bss hii  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    BssHII
    Description:
    BssHII 2 500 units
    Catalog Number:
    r0199l
    Price:
    277
    Size:
    2 500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs bss hii
    BssHII
    BssHII 2 500 units
    https://www.bioz.com/result/bss hii/product/New England Biolabs
    Average 99 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    bss hii - by Bioz Stars, 2020-01
    99/100 stars

    Images

    Related Articles

    Nucleic Acid Electrophoresis:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Single colonies were isolated and cultured in LB medium with 50 μg/ml ampicillin (LB Amp) (1 ml) for 6 h. The DNA in each colony was purified with the QIAprep Spin Miniprep Kit (Qiagen) and analyzed by gel electrophoresis after Bss HII treatment (Supplementary Fig. ).

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Single colonies were isolated and cultured in LB medium with 50 μg/ml ampicillin (LB Amp) (1 ml) for 6 h. The DNA in each colony was purified with the QIAprep Spin Miniprep Kit (Qiagen) and analyzed by gel electrophoresis after Bss HII treatment (Supplementary Fig. ).

    Amplification:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: The DNA fragment containing the CMV promoter, the EGFP gene, and the SV40 polyadenylation (poly(A)) signal was amplified by PCR, using PrimeSTAR Max DNA polymerase (Takara Bio), the pEGFP-C1 vector (Takara Bio USA), and two primers with the sequences of 5′-d(GGG GCGCGC GGACAAACCACAACTAGAATG)-3′ and 5′-d(CCC GCGCGC TAGTTATTAATAGTAATCAAT)-3′, in which the underlines indicate the Bss HII sites. .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively).

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: Preparation of pBSII EGFP The DNA fragment containing the CMV promoter, the EGFP gene, and the SV40 polyadenylation (poly(A)) signal was amplified by PCR, using PrimeSTAR Max DNA polymerase (Takara Bio), the pEGFP-C1 vector (Takara Bio USA), and two primers with the sequences of 5′-d(GGG GCGCGC GGACAAACCACAACTAGAATG)-3′ and 5′-d(CCC GCGCGC TAGTTATTAATAGTAATCAAT)-3′, in which the underlines indicate the Bss HII sites. .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively).

    Agarose Gel Electrophoresis:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    DNA Ligation:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Ligation:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Isolation:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Single colonies were isolated and cultured in LB medium with 50 μg/ml ampicillin (LB Amp) (1 ml) for 6 h. The DNA in each colony was purified with the QIAprep Spin Miniprep Kit (Qiagen) and analyzed by gel electrophoresis after Bss HII treatment (Supplementary Fig. ).

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Single colonies were isolated and cultured in LB medium with 50 μg/ml ampicillin (LB Amp) (1 ml) for 6 h. The DNA in each colony was purified with the QIAprep Spin Miniprep Kit (Qiagen) and analyzed by gel electrophoresis after Bss HII treatment (Supplementary Fig. ).

    Cell Culture:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Purification:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Incubation:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Polymerase Chain Reaction:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Plasmid Preparation:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs bss hii
    Pulsed-field gel electrophoresis (PFGE) patterns of <t>Bss</t> <t>HII</t> restriction endonuclease analysis of genomic DNA (REAG-B) with dendrogram for Candida albicans isolates. A genetic similarity percentage is shown above the dendrogram. Patient identification (Pt ID), sample site (Source), and number of days after admission to the intensive care unit that the strain was isolated (Day) are included along each PFGE lane. Saccharomyces cerevisiae DNA concatemers and λ DNA ladder were used as size markers. Sizes are measured in kilobases (Kb). C. albicans strain SC5314 (ATCC MYA-2876) was used as the control strain. Abbreviations: SG, supragingival dental plaque; TS, tracheal secretion; BL, bronchoalveolar lavage.
    Bss Hii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bss hii/product/New England Biolabs
    Average 90 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    bss hii - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results


    Pulsed-field gel electrophoresis (PFGE) patterns of Bss HII restriction endonuclease analysis of genomic DNA (REAG-B) with dendrogram for Candida albicans isolates. A genetic similarity percentage is shown above the dendrogram. Patient identification (Pt ID), sample site (Source), and number of days after admission to the intensive care unit that the strain was isolated (Day) are included along each PFGE lane. Saccharomyces cerevisiae DNA concatemers and λ DNA ladder were used as size markers. Sizes are measured in kilobases (Kb). C. albicans strain SC5314 (ATCC MYA-2876) was used as the control strain. Abbreviations: SG, supragingival dental plaque; TS, tracheal secretion; BL, bronchoalveolar lavage.

