bsshii  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    BssHII
    Description:
    BssHII 2 500 units
    Catalog Number:
    R0199L
    Price:
    277
    Size:
    2 500 units
    Category:
    Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs bsshii
    BssHII
    BssHII 2 500 units
    https://www.bioz.com/result/bsshii/product/New England Biolabs
    Average 99 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    bsshii - by Bioz Stars, 2019-12
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Forced Selection of tRNAGlu Reveals the Importance of Two Adenosine-Rich RNA Loops Within the U5-PBS for SIVsmmPBj Replication
    Article Snippet: The proviral clones pHXB2(Glu) and pHXB2(Glu Loop 1) were digested with the restriction enzymes Hpa I and BssH II (New England Biolabs, Beverly, MA) to release a 868 base pair fragment containing the 5' long terminal repeat, PBS, and leader region of gag . .. The proviral clones pHXB2(Glu) and pHXB2(Glu Loop 1) were digested with the restriction enzymes Hpa I and BssH II (New England Biolabs, Beverly, MA) to release a 868 base pair fragment containing the 5' long terminal repeat, PBS, and leader region of gag .

    Article Title: A bacterial reporter panel for the detection and classification of antibiotic substances
    Article Snippet: Plasmid pBRlux‐trp bearing trpED was constructed based on the low‐copy plasmid pBR2TTS that harbours the Photorhabdus luminescens luxCDABE genes downstream of a multiple cloning site ( ). .. The PCR products were cut with restriction enzyme BSSHII (New England Biolabs, USA), and ligated into the pBR2TTS vector already harbouring trpE (T4 DNA ligase, Fermentas ), which was first transformed into E. coli DH5α and then transferred to E. coli SM301.

    Article Title: Genomics analysis of potassium channel genes in songbirds reveals molecular specializations of brain circuits for the maintenance and production of learned vocalizations
    Article Snippet: We performed a similar analysis for ESTs containing known or predicted protein coding sequence and only selected clones that could be aligned to a single unambiguous locus. .. Briefly, we first isolated plasmid DNA from the Songbird ESTIMA cDNA clone collection, digested out the cDNA insert with a BSSHII restriction enzyme (New England Biolabs; Ipswich, MA), and twice purified the template with a GeneJet (Fermentas, NJ) or Qiagen PCR purification kit (Qiagen Inc., Valencia, CA).

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: Paragraph title: Cloning and expression of recombinant monoclonal antibodies ... Restriction digestion of full length HC and LC inserts and expression vectors (pCMV-CD30-4IE3_HC and pCMV-CD30-4IE3_LC) was performed with the restriction enzymes BssHII, NheI and HindIII (New England Biolabs).

    Article Title: BRAIN EXPRESSION AND SONG REGULATION OF THE CHOLECYSTOKININ GENE IN THE ZEBRA FINCH (TAENIOPYGIA GUTTATA)
    Article Snippet: Digoxygenin-(DIG)-, fluorescein- or 33 P-labeled riboprobes were synthesized using previously established protocols ( ; ). .. For clones from the ESTIMA zebra finch brain cDNA collection , isolated plasmid DNA was restriction enzyme digested (BSSHII; New England Biolabs; Ipswich, MA) to release the insert template, and twice purified with Qiagen’s PCR purification kit (Qiagen Inc., Valencia, CA). .. Plasmid containing a ~700 bp fragment of the zebra finch homologue of the 65-kDa isoform of glutamic acid decarboxylase ( Gad65 ; Genbank accession ; ) was also isolated, restriction enzyme digested and twice purified as for the ESTIMA clones.

    Article Title: Genome Evolution and the Emergence of Fruiting Body Development in Myxococcus xanthus
    Article Snippet: Paragraph title: Cloning of M. xanthus genomic DNA flanking magellan -4 insertions ... Genomic DNA (0.5 µg) was digested with BssHII (New England Biolabs) in a total volume of 20 µl and digestions were dialyzed on a 0.025 µm pore size filter (Millipore) against distilled water for 30 min (drop dialysis).

    Article Title: Self-reactive IgE exacerbates interferon responses associated with autoimmunity
    Article Snippet: The human dsDNA-specific IgG clone E11 (IgGD ) was generated as previously described . .. To generate the human dsDNA-specific IgE (IgED ), E11 variable regions were cloned by restriction digestion using BssHII and SalI enzymes from New England Biolabs and ligated into an IgE Orip/EBNA-1-based episomal mammalian expression vector pOE (MedImmune LLC). .. A human IgE specific for metapneumovirus (hMPV) was generated in a similar fashion to be used as an isotype control (IgEI ).

    Article Title: Serotonin, via HTR2 receptors, excites neurons in a cortical-like pre-motor nucleus necessary for song learning and production
    Article Snippet: Briefly, clones corresponding to HTR2A (GenBank accession code: ), HTR2B ( ) and HTR2C ( ) were obtained from the ESTIMA zebra finch brain cDNA collection ( ). .. Plasmid DNA was extracted (GeneJET Plasmid Miniprep kit; Fermentas, Glen Burnie, MD), restriction enzyme digested (BSSHII; New England Biolabs; Ipswich, MA) to release the insert template, and twice purified with a PCR purification kit (GeneJET PCR Purification Kit).

    Article Title: From deep sequencing to actual clones
    Article Snippet: Briefly, the phage plasmid prep output was digested with BssHII/NheI (NEB) for 4 h at 37°C, then gel extracted and ligated with 1 μg of a pEP vector carrying compatible ends. .. The blunt-end ligation of the HCDR3-specific inverse PCR was then transformed into BL21(DE3)Gold cells to allow subsequent expression of the soluble scFv.

    Centrifugation:

    Article Title: Genome Evolution and the Emergence of Fruiting Body Development in Myxococcus xanthus
    Article Snippet: A 1 ml cell culture was harvested by centrifugation and resuspended in 0.2 ml of 1X PBS buffer [8 g NaCl, 0.2 g KCl, 1.44 g Na2 PO4 and 0.24 g KH2 PO4 in 1000 ml distilled H2 O, pH 7.4]. .. Genomic DNA (0.5 µg) was digested with BssHII (New England Biolabs) in a total volume of 20 µl and digestions were dialyzed on a 0.025 µm pore size filter (Millipore) against distilled water for 30 min (drop dialysis).

    Amplification:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: The DNA fragment containing the CMV promoter, the EGFP gene, and the SV40 polyadenylation (poly(A)) signal was amplified by PCR, using PrimeSTAR Max DNA polymerase (Takara Bio), the pEGFP-C1 vector (Takara Bio USA), and two primers with the sequences of 5′-d(GGG GCGCGC GGACAAACCACAACTAGAATG)-3′ and 5′-d(CCC GCGCGC TAGTTATTAATAGTAATCAAT)-3′, in which the underlines indicate the Bss HII sites. .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively).

    Article Title: Hybrid mouse-prokaryotic DNA (cytosine-5) methyltransferases retain the specificity of the parental C-terminal domain
    Article Snippet: The amplified DNA was phenol–chloroform extracted and digested with Bss HII and Eco RI. .. The digested products were run on a low melting point agarose gel and the band of interest was purified using Geneclean II (Bio 101) and ligated into pLit29, which had been pre-digested with Bss HII and Eco RI (NEB).

    Article Title: Deletions in the Transmembrane Domain of a Sindbis Virus Glycoprotein Alter Virus Infectivity, Stability, and Host Range
    Article Snippet: After the desired mutations were made by either method and confirmed by sequencing, they were subcloned into the Y420 vector using the Bcl I and BssH II (New England Biolabs, Beverly, Mass.) unique sites. .. After confirmation of the correct sequence throughout the insert, infectious RNA was transcribed in vitro using SP6 RNA polymerase (New England Biolabs) and introduced into cells by electroporation as described below and in reference .

    Article Title: A bacterial reporter panel for the detection and classification of antibiotic substances
    Article Snippet: The PCR products were cut with restriction enzyme BSSHII (New England Biolabs, USA), and ligated into the pBR2TTS vector already harbouring trpE (T4 DNA ligase, Fermentas ), which was first transformed into E. coli DH5α and then transferred to E. coli SM301. .. The antibiotic selectivity marker present on the plasmid, ampicillin resistance gene (bla ), was eliminated by a frameshift mutation using bla‐long and bla‐pstI primers (Table S1).

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: Restriction digestion of full length HC and LC inserts and expression vectors (pCMV-CD30-4IE3_HC and pCMV-CD30-4IE3_LC) was performed with the restriction enzymes BssHII, NheI and HindIII (New England Biolabs). .. The resulting products were loaded on 2% TBE-agarose gels and bands of ~ 5.9 kb for the HC vector backbone, 5.3 kb for the LC vector backbone, ~ 370 bp for HC inserts, and ~ 340 bp for LC inserts were size-selected on agarose gels and purified as described above.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Assessment of antibody library diversity through next generation sequencing and technical error compensation
    Article Snippet: A third single domain “nanobody” library (hVH) was created using only the VH domains, amplified in a single reaction. .. At the end of each library construction, the assembled VH-VL DNA products for hscFv1 and hscFv2, or the VH products for hVH, were ligated in the pLinker220 vector [ ] for yeast expression in the SPLINT format, using restriction sites BssHII/NheI (NEB).

    Article Title: From deep sequencing to actual clones
    Article Snippet: After amplification, the correct PCR product was gel extracted and purified (Qiaquick Gel extraction kit, Qiagen) to avoid contamination from the original plasmid template. .. Briefly, the phage plasmid prep output was digested with BssHII/NheI (NEB) for 4 h at 37°C, then gel extracted and ligated with 1 μg of a pEP vector carrying compatible ends.

