bsr gi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Name:
    BsrGI
    Description:
    BsrGI 5 000 units
    Catalog Number:
    r0575l
    Price:
    282
    Size:
    5 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs bsr gi
    BsrGI
    BsrGI 5 000 units
    https://www.bioz.com/result/bsr gi/product/New England Biolabs
    Average 98 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    bsr gi - by Bioz Stars, 2020-07
    98/100 stars

    Images

    1) Product Images from "Directional cDNA library construction assisted by the in vitro recombination reaction"

    Article Title: Directional cDNA library construction assisted by the in vitro recombination reaction

    Journal: Nucleic Acids Research

    doi:

    Comparison of cloned plasmids produced from an equimolar mixture of three DNA fragments of different sizes by RC and LC. Plasmids retrieved from transformants generated by RC and LC were digested with Bgl II ( A ) or Bsr GI ( B ), and then run on 0.7 or 1.2% agarose gels, respectively. Plasmids were linearized by Bgl II digestion, and inserts were excised from the vector (pSP73) by Bsr GI digestion. Because the resultant clones by RC contained recombination site sequences in the vector portion, the size of the RC plasmid became slightly larger than that of the LC plasmid even when it carried the same insert. In (B), contaminating E.coli chromosomal DNA appeared as the uppermost band in both lanes and the excised βGal fragment, which should run slightly slower than the vectors, was not seen in either lane.
    Figure Legend Snippet: Comparison of cloned plasmids produced from an equimolar mixture of three DNA fragments of different sizes by RC and LC. Plasmids retrieved from transformants generated by RC and LC were digested with Bgl II ( A ) or Bsr GI ( B ), and then run on 0.7 or 1.2% agarose gels, respectively. Plasmids were linearized by Bgl II digestion, and inserts were excised from the vector (pSP73) by Bsr GI digestion. Because the resultant clones by RC contained recombination site sequences in the vector portion, the size of the RC plasmid became slightly larger than that of the LC plasmid even when it carried the same insert. In (B), contaminating E.coli chromosomal DNA appeared as the uppermost band in both lanes and the excised βGal fragment, which should run slightly slower than the vectors, was not seen in either lane.

    Techniques Used: Clone Assay, Produced, Generated, Plasmid Preparation

    2) Product Images from "Structural and Functional Characterization of IS679 and IS66-Family Elements"

    Article Title: Structural and Functional Characterization of IS679 and IS66-Family Elements

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.183.14.4296-4304.2001

    (A) Schematic representation of the IS 679 structure. IS 679 (2,704 bp) has imperfect 25-bp IRs. The IRs at the left and right inverted repeats (IRL and IRR) are indicated by solid triangles. Open, dotted, and cross-hatched arrows indicate, respectively, tnpA, tnpB , and tnpC . The two cross-hatched ovals flanking IS 679 indicate direct repeats of an 8-bp target site sequence. (B) Schematic representations of the structures of pHAN plasmids. pHAN103 carries Tn 679 with the kanamycin resistance gene (Km r ) between an intact IS 679 sequence and the 3′-end region having IRR. Plasmids pHAN104, pHAN105, and pHAN106 carry a Tn 679 derivative with deletions (hatched box) in tnpA, tnpB , and tnpC (thin arrows), respectively. Small solid arrows beneath the pHAN plasmid indicate primers used to construct each plasmid (see Materials and Methods). Primers with a tail indicate an additional sequence with a restriction site. s, Sac II; ai, Bsa I; ei, Bsp EI; gi, Bsr GI; r, Rsr II.
    Figure Legend Snippet: (A) Schematic representation of the IS 679 structure. IS 679 (2,704 bp) has imperfect 25-bp IRs. The IRs at the left and right inverted repeats (IRL and IRR) are indicated by solid triangles. Open, dotted, and cross-hatched arrows indicate, respectively, tnpA, tnpB , and tnpC . The two cross-hatched ovals flanking IS 679 indicate direct repeats of an 8-bp target site sequence. (B) Schematic representations of the structures of pHAN plasmids. pHAN103 carries Tn 679 with the kanamycin resistance gene (Km r ) between an intact IS 679 sequence and the 3′-end region having IRR. Plasmids pHAN104, pHAN105, and pHAN106 carry a Tn 679 derivative with deletions (hatched box) in tnpA, tnpB , and tnpC (thin arrows), respectively. Small solid arrows beneath the pHAN plasmid indicate primers used to construct each plasmid (see Materials and Methods). Primers with a tail indicate an additional sequence with a restriction site. s, Sac II; ai, Bsa I; ei, Bsp EI; gi, Bsr GI; r, Rsr II.

    Techniques Used: Sequencing, Plasmid Preparation, Construct

    Related Articles

    Clone Assay:

    Article Title: Haplotype-specific modulation of a SOX10/CREB response element at the Charcot–Marie–Tooth disease type 4C locus SH3TC2
    Article Snippet: .. Successful cloning of each genomic segment upstream of the luciferase reporter gene was assessed by genotyping with Bsr GI (New England Biolabs). .. Site-directed mutagenesis reactions were performed using the QuikChange II Mutagenesis Kit (Agilent Technologies) and appropriate mutation-bearing primers ( ).