    Journal: Journal of Oral Microbiology

    Article Title: Genetic relationships between Candida albicans strains isolated from dental plaque, trachea, and bronchoalveolar lavage fluid from mechanically ventilated intensive care unit patients

    doi: 10.3402/jom.v3i0.6362

    Figure Lengend Snippet: Pulsed-field gel electrophoresis (PFGE) patterns of Bss HII restriction endonuclease analysis of genomic DNA (REAG-B) with dendrogram for Candida albicans isolates. A genetic similarity percentage is shown above the dendrogram. Patient identification (Pt ID), sample site (Source), and number of days after admission to the intensive care unit that the strain was isolated (Day) are included along each PFGE lane. Saccharomyces cerevisiae DNA concatemers and λ DNA ladder were used as size markers. Sizes are measured in kilobases (Kb). C. albicans strain SC5314 (ATCC MYA-2876) was used as the control strain. Abbreviations: SG, supragingival dental plaque; TS, tracheal secretion; BL, bronchoalveolar lavage.

    Article Snippet: For Bss HII digestion, the plug was transferred to a microcentrifuge tube containing 500 µl of buffer 3 (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2 , 1 mM dithiothreitol), and incubated on ice for 30 min. After aspirating buffer, the plug was placed in 160 µl of buffer 3 containing 4 U of Bss HII (New England BioLabs), and incubated overnight at 50°C.

    Techniques: Pulsed-Field Gel, Electrophoresis, Isolation

    Genomic DNA sequence of first exon (in upper case) and flanking intron regions (in lower case) of nuclear progestin receptor (nPR or pgr ) . First and second TALEN targeting sites are highlighted either in green or yellow, respectively. Translation start site (ATG) and restriction enzyme recognition sites ( Bss HII: GCGCGC; Sac II, CCGCGG) are indicated by box. Forward and reverse PCR primers for amplification of genomic region including TALEN targeting sites are underlined. The numbers on the far right of the figure indicate the positions of the nucleotide counting from the ATG starting site. Transcriptional and translational start sites were manually annotated based on our previous published pgr sequence [( 25 ); Genbank access number EF155644] due to annotation errors in databases.

    Journal: Frontiers in Endocrinology

    Article Title: Nuclear Progestin Receptor (Pgr) Knockouts in Zebrafish Demonstrate Role for Pgr in Ovulation but Not in Rapid Non-Genomic Steroid Mediated Meiosis Resumption

    doi: 10.3389/fendo.2015.00037

    Figure Lengend Snippet: Genomic DNA sequence of first exon (in upper case) and flanking intron regions (in lower case) of nuclear progestin receptor (nPR or pgr ) . First and second TALEN targeting sites are highlighted either in green or yellow, respectively. Translation start site (ATG) and restriction enzyme recognition sites ( Bss HII: GCGCGC; Sac II, CCGCGG) are indicated by box. Forward and reverse PCR primers for amplification of genomic region including TALEN targeting sites are underlined. The numbers on the far right of the figure indicate the positions of the nucleotide counting from the ATG starting site. Transcriptional and translational start sites were manually annotated based on our previous published pgr sequence [( 25 ); Genbank access number EF155644] due to annotation errors in databases.

    Article Snippet: About 8.2 μl of PCR product was digested with 0.8 μl of Bss HII (5 U/μl) or Sac II (20 U/μl) (NEB, Cambridge, MA) in 10 μl volume with 1 μl of 10 × reaction buffer at 37°C for 2 h. Mutation rates were estimated by comparing band intensities of undigested PCR products (due to loss RE sites caused by mutation) to intensities of digested PCR products (due to retention of RE sites, i.e., wild-type).

    Techniques: Sequencing, Polymerase Chain Reaction, Amplification