTR GFP control mRNA which was set to 100%. C . A real time PCR measurement of GFP mRNA levels present in the transfected cells described in B was determined for each sample.

    Journal: PLoS Pathogens

    Article Title: An Upstream Open Reading Frame Modulates Ebola Virus Polymerase Translation and Virus Replication

    doi: 10.1371/journal.ppat.1003147

    Figure Lengend Snippet: Suppression of pORF translation by the uAUG in the L 5′-UTR is position dependent. A . Diagram depicting wild-type and mutated L 5′-UTR-GFP reporter constructs in which the location of the uAUG was altered. For the L uORF, the black box represents the L uORF sequence, while the gray box depicts the remainder of the overlapping uORF that consists of GFP-derived sequences. Nucleotide changes that differ from the wildtype L 5′-UTR sequence are indicated in bold and the underlined sequences highlight the uORFs. Additional mutations were introduced to preserve the Kozak sequence at the −3 and +4 position such that they match that present in the wildtype L 5′-UTR. The reading frame of the uORF for each construct is indicated on the right. B . Equal amounts of in vitro transcribed mRNAs corresponding to the constructs depicted in panel A were transfected into 293T cells. At 2.5 hours post transfection, cells were harvested and analyzed by flow cytometry for GFP fluorescence. Each bar represents the mean of triplicate samples, and all values were calculated relative to the B-actin 5′-UTR GFP control mRNA which was set to 100%. C . A real time PCR measurement of GFP mRNA levels present in the transfected cells described in B was determined for each sample.

    Article Snippet: Each cDNA was then subjected to real time quantitative PCR with primers specific for GFP (Bio-Rad C1000 Thermal Cycler).

    Techniques: Construct, Sequencing, Derivative Assay, In Vitro, Transfection, Flow Cytometry, Cytometry, Fluorescence, Real-time Polymerase Chain Reaction

    A screen of EBOV 5' UTRs demonstrates that the polymerase (L) 5'-UTR suppresses GFP expression. A . Diagram of the in vitro generated mRNAs used to assess the impact of 5′-UTRs on translation efficiency. EBOV 5′-UTRs or the β-actin control 5′-UTR were placed upstream of a GFP reporter ORF. Distances in nucleotides from the pAUG are indicated at the top. uAUGs are indicated by (S) and stop codons for uORFs are indicated by (X). Within the UTRs, black boxes indicate uORFs out of frame with GFP, while white boxes indicate uORFs in frame with GFP. The lengths (in nucleotides, including stop codons) of the uORFs are indicated. For the L uORF, the black box represents the L uORF sequence, while the gray box depicts the remainder of the overlapping uORF that consists of GFP-derived sequences. The UTRs are listed according to their order in the EBOV genome. B . Mean GFP fluorescence intensity (M.F.I.) of 293T cells transfected with equal copies (determined by real time PCR) of in vitro transcribed mRNAs encoding GFP corresponding to those diagramed in A. At 2.5 hours post transfection, cells were harvested and analyzed by flow cytometry for GFP expression. The bars are presented according to the order of genes in the EBOV genome, and data highlighting the L 5′-UTR is indicated by a gray bar. Data are the mean of triplicate samples. C . A real time PCR measurement of GFP mRNA levels present in the transfected cells described in B was determined for each sample. Each sample was normalized to 18s rRNA. D . The same mRNAs transfected in B were transfected into primary human dendritic cells (DC). Data are the values from single transfections. E and F . Selected GFP expression data from the experiments described in 2B and D, but depicted in histogram format. 293T cells and dendritic cells were mock transfected (dashed line), or transfected with GFP downstream of either the β-actin (dotted line) or L 5′-UTR (solid line), indicating the L 5′-UTR suppresses GFP expression. The data are representative of three independent experiments.

    Journal: PLoS Pathogens

    Article Title: An Upstream Open Reading Frame Modulates Ebola Virus Polymerase Translation and Virus Replication

    doi: 10.1371/journal.ppat.1003147

    Figure Lengend Snippet: A screen of EBOV 5' UTRs demonstrates that the polymerase (L) 5'-UTR suppresses GFP expression. A . Diagram of the in vitro generated mRNAs used to assess the impact of 5′-UTRs on translation efficiency. EBOV 5′-UTRs or the β-actin control 5′-UTR were placed upstream of a GFP reporter ORF. Distances in nucleotides from the pAUG are indicated at the top. uAUGs are indicated by (S) and stop codons for uORFs are indicated by (X). Within the UTRs, black boxes indicate uORFs out of frame with GFP, while white boxes indicate uORFs in frame with GFP. The lengths (in nucleotides, including stop codons) of the uORFs are indicated. For the L uORF, the black box represents the L uORF sequence, while the gray box depicts the remainder of the overlapping uORF that consists of GFP-derived sequences. The UTRs are listed according to their order in the EBOV genome. B . Mean GFP fluorescence intensity (M.F.I.) of 293T cells transfected with equal copies (determined by real time PCR) of in vitro transcribed mRNAs encoding GFP corresponding to those diagramed in A. At 2.5 hours post transfection, cells were harvested and analyzed by flow cytometry for GFP expression. The bars are presented according to the order of genes in the EBOV genome, and data highlighting the L 5′-UTR is indicated by a gray bar. Data are the mean of triplicate samples. C . A real time PCR measurement of GFP mRNA levels present in the transfected cells described in B was determined for each sample. Each sample was normalized to 18s rRNA. D . The same mRNAs transfected in B were transfected into primary human dendritic cells (DC). Data are the values from single transfections. E and F . Selected GFP expression data from the experiments described in 2B and D, but depicted in histogram format. 293T cells and dendritic cells were mock transfected (dashed line), or transfected with GFP downstream of either the β-actin (dotted line) or L 5′-UTR (solid line), indicating the L 5′-UTR suppresses GFP expression. The data are representative of three independent experiments.

    Article Snippet: Each cDNA was then subjected to real time quantitative PCR with primers specific for GFP (Bio-Rad C1000 Thermal Cycler).

    Techniques: Expressing, In Vitro, Generated, Sequencing, Derivative Assay, Fluorescence, Transfection, Real-time Polymerase Chain Reaction, Flow Cytometry, Cytometry

    pORF translation is suppressed by a strong uAUG Kozak sequence in the L 5′-UTR, but is not affected by a weak uAUG Kozak sequence. A . Diagram depicting the in vitro generated L 5′-UTR GFP mRNA reporter constructs with permutations surrounding the L uAUG. For the L uORF, the black box represents the L uORF sequence, while the gray box depicts the remainder of the overlapping uORF that consists of GFP-derived sequences. Each sequence surrounding the uAUG above the diagram represents a reporter construct. The top is the wildtype nucleotide sequence surrounding the L uAUG (WT L 5′-UTR). The next construct has a strong Kozak sequence (A at the −3 position and a G at the +4 position, where the A of the AUG is designated as +1). Two constructs predicted to have a weak Kozak sequence (uAUG WK1 and WK2) have mutations at the +4 and +4/+5 positions, respectively. The construct labeled “uAUG STOP” has a point mutation that incorporates a stop codon directly after the uAUG start codon. Finally, uUUG and uUCG both ablate the uAUG start codon. Each construct is analyzed in panel B. B . Equal amounts of each in vitro transcribed mRNA were transfected into 293T cells. At 2.5 hours post transfection, cells were harvested and analyzed by flow cytometry. Each bar represents the mean and standard deviation of triplicate samples, and all values were calculated relative to the B-actin 5′-UTR GFP control mRNA, which was set to 100%. C . A real time PCR measurement of GFP mRNA levels present in the transfected cells described in B was determined for each sample.

    Journal: PLoS Pathogens

    Article Title: An Upstream Open Reading Frame Modulates Ebola Virus Polymerase Translation and Virus Replication

    doi: 10.1371/journal.ppat.1003147

    Figure Lengend Snippet: pORF translation is suppressed by a strong uAUG Kozak sequence in the L 5′-UTR, but is not affected by a weak uAUG Kozak sequence. A . Diagram depicting the in vitro generated L 5′-UTR GFP mRNA reporter constructs with permutations surrounding the L uAUG. For the L uORF, the black box represents the L uORF sequence, while the gray box depicts the remainder of the overlapping uORF that consists of GFP-derived sequences. Each sequence surrounding the uAUG above the diagram represents a reporter construct. The top is the wildtype nucleotide sequence surrounding the L uAUG (WT L 5′-UTR). The next construct has a strong Kozak sequence (A at the −3 position and a G at the +4 position, where the A of the AUG is designated as +1). Two constructs predicted to have a weak Kozak sequence (uAUG WK1 and WK2) have mutations at the +4 and +4/+5 positions, respectively. The construct labeled “uAUG STOP” has a point mutation that incorporates a stop codon directly after the uAUG start codon. Finally, uUUG and uUCG both ablate the uAUG start codon. Each construct is analyzed in panel B. B . Equal amounts of each in vitro transcribed mRNA were transfected into 293T cells. At 2.5 hours post transfection, cells were harvested and analyzed by flow cytometry. Each bar represents the mean and standard deviation of triplicate samples, and all values were calculated relative to the B-actin 5′-UTR GFP control mRNA, which was set to 100%. C . A real time PCR measurement of GFP mRNA levels present in the transfected cells described in B was determined for each sample.

    Article Snippet: Each cDNA was then subjected to real time quantitative PCR with primers specific for GFP (Bio-Rad C1000 Thermal Cycler).

    Techniques: Sequencing, In Vitro, Generated, Construct, Derivative Assay, Labeling, Mutagenesis, Transfection, Flow Cytometry, Cytometry, Standard Deviation, Real-time Polymerase Chain Reaction