    Amplification:

    Article Title: Spread of Cryptococcus gattii in British Columbia, Canada, and Detection in the Pacific Northwest, USA
    Article Snippet: .. The URA5 gene was amplified as previously described ( ) and then completely digested at 37°C in a 20-μL reaction containing 1× NEB2 buffer, 1× bovine serum albumin, and 4 U each of Hha I, Dde I, and BsrG I (New England Biolabs, Inc., Ipswich, MA, USA). .. RFLP products were subjected to electrophoresis and visualized on a 3% agarose gel prestained with ethidium bromide.

    Synthesized:

    Article Title: Asparagine requirement in Plasmodium berghei as a target to prevent malaria transmission and liver infections
    Article Snippet: .. For Southern analysis, genomic DNA preparations (10 μg) from Pb WT and Pb ASKO parasites were subjected to BsrGI and XbaI digestion followed by hybridization with 5′-UTR-specific probe that was synthesized using Klenow Fragment (New England Biolabs) with 5′-UTR PCR product as a template in the presence of 5 μCi [α-32 P]-dATP. .. Northern analysis was carried out with 2 μg of total RNA prepared from Pb WT and Pb ASKO parasites that were hybridized with Pb AS-specific probe synthesized by Klenow Fragment using PbAS cDNA as a template.

    Isolation:

    Article Title: Highly Significant Antiviral Activity of HIV-1 LTR-Specific Tre-Recombinase in Humanized Mice
    Article Snippet: .. Plasmid DNA was isolated from overnight cultures and digested with BsrG I and Xba I (NEB), resulting in different fragment sizes for recombined versus non-recombined substrate on agarose gels. .. Recombination on the Tre target loxLTR served as positive control.

    Purification:

    Article Title: RNA-DNA hybrid (R-loop) immunoprecipitation mapping: an analytical workflow to evaluate inherent biases
    Article Snippet: .. 2, 4, 6, 8, 10, 12, 14, and 16, purified DNA samples (∼25 µg each) were fragmented using a restriction enzyme cocktail of 1 µL HindIII (20 U/µL), 1 µL EcoRI (20 U/µL), 2 µL BsrGI (10 U/µL), 1 µL XbaI (20 U/µL), and 4 µL SspI (5 U/µL) in NEB Buffer 2 (NEB) (V = 300 µL) at 37°C for 4 h. The fragmented DNA samples were repurified either by phenol-chloroform extraction (experiments 1–4, 9–12) or by the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel) (experiments 5–8, 13–16). ..

    Sequencing:

    Article Title: Directional cDNA library construction assisted by the in vitro recombination reaction
    Article Snippet: .. MCS, Tet and βGal thus obtained were digested with Bsr GI (New England BioLabs), which cleaves at the TGTACA sequence within the common 15 bp core region of each att sequence, leaving four-base 5′ overhangs. .. The products with or without Bsr GI digestion were finally purified using the Concert Rapid PCR Purification System (Life Technologies) and then used for LC or RC, respectively.

    Luciferase:

    Article Title: Haplotype-specific modulation of a SOX10/CREB response element at the Charcot–Marie–Tooth disease type 4C locus SH3TC2
    Article Snippet: .. Successful cloning of each genomic segment upstream of the luciferase reporter gene was assessed by genotyping with Bsr GI (New England Biolabs). .. Site-directed mutagenesis reactions were performed using the QuikChange II Mutagenesis Kit (Agilent Technologies) and appropriate mutation-bearing primers ( ).

    Polymerase Chain Reaction:

    Article Title: RNA-DNA hybrid (R-loop) immunoprecipitation mapping: an analytical workflow to evaluate inherent biases
    Article Snippet: .. 2, 4, 6, 8, 10, 12, 14, and 16, purified DNA samples (∼25 µg each) were fragmented using a restriction enzyme cocktail of 1 µL HindIII (20 U/µL), 1 µL EcoRI (20 U/µL), 2 µL BsrGI (10 U/µL), 1 µL XbaI (20 U/µL), and 4 µL SspI (5 U/µL) in NEB Buffer 2 (NEB) (V = 300 µL) at 37°C for 4 h. The fragmented DNA samples were repurified either by phenol-chloroform extraction (experiments 1–4, 9–12) or by the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel) (experiments 5–8, 13–16). ..

    Article Title: Asparagine requirement in Plasmodium berghei as a target to prevent malaria transmission and liver infections
    Article Snippet: .. For Southern analysis, genomic DNA preparations (10 μg) from Pb WT and Pb ASKO parasites were subjected to BsrGI and XbaI digestion followed by hybridization with 5′-UTR-specific probe that was synthesized using Klenow Fragment (New England Biolabs) with 5′-UTR PCR product as a template in the presence of 5 μCi [α-32 P]-dATP. .. Northern analysis was carried out with 2 μg of total RNA prepared from Pb WT and Pb ASKO parasites that were hybridized with Pb AS-specific probe synthesized by Klenow Fragment using PbAS cDNA as a template.

    Plasmid Preparation:

    Article Title: Highly Significant Antiviral Activity of HIV-1 LTR-Specific Tre-Recombinase in Humanized Mice
    Article Snippet: .. Plasmid DNA was isolated from overnight cultures and digested with BsrG I and Xba I (NEB), resulting in different fragment sizes for recombined versus non-recombined substrate on agarose gels. .. Recombination on the Tre target loxLTR served as positive control.

