buffer 2  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    NEBuffer 2
    Description:
    NEBuffer 2 5 0 ml
    Catalog Number:
    b7002s
    Price:
    24
    Size:
    5 0 ml
    Category:
    Buffers
    Buy from Supplier


    Structured Review

    New England Biolabs buffer 2
    NEBuffer 2
    NEBuffer 2 5 0 ml
    https://www.bioz.com/result/buffer 2/product/New England Biolabs
    Average 99 stars, based on 32 article reviews
    Price from $9.99 to $1999.99
    buffer 2 - by Bioz Stars, 2020-08
    99/100 stars

    Images

    Related Articles

    In Vitro:

    Article Title: Heritable genome-wide variation of gene expression and promoter methylation between wild and domesticated chickens
    Article Snippet: .. Positive control samples were synthesized by in vitro methylation, using a nuclease-free water diluted reaction mix of 16.5 μl, including an all bird pool of 1 μg DNA, 2 μl 10× NEBuffer2, 2 μl SAM (640 μM), 1 μl SssI methylase (4 U/μl) (New England BioLabs Inc.). .. Negative control samples were synthesized by whole genome amplification on the same all bird DNA pool (10-20 ng/μl) as for the positive control using the REPLI-g Mini Kit (Qiagen).

    Positive Control:

    Article Title: Heritable genome-wide variation of gene expression and promoter methylation between wild and domesticated chickens
    Article Snippet: .. Positive control samples were synthesized by in vitro methylation, using a nuclease-free water diluted reaction mix of 16.5 μl, including an all bird pool of 1 μg DNA, 2 μl 10× NEBuffer2, 2 μl SAM (640 μM), 1 μl SssI methylase (4 U/μl) (New England BioLabs Inc.). .. Negative control samples were synthesized by whole genome amplification on the same all bird DNA pool (10-20 ng/μl) as for the positive control using the REPLI-g Mini Kit (Qiagen).

    Synthesized:

    Article Title: Heritable genome-wide variation of gene expression and promoter methylation between wild and domesticated chickens
    Article Snippet: .. Positive control samples were synthesized by in vitro methylation, using a nuclease-free water diluted reaction mix of 16.5 μl, including an all bird pool of 1 μg DNA, 2 μl 10× NEBuffer2, 2 μl SAM (640 μM), 1 μl SssI methylase (4 U/μl) (New England BioLabs Inc.). .. Negative control samples were synthesized by whole genome amplification on the same all bird DNA pool (10-20 ng/μl) as for the positive control using the REPLI-g Mini Kit (Qiagen).

    Ligation:

    Article Title: Development of an Illumina-based ChIP-exonuclease method provides insight into FoxA1-DNA binding properties
    Article Snippet: .. The beads then undergo five successive incubations in a 2 mL tube agitated at 900 rpm in a thermomixer as followed: 1) End polishing: 1 mM ATP, 100 uM dNTP, 15 U T4 DNA polymerase, 5 U Klenow DNA polymerase, 50 U T4 PolyNucleotide Kinase, in 100 uL 1× NEBuffer 2 (50 mM NaCl, 10 mM Tris–HCl, 10 mM MgCl2, 1 mM DTT, pH 7.9) at 30°C for 30 min. 2) Ligation of the P7 exo-adapter: 1 mM ATP, 150 pmol P7 exo-adapter, 2000 U T4 DNA ligase, in 100 uL 1× NEBuffer 2 at 25°C for 60 min. 3) Nick repair: 150 uM dNTP, 15 U phi29 DNA polymerase in 100 uL 1× phi29 reaction buffer (50 mM Tris–HCl pH 7.5, 10 mM MgCl2, 10 mM (NH4)2SO4, 1 mM DTT, pH 7.5) at 30°C for 20 min. 4) Lambda exonuclease digestion: 10 U Lambda exonuclease in 100 uL 1× NEB Lambda exonuclease buffer (67 mM Glycine-KOH, 2.5 mM MgCl2, 50 μg/mL BSA, pH 9.4) at 37°C for 30 min. 5) RecJf exonuclease digestion: 30 U RecJf exonuclease in 100 uL NEBuffer 2 at 37°C for 30 min. .. The beads are washed two times in 1 mL RIPA buffer and two times in 1 mL Tris HCl pH 8 after every incubation.

    Random Hexamer Labeling:

    Article Title: miR-206 knockout shows it is critical for myogenesis and directly regulates newly identified target mRNAs.
    Article Snippet: .. Second strand cDNA was prepared by incubating 0.5 µM dNTPs, 1 µM Illumina-compatible random hexamer primer (5’-TCCCTACACGACGCTCTTCCGATCTNNNNNN-3’), and 0.15 U Klenow Ac ce pte d M an us cri pt Fragment (3’5’ exo-) (NEB) in 1X NEBuffer 2 at 37°C for 30 minutes (cite). .. Double stranded DNA was purified using the E.Z.N.A Cycle-Pure Kit (Omega Bio-Tek) then PCR amplified for 13 cycles using 200 µM dNTPs, 240 µM TruSeq Indexed Adapters (AD001; AD003; AD008; AD009), 240 µM TruSeq Universal Adapter (5’- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’) and 0.025 U Taq DNA Polymerase (NEB) in 1X Standard Taq Reaction Buffer (NEB).

    Incubation:

    Article Title: Identifying cis elements for spatio-temporal control of mammalian DNA replication
    Article Snippet: .. Hi-C libraries were divided into 8 tubes, and 5μg of Hi-C library with 0.5μl 10 mg/ml BSA, 5μl 10× NEBuffer 2, 2μl 2.5mM dATP, and 5μl T4 DNA polymerase (NEB M0203L) were added and incubated at 20°C for 4 hours. ..

    other:

    Article Title: A single quantum dot-based nanosensor with multilayer of multiple acceptors for ultrasensitive detection of human alkyladenine DNA glycosylase single quantum dot-based nanosensor with multilayer of multiple acceptors for ultrasensitive detection of human alkyladenine DNA glycosylase †Electronic supplementary information (ESI) available. See DOI: 10.1039/c9sc02137j
    Article Snippet: Human alkyladenine DNA glycosylase (hAAG), human apurinic/apyrimidinic endonuclease 1 (APE1), Klenow fragment (3′ → 5′ exo– ), human 8-oxoguanine-DNA glycosylase 1 (hOGG1), uracil DNA glycosylase (UDG), T4 polynucleotide kinase (PNK), 10× NEBuffer 2 (500 mM NaCl, 100 mM Tris–HCl, 100 mM MgCl2 , 10 mM DTT, pH 7.9), and 10× NEBuffer 4 (500 mM potassium acetate, 200 mM Tris–acetate, 100 mM magnesium acetate, 10 mM DTT, pH 7.9) were purchased from New England Biolabs (Ipswich, MA, USA).

    Methylation:

    Article Title: Heritable genome-wide variation of gene expression and promoter methylation between wild and domesticated chickens
    Article Snippet: .. Positive control samples were synthesized by in vitro methylation, using a nuclease-free water diluted reaction mix of 16.5 μl, including an all bird pool of 1 μg DNA, 2 μl 10× NEBuffer2, 2 μl SAM (640 μM), 1 μl SssI methylase (4 U/μl) (New England BioLabs Inc.). .. Negative control samples were synthesized by whole genome amplification on the same all bird DNA pool (10-20 ng/μl) as for the positive control using the REPLI-g Mini Kit (Qiagen).

    Polymerase Chain Reaction:

    Article Title: Simplified CRISPR tools for efficient genome editing and streamlined protocols for their delivery into mammalian cells and mouse zygotes
    Article Snippet: .. We prefer to do this in a PCR thermal cycler, using the program: Ramp Rate 1 – 95–85 °C = −2 °C/s Ramp Rate 2 – 85–25 °C = −0.3 °C/s T7EI is diluted by taking 1 μL (10 U/μL stock) and adding 1 μL 10X NEBuffer 2 and 8 μL water. .. Digest heteroduplexes with 2 μL of diluted T7EI (2 U) with incubation at 37 °C for 60 min. Cleavage products can be visualized by agarose gel electrophoresis (or any other method that can separate DNA fragments in this size range).

    Article Title: The Carnivorous Pale Pitcher Plant Harbors Diverse, Distinct, and Time-Dependent Bacterial Communities ▿The Carnivorous Pale Pitcher Plant Harbors Diverse, Distinct, and Time-Dependent Bacterial Communities ▿ †
    Article Snippet: .. Twenty microliters of cleaned PCR product was digested using the restriction enzyme HaeIII (10 μl 10× NEBuffer 2, 0.5 μl HaeIII enzyme [New England Biolabs, Ipswich, MA], 69.5 μl water) for 4 h at 37°C. ..

    Hi-C:

    Article Title: Identifying cis elements for spatio-temporal control of mammalian DNA replication
    Article Snippet: .. Hi-C libraries were divided into 8 tubes, and 5μg of Hi-C library with 0.5μl 10 mg/ml BSA, 5μl 10× NEBuffer 2, 2μl 2.5mM dATP, and 5μl T4 DNA polymerase (NEB M0203L) were added and incubated at 20°C for 4 hours. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs cutsmart buffer
    Experimental results for exonuclease combinations treatment. ( A ) The cleavage mechanism of Lamada and Exonuclease I combinations. Other exonuclease combinations (Lambda and RecJF; Exonuclease I and Exonuclease III) are shown in Supplementary Figure S1A and Supplementary Table S1 . ( B ) Three exonuclease combinations (LRL; LRC; LIC) removed linear DNA from a paradigm mixture. M, 1 kb DNA ladder; P, pGL4.23 plasmid; L, linearized plasmid; X, mixture (plasmid and linear DNA 1:1); 1-X, LRL-Mixture, LRL to cut mixture; 2-X, LRC-Mixture, LRC to cut mixture; 3-X, LIC-Mixture, LIC to cut mixture; 3-P, LIC to cut plasmid; 3-L, LIC-Lin, LIC to cut linearized plasmid; MS, supercoiled ladder. ( C ) I+III combination and Exonuclease VIII, truncated elimination tests. 5-X, VIII4-Mixture, Exonuclease VIII, truncated within Buffer 4 to remove mixture; 6-X, VIIIC-Mixture, Exonuclease VIII, truncated within <t>CutSmart</t> buffer to remove mixture; 4-X: I+III-Mixture, I+III to remove mixture. Loading samples for agarose gel electrophoresis were purified by phenol-chloroform.
    Cutsmart Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cutsmart buffer/product/New England Biolabs
    Average 99 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    cutsmart buffer - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    94
    New England Biolabs methyltransferase buffer
    Single-Molecule Detection of CMG Pausing at a Lagging-Strand <t>Methyltransferase</t> Block (A) Schematic representation of experimental approach used in single-molecule DNA unwinding assays. (B) Images of a sample field of view showing accumulation of EGFP-RPA fluorescence signal at different time points from the addition of EGFP-RPA into the chamber. (C) Example unwinding traces of DNA substrates without a protein barrier. Traces exhibit a signal drop upon completion of unwinding due to dissociation of the leading-strand template (depicted in A). (D) Distribution of average fork rates measured in fully unwound substrates without MH (black) and after bypassing MH Lag (blue). Number of molecules are n(-MH) = 199, n(MH Lag after pause) = 20. (E) Sample unwinding traces of DNA substrates modified with MH Lag . Pausing observed at 800 bp is highlighted with gray rectangle. (F) Distribution of pause durations observed in molecules exhibiting a pausing event (n = 109). The solid line is a fit to a single exponential. See also Figure S6 .
    Methyltransferase Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/methyltransferase buffer/product/New England Biolabs
    Average 94 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    methyltransferase buffer - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    92
    New England Biolabs ck2 buffer
    Phosphorylation of PACSIN 1 at serine 358 by <t>CK2.</t> A , scheme of PACSIN 1 represents its domain structure and location of Ser 358 . B , recombinant wild-type PACSIN 1 ( P1 wt ) and PACSIN 1 S358A ( P1 S358A ) were purified as GST fusion proteins, and GST was removed by proteolytic cleavage. The proteins were incubated with CK2 and [γ- 32 P]ATP for 20 min and analyzed by SDS-PAGE. The SDS-polyacrylamide gel was stained with Coomassie Brilliant Blue, dried, and exposed to an x-ray film. C , recombinant proteins including GST and an unrelated mutant PACSIN 1 T25A ( P1 T25A ) as controls were incubated with (+) or without (−) CK2, resolved by native PAGE, and immunoblotted with antibodies specific for PACSIN 1 or PACSIN 1 pS358. D , for kinetic analysis wild-type PACSIN 1 (P1 wt) was incubated with CK2 for the indicated time periods, separated by native PAGE and immunoblotted ( WB ) for PACSIN 1.
    Ck2 Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ck2 buffer/product/New England Biolabs
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    ck2 buffer - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    Image Search Results


    Experimental results for exonuclease combinations treatment. ( A ) The cleavage mechanism of Lamada and Exonuclease I combinations. Other exonuclease combinations (Lambda and RecJF; Exonuclease I and Exonuclease III) are shown in Supplementary Figure S1A and Supplementary Table S1 . ( B ) Three exonuclease combinations (LRL; LRC; LIC) removed linear DNA from a paradigm mixture. M, 1 kb DNA ladder; P, pGL4.23 plasmid; L, linearized plasmid; X, mixture (plasmid and linear DNA 1:1); 1-X, LRL-Mixture, LRL to cut mixture; 2-X, LRC-Mixture, LRC to cut mixture; 3-X, LIC-Mixture, LIC to cut mixture; 3-P, LIC to cut plasmid; 3-L, LIC-Lin, LIC to cut linearized plasmid; MS, supercoiled ladder. ( C ) I+III combination and Exonuclease VIII, truncated elimination tests. 5-X, VIII4-Mixture, Exonuclease VIII, truncated within Buffer 4 to remove mixture; 6-X, VIIIC-Mixture, Exonuclease VIII, truncated within CutSmart buffer to remove mixture; 4-X: I+III-Mixture, I+III to remove mixture. Loading samples for agarose gel electrophoresis were purified by phenol-chloroform.

    Journal: Nucleic Acids Research

    Article Title: Exonuclease combinations reduce noises in 3D genomics technologies

    doi: 10.1093/nar/gkaa106

    Figure Lengend Snippet: Experimental results for exonuclease combinations treatment. ( A ) The cleavage mechanism of Lamada and Exonuclease I combinations. Other exonuclease combinations (Lambda and RecJF; Exonuclease I and Exonuclease III) are shown in Supplementary Figure S1A and Supplementary Table S1 . ( B ) Three exonuclease combinations (LRL; LRC; LIC) removed linear DNA from a paradigm mixture. M, 1 kb DNA ladder; P, pGL4.23 plasmid; L, linearized plasmid; X, mixture (plasmid and linear DNA 1:1); 1-X, LRL-Mixture, LRL to cut mixture; 2-X, LRC-Mixture, LRC to cut mixture; 3-X, LIC-Mixture, LIC to cut mixture; 3-P, LIC to cut plasmid; 3-L, LIC-Lin, LIC to cut linearized plasmid; MS, supercoiled ladder. ( C ) I+III combination and Exonuclease VIII, truncated elimination tests. 5-X, VIII4-Mixture, Exonuclease VIII, truncated within Buffer 4 to remove mixture; 6-X, VIIIC-Mixture, Exonuclease VIII, truncated within CutSmart buffer to remove mixture; 4-X: I+III-Mixture, I+III to remove mixture. Loading samples for agarose gel electrophoresis were purified by phenol-chloroform.

    Article Snippet: Linearized plasmid DNA was obtained in the following 200 μl solution/per reaction, including 23.4 μl plasmid, 5 μl BamHI-HF (HindIII for P2) (NEB), 20 μl 10× Cutsmart Buffer (NEBuffer 2 for P2) and 151.6 μl H2 O.

    Techniques: Plasmid Preparation, Agarose Gel Electrophoresis, Purification

    Single-Molecule Detection of CMG Pausing at a Lagging-Strand Methyltransferase Block (A) Schematic representation of experimental approach used in single-molecule DNA unwinding assays. (B) Images of a sample field of view showing accumulation of EGFP-RPA fluorescence signal at different time points from the addition of EGFP-RPA into the chamber. (C) Example unwinding traces of DNA substrates without a protein barrier. Traces exhibit a signal drop upon completion of unwinding due to dissociation of the leading-strand template (depicted in A). (D) Distribution of average fork rates measured in fully unwound substrates without MH (black) and after bypassing MH Lag (blue). Number of molecules are n(-MH) = 199, n(MH Lag after pause) = 20. (E) Sample unwinding traces of DNA substrates modified with MH Lag . Pausing observed at 800 bp is highlighted with gray rectangle. (F) Distribution of pause durations observed in molecules exhibiting a pausing event (n = 109). The solid line is a fit to a single exponential. See also Figure S6 .

    Journal: Cell Reports

    Article Title: Dynamics of the Eukaryotic Replicative Helicase at Lagging-Strand Protein Barriers Support the Steric Exclusion Model

    doi: 10.1016/j.celrep.2019.01.086

    Figure Lengend Snippet: Single-Molecule Detection of CMG Pausing at a Lagging-Strand Methyltransferase Block (A) Schematic representation of experimental approach used in single-molecule DNA unwinding assays. (B) Images of a sample field of view showing accumulation of EGFP-RPA fluorescence signal at different time points from the addition of EGFP-RPA into the chamber. (C) Example unwinding traces of DNA substrates without a protein barrier. Traces exhibit a signal drop upon completion of unwinding due to dissociation of the leading-strand template (depicted in A). (D) Distribution of average fork rates measured in fully unwound substrates without MH (black) and after bypassing MH Lag (blue). Number of molecules are n(-MH) = 199, n(MH Lag after pause) = 20. (E) Sample unwinding traces of DNA substrates modified with MH Lag . Pausing observed at 800 bp is highlighted with gray rectangle. (F) Distribution of pause durations observed in molecules exhibiting a pausing event (n = 109). The solid line is a fit to a single exponential. See also Figure S6 .

    Article Snippet: 5FdC-modified fork templates were mixed with HpaII methyltransferase (M.HpaII) in 1:4 DNA to protein molar ratio in methyltransferase buffer (50 mM Tris-HCl, pH 7.5, 0.5 mM 2-mercaptoethanol (β-ME), 10 mM EDTA, NEB) supplemented with 100 μM S-adenosylmethionine (NEB), and incubated at 37°C for 3 hours.

    Techniques: Blocking Assay, Recombinase Polymerase Amplification, Fluorescence, Modification

    Phosphorylation of PACSIN 1 at serine 358 by CK2. A , scheme of PACSIN 1 represents its domain structure and location of Ser 358 . B , recombinant wild-type PACSIN 1 ( P1 wt ) and PACSIN 1 S358A ( P1 S358A ) were purified as GST fusion proteins, and GST was removed by proteolytic cleavage. The proteins were incubated with CK2 and [γ- 32 P]ATP for 20 min and analyzed by SDS-PAGE. The SDS-polyacrylamide gel was stained with Coomassie Brilliant Blue, dried, and exposed to an x-ray film. C , recombinant proteins including GST and an unrelated mutant PACSIN 1 T25A ( P1 T25A ) as controls were incubated with (+) or without (−) CK2, resolved by native PAGE, and immunoblotted with antibodies specific for PACSIN 1 or PACSIN 1 pS358. D , for kinetic analysis wild-type PACSIN 1 (P1 wt) was incubated with CK2 for the indicated time periods, separated by native PAGE and immunoblotted ( WB ) for PACSIN 1.

    Journal: The Journal of Biological Chemistry

    Article Title: Casein Kinase 2 Phosphorylation of Protein Kinase C and Casein Kinase 2 Substrate in Neurons (PACSIN) 1 Protein Regulates Neuronal Spine Formation *

    doi: 10.1074/jbc.M113.461293

    Figure Lengend Snippet: Phosphorylation of PACSIN 1 at serine 358 by CK2. A , scheme of PACSIN 1 represents its domain structure and location of Ser 358 . B , recombinant wild-type PACSIN 1 ( P1 wt ) and PACSIN 1 S358A ( P1 S358A ) were purified as GST fusion proteins, and GST was removed by proteolytic cleavage. The proteins were incubated with CK2 and [γ- 32 P]ATP for 20 min and analyzed by SDS-PAGE. The SDS-polyacrylamide gel was stained with Coomassie Brilliant Blue, dried, and exposed to an x-ray film. C , recombinant proteins including GST and an unrelated mutant PACSIN 1 T25A ( P1 T25A ) as controls were incubated with (+) or without (−) CK2, resolved by native PAGE, and immunoblotted with antibodies specific for PACSIN 1 or PACSIN 1 pS358. D , for kinetic analysis wild-type PACSIN 1 (P1 wt) was incubated with CK2 for the indicated time periods, separated by native PAGE and immunoblotted ( WB ) for PACSIN 1.

    Article Snippet: Samples of recombinant proteins (0.5 μg) were incubated at 30 °C for the indicated time periods in CK2 buffer (20 m m Tris, pH 7.5, 50 m m KCl, 10 m m MgCl2 with 200 μ m ATP (or 125 μ m ATP + 0.2 megabecquerel of [γ-32 P]ATP)) and 250 units of CK2 (New England Biolabs).

    Techniques: Recombinant, Purification, Incubation, SDS Page, Staining, Mutagenesis, Clear Native PAGE, Western Blot

    Reduced spine formation in the presence of the PACSIN 1 S358A mutant or after CK2 inhibition. A , rat hippocampal neurons were transfected with either PACSIN 1 wt ( left ). the mutant protein S358A ( right ) or the mutant protein S358D (data not shown) in combination with EGFP to visualize spines ( upper panel ). Enlargements of three dendrite segments of neurons transfected with either PACSIN 1 wt ( left ) or S358A mutant ( right ) are shown. Fewer spines can be detected in neurons expressing PACSIN 1 S358A ( lower panel ). B , quantification of two independent experiments. For each group five dendrites were counted on each of 12 cells, n = 60 dendrites; **, p

    Journal: The Journal of Biological Chemistry

    Article Title: Casein Kinase 2 Phosphorylation of Protein Kinase C and Casein Kinase 2 Substrate in Neurons (PACSIN) 1 Protein Regulates Neuronal Spine Formation *

    doi: 10.1074/jbc.M113.461293

    Figure Lengend Snippet: Reduced spine formation in the presence of the PACSIN 1 S358A mutant or after CK2 inhibition. A , rat hippocampal neurons were transfected with either PACSIN 1 wt ( left ). the mutant protein S358A ( right ) or the mutant protein S358D (data not shown) in combination with EGFP to visualize spines ( upper panel ). Enlargements of three dendrite segments of neurons transfected with either PACSIN 1 wt ( left ) or S358A mutant ( right ) are shown. Fewer spines can be detected in neurons expressing PACSIN 1 S358A ( lower panel ). B , quantification of two independent experiments. For each group five dendrites were counted on each of 12 cells, n = 60 dendrites; **, p

    Article Snippet: Samples of recombinant proteins (0.5 μg) were incubated at 30 °C for the indicated time periods in CK2 buffer (20 m m Tris, pH 7.5, 50 m m KCl, 10 m m MgCl2 with 200 μ m ATP (or 125 μ m ATP + 0.2 megabecquerel of [γ-32 P]ATP)) and 250 units of CK2 (New England Biolabs).

    Techniques: Mutagenesis, Inhibition, Transfection, Expressing

    Model of the mechanism by which PACSIN 1 affects spine formation. A , in the absence of BDNF, overexpression of PACSIN 1 S358A or inhibition of CK2 supports a stable Rac1-NADRIN-PACSIN 1 complex which leads to Rac1 GTP hydrolysis. B , in the presence of BDNF higher levels of activated CK2 phosphorylate PACSIN 1 at Ser 358 which causes a destabilization of the protein complex. This leads to higher concentrations of Rac1 GTP which induces spine formation. TrkB , tropomyosin-related kinase B.

    Journal: The Journal of Biological Chemistry

    Article Title: Casein Kinase 2 Phosphorylation of Protein Kinase C and Casein Kinase 2 Substrate in Neurons (PACSIN) 1 Protein Regulates Neuronal Spine Formation *

    doi: 10.1074/jbc.M113.461293

    Figure Lengend Snippet: Model of the mechanism by which PACSIN 1 affects spine formation. A , in the absence of BDNF, overexpression of PACSIN 1 S358A or inhibition of CK2 supports a stable Rac1-NADRIN-PACSIN 1 complex which leads to Rac1 GTP hydrolysis. B , in the presence of BDNF higher levels of activated CK2 phosphorylate PACSIN 1 at Ser 358 which causes a destabilization of the protein complex. This leads to higher concentrations of Rac1 GTP which induces spine formation. TrkB , tropomyosin-related kinase B.

    Article Snippet: Samples of recombinant proteins (0.5 μg) were incubated at 30 °C for the indicated time periods in CK2 buffer (20 m m Tris, pH 7.5, 50 m m KCl, 10 m m MgCl2 with 200 μ m ATP (or 125 μ m ATP + 0.2 megabecquerel of [γ-32 P]ATP)) and 250 units of CK2 (New England Biolabs).

    Techniques: Over Expression, Inhibition