    Synthesized:

    Article Title: BRAIN EXPRESSION AND SONG REGULATION OF THE CHOLECYSTOKININ GENE IN THE ZEBRA FINCH (TAENIOPYGIA GUTTATA)
    Article Snippet: Digoxygenin-(DIG)-, fluorescein- or 33 P-labeled riboprobes were synthesized using previously established protocols ( ; ). .. For clones from the ESTIMA zebra finch brain cDNA collection , isolated plasmid DNA was restriction enzyme digested (BSSHII; New England Biolabs; Ipswich, MA) to release the insert template, and twice purified with Qiagen’s PCR purification kit (Qiagen Inc., Valencia, CA).

    Article Title: Assessment of antibody library diversity through next generation sequencing and technical error compensation
    Article Snippet: The scFvs were excised from the library plasmid (~8μg of the library were digested 3h 37°C with 4U of NheI (NEB), 3h 50°C with 4U of BssHII (NEB)) and ligated to the adapters (forward adapter: scFv: reverse adapter in 10:1:10 ratio, ~200–250 ng library 400U T4 ligase (NEB), O/N 16°C). .. The scFvs were excised from the library plasmid (~8μg of the library were digested 3h 37°C with 4U of NheI (NEB), 3h 50°C with 4U of BssHII (NEB)) and ligated to the adapters (forward adapter: scFv: reverse adapter in 10:1:10 ratio, ~200–250 ng library 400U T4 ligase (NEB), O/N 16°C).

    Article Title: Serotonin, via HTR2 receptors, excites neurons in a cortical-like pre-motor nucleus necessary for song learning and production
    Article Snippet: Digoxygenin-(DIG)-labeled riboprobes were synthesized using established protocols ( ). .. Plasmid DNA was extracted (GeneJET Plasmid Miniprep kit; Fermentas, Glen Burnie, MD), restriction enzyme digested (BSSHII; New England Biolabs; Ipswich, MA) to release the insert template, and twice purified with a PCR purification kit (GeneJET PCR Purification Kit).

    Cytometry:

    Article Title: From deep sequencing to actual clones
    Article Snippet: Briefly, the phage plasmid prep output was digested with BssHII/NheI (NEB) for 4 h at 37°C, then gel extracted and ligated with 1 μg of a pEP vector carrying compatible ends. .. Before carrying out binding assays, single clones for each transformation were analyzed by Sanger sequencing in order to confirm the presence of the correct HCDR3 and obtain the sequence of the full-length scFv.

    Construct:

    Article Title: A bacterial reporter panel for the detection and classification of antibiotic substances
    Article Snippet: Plasmid pBRlux‐trp bearing trpED was constructed based on the low‐copy plasmid pBR2TTS that harbours the Photorhabdus luminescens luxCDABE genes downstream of a multiple cloning site ( ). .. The PCR products were cut with restriction enzyme BSSHII (New England Biolabs, USA), and ligated into the pBR2TTS vector already harbouring trpE (T4 DNA ligase, Fermentas ), which was first transformed into E. coli DH5α and then transferred to E. coli SM301.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Real-time Polymerase Chain Reaction:

    Article Title: Molecular Dissection of the Essential Features of the Origin of Replication of the Second Vibrio cholerae Chromosome
    Article Snippet: The entirety of both Minipreps was digested with BstAPI, BssHII, and NaeI (NEB). .. The mutant libraries were then prepared for sequencing with the Nextera XT DNA sample preparation kit and indices from the Nextera XT Index kit (Illumina).

    Incubation:

    Article Title: Recrudescent Campylobacter jejuni Infection in an Immunocompetent Adult following Experimental Infection with a Well-Characterized Organism
    Article Snippet: The plugs were resuspended in 1 ml of 1× restriction buffer for 1 h at room temperature. .. The plugs were removed and put into 500 μl of fresh restriction buffer and BssHII enzyme (8 U; New England Biolabs, Beverly, MA), and the mixture was incubated overnight at 37°C. .. Pulsed-field gel electrophoresis (PFGE) was done with a contour-clamped homogeneous electric field (CHEF) apparatus (Bio-Rad) ( ).

    Article Title: Genome Evolution and the Emergence of Fruiting Body Development in Myxococcus xanthus
    Article Snippet: Genomic DNA (0.5 µg) was digested with BssHII (New England Biolabs) in a total volume of 20 µl and digestions were dialyzed on a 0.025 µm pore size filter (Millipore) against distilled water for 30 min (drop dialysis). .. 8 µl of this DNA was treated with T4 DNA ligase (Promega) and drop-dialyzed before electroporation into E. coli host CC118 .

    Article Title: CD44posCD49fhiCD133/2hi Defines Xenograft-Initiating Cells in Estrogen Receptor-Negative Breast Cancer
    Article Snippet: Alterations in DNA methylation were evaluated via a modified cytosine extension assay ( ). .. Briefly, duplicate tubes containing 50 ng of genomic DNA [isolated via Trizol (Invitrogen) from live sorted xenografts] were digested overnight with a 10-fold excess of HpaII or BssHII endonuclease (New England Biolabs); in addition, one tube was incubated without restriction enzyme addition and served as a nonspecific background control. .. The 35-µL nucleotide extension reaction [containing 50 ng of DNA, 1× PCR buffer (Invitrogen), 1.0 mmol/L MgCl2 , 0.35 unit of Taq DNA polymerase (Invitrogen), and 8.0 µCi [32 P]dCTP (Perkin-Elmer)] was incubated at 72°C for 2 hours.

    Activity Assay:

    Article Title: From deep sequencing to actual clones
    Article Snippet: The inverse PCR was carried out using a highly processive and high-fidelity polymerase with proof-reading activity (Phusion High Fidelity Polymerase, NEB) and 0.1 ng of template DNA (100–1000 times the diversity of the selection output). .. Briefly, the phage plasmid prep output was digested with BssHII/NheI (NEB) for 4 h at 37°C, then gel extracted and ligated with 1 μg of a pEP vector carrying compatible ends.

    Expressing:

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: Thermocycling conditions were as follows: initial denaturation at 98 °C for 3 min, then 16 cycles of denaturation at 98 °C for 30 s, annealing at 69 °C for 30 s and extension at 72 °C for 1 min, followed by a final extension step at 72 °C for 5 min. PCR products were separated on a TBE-agarose gel, full-length HC and LC amplicons with restriction digestion sites were extracted from the gel using the Zymoclean Gel DNA Recovery Kit (Zymo Research) and products were stored at − 20 °C until further use. .. Restriction digestion of full length HC and LC inserts and expression vectors (pCMV-CD30-4IE3_HC and pCMV-CD30-4IE3_LC) was performed with the restriction enzymes BssHII, NheI and HindIII (New England Biolabs). .. The resulting products were loaded on 2% TBE-agarose gels and bands of ~ 5.9 kb for the HC vector backbone, 5.3 kb for the LC vector backbone, ~ 370 bp for HC inserts, and ~ 340 bp for LC inserts were size-selected on agarose gels and purified as described above.

    Article Title: Self-reactive IgE exacerbates interferon responses associated with autoimmunity
    Article Snippet: The human dsDNA-specific IgG clone E11 (IgGD ) was generated as previously described . .. To generate the human dsDNA-specific IgE (IgED ), E11 variable regions were cloned by restriction digestion using BssHII and SalI enzymes from New England Biolabs and ligated into an IgE Orip/EBNA-1-based episomal mammalian expression vector pOE (MedImmune LLC). .. A human IgE specific for metapneumovirus (hMPV) was generated in a similar fashion to be used as an isotype control (IgEI ).

    Article Title: Assessment of antibody library diversity through next generation sequencing and technical error compensation
    Article Snippet: A third single domain “nanobody” library (hVH) was created using only the VH domains, amplified in a single reaction. .. At the end of each library construction, the assembled VH-VL DNA products for hscFv1 and hscFv2, or the VH products for hVH, were ligated in the pLinker220 vector [ ] for yeast expression in the SPLINT format, using restriction sites BssHII/NheI (NEB). .. Ligation of each library (~1μg) was transformed by electroporation into Max Efficiency E.coli DH5α cells (Invitrogen).

    Article Title: From deep sequencing to actual clones
    Article Snippet: In contrast, the inverse PCR for the anti- L. acidophilus selections was carried on the plasmid prep of the phage selected scFv population subcloned into a modified pEP expression vector. .. Briefly, the phage plasmid prep output was digested with BssHII/NheI (NEB) for 4 h at 37°C, then gel extracted and ligated with 1 μg of a pEP vector carrying compatible ends.

    Modification:

    Article Title: Deletions in the Transmembrane Domain of a Sindbis Virus Glycoprotein Alter Virus Infectivity, Stability, and Host Range
    Article Snippet: The QuikChange mutants were made in two steps using Pfu polymerase (Stratagene), a modification described by Wang and Malcolm ( ). .. After the desired mutations were made by either method and confirmed by sequencing, they were subcloned into the Y420 vector using the Bcl I and BssH II (New England Biolabs, Beverly, Mass.) unique sites.

    Article Title: From deep sequencing to actual clones
    Article Snippet: In contrast, the inverse PCR for the anti- L. acidophilus selections was carried on the plasmid prep of the phage selected scFv population subcloned into a modified pEP expression vector. .. Briefly, the phage plasmid prep output was digested with BssHII/NheI (NEB) for 4 h at 37°C, then gel extracted and ligated with 1 μg of a pEP vector carrying compatible ends.

    Article Title: CD44posCD49fhiCD133/2hi Defines Xenograft-Initiating Cells in Estrogen Receptor-Negative Breast Cancer
    Article Snippet: Briefly, duplicate tubes containing 50 ng of genomic DNA [isolated via Trizol (Invitrogen) from live sorted xenografts] were digested overnight with a 10-fold excess of HpaII or BssHII endonuclease (New England Biolabs); in addition, one tube was incubated without restriction enzyme addition and served as a nonspecific background control. .. Briefly, duplicate tubes containing 50 ng of genomic DNA [isolated via Trizol (Invitrogen) from live sorted xenografts] were digested overnight with a 10-fold excess of HpaII or BssHII endonuclease (New England Biolabs); in addition, one tube was incubated without restriction enzyme addition and served as a nonspecific background control.

    Transformation Assay:

    Article Title: A bacterial reporter panel for the detection and classification of antibiotic substances
    Article Snippet: Then, primers carrying a BSSHII restriction site, designed for trpD , were used to PCR‐amplify this region from the E. coli MG1655 genome (Table S1). .. The PCR products were cut with restriction enzyme BSSHII (New England Biolabs, USA), and ligated into the pBR2TTS vector already harbouring trpE (T4 DNA ligase, Fermentas ), which was first transformed into E. coli DH5α and then transferred to E. coli SM301. .. Tryptophan synthesis capability was verified by growing the bacteria on enriched M9 medium lacking this amino acid.

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: Restriction digestion of full length HC and LC inserts and expression vectors (pCMV-CD30-4IE3_HC and pCMV-CD30-4IE3_LC) was performed with the restriction enzymes BssHII, NheI and HindIII (New England Biolabs). .. The resulting products were loaded on 2% TBE-agarose gels and bands of ~ 5.9 kb for the HC vector backbone, 5.3 kb for the LC vector backbone, ~ 370 bp for HC inserts, and ~ 340 bp for LC inserts were size-selected on agarose gels and purified as described above.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs). .. After digestion, all three fragments were joined via MightyMix ligation (TAKARA); in the resulting construct the ERE reporter and the ER halves face opposite directions, it was termed pRC21-estrogensensor.

    Article Title: Molecular Dissection of the Essential Features of the Origin of Replication of the Second Vibrio cholerae Chromosome
    Article Snippet: The entirety of both Minipreps was digested with BstAPI, BssHII, and NaeI (NEB). .. The entirety of both Minipreps was digested with BstAPI, BssHII, and NaeI (NEB).

    Article Title: Assessment of antibody library diversity through next generation sequencing and technical error compensation
    Article Snippet: At the end of each library construction, the assembled VH-VL DNA products for hscFv1 and hscFv2, or the VH products for hVH, were ligated in the pLinker220 vector [ ] for yeast expression in the SPLINT format, using restriction sites BssHII/NheI (NEB). .. Ligation of each library (~1μg) was transformed by electroporation into Max Efficiency E.coli DH5α cells (Invitrogen).

    Article Title: From deep sequencing to actual clones
    Article Snippet: One hundred ng of the purified product were blunt-end ligated with T4 ligase for 2 h at 23°C and transformed into DH5aF′ bacterial cells. .. Briefly, the phage plasmid prep output was digested with BssHII/NheI (NEB) for 4 h at 37°C, then gel extracted and ligated with 1 μg of a pEP vector carrying compatible ends.

    Flow Cytometry:

    Article Title: From deep sequencing to actual clones
    Article Snippet: Briefly, the phage plasmid prep output was digested with BssHII/NheI (NEB) for 4 h at 37°C, then gel extracted and ligated with 1 μg of a pEP vector carrying compatible ends. .. Before carrying out binding assays, single clones for each transformation were analyzed by Sanger sequencing in order to confirm the presence of the correct HCDR3 and obtain the sequence of the full-length scFv.

    Sequencing:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Single colonies were isolated and cultured in LB medium with 50 μg/ml ampicillin (LB Amp) (1 ml) for 6 h. The DNA in each colony was purified with the QIAprep Spin Miniprep Kit (Qiagen) and analyzed by gel electrophoresis after Bss HII treatment (Supplementary Fig. ).

    Article Title: Hybrid mouse-prokaryotic DNA (cytosine-5) methyltransferases retain the specificity of the parental C-terminal domain
    Article Snippet: The reverse primer was designed for the C-terminal nucleotide sequence of the protein and contained the stop codon and an Eco RI site. .. The digested products were run on a low melting point agarose gel and the band of interest was purified using Geneclean II (Bio 101) and ligated into pLit29, which had been pre-digested with Bss HII and Eco RI (NEB).

    Article Title: Deletions in the Transmembrane Domain of a Sindbis Virus Glycoprotein Alter Virus Infectivity, Stability, and Host Range
    Article Snippet: After this first PCR step, 25 μl of each of the sense and antisense reactions was combined into one reaction, 1 μl of Pfu polymerase was added, and the PCR program was repeated in full. .. After the desired mutations were made by either method and confirmed by sequencing, they were subcloned into the Y420 vector using the Bcl I and BssH II (New England Biolabs, Beverly, Mass.) unique sites. .. After confirmation of the correct sequence throughout the insert, infectious RNA was transcribed in vitro using SP6 RNA polymerase (New England Biolabs) and introduced into cells by electroporation as described below and in reference .

    Article Title: A bacterial reporter panel for the detection and classification of antibiotic substances
    Article Snippet: The PCR products were cut with restriction enzyme BSSHII (New England Biolabs, USA), and ligated into the pBR2TTS vector already harbouring trpE (T4 DNA ligase, Fermentas ), which was first transformed into E. coli DH5α and then transferred to E. coli SM301. .. The antibiotic selectivity marker present on the plasmid, ampicillin resistance gene (bla ), was eliminated by a frameshift mutation using bla‐long and bla‐pstI primers (Table S1).

    Article Title: Genomics analysis of potassium channel genes in songbirds reveals molecular specializations of brain circuits for the maintenance and production of learned vocalizations
    Article Snippet: We performed a similar analysis for ESTs containing known or predicted protein coding sequence and only selected clones that could be aligned to a single unambiguous locus. .. Briefly, we first isolated plasmid DNA from the Songbird ESTIMA cDNA clone collection, digested out the cDNA insert with a BSSHII restriction enzyme (New England Biolabs; Ipswich, MA), and twice purified the template with a GeneJet (Fermentas, NJ) or Qiagen PCR purification kit (Qiagen Inc., Valencia, CA).

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: Restriction digestion of full length HC and LC inserts and expression vectors (pCMV-CD30-4IE3_HC and pCMV-CD30-4IE3_LC) was performed with the restriction enzymes BssHII, NheI and HindIII (New England Biolabs). .. Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using instant sticky-end DNA ligase (New England Biolabs) and transformed into one-shot chemically competent E. coli TOP10 cells (IBA) following the manufacturer’s instructions.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Molecular Dissection of the Essential Features of the Origin of Replication of the Second Vibrio cholerae Chromosome
    Article Snippet: The entirety of both Minipreps was digested with BstAPI, BssHII, and NaeI (NEB). .. The entirety of both Minipreps was digested with BstAPI, BssHII, and NaeI (NEB).

    Article Title: Assessment of antibody library diversity through next generation sequencing and technical error compensation
    Article Snippet: Paragraph title: Sequencing sample preparation ... The scFvs were excised from the library plasmid (~8μg of the library were digested 3h 37°C with 4U of NheI (NEB), 3h 50°C with 4U of BssHII (NEB)) and ligated to the adapters (forward adapter: scFv: reverse adapter in 10:1:10 ratio, ~200–250 ng library 400U T4 ligase (NEB), O/N 16°C).

    Article Title: From deep sequencing to actual clones
    Article Snippet: Briefly, the phage plasmid prep output was digested with BssHII/NheI (NEB) for 4 h at 37°C, then gel extracted and ligated with 1 μg of a pEP vector carrying compatible ends. .. The blunt-end ligation of the HCDR3-specific inverse PCR was then transformed into BL21(DE3)Gold cells to allow subsequent expression of the soluble scFv.

    Inverse PCR:

    Article Title: From deep sequencing to actual clones
    Article Snippet: Paragraph title: Primer design and inverse PCR ... Briefly, the phage plasmid prep output was digested with BssHII/NheI (NEB) for 4 h at 37°C, then gel extracted and ligated with 1 μg of a pEP vector carrying compatible ends.

    Ligation:

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Assessment of antibody library diversity through next generation sequencing and technical error compensation
    Article Snippet: The scFvs were excised from the library plasmid (~8μg of the library were digested 3h 37°C with 4U of NheI (NEB), 3h 50°C with 4U of BssHII (NEB)) and ligated to the adapters (forward adapter: scFv: reverse adapter in 10:1:10 ratio, ~200–250 ng library 400U T4 ligase (NEB), O/N 16°C). .. The scFvs were excised from the library plasmid (~8μg of the library were digested 3h 37°C with 4U of NheI (NEB), 3h 50°C with 4U of BssHII (NEB)) and ligated to the adapters (forward adapter: scFv: reverse adapter in 10:1:10 ratio, ~200–250 ng library 400U T4 ligase (NEB), O/N 16°C).

    Article Title: From deep sequencing to actual clones
    Article Snippet: Briefly, the phage plasmid prep output was digested with BssHII/NheI (NEB) for 4 h at 37°C, then gel extracted and ligated with 1 μg of a pEP vector carrying compatible ends. .. The bacteria transformed with the pEP subcloned library were harvested and plasmid DNA was extracted to be used as template for the HCDR3-specific inverse PCR.

    Cell Culture:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Article Title: Deletions in the Transmembrane Domain of a Sindbis Virus Glycoprotein Alter Virus Infectivity, Stability, and Host Range
    Article Snippet: After the desired mutations were made by either method and confirmed by sequencing, they were subcloned into the Y420 vector using the Bcl I and BssH II (New England Biolabs, Beverly, Mass.) unique sites. .. After confirmation of the correct sequence throughout the insert, infectious RNA was transcribed in vitro using SP6 RNA polymerase (New England Biolabs) and introduced into cells by electroporation as described below and in reference .

    Article Title: Genome Evolution and the Emergence of Fruiting Body Development in Myxococcus xanthus
    Article Snippet: A 1 ml cell culture was harvested by centrifugation and resuspended in 0.2 ml of 1X PBS buffer [8 g NaCl, 0.2 g KCl, 1.44 g Na2 PO4 and 0.24 g KH2 PO4 in 1000 ml distilled H2 O, pH 7.4]. .. Genomic DNA (0.5 µg) was digested with BssHII (New England Biolabs) in a total volume of 20 µl and digestions were dialyzed on a 0.025 µm pore size filter (Millipore) against distilled water for 30 min (drop dialysis).

    Liquid Chromatography:

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: Thermocycling conditions were as follows: initial denaturation at 98 °C for 3 min, then 16 cycles of denaturation at 98 °C for 30 s, annealing at 69 °C for 30 s and extension at 72 °C for 1 min, followed by a final extension step at 72 °C for 5 min. PCR products were separated on a TBE-agarose gel, full-length HC and LC amplicons with restriction digestion sites were extracted from the gel using the Zymoclean Gel DNA Recovery Kit (Zymo Research) and products were stored at − 20 °C until further use. .. Restriction digestion of full length HC and LC inserts and expression vectors (pCMV-CD30-4IE3_HC and pCMV-CD30-4IE3_LC) was performed with the restriction enzymes BssHII, NheI and HindIII (New England Biolabs). .. The resulting products were loaded on 2% TBE-agarose gels and bands of ~ 5.9 kb for the HC vector backbone, 5.3 kb for the LC vector backbone, ~ 370 bp for HC inserts, and ~ 340 bp for LC inserts were size-selected on agarose gels and purified as described above.

    Generated:

    Article Title: Deletions in the Transmembrane Domain of a Sindbis Virus Glycoprotein Alter Virus Infectivity, Stability, and Host Range
    Article Snippet: After the desired mutations were made by either method and confirmed by sequencing, they were subcloned into the Y420 vector using the Bcl I and BssH II (New England Biolabs, Beverly, Mass.) unique sites. .. Primer sequences used to verify all the described deletions were, for the sense strand, 5′ GAC TTA CTA CCA TCG CCA TCC 3′, and for the antisense primer, 5′ CAA AGG TAT GCA CAA CTG G 3′.

    Article Title: Self-reactive IgE exacerbates interferon responses associated with autoimmunity
    Article Snippet: The human dsDNA-specific IgG clone E11 (IgGD ) was generated as previously described . .. To generate the human dsDNA-specific IgE (IgED ), E11 variable regions were cloned by restriction digestion using BssHII and SalI enzymes from New England Biolabs and ligated into an IgE Orip/EBNA-1-based episomal mammalian expression vector pOE (MedImmune LLC).

    other:

    Article Title: Genetic relationships between Candida albicans strains isolated from dental plaque, trachea, and bronchoalveolar lavage fluid from mechanically ventilated intensive care unit patients
    Article Snippet: In comparison, restriction endonuclease analysis of the genome (REAG) from the 49 isolates of 22 patients yielded 24 patterns after digestion with Sfi I ( ) and 25 patterns after digestion with Bss HII ( ).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Deletions in the Transmembrane Domain of a Sindbis Virus Glycoprotein Alter Virus Infectivity, Stability, and Host Range
    Article Snippet: Paragraph title: Site-directed mutagenesis and reverse transcription (RT)-PCR analysis of mutant viruses. ... After the desired mutations were made by either method and confirmed by sequencing, they were subcloned into the Y420 vector using the Bcl I and BssH II (New England Biolabs, Beverly, Mass.) unique sites.

    Binding Assay:

    Article Title: From deep sequencing to actual clones
    Article Snippet: Briefly, the phage plasmid prep output was digested with BssHII/NheI (NEB) for 4 h at 37°C, then gel extracted and ligated with 1 μg of a pEP vector carrying compatible ends. .. The blunt-end ligation of the HCDR3-specific inverse PCR was then transformed into BL21(DE3)Gold cells to allow subsequent expression of the soluble scFv.

    Cellular Antioxidant Activity Assay:

    Article Title: Deletions in the Transmembrane Domain of a Sindbis Virus Glycoprotein Alter Virus Infectivity, Stability, and Host Range
    Article Snippet: After the desired mutations were made by either method and confirmed by sequencing, they were subcloned into the Y420 vector using the Bcl I and BssH II (New England Biolabs, Beverly, Mass.) unique sites. .. To confirm that the desired deletions remained in the virus grown in cell culture, the RNA was extracted from the virus, reverse transcribed, and amplified by PCR (RT-PCR) as described above.

    Pulsed-Field Gel:

    Article Title: Recrudescent Campylobacter jejuni Infection in an Immunocompetent Adult following Experimental Infection with a Well-Characterized Organism
    Article Snippet: The plugs were removed and put into 500 μl of fresh restriction buffer and BssHII enzyme (8 U; New England Biolabs, Beverly, MA), and the mixture was incubated overnight at 37°C. .. Pulsed-field gel electrophoresis (PFGE) was done with a contour-clamped homogeneous electric field (CHEF) apparatus (Bio-Rad) ( ).

    Nucleic Acid Electrophoresis:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Mutagenesis:

    Article Title: Forced Selection of tRNAGlu Reveals the Importance of Two Adenosine-Rich RNA Loops Within the U5-PBS for SIVsmmPBj Replication
    Article Snippet: Paragraph title: Construction of HIV-NL4.3 and SIVsmmPBj14 mutant proviral genomes ... The proviral clones pHXB2(Glu) and pHXB2(Glu Loop 1) were digested with the restriction enzymes Hpa I and BssH II (New England Biolabs, Beverly, MA) to release a 868 base pair fragment containing the 5' long terminal repeat, PBS, and leader region of gag .

    Article Title: Deletions in the Transmembrane Domain of a Sindbis Virus Glycoprotein Alter Virus Infectivity, Stability, and Host Range
    Article Snippet: Paragraph title: Site-directed mutagenesis and reverse transcription (RT)-PCR analysis of mutant viruses. ... After the desired mutations were made by either method and confirmed by sequencing, they were subcloned into the Y420 vector using the Bcl I and BssH II (New England Biolabs, Beverly, Mass.) unique sites.

    Article Title: A bacterial reporter panel for the detection and classification of antibiotic substances
    Article Snippet: The PCR products were cut with restriction enzyme BSSHII (New England Biolabs, USA), and ligated into the pBR2TTS vector already harbouring trpE (T4 DNA ligase, Fermentas ), which was first transformed into E. coli DH5α and then transferred to E. coli SM301. .. The PCR products were cut with restriction enzyme BSSHII (New England Biolabs, USA), and ligated into the pBR2TTS vector already harbouring trpE (T4 DNA ligase, Fermentas ), which was first transformed into E. coli DH5α and then transferred to E. coli SM301.

    Article Title: Molecular Dissection of the Essential Features of the Origin of Replication of the Second Vibrio cholerae Chromosome
    Article Snippet: The entirety of both Minipreps was digested with BstAPI, BssHII, and NaeI (NEB). .. The entirety of both Minipreps was digested with BstAPI, BssHII, and NaeI (NEB).

    Isolation:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Article Title: Genomics analysis of potassium channel genes in songbirds reveals molecular specializations of brain circuits for the maintenance and production of learned vocalizations
    Article Snippet: DIG-labeled riboprobes were prepared as previously described ([ ]; see also [ , ]). .. Briefly, we first isolated plasmid DNA from the Songbird ESTIMA cDNA clone collection, digested out the cDNA insert with a BSSHII restriction enzyme (New England Biolabs; Ipswich, MA), and twice purified the template with a GeneJet (Fermentas, NJ) or Qiagen PCR purification kit (Qiagen Inc., Valencia, CA). .. Antisense strand probes were synthesized at 37°C for 4–5 hours using T3 RNA polymerase (Promega Inc., Madison, WI) and DIG-labeling mix (Roche), and were purified by Sephadex G-50 columns.

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: Restriction digestion of full length HC and LC inserts and expression vectors (pCMV-CD30-4IE3_HC and pCMV-CD30-4IE3_LC) was performed with the restriction enzymes BssHII, NheI and HindIII (New England Biolabs). .. Ligations of the corresponding inserts and vectors for the amplified HC and LC clonotypes were performed using instant sticky-end DNA ligase (New England Biolabs) and transformed into one-shot chemically competent E. coli TOP10 cells (IBA) following the manufacturer’s instructions.

    Article Title: BRAIN EXPRESSION AND SONG REGULATION OF THE CHOLECYSTOKININ GENE IN THE ZEBRA FINCH (TAENIOPYGIA GUTTATA)
    Article Snippet: Digoxygenin-(DIG)-, fluorescein- or 33 P-labeled riboprobes were synthesized using previously established protocols ( ; ). .. For clones from the ESTIMA zebra finch brain cDNA collection , isolated plasmid DNA was restriction enzyme digested (BSSHII; New England Biolabs; Ipswich, MA) to release the insert template, and twice purified with Qiagen’s PCR purification kit (Qiagen Inc., Valencia, CA). .. Plasmid containing a ~700 bp fragment of the zebra finch homologue of the 65-kDa isoform of glutamic acid decarboxylase ( Gad65 ; Genbank accession ; ) was also isolated, restriction enzyme digested and twice purified as for the ESTIMA clones.

    Article Title: Genome Evolution and the Emergence of Fruiting Body Development in Myxococcus xanthus
    Article Snippet: Genomic DNA was isolated by using Invitrogen Easy-DNA kit. .. Genomic DNA (0.5 µg) was digested with BssHII (New England Biolabs) in a total volume of 20 µl and digestions were dialyzed on a 0.025 µm pore size filter (Millipore) against distilled water for 30 min (drop dialysis).

    Article Title: CD44posCD49fhiCD133/2hi Defines Xenograft-Initiating Cells in Estrogen Receptor-Negative Breast Cancer
    Article Snippet: Alterations in DNA methylation were evaluated via a modified cytosine extension assay ( ). .. Briefly, duplicate tubes containing 50 ng of genomic DNA [isolated via Trizol (Invitrogen) from live sorted xenografts] were digested overnight with a 10-fold excess of HpaII or BssHII endonuclease (New England Biolabs); in addition, one tube was incubated without restriction enzyme addition and served as a nonspecific background control. .. The 35-µL nucleotide extension reaction [containing 50 ng of DNA, 1× PCR buffer (Invitrogen), 1.0 mmol/L MgCl2 , 0.35 unit of Taq DNA polymerase (Invitrogen), and 8.0 µCi [32 P]dCTP (Perkin-Elmer)] was incubated at 72°C for 2 hours.

    Purification:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: The DNA fragment containing the CMV promoter, the EGFP gene, and the SV40 polyadenylation (poly(A)) signal was amplified by PCR, using PrimeSTAR Max DNA polymerase (Takara Bio), the pEGFP-C1 vector (Takara Bio USA), and two primers with the sequences of 5′-d(GGG GCGCGC GGACAAACCACAACTAGAATG)-3′ and 5′-d(CCC GCGCGC TAGTTATTAATAGTAATCAAT)-3′, in which the underlines indicate the Bss HII sites. .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Article Title: Hybrid mouse-prokaryotic DNA (cytosine-5) methyltransferases retain the specificity of the parental C-terminal domain
    Article Snippet: The amplified DNA was phenol–chloroform extracted and digested with Bss HII and Eco RI. .. The digested products were run on a low melting point agarose gel and the band of interest was purified using Geneclean II (Bio 101) and ligated into pLit29, which had been pre-digested with Bss HII and Eco RI (NEB). .. The resulting clone, pLit29Δ Hha I, contained a truncated M. Hha I gene and the correct construct was verified by sequencing.

    Article Title: A bacterial reporter panel for the detection and classification of antibiotic substances
    Article Snippet: The PCR products were cut with restriction enzyme SalI (New England Biolabs, USA) and ligated (T4 DNA ligase, Fermentas ) into a pBR2TTS vector, which was then transformed into E. coli DH5α and purified. .. The PCR products were cut with restriction enzyme BSSHII (New England Biolabs, USA), and ligated into the pBR2TTS vector already harbouring trpE (T4 DNA ligase, Fermentas ), which was first transformed into E. coli DH5α and then transferred to E. coli SM301.

    Article Title: Genomics analysis of potassium channel genes in songbirds reveals molecular specializations of brain circuits for the maintenance and production of learned vocalizations
    Article Snippet: DIG-labeled riboprobes were prepared as previously described ([ ]; see also [ , ]). .. Briefly, we first isolated plasmid DNA from the Songbird ESTIMA cDNA clone collection, digested out the cDNA insert with a BSSHII restriction enzyme (New England Biolabs; Ipswich, MA), and twice purified the template with a GeneJet (Fermentas, NJ) or Qiagen PCR purification kit (Qiagen Inc., Valencia, CA). .. Antisense strand probes were synthesized at 37°C for 4–5 hours using T3 RNA polymerase (Promega Inc., Madison, WI) and DIG-labeling mix (Roche), and were purified by Sephadex G-50 columns.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs). .. After digestion, all three fragments were joined via MightyMix ligation (TAKARA); in the resulting construct the ERE reporter and the ER halves face opposite directions, it was termed pRC21-estrogensensor.

    Article Title: BRAIN EXPRESSION AND SONG REGULATION OF THE CHOLECYSTOKININ GENE IN THE ZEBRA FINCH (TAENIOPYGIA GUTTATA)
    Article Snippet: Digoxygenin-(DIG)-, fluorescein- or 33 P-labeled riboprobes were synthesized using previously established protocols ( ; ). .. For clones from the ESTIMA zebra finch brain cDNA collection , isolated plasmid DNA was restriction enzyme digested (BSSHII; New England Biolabs; Ipswich, MA) to release the insert template, and twice purified with Qiagen’s PCR purification kit (Qiagen Inc., Valencia, CA). .. Plasmid containing a ~700 bp fragment of the zebra finch homologue of the 65-kDa isoform of glutamic acid decarboxylase ( Gad65 ; Genbank accession ; ) was also isolated, restriction enzyme digested and twice purified as for the ESTIMA clones.

    Article Title: Serotonin, via HTR2 receptors, excites neurons in a cortical-like pre-motor nucleus necessary for song learning and production
    Article Snippet: Briefly, clones corresponding to HTR2A (GenBank accession code: ), HTR2B ( ) and HTR2C ( ) were obtained from the ESTIMA zebra finch brain cDNA collection ( ). .. Plasmid DNA was extracted (GeneJET Plasmid Miniprep kit; Fermentas, Glen Burnie, MD), restriction enzyme digested (BSSHII; New England Biolabs; Ipswich, MA) to release the insert template, and twice purified with a PCR purification kit (GeneJET PCR Purification Kit). .. Sense and antisense strand probes were then synthesized at 37°C for 5 hours using the appropriate T3 or T7 RNA polymerase (Promega Inc., Madison, WI) and nucleotide label mix, and purified by Sephadex G-50 columns.

    Article Title: From deep sequencing to actual clones
    Article Snippet: One hundred ng of the purified product were blunt-end ligated with T4 ligase for 2 h at 23°C and transformed into DH5aF′ bacterial cells. .. Briefly, the phage plasmid prep output was digested with BssHII/NheI (NEB) for 4 h at 37°C, then gel extracted and ligated with 1 μg of a pEP vector carrying compatible ends.

    Polymerase Chain Reaction:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: The DNA fragment containing the CMV promoter, the EGFP gene, and the SV40 polyadenylation (poly(A)) signal was amplified by PCR, using PrimeSTAR Max DNA polymerase (Takara Bio), the pEGFP-C1 vector (Takara Bio USA), and two primers with the sequences of 5′-d(GGG GCGCGC GGACAAACCACAACTAGAATG)-3′ and 5′-d(CCC GCGCGC TAGTTATTAATAGTAATCAAT)-3′, in which the underlines indicate the Bss HII sites. .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Article Title: Hybrid mouse-prokaryotic DNA (cytosine-5) methyltransferases retain the specificity of the parental C-terminal domain
    Article Snippet: Amplification of the M. Hha I gene used a Perkin Elmer GeneAmp PCR System 2400 and Vent exo– DNA polymerase (NEB). .. The digested products were run on a low melting point agarose gel and the band of interest was purified using Geneclean II (Bio 101) and ligated into pLit29, which had been pre-digested with Bss HII and Eco RI (NEB).

    Article Title: Deletions in the Transmembrane Domain of a Sindbis Virus Glycoprotein Alter Virus Infectivity, Stability, and Host Range
    Article Snippet: After this first PCR step, 25 μl of each of the sense and antisense reactions was combined into one reaction, 1 μl of Pfu polymerase was added, and the PCR program was repeated in full. .. After the desired mutations were made by either method and confirmed by sequencing, they were subcloned into the Y420 vector using the Bcl I and BssH II (New England Biolabs, Beverly, Mass.) unique sites.

    Article Title: A bacterial reporter panel for the detection and classification of antibiotic substances
    Article Snippet: Then, primers carrying a BSSHII restriction site, designed for trpD , were used to PCR‐amplify this region from the E. coli MG1655 genome (Table S1). .. The PCR products were cut with restriction enzyme BSSHII (New England Biolabs, USA), and ligated into the pBR2TTS vector already harbouring trpE (T4 DNA ligase, Fermentas ), which was first transformed into E. coli DH5α and then transferred to E. coli SM301. .. Tryptophan synthesis capability was verified by growing the bacteria on enriched M9 medium lacking this amino acid.

    Article Title: Genomics analysis of potassium channel genes in songbirds reveals molecular specializations of brain circuits for the maintenance and production of learned vocalizations
    Article Snippet: DIG-labeled riboprobes were prepared as previously described ([ ]; see also [ , ]). .. Briefly, we first isolated plasmid DNA from the Songbird ESTIMA cDNA clone collection, digested out the cDNA insert with a BSSHII restriction enzyme (New England Biolabs; Ipswich, MA), and twice purified the template with a GeneJet (Fermentas, NJ) or Qiagen PCR purification kit (Qiagen Inc., Valencia, CA). .. Antisense strand probes were synthesized at 37°C for 4–5 hours using T3 RNA polymerase (Promega Inc., Madison, WI) and DIG-labeling mix (Roche), and were purified by Sephadex G-50 columns.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: BRAIN EXPRESSION AND SONG REGULATION OF THE CHOLECYSTOKININ GENE IN THE ZEBRA FINCH (TAENIOPYGIA GUTTATA)
    Article Snippet: Digoxygenin-(DIG)-, fluorescein- or 33 P-labeled riboprobes were synthesized using previously established protocols ( ; ). .. For clones from the ESTIMA zebra finch brain cDNA collection , isolated plasmid DNA was restriction enzyme digested (BSSHII; New England Biolabs; Ipswich, MA) to release the insert template, and twice purified with Qiagen’s PCR purification kit (Qiagen Inc., Valencia, CA). .. Plasmid containing a ~700 bp fragment of the zebra finch homologue of the 65-kDa isoform of glutamic acid decarboxylase ( Gad65 ; Genbank accession ; ) was also isolated, restriction enzyme digested and twice purified as for the ESTIMA clones.

    Article Title: Serotonin, via HTR2 receptors, excites neurons in a cortical-like pre-motor nucleus necessary for song learning and production
    Article Snippet: Briefly, clones corresponding to HTR2A (GenBank accession code: ), HTR2B ( ) and HTR2C ( ) were obtained from the ESTIMA zebra finch brain cDNA collection ( ). .. Plasmid DNA was extracted (GeneJET Plasmid Miniprep kit; Fermentas, Glen Burnie, MD), restriction enzyme digested (BSSHII; New England Biolabs; Ipswich, MA) to release the insert template, and twice purified with a PCR purification kit (GeneJET PCR Purification Kit). .. Sense and antisense strand probes were then synthesized at 37°C for 5 hours using the appropriate T3 or T7 RNA polymerase (Promega Inc., Madison, WI) and nucleotide label mix, and purified by Sephadex G-50 columns.

    Article Title: From deep sequencing to actual clones
    Article Snippet: After amplification, the correct PCR product was gel extracted and purified (Qiaquick Gel extraction kit, Qiagen) to avoid contamination from the original plasmid template. .. Briefly, the phage plasmid prep output was digested with BssHII/NheI (NEB) for 4 h at 37°C, then gel extracted and ligated with 1 μg of a pEP vector carrying compatible ends.

    Selection:

    Article Title: A bacterial reporter panel for the detection and classification of antibiotic substances
    Article Snippet: Paragraph title: Construction of a non‐antibiotic selection system and reporter strains ... The PCR products were cut with restriction enzyme BSSHII (New England Biolabs, USA), and ligated into the pBR2TTS vector already harbouring trpE (T4 DNA ligase, Fermentas ), which was first transformed into E. coli DH5α and then transferred to E. coli SM301.

    Article Title: Genomics analysis of potassium channel genes in songbirds reveals molecular specializations of brain circuits for the maintenance and production of learned vocalizations
    Article Snippet: Paragraph title: cDNA selection and riboprobe synthesis ... Briefly, we first isolated plasmid DNA from the Songbird ESTIMA cDNA clone collection, digested out the cDNA insert with a BSSHII restriction enzyme (New England Biolabs; Ipswich, MA), and twice purified the template with a GeneJet (Fermentas, NJ) or Qiagen PCR purification kit (Qiagen Inc., Valencia, CA).

    Article Title: From deep sequencing to actual clones
    Article Snippet: An inverse PCR for the anti-CDK2 selection output was carried out directly on the plasmid prep obtained from the yeast sorted population. .. Briefly, the phage plasmid prep output was digested with BssHII/NheI (NEB) for 4 h at 37°C, then gel extracted and ligated with 1 μg of a pEP vector carrying compatible ends.

    Staining:

    Article Title: Recrudescent Campylobacter jejuni Infection in an Immunocompetent Adult following Experimental Infection with a Well-Characterized Organism
    Article Snippet: The plugs were removed and put into 500 μl of fresh restriction buffer and BssHII enzyme (8 U; New England Biolabs, Beverly, MA), and the mixture was incubated overnight at 37°C. .. Pulsed-field gel electrophoresis (PFGE) was done with a contour-clamped homogeneous electric field (CHEF) apparatus (Bio-Rad) ( ).

    Agarose Gel Electrophoresis:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: The DNA fragment containing the CMV promoter, the EGFP gene, and the SV40 polyadenylation (poly(A)) signal was amplified by PCR, using PrimeSTAR Max DNA polymerase (Takara Bio), the pEGFP-C1 vector (Takara Bio USA), and two primers with the sequences of 5′-d(GGG GCGCGC GGACAAACCACAACTAGAATG)-3′ and 5′-d(CCC GCGCGC TAGTTATTAATAGTAATCAAT)-3′, in which the underlines indicate the Bss HII sites. .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Article Title: Hybrid mouse-prokaryotic DNA (cytosine-5) methyltransferases retain the specificity of the parental C-terminal domain
    Article Snippet: The amplified DNA was phenol–chloroform extracted and digested with Bss HII and Eco RI. .. The digested products were run on a low melting point agarose gel and the band of interest was purified using Geneclean II (Bio 101) and ligated into pLit29, which had been pre-digested with Bss HII and Eco RI (NEB). .. The resulting clone, pLit29Δ Hha I, contained a truncated M. Hha I gene and the correct construct was verified by sequencing.

    In Situ Hybridization:

    Article Title: Serotonin, via HTR2 receptors, excites neurons in a cortical-like pre-motor nucleus necessary for song learning and production
    Article Snippet: Paragraph title: In situ Hybridization for Serotonin receptor 2A, 2B and 2C (HTR2A/HTR2B/HTR2C) ... Plasmid DNA was extracted (GeneJET Plasmid Miniprep kit; Fermentas, Glen Burnie, MD), restriction enzyme digested (BSSHII; New England Biolabs; Ipswich, MA) to release the insert template, and twice purified with a PCR purification kit (GeneJET PCR Purification Kit).

    Plasmid Preparation:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: The DNA fragment containing the CMV promoter, the EGFP gene, and the SV40 polyadenylation (poly(A)) signal was amplified by PCR, using PrimeSTAR Max DNA polymerase (Takara Bio), the pEGFP-C1 vector (Takara Bio USA), and two primers with the sequences of 5′-d(GGG GCGCGC GGACAAACCACAACTAGAATG)-3′ and 5′-d(CCC GCGCGC TAGTTATTAATAGTAATCAAT)-3′, in which the underlines indicate the Bss HII sites. .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Article Title: Hybrid mouse-prokaryotic DNA (cytosine-5) methyltransferases retain the specificity of the parental C-terminal domain
    Article Snippet: The digested products were run on a low melting point agarose gel and the band of interest was purified using Geneclean II (Bio 101) and ligated into pLit29, which had been pre-digested with Bss HII and Eco RI (NEB). .. The digested products were run on a low melting point agarose gel and the band of interest was purified using Geneclean II (Bio 101) and ligated into pLit29, which had been pre-digested with Bss HII and Eco RI (NEB).

    Article Title: Forced Selection of tRNAGlu Reveals the Importance of Two Adenosine-Rich RNA Loops Within the U5-PBS for SIVsmmPBj Replication
    Article Snippet: The proviral clones pHXB2(Glu) and pHXB2(Glu Loop 1) were digested with the restriction enzymes Hpa I and BssH II (New England Biolabs, Beverly, MA) to release a 868 base pair fragment containing the 5' long terminal repeat, PBS, and leader region of gag . .. The proviral clones pHXB2(Glu) and pHXB2(Glu Loop 1) were digested with the restriction enzymes Hpa I and BssH II (New England Biolabs, Beverly, MA) to release a 868 base pair fragment containing the 5' long terminal repeat, PBS, and leader region of gag .

    Article Title: Deletions in the Transmembrane Domain of a Sindbis Virus Glycoprotein Alter Virus Infectivity, Stability, and Host Range
    Article Snippet: After this first PCR step, 25 μl of each of the sense and antisense reactions was combined into one reaction, 1 μl of Pfu polymerase was added, and the PCR program was repeated in full. .. After the desired mutations were made by either method and confirmed by sequencing, they were subcloned into the Y420 vector using the Bcl I and BssH II (New England Biolabs, Beverly, Mass.) unique sites. .. After confirmation of the correct sequence throughout the insert, infectious RNA was transcribed in vitro using SP6 RNA polymerase (New England Biolabs) and introduced into cells by electroporation as described below and in reference .

    Article Title: A bacterial reporter panel for the detection and classification of antibiotic substances
    Article Snippet: Then, primers carrying a BSSHII restriction site, designed for trpD , were used to PCR‐amplify this region from the E. coli MG1655 genome (Table S1). .. The PCR products were cut with restriction enzyme BSSHII (New England Biolabs, USA), and ligated into the pBR2TTS vector already harbouring trpE (T4 DNA ligase, Fermentas ), which was first transformed into E. coli DH5α and then transferred to E. coli SM301. .. Tryptophan synthesis capability was verified by growing the bacteria on enriched M9 medium lacking this amino acid.

    Article Title: Genomics analysis of potassium channel genes in songbirds reveals molecular specializations of brain circuits for the maintenance and production of learned vocalizations
    Article Snippet: DIG-labeled riboprobes were prepared as previously described ([ ]; see also [ , ]). .. Briefly, we first isolated plasmid DNA from the Songbird ESTIMA cDNA clone collection, digested out the cDNA insert with a BSSHII restriction enzyme (New England Biolabs; Ipswich, MA), and twice purified the template with a GeneJet (Fermentas, NJ) or Qiagen PCR purification kit (Qiagen Inc., Valencia, CA). .. Antisense strand probes were synthesized at 37°C for 4–5 hours using T3 RNA polymerase (Promega Inc., Madison, WI) and DIG-labeling mix (Roche), and were purified by Sephadex G-50 columns.

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: Restriction digestion of full length HC and LC inserts and expression vectors (pCMV-CD30-4IE3_HC and pCMV-CD30-4IE3_LC) was performed with the restriction enzymes BssHII, NheI and HindIII (New England Biolabs). .. Restriction digestion of full length HC and LC inserts and expression vectors (pCMV-CD30-4IE3_HC and pCMV-CD30-4IE3_LC) was performed with the restriction enzymes BssHII, NheI and HindIII (New England Biolabs).

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: Paragraph title: Plasmid construction ... For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: BRAIN EXPRESSION AND SONG REGULATION OF THE CHOLECYSTOKININ GENE IN THE ZEBRA FINCH (TAENIOPYGIA GUTTATA)
    Article Snippet: Digoxygenin-(DIG)-, fluorescein- or 33 P-labeled riboprobes were synthesized using previously established protocols ( ; ). .. For clones from the ESTIMA zebra finch brain cDNA collection , isolated plasmid DNA was restriction enzyme digested (BSSHII; New England Biolabs; Ipswich, MA) to release the insert template, and twice purified with Qiagen’s PCR purification kit (Qiagen Inc., Valencia, CA). .. Plasmid containing a ~700 bp fragment of the zebra finch homologue of the 65-kDa isoform of glutamic acid decarboxylase ( Gad65 ; Genbank accession ; ) was also isolated, restriction enzyme digested and twice purified as for the ESTIMA clones.

    Article Title: Genome Evolution and the Emergence of Fruiting Body Development in Myxococcus xanthus
    Article Snippet: Genomic DNA (0.5 µg) was digested with BssHII (New England Biolabs) in a total volume of 20 µl and digestions were dialyzed on a 0.025 µm pore size filter (Millipore) against distilled water for 30 min (drop dialysis). .. 8 µl of this DNA was treated with T4 DNA ligase (Promega) and drop-dialyzed before electroporation into E. coli host CC118 .

    Article Title: Molecular Dissection of the Essential Features of the Origin of Replication of the Second Vibrio cholerae Chromosome
    Article Snippet: Plasmid DNA was prepared using 1/8 of each strain pool and a Qiagen Miniprep kit. .. The entirety of both Minipreps was digested with BstAPI, BssHII, and NaeI (NEB).

    Article Title: Self-reactive IgE exacerbates interferon responses associated with autoimmunity
    Article Snippet: The human dsDNA-specific IgG clone E11 (IgGD ) was generated as previously described . .. To generate the human dsDNA-specific IgE (IgED ), E11 variable regions were cloned by restriction digestion using BssHII and SalI enzymes from New England Biolabs and ligated into an IgE Orip/EBNA-1-based episomal mammalian expression vector pOE (MedImmune LLC). .. A human IgE specific for metapneumovirus (hMPV) was generated in a similar fashion to be used as an isotype control (IgEI ).

    Article Title: Assessment of antibody library diversity through next generation sequencing and technical error compensation
    Article Snippet: Before annealing the reverse strand was phosphorylated (0.2nmol Oligos, 10U PNK (NEB) 37°C 1h, 65°C 20min) to allow the ligation. .. The scFvs were excised from the library plasmid (~8μg of the library were digested 3h 37°C with 4U of NheI (NEB), 3h 50°C with 4U of BssHII (NEB)) and ligated to the adapters (forward adapter: scFv: reverse adapter in 10:1:10 ratio, ~200–250 ng library 400U T4 ligase (NEB), O/N 16°C). .. The ligation was run on agarose gel and the band corresponding to the single insert with 5’ and 3’ adapters was resolved and purified with MinElute Gel Extraction Kit (Qiagen).

    Article Title: Serotonin, via HTR2 receptors, excites neurons in a cortical-like pre-motor nucleus necessary for song learning and production
    Article Snippet: Briefly, clones corresponding to HTR2A (GenBank accession code: ), HTR2B ( ) and HTR2C ( ) were obtained from the ESTIMA zebra finch brain cDNA collection ( ). .. Plasmid DNA was extracted (GeneJET Plasmid Miniprep kit; Fermentas, Glen Burnie, MD), restriction enzyme digested (BSSHII; New England Biolabs; Ipswich, MA) to release the insert template, and twice purified with a PCR purification kit (GeneJET PCR Purification Kit). .. Sense and antisense strand probes were then synthesized at 37°C for 5 hours using the appropriate T3 or T7 RNA polymerase (Promega Inc., Madison, WI) and nucleotide label mix, and purified by Sephadex G-50 columns.

    Article Title: Assessment of antibody library diversity through next generation sequencing and technical error compensation
    Article Snippet: A third single domain “nanobody” library (hVH) was created using only the VH domains, amplified in a single reaction. .. At the end of each library construction, the assembled VH-VL DNA products for hscFv1 and hscFv2, or the VH products for hVH, were ligated in the pLinker220 vector [ ] for yeast expression in the SPLINT format, using restriction sites BssHII/NheI (NEB). .. Ligation of each library (~1μg) was transformed by electroporation into Max Efficiency E.coli DH5α cells (Invitrogen).

    Article Title: From deep sequencing to actual clones
    Article Snippet: In contrast, the inverse PCR for the anti- L. acidophilus selections was carried on the plasmid prep of the phage selected scFv population subcloned into a modified pEP expression vector. .. Briefly, the phage plasmid prep output was digested with BssHII/NheI (NEB) for 4 h at 37°C, then gel extracted and ligated with 1 μg of a pEP vector carrying compatible ends. .. The bacteria transformed with the pEP subcloned library were harvested and plasmid DNA was extracted to be used as template for the HCDR3-specific inverse PCR.

    In Vitro:

    Article Title: Forced Selection of tRNAGlu Reveals the Importance of Two Adenosine-Rich RNA Loops Within the U5-PBS for SIVsmmPBj Replication
    Article Snippet: The proviral clones pHXB2(Glu) and pHXB2(Glu Loop 1) were digested with the restriction enzymes Hpa I and BssH II (New England Biolabs, Beverly, MA) to release a 868 base pair fragment containing the 5' long terminal repeat, PBS, and leader region of gag . .. The 5' long terminal repeat, PBS, and leader region of gag of this clone was inserted into the multiple cloning site, Xho I-to- Eco47 III (New England Biolabs and Promega, Madison, WI, respectively), of the pSE420 vector (Invitrogen, Carlsbad, CA).

    Article Title: Assessment of antibody library diversity through next generation sequencing and technical error compensation
    Article Snippet: The scFvs were excised from the library plasmid (~8μg of the library were digested 3h 37°C with 4U of NheI (NEB), 3h 50°C with 4U of BssHII (NEB)) and ligated to the adapters (forward adapter: scFv: reverse adapter in 10:1:10 ratio, ~200–250 ng library 400U T4 ligase (NEB), O/N 16°C). .. The scFvs were excised from the library plasmid (~8μg of the library were digested 3h 37°C with 4U of NheI (NEB), 3h 50°C with 4U of BssHII (NEB)) and ligated to the adapters (forward adapter: scFv: reverse adapter in 10:1:10 ratio, ~200–250 ng library 400U T4 ligase (NEB), O/N 16°C).

    Recombinant:

    Article Title: Simple paired heavy- and light-chain antibody repertoire sequencing using endoplasmic reticulum microsomes
    Article Snippet: Paragraph title: Cloning and expression of recombinant monoclonal antibodies ... Restriction digestion of full length HC and LC inserts and expression vectors (pCMV-CD30-4IE3_HC and pCMV-CD30-4IE3_LC) was performed with the restriction enzymes BssHII, NheI and HindIII (New England Biolabs).

    Sample Prep:

    Article Title: Molecular Dissection of the Essential Features of the Origin of Replication of the Second Vibrio cholerae Chromosome
    Article Snippet: The entirety of both Minipreps was digested with BstAPI, BssHII, and NaeI (NEB). .. The digests were run on 1.5% agarose gels, and the 531-bp fragment was excised and purified with a Qiagen gel purification kit and cleaned with GE Illustra MicroSpin G-50 columns.

    Article Title: Assessment of antibody library diversity through next generation sequencing and technical error compensation
    Article Snippet: Paragraph title: Sequencing sample preparation ... The scFvs were excised from the library plasmid (~8μg of the library were digested 3h 37°C with 4U of NheI (NEB), 3h 50°C with 4U of BssHII (NEB)) and ligated to the adapters (forward adapter: scFv: reverse adapter in 10:1:10 ratio, ~200–250 ng library 400U T4 ligase (NEB), O/N 16°C).

    In Situ:

    Article Title: Genomics analysis of potassium channel genes in songbirds reveals molecular specializations of brain circuits for the maintenance and production of learned vocalizations
    Article Snippet: Given the close proximity of these reads to the gene model, and in most cases evidence of polyadenylation (i.e. poly-A tail), we are reasonably confident that these cDNAs correspond to the 3′-end of the gene, and thus are suitable for use as in situ probes. .. Briefly, we first isolated plasmid DNA from the Songbird ESTIMA cDNA clone collection, digested out the cDNA insert with a BSSHII restriction enzyme (New England Biolabs; Ipswich, MA), and twice purified the template with a GeneJet (Fermentas, NJ) or Qiagen PCR purification kit (Qiagen Inc., Valencia, CA).

    Ethanol Precipitation:

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs). .. After digestion, all three fragments were joined via MightyMix ligation (TAKARA); in the resulting construct the ERE reporter and the ER halves face opposite directions, it was termed pRC21-estrogensensor.

    DNA Methylation Assay:

    Article Title: CD44posCD49fhiCD133/2hi Defines Xenograft-Initiating Cells in Estrogen Receptor-Negative Breast Cancer
    Article Snippet: Briefly, duplicate tubes containing 50 ng of genomic DNA [isolated via Trizol (Invitrogen) from live sorted xenografts] were digested overnight with a 10-fold excess of HpaII or BssHII endonuclease (New England Biolabs); in addition, one tube was incubated without restriction enzyme addition and served as a nonspecific background control. .. Briefly, duplicate tubes containing 50 ng of genomic DNA [isolated via Trizol (Invitrogen) from live sorted xenografts] were digested overnight with a 10-fold excess of HpaII or BssHII endonuclease (New England Biolabs); in addition, one tube was incubated without restriction enzyme addition and served as a nonspecific background control.

    CTG Assay:

    Article Title: Deletions in the Transmembrane Domain of a Sindbis Virus Glycoprotein Alter Virus Infectivity, Stability, and Host Range
    Article Snippet: After the desired mutations were made by either method and confirmed by sequencing, they were subcloned into the Y420 vector using the Bcl I and BssH II (New England Biolabs, Beverly, Mass.) unique sites. .. To confirm that the desired deletions remained in the virus grown in cell culture, the RNA was extracted from the virus, reverse transcribed, and amplified by PCR (RT-PCR) as described above.

    Marker:

    Article Title: A bacterial reporter panel for the detection and classification of antibiotic substances
    Article Snippet: The PCR products were cut with restriction enzyme BSSHII (New England Biolabs, USA), and ligated into the pBR2TTS vector already harbouring trpE (T4 DNA ligase, Fermentas ), which was first transformed into E. coli DH5α and then transferred to E. coli SM301. .. The PCR products were cut with restriction enzyme BSSHII (New England Biolabs, USA), and ligated into the pBR2TTS vector already harbouring trpE (T4 DNA ligase, Fermentas ), which was first transformed into E. coli DH5α and then transferred to E. coli SM301.

    Gel Extraction:

    Article Title: From deep sequencing to actual clones
    Article Snippet: After amplification, the correct PCR product was gel extracted and purified (Qiaquick Gel extraction kit, Qiagen) to avoid contamination from the original plasmid template. .. Briefly, the phage plasmid prep output was digested with BssHII/NheI (NEB) for 4 h at 37°C, then gel extracted and ligated with 1 μg of a pEP vector carrying compatible ends.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs restriction enzymes bsshii
    Rearranged BKPyV Dunlop NCCR showed higher EVGR expression than did BKPyVww NCCR in HEK293 cells. (A) Schematic representation of the HPyV genome: noncoding control region (NCCR); early viral gene region (EVGR, in red) encoding large and small T antigens (Tags), alternative spliced Tags; microRNAs (blue arrow); late viral gene region (LVGR) encoding structural proteins (Vp1, Vp2, and Vp3) and the agnoprotein (agno) only in BKPyV and JCPyV. (B) Representation of the bidirectional reporter vector pRG13D12, containing the following: NCCR (in gray) in the early to late orientation cloned via restriction sites <t>MluI</t> and <t>BssHII;</t> the red fluorescence protein dsRed2, used as a marker of EVGR expression; the enhanced green fluorescence protein, EGFP, in the opposite orientation, used as a marker of LVGR expression; SV40 polyadenylation signals [SV40 poly(A)] for the dsRed2 and EGFP expression cassette; E1 ori for bacterial plasmid replication; the ampicillin-resistant gene (Amp) for selecting Escherichia coli transformants. (C) Flow cytometry of HEK293 cells 2 dpt with the pRG13D12 reporter vector alone or containing the NCCR of the archetype BKPyVww, the BKPyV(DUN), or the BKPyV(DUN-R) in the reverse orientation. x axis, EGFP fluorescence; y axis, dsRed2 fluorescence; 10,000 control transfected cells were gated for the live gate, while 5,000 transfected cells were gated for the P3 (Q1, Q2, and Q4) gate. Q1, Q4, and Q2 depict cells expressing red fluorescence, green fluorescence, and both, respectively. Ex, excitation wavelength; Em, emission wavelength. (D) Quantification of cells: red bars, sum of red cells (Q1 + Q2); green bars, sum of green cells (Q2 + Q4); yellow bars, red- and green-fluorescence double-positive cells (Q2); black bars, nonfluorescent cells (Q3, negative). Means with standard deviations (SD) from three independent replicates are shown. (E) Normalized mean fluorescence intensity (MFI). The weighted MFI was calculated for each measurement (see formulas in Materials and Methods); late expression was normalized to BKPyVww NCCR (green MFI was set as 100), while early expression was normalized to BKPyVww NCCR (red MFI was set as 1). Means with SD from three independent replicates are shown.
    Restriction Enzymes Bsshii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzymes bsshii/product/New England Biolabs
    Average 99 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    restriction enzymes bsshii - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    Rearranged BKPyV Dunlop NCCR showed higher EVGR expression than did BKPyVww NCCR in HEK293 cells. (A) Schematic representation of the HPyV genome: noncoding control region (NCCR); early viral gene region (EVGR, in red) encoding large and small T antigens (Tags), alternative spliced Tags; microRNAs (blue arrow); late viral gene region (LVGR) encoding structural proteins (Vp1, Vp2, and Vp3) and the agnoprotein (agno) only in BKPyV and JCPyV. (B) Representation of the bidirectional reporter vector pRG13D12, containing the following: NCCR (in gray) in the early to late orientation cloned via restriction sites MluI and BssHII; the red fluorescence protein dsRed2, used as a marker of EVGR expression; the enhanced green fluorescence protein, EGFP, in the opposite orientation, used as a marker of LVGR expression; SV40 polyadenylation signals [SV40 poly(A)] for the dsRed2 and EGFP expression cassette; E1 ori for bacterial plasmid replication; the ampicillin-resistant gene (Amp) for selecting Escherichia coli transformants. (C) Flow cytometry of HEK293 cells 2 dpt with the pRG13D12 reporter vector alone or containing the NCCR of the archetype BKPyVww, the BKPyV(DUN), or the BKPyV(DUN-R) in the reverse orientation. x axis, EGFP fluorescence; y axis, dsRed2 fluorescence; 10,000 control transfected cells were gated for the live gate, while 5,000 transfected cells were gated for the P3 (Q1, Q2, and Q4) gate. Q1, Q4, and Q2 depict cells expressing red fluorescence, green fluorescence, and both, respectively. Ex, excitation wavelength; Em, emission wavelength. (D) Quantification of cells: red bars, sum of red cells (Q1 + Q2); green bars, sum of green cells (Q2 + Q4); yellow bars, red- and green-fluorescence double-positive cells (Q2); black bars, nonfluorescent cells (Q3, negative). Means with standard deviations (SD) from three independent replicates are shown. (E) Normalized mean fluorescence intensity (MFI). The weighted MFI was calculated for each measurement (see formulas in Materials and Methods); late expression was normalized to BKPyVww NCCR (green MFI was set as 100), while early expression was normalized to BKPyVww NCCR (red MFI was set as 1). Means with SD from three independent replicates are shown.

    Journal:

    Article Title: Novel Human Polyomavirus Noncoding Control Regions Differ in Bidirectional Gene Expression according to Host Cell, Large T-Antigen Expression, and Clinically Occurring Rearrangements

    doi: 10.1128/JVI.02231-17

    Figure Lengend Snippet: Rearranged BKPyV Dunlop NCCR showed higher EVGR expression than did BKPyVww NCCR in HEK293 cells. (A) Schematic representation of the HPyV genome: noncoding control region (NCCR); early viral gene region (EVGR, in red) encoding large and small T antigens (Tags), alternative spliced Tags; microRNAs (blue arrow); late viral gene region (LVGR) encoding structural proteins (Vp1, Vp2, and Vp3) and the agnoprotein (agno) only in BKPyV and JCPyV. (B) Representation of the bidirectional reporter vector pRG13D12, containing the following: NCCR (in gray) in the early to late orientation cloned via restriction sites MluI and BssHII; the red fluorescence protein dsRed2, used as a marker of EVGR expression; the enhanced green fluorescence protein, EGFP, in the opposite orientation, used as a marker of LVGR expression; SV40 polyadenylation signals [SV40 poly(A)] for the dsRed2 and EGFP expression cassette; E1 ori for bacterial plasmid replication; the ampicillin-resistant gene (Amp) for selecting Escherichia coli transformants. (C) Flow cytometry of HEK293 cells 2 dpt with the pRG13D12 reporter vector alone or containing the NCCR of the archetype BKPyVww, the BKPyV(DUN), or the BKPyV(DUN-R) in the reverse orientation. x axis, EGFP fluorescence; y axis, dsRed2 fluorescence; 10,000 control transfected cells were gated for the live gate, while 5,000 transfected cells were gated for the P3 (Q1, Q2, and Q4) gate. Q1, Q4, and Q2 depict cells expressing red fluorescence, green fluorescence, and both, respectively. Ex, excitation wavelength; Em, emission wavelength. (D) Quantification of cells: red bars, sum of red cells (Q1 + Q2); green bars, sum of green cells (Q2 + Q4); yellow bars, red- and green-fluorescence double-positive cells (Q2); black bars, nonfluorescent cells (Q3, negative). Means with standard deviations (SD) from three independent replicates are shown. (E) Normalized mean fluorescence intensity (MFI). The weighted MFI was calculated for each measurement (see formulas in Materials and Methods); late expression was normalized to BKPyVww NCCR (green MFI was set as 100), while early expression was normalized to BKPyVww NCCR (red MFI was set as 1). Means with SD from three independent replicates are shown.

    Article Snippet: The HPyV NCCRs were chemically synthesized in pUC57 (Eurogentec S.A, Belgium) , excised using the restriction enzymes BssHII and MluI (New England BioLabs, England), and cloned into the corresponding restriction sites of pRG13D12.

    Techniques: Expressing, Plasmid Preparation, Clone Assay, Fluorescence, Marker, Flow Cytometry, Cytometry, Transfection, Electron Microscopy