    Hybridization:

    Article Title: Asparagine requirement in Plasmodium berghei as a target to prevent malaria transmission and liver infections
    Article Snippet: .. For Southern analysis, genomic DNA preparations (10 μg) from Pb WT and Pb ASKO parasites were subjected to BsrGI and XbaI digestion followed by hybridization with 5′-UTR-specific probe that was synthesized using Klenow Fragment (New England Biolabs) with 5′-UTR PCR product as a template in the presence of 5 μCi [α-32 P]-dATP. .. Northern analysis was carried out with 2 μg of total RNA prepared from Pb WT and Pb ASKO parasites that were hybridized with Pb AS-specific probe synthesized by Klenow Fragment using PbAS cDNA as a template.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    New England Biolabs bsr gi
    Comparison of cloned plasmids produced from an equimolar mixture of three DNA fragments of different sizes by RC and LC. Plasmids retrieved from transformants generated by RC and LC were digested with Bgl II ( A ) or <t>Bsr</t> GI ( B ), and then run on 0.7 or 1.2% agarose gels, respectively. Plasmids were linearized by Bgl II digestion, and inserts were excised from the vector (pSP73) by Bsr GI digestion. Because the resultant clones by RC contained recombination site sequences in the vector portion, the size of the RC plasmid became slightly larger than that of the LC plasmid even when it carried the same insert. In (B), contaminating E.coli chromosomal DNA appeared as the uppermost band in both lanes and the excised <t>βGal</t> fragment, which should run slightly slower than the vectors, was not seen in either lane.
    Bsr Gi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsr gi/product/New England Biolabs
    Average 98 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    bsr gi - by Bioz Stars, 2020-07
    98/100 stars
      Buy from Supplier

    85
    New England Biolabs hin diii bsr gi
    PCR method for generating targetron constructs. A 361 bp linear DNA (top) corresponding to the 5′ exon and 5′ end of the Ll.LtrB group II intron was generated by a two-step PCR using two pairs of partially overlapping primers (primers 1 and 3 and primers 2 and 4) to introduce modifications into IBS1/2 (primer 1), EBS2 (primer 2) and EBS1/δ (primer 4). Primer sequences were: primer 1, AAAAAAGCTTCGTCGATCGGAANNNNNNNNNNNNGTGCGCCCAGATAGGGTG; primer 2, CGCAAGTTTCTAATTTCGGTTNNNNNTCGATAGAGGAAAGTGTCT; primer 3, AACCGAAATTAGAAACTTGCGTTCA; primer 4, CAGATTGTACAAATGTGGTGATAACAGATAAGTCNNNNNNNNNAACTTACCTTTCTTTGT (N indicates nucleotide residues that are changed to retarget the intron to specific genes). The 361 bp PCR product is then used as a megaprimer for a second PCR with a 6.7 kb vector backbone generated by Eco RV digestion of pACD3-RAM-PCR. The final PCR product contains gaps (arrowheads) at different positions, depending on the strand of the 361 bp linear DNA from which priming occurred. EV, Eco RV site; B, <t>Bsr</t> GI site; H, Hin <t>dIII</t> site; ori , P15A replication origin of pACYC184 vector.
    Hin Diii Bsr Gi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hin diii bsr gi/product/New England Biolabs
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hin diii bsr gi - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    91
    New England Biolabs bsr gi digested adamts17 pcd
    <t>ADAMTS17-PCD</t> and ADAMTS17-AD localize to fibrillin microfibrils deposited by cultured human dermal fibroblasts (HDF). ( a , b ) HDF were cultured in the presence of 50 μg ADAMTS17-PCD ( a ) or 50 μg ADAMTS17-AD ( b ) for 6 days and co-stained with anti-myc (for ADAMTS17-PCD (PCD) or ADAMTS17-AD (AD)) and antibodies against fibrillin-1 (FBN1), fibrillin-2 (FBN2), or fibronectin (FN) as indicated. Since background staining with the anti-myc antibody was very low, only the merged images are shown for the control cells (right-hand panels).
    Bsr Gi Digested Adamts17 Pcd, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsr gi digested adamts17 pcd/product/New England Biolabs
    Average 91 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    bsr gi digested adamts17 pcd - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    Image Search Results


    Comparison of cloned plasmids produced from an equimolar mixture of three DNA fragments of different sizes by RC and LC. Plasmids retrieved from transformants generated by RC and LC were digested with Bgl II ( A ) or Bsr GI ( B ), and then run on 0.7 or 1.2% agarose gels, respectively. Plasmids were linearized by Bgl II digestion, and inserts were excised from the vector (pSP73) by Bsr GI digestion. Because the resultant clones by RC contained recombination site sequences in the vector portion, the size of the RC plasmid became slightly larger than that of the LC plasmid even when it carried the same insert. In (B), contaminating E.coli chromosomal DNA appeared as the uppermost band in both lanes and the excised βGal fragment, which should run slightly slower than the vectors, was not seen in either lane.

    Journal: Nucleic Acids Research

    Article Title: Directional cDNA library construction assisted by the in vitro recombination reaction

    doi:

    Figure Lengend Snippet: Comparison of cloned plasmids produced from an equimolar mixture of three DNA fragments of different sizes by RC and LC. Plasmids retrieved from transformants generated by RC and LC were digested with Bgl II ( A ) or Bsr GI ( B ), and then run on 0.7 or 1.2% agarose gels, respectively. Plasmids were linearized by Bgl II digestion, and inserts were excised from the vector (pSP73) by Bsr GI digestion. Because the resultant clones by RC contained recombination site sequences in the vector portion, the size of the RC plasmid became slightly larger than that of the LC plasmid even when it carried the same insert. In (B), contaminating E.coli chromosomal DNA appeared as the uppermost band in both lanes and the excised βGal fragment, which should run slightly slower than the vectors, was not seen in either lane.

    Article Snippet: MCS, Tet and βGal thus obtained were digested with Bsr GI (New England BioLabs), which cleaves at the TGTACA sequence within the common 15 bp core region of each att sequence, leaving four-base 5′ overhangs.

    Techniques: Clone Assay, Produced, Generated, Plasmid Preparation

    (A) The flank area with enzymes sequences (yellow: Bgl II, gray: Swa I, pink: Kpn I, orange: Fse I, violet: Bsr gI). (B) The map of the pGEM-b1 vector. (C) pGEM-b1 vector that contain the flank regions and specific restricted enzymes for cloning. (D) The pLexsy-2 vector contain construct after cloning

    Journal: Iranian Journal of Parasitology

    Article Title: Designing and Cloning Molecular Constructs to Knock Out N-Acetylglucosamine Phosphatidylinositol De-N-Acetylase (GPI12) Gene in Leishmania major (MRHO/IR/75/ER)

    doi:

    Figure Lengend Snippet: (A) The flank area with enzymes sequences (yellow: Bgl II, gray: Swa I, pink: Kpn I, orange: Fse I, violet: Bsr gI). (B) The map of the pGEM-b1 vector. (C) pGEM-b1 vector that contain the flank regions and specific restricted enzymes for cloning. (D) The pLexsy-2 vector contain construct after cloning

    Article Snippet: The PCR fragments were cut by Fse I and Bsr gI enzymes (New England Biolabs, UK).

    Techniques: Plasmid Preparation, Clone Assay, Construct

    In all figures, lane 1 shows molecular size marker. (A) The sequences of flank areas on which PCR was performed by primerM13; Lane 2 shows the amplified ∼1kb band. (B) The PCR fragments which were cut with Bgl II and Kpn I enzymes. The PCR product which was divided into 3 pieces of 600, 300 and 100 bp; Lane 2 shows the 300 bp fragment. (C) The pLEXSY vector, which was cut by Fse I and Bsr gI enzymes; Lane 2 shows the ∼ 0.7 kb fragment is separated from the vector. (D) The pLEXSY vector, which was cut by Bgl II and Kpn I enzymes. Lane 2 shows the ∼1 kb fragment is separated from the vector. (E) The PCR fragments which were cut with Fse I and Bsr gI enzymes. The PCR product which was divided into 3 pieces of 500, 400 and 100 bp; Lane 2 shows the 500 bp fragment

    Journal: Iranian Journal of Parasitology

    Article Title: Designing and Cloning Molecular Constructs to Knock Out N-Acetylglucosamine Phosphatidylinositol De-N-Acetylase (GPI12) Gene in Leishmania major (MRHO/IR/75/ER)

    doi:

    Figure Lengend Snippet: In all figures, lane 1 shows molecular size marker. (A) The sequences of flank areas on which PCR was performed by primerM13; Lane 2 shows the amplified ∼1kb band. (B) The PCR fragments which were cut with Bgl II and Kpn I enzymes. The PCR product which was divided into 3 pieces of 600, 300 and 100 bp; Lane 2 shows the 300 bp fragment. (C) The pLEXSY vector, which was cut by Fse I and Bsr gI enzymes; Lane 2 shows the ∼ 0.7 kb fragment is separated from the vector. (D) The pLEXSY vector, which was cut by Bgl II and Kpn I enzymes. Lane 2 shows the ∼1 kb fragment is separated from the vector. (E) The PCR fragments which were cut with Fse I and Bsr gI enzymes. The PCR product which was divided into 3 pieces of 500, 400 and 100 bp; Lane 2 shows the 500 bp fragment

    Article Snippet: The PCR fragments were cut by Fse I and Bsr gI enzymes (New England Biolabs, UK).

    Techniques: Marker, Polymerase Chain Reaction, Amplification, Plasmid Preparation

    PCR method for generating targetron constructs. A 361 bp linear DNA (top) corresponding to the 5′ exon and 5′ end of the Ll.LtrB group II intron was generated by a two-step PCR using two pairs of partially overlapping primers (primers 1 and 3 and primers 2 and 4) to introduce modifications into IBS1/2 (primer 1), EBS2 (primer 2) and EBS1/δ (primer 4). Primer sequences were: primer 1, AAAAAAGCTTCGTCGATCGGAANNNNNNNNNNNNGTGCGCCCAGATAGGGTG; primer 2, CGCAAGTTTCTAATTTCGGTTNNNNNTCGATAGAGGAAAGTGTCT; primer 3, AACCGAAATTAGAAACTTGCGTTCA; primer 4, CAGATTGTACAAATGTGGTGATAACAGATAAGTCNNNNNNNNNAACTTACCTTTCTTTGT (N indicates nucleotide residues that are changed to retarget the intron to specific genes). The 361 bp PCR product is then used as a megaprimer for a second PCR with a 6.7 kb vector backbone generated by Eco RV digestion of pACD3-RAM-PCR. The final PCR product contains gaps (arrowheads) at different positions, depending on the strand of the 361 bp linear DNA from which priming occurred. EV, Eco RV site; B, Bsr GI site; H, Hin dIII site; ori , P15A replication origin of pACYC184 vector.

    Journal: Nucleic Acids Research

    Article Title: Targeted and random bacterial gene disruption using a group II intron (targetron) vector containing a retrotransposition-activated selectable marker

    doi:

    Figure Lengend Snippet: PCR method for generating targetron constructs. A 361 bp linear DNA (top) corresponding to the 5′ exon and 5′ end of the Ll.LtrB group II intron was generated by a two-step PCR using two pairs of partially overlapping primers (primers 1 and 3 and primers 2 and 4) to introduce modifications into IBS1/2 (primer 1), EBS2 (primer 2) and EBS1/δ (primer 4). Primer sequences were: primer 1, AAAAAAGCTTCGTCGATCGGAANNNNNNNNNNNNGTGCGCCCAGATAGGGTG; primer 2, CGCAAGTTTCTAATTTCGGTTNNNNNTCGATAGAGGAAAGTGTCT; primer 3, AACCGAAATTAGAAACTTGCGTTCA; primer 4, CAGATTGTACAAATGTGGTGATAACAGATAAGTCNNNNNNNNNAACTTACCTTTCTTTGT (N indicates nucleotide residues that are changed to retarget the intron to specific genes). The 361 bp PCR product is then used as a megaprimer for a second PCR with a 6.7 kb vector backbone generated by Eco RV digestion of pACD3-RAM-PCR. The final PCR product contains gaps (arrowheads) at different positions, depending on the strand of the 361 bp linear DNA from which priming occurred. EV, Eco RV site; B, Bsr GI site; H, Hin dIII site; ori , P15A replication origin of pACYC184 vector.

    Article Snippet: Alternatively, the 361 bp PCR product and pACD3-RAM were both digested with Hin dIII + Bsr GI and then ligated with T4 DNA ligase (400 U) (New England Biolabs, Beverly, MA) for 1 h at room temperature, prior to transformation.

    Techniques: Polymerase Chain Reaction, Construct, Generated, Introduce, Plasmid Preparation

    ADAMTS17-PCD and ADAMTS17-AD localize to fibrillin microfibrils deposited by cultured human dermal fibroblasts (HDF). ( a , b ) HDF were cultured in the presence of 50 μg ADAMTS17-PCD ( a ) or 50 μg ADAMTS17-AD ( b ) for 6 days and co-stained with anti-myc (for ADAMTS17-PCD (PCD) or ADAMTS17-AD (AD)) and antibodies against fibrillin-1 (FBN1), fibrillin-2 (FBN2), or fibronectin (FN) as indicated. Since background staining with the anti-myc antibody was very low, only the merged images are shown for the control cells (right-hand panels).

    Journal: Scientific Reports

    Article Title: Unusual life cycle and impact on microfibril assembly of ADAMTS17, a secreted metalloprotease mutated in genetic eye disease

    doi: 10.1038/srep41871

    Figure Lengend Snippet: ADAMTS17-PCD and ADAMTS17-AD localize to fibrillin microfibrils deposited by cultured human dermal fibroblasts (HDF). ( a , b ) HDF were cultured in the presence of 50 μg ADAMTS17-PCD ( a ) or 50 μg ADAMTS17-AD ( b ) for 6 days and co-stained with anti-myc (for ADAMTS17-PCD (PCD) or ADAMTS17-AD (AD)) and antibodies against fibrillin-1 (FBN1), fibrillin-2 (FBN2), or fibronectin (FN) as indicated. Since background staining with the anti-myc antibody was very low, only the merged images are shown for the control cells (right-hand panels).

    Article Snippet: To introduce the Arg223 to Ala (RA) furin site mutation, two overlapping PCR products were assembled together with Not I × Bsr GI digested ADAMTS17-PCD using the NEBuilder® HiFi DNA Assembly Kit (New England Biolabs, Ipswich, MA).

    Techniques: Cell Culture, Staining

    ADAMTS17-PCD interferes with fibrillin-2 microfibril formation by mouse embryo fibroblasts. ( a ) Mouse embryo fibroblasts (MEFs) were cultured in the presence of 50 μg ADAMTS17-PCD (PCD) or an equivalent volume of buffer (PBS) for 48 h and co-stained for ADAMTS17-PCD with anti-myc and with antibodies against fibrillin-1 (FBN1), fibrillin-2 (FBN2), or fibronectin (FN) as indicated. ( b ) qRT-PCR analysis of Fbn1, Fbn2 , and Fn in MEFs shows reduction in Fbn2 gene expression in the presence of ADAMTS17-PCD (PCD). Note the lesser reduction in Fbn1 expression and no change in Fn gene expression. ( c ) MEF cell number was greatly reduced in the presence of ADAMTS17-AD. ( d ) Rat aortic smooth muscle cells (ASMC, A7r5) were cultured in the presence of ADAMTS17-PCD (PCD), ADAMTS17-AD (AD) or the equivalent volume of PBS for 72 h and costained using anti-myc and fibronectin (FN). Note the punctate staining of ADAMTS17-PCD and ADAMTS17-AD, which does not co-localize with fibronectin fibrils.

    Journal: Scientific Reports

    Article Title: Unusual life cycle and impact on microfibril assembly of ADAMTS17, a secreted metalloprotease mutated in genetic eye disease

    doi: 10.1038/srep41871

    Figure Lengend Snippet: ADAMTS17-PCD interferes with fibrillin-2 microfibril formation by mouse embryo fibroblasts. ( a ) Mouse embryo fibroblasts (MEFs) were cultured in the presence of 50 μg ADAMTS17-PCD (PCD) or an equivalent volume of buffer (PBS) for 48 h and co-stained for ADAMTS17-PCD with anti-myc and with antibodies against fibrillin-1 (FBN1), fibrillin-2 (FBN2), or fibronectin (FN) as indicated. ( b ) qRT-PCR analysis of Fbn1, Fbn2 , and Fn in MEFs shows reduction in Fbn2 gene expression in the presence of ADAMTS17-PCD (PCD). Note the lesser reduction in Fbn1 expression and no change in Fn gene expression. ( c ) MEF cell number was greatly reduced in the presence of ADAMTS17-AD. ( d ) Rat aortic smooth muscle cells (ASMC, A7r5) were cultured in the presence of ADAMTS17-PCD (PCD), ADAMTS17-AD (AD) or the equivalent volume of PBS for 72 h and costained using anti-myc and fibronectin (FN). Note the punctate staining of ADAMTS17-PCD and ADAMTS17-AD, which does not co-localize with fibronectin fibrils.

    Article Snippet: To introduce the Arg223 to Ala (RA) furin site mutation, two overlapping PCR products were assembled together with Not I × Bsr GI digested ADAMTS17-PCD using the NEBuilder® HiFi DNA Assembly Kit (New England Biolabs, Ipswich, MA).

    Techniques: Cell Culture, Staining, Quantitative RT-PCR, Expressing

    ADAMTS17 undergoes autocatalysis in trans that is independent of furin processing. ( a ) Western blot analysis of conditioned medium (Med) and cell lysate (Lys) of HEK293F cells co-transfected with ADAMTS17 EA (17-EA) and ADAMTS17 (17), ADAMTS17 EA (17-EA), ADAMTS17-PCD (PCD), or empty vector (v) indicate trans-cleavage of ADAMTS17 EA by ADAMTS17 and ADAMTS17-PCD. White arrows indicate lanes with cleavage products, detected with the anti-propeptide antibody (anti-PP, green). Anti-myc (red) detects zymogen and mature forms of ADAMTS17 in the cell lysates and zymogen and mature form of ADAMTS17-PCD in the cell lysate and conditioned medium. ( b ) Western blot analysis of conditioned medium (Med) from HEK293F cells, stably expressing ADAMTS17-AD (AD) and transiently expressing ADAMTS17 (17), ADAMTS17 EA (17-EA), ADAMTS17 RA (17-RA) or empty vector (v). Note reduced levels of ADAMTS17-AD in the presence of ADAMTS17 or ADAMTS17 RA (left-hand panel, red) and mass shift of furin-resistant species compared to wild type (brackets indicated by Δ1 and Δ2) (middle panel, green). The proteolytic product detected with anti-AD is indicated with an arrow (right-hand panel, red) and only appears upon transfection of ADAMTS17-AD expressing cells with ADAMTS17 or ADAMTS17 RA . ( c ) Western blot analysis of conditioned medium (Med) from HEK293F cells, stably expressing ADAMTS17-AD (AD) and transiently expressing ADAMTS17-PCD (PCD), ADAMTS17-PCD EA (PCD-EA), ADAMTS17-PCD RA (PCD-RA) or empty vector (v). The mature form of ADAMTS17-PCD (PCD-M) was not generated in ADAMTS17-PCD RA , indicating lack of furin processing (left-hand panel, red and middle panel, green). Furin processing did not abolish proteolytic activity as observed by reduction in the intensity of anti-myc reactive ADAMTS17-AD (left-hand panel, top band) or the appearance of an additional band reactive with the anti-AD antibody (arrow, right panel, red). Note that the α-Myc antibody (red) detects both ADAMTS17-PCD and ADAMTS17-AD. M, mature enzyme; Z, zymogen.

    Journal: Scientific Reports

    Article Title: Unusual life cycle and impact on microfibril assembly of ADAMTS17, a secreted metalloprotease mutated in genetic eye disease

    doi: 10.1038/srep41871

    Figure Lengend Snippet: ADAMTS17 undergoes autocatalysis in trans that is independent of furin processing. ( a ) Western blot analysis of conditioned medium (Med) and cell lysate (Lys) of HEK293F cells co-transfected with ADAMTS17 EA (17-EA) and ADAMTS17 (17), ADAMTS17 EA (17-EA), ADAMTS17-PCD (PCD), or empty vector (v) indicate trans-cleavage of ADAMTS17 EA by ADAMTS17 and ADAMTS17-PCD. White arrows indicate lanes with cleavage products, detected with the anti-propeptide antibody (anti-PP, green). Anti-myc (red) detects zymogen and mature forms of ADAMTS17 in the cell lysates and zymogen and mature form of ADAMTS17-PCD in the cell lysate and conditioned medium. ( b ) Western blot analysis of conditioned medium (Med) from HEK293F cells, stably expressing ADAMTS17-AD (AD) and transiently expressing ADAMTS17 (17), ADAMTS17 EA (17-EA), ADAMTS17 RA (17-RA) or empty vector (v). Note reduced levels of ADAMTS17-AD in the presence of ADAMTS17 or ADAMTS17 RA (left-hand panel, red) and mass shift of furin-resistant species compared to wild type (brackets indicated by Δ1 and Δ2) (middle panel, green). The proteolytic product detected with anti-AD is indicated with an arrow (right-hand panel, red) and only appears upon transfection of ADAMTS17-AD expressing cells with ADAMTS17 or ADAMTS17 RA . ( c ) Western blot analysis of conditioned medium (Med) from HEK293F cells, stably expressing ADAMTS17-AD (AD) and transiently expressing ADAMTS17-PCD (PCD), ADAMTS17-PCD EA (PCD-EA), ADAMTS17-PCD RA (PCD-RA) or empty vector (v). The mature form of ADAMTS17-PCD (PCD-M) was not generated in ADAMTS17-PCD RA , indicating lack of furin processing (left-hand panel, red and middle panel, green). Furin processing did not abolish proteolytic activity as observed by reduction in the intensity of anti-myc reactive ADAMTS17-AD (left-hand panel, top band) or the appearance of an additional band reactive with the anti-AD antibody (arrow, right panel, red). Note that the α-Myc antibody (red) detects both ADAMTS17-PCD and ADAMTS17-AD. M, mature enzyme; Z, zymogen.

    Article Snippet: To introduce the Arg223 to Ala (RA) furin site mutation, two overlapping PCR products were assembled together with Not I × Bsr GI digested ADAMTS17-PCD using the NEBuilder® HiFi DNA Assembly Kit (New England Biolabs, Ipswich, MA).

    Techniques: Western Blot, Transfection, Plasmid Preparation, Stable Transfection, Expressing, Generated, Activity Assay

    ADAMTS17-PCD self-associates via disulfide bonds involving the propeptide. ( a ) Coomassie blue stained 7.5% SDS-PAGE of purified ADAMTS17-PCD (20 μg/lane) separated under reducing (+ DTT) and non-reducing (− DTT) conditions. The black arrowhead depicts the border between the stacking and separating gel; 1 and 2 indicate large molecular weight complexes of ADAMTS17-PCD, which in the absence of DTT, did not enter the stacking or separating gel, respectively. The “+ DTT” and “− DTT” lanes are separated by an empty lane. M, mature enzyme; Z, zymogen. ( b ) Flow chart outlining the design of cross-linking experiments in c. ( c ) Coomassie blue-stained reducing SDS-PAGE of purified ADAMTS17-PCD (10 μg/lane) incubated with increasing concentrations of BS 3 cross-linker in the presence (+ DTT) or absence of reducing agent (no DTT) (Annotations as in a). ( d ) Schematic of ADAMTS17-PCD showing cysteine residues and indicating their oxidized or reduced status determined by LC-MS/MS. ( e ) Western-blot analysis of conditioned medium (Med) and cell lysate (Lys) from cells expressing ADAMTS17 (17), ADAMTS17 EA (17-EA), ADAMTS17-PCD (PCD), and ADAMTS17-PCD EA (PCD-EA) under reducing (+ DTT) and non-reducing conditions (no DTT). Areas of the gel in the high MW range ( > 100 kDa) reacting with anti-myc in the absence of DTT in medium and lysate are outlined with a bar. The asterisk indicates prominent anti-myc reactive ADAMTS17-PCD band in the lysate under non-reducing conditions. ( f ) Surface plasmon resonance indicates interaction of ADAMTS17-PCD to surface immobilized ADAMTS17-PCD in a dose dependent manner. The dissociation constant (K D ) was calculated assuming 1:1 binding. ( g ) Schematic of ADAMTS17-PCD truncation mutants (top panel). Western blot analysis of conditioned medium and cell lysate from HEK293 cells transiently transfected with ADAMTS17-PCD truncation mutants indicates anti-myc and anti-catalytic domain antibody reactive bands (yellow) of the predicted molecular weight in cell lysates for each mutant (bottom, right-hand panel). However, the entire propeptide is required for secretion (bottom, left-hand panel).

    Journal: Scientific Reports

    Article Title: Unusual life cycle and impact on microfibril assembly of ADAMTS17, a secreted metalloprotease mutated in genetic eye disease

    doi: 10.1038/srep41871

    Figure Lengend Snippet: ADAMTS17-PCD self-associates via disulfide bonds involving the propeptide. ( a ) Coomassie blue stained 7.5% SDS-PAGE of purified ADAMTS17-PCD (20 μg/lane) separated under reducing (+ DTT) and non-reducing (− DTT) conditions. The black arrowhead depicts the border between the stacking and separating gel; 1 and 2 indicate large molecular weight complexes of ADAMTS17-PCD, which in the absence of DTT, did not enter the stacking or separating gel, respectively. The “+ DTT” and “− DTT” lanes are separated by an empty lane. M, mature enzyme; Z, zymogen. ( b ) Flow chart outlining the design of cross-linking experiments in c. ( c ) Coomassie blue-stained reducing SDS-PAGE of purified ADAMTS17-PCD (10 μg/lane) incubated with increasing concentrations of BS 3 cross-linker in the presence (+ DTT) or absence of reducing agent (no DTT) (Annotations as in a). ( d ) Schematic of ADAMTS17-PCD showing cysteine residues and indicating their oxidized or reduced status determined by LC-MS/MS. ( e ) Western-blot analysis of conditioned medium (Med) and cell lysate (Lys) from cells expressing ADAMTS17 (17), ADAMTS17 EA (17-EA), ADAMTS17-PCD (PCD), and ADAMTS17-PCD EA (PCD-EA) under reducing (+ DTT) and non-reducing conditions (no DTT). Areas of the gel in the high MW range ( > 100 kDa) reacting with anti-myc in the absence of DTT in medium and lysate are outlined with a bar. The asterisk indicates prominent anti-myc reactive ADAMTS17-PCD band in the lysate under non-reducing conditions. ( f ) Surface plasmon resonance indicates interaction of ADAMTS17-PCD to surface immobilized ADAMTS17-PCD in a dose dependent manner. The dissociation constant (K D ) was calculated assuming 1:1 binding. ( g ) Schematic of ADAMTS17-PCD truncation mutants (top panel). Western blot analysis of conditioned medium and cell lysate from HEK293 cells transiently transfected with ADAMTS17-PCD truncation mutants indicates anti-myc and anti-catalytic domain antibody reactive bands (yellow) of the predicted molecular weight in cell lysates for each mutant (bottom, right-hand panel). However, the entire propeptide is required for secretion (bottom, left-hand panel).

    Article Snippet: To introduce the Arg223 to Ala (RA) furin site mutation, two overlapping PCR products were assembled together with Not I × Bsr GI digested ADAMTS17-PCD using the NEBuilder® HiFi DNA Assembly Kit (New England Biolabs, Ipswich, MA).

    Techniques: Staining, SDS Page, Purification, Molecular Weight, Flow Cytometry, Incubation, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Western Blot, Expressing, SPR Assay, Binding Assay, Transfection, Mutagenesis

    ADAMTS17-PCD binds to fibrillin-2 but not fibrillin-1 or fibronectin. ( a ) Domain structure of recombinant fibrillin-1 and fibrillin-2 peptides used to analyze interactions with ADAMTS17-PCD (PCD) or ADAMTS17-AD (AD). ( b ) Coomassie blue stained SDS-PAGE showing the integrity and purity of the recombinant proteins used in the interaction studies. The asterisks indicate the full-length constructs. M, mature enzyme; Z, zymogen. ( c ) Surface plasmon resonance shows binding of FBN2-N and FBN2-C to ADAMTS17-PCD (left-hand panels) or ADAMTS17-AD (right-hand panels). Binding was dose-dependent and Ca 2+ -dependent. The dissociation constant (K D ) was calculated assuming 1:1 stoichiometry. ( d ) ADAMTS17-PCD (top panel) or ADAMTS17-AD (bottom panel) did not bind to FBN1-N, FBN1-C, or cellular fibronectin (FN) analytes and ADAMTS17-AD did not self-interact or bind to ADAMTS17-PCD.

    Journal: Scientific Reports

    Article Title: Unusual life cycle and impact on microfibril assembly of ADAMTS17, a secreted metalloprotease mutated in genetic eye disease

    doi: 10.1038/srep41871

    Figure Lengend Snippet: ADAMTS17-PCD binds to fibrillin-2 but not fibrillin-1 or fibronectin. ( a ) Domain structure of recombinant fibrillin-1 and fibrillin-2 peptides used to analyze interactions with ADAMTS17-PCD (PCD) or ADAMTS17-AD (AD). ( b ) Coomassie blue stained SDS-PAGE showing the integrity and purity of the recombinant proteins used in the interaction studies. The asterisks indicate the full-length constructs. M, mature enzyme; Z, zymogen. ( c ) Surface plasmon resonance shows binding of FBN2-N and FBN2-C to ADAMTS17-PCD (left-hand panels) or ADAMTS17-AD (right-hand panels). Binding was dose-dependent and Ca 2+ -dependent. The dissociation constant (K D ) was calculated assuming 1:1 stoichiometry. ( d ) ADAMTS17-PCD (top panel) or ADAMTS17-AD (bottom panel) did not bind to FBN1-N, FBN1-C, or cellular fibronectin (FN) analytes and ADAMTS17-AD did not self-interact or bind to ADAMTS17-PCD.

    Article Snippet: To introduce the Arg223 to Ala (RA) furin site mutation, two overlapping PCR products were assembled together with Not I × Bsr GI digested ADAMTS17-PCD using the NEBuilder® HiFi DNA Assembly Kit (New England Biolabs, Ipswich, MA).

    Techniques: Recombinant, Staining, SDS Page, Construct, SPR Assay, Binding Assay

    ADAMTS17 undergoes autocatalytic processing. ( a ) Domain organization of ADAMTS17 and the constructs ADAMTS17-PCD and ADAMTS17-AD. The location of the ADAMTS17 antibody epitopes (black line) and the sites of site-directed mutagenesis (furin-site: R 223 A, active site: E 390 A) are indicated above the ADAMTS17 domains. The predicted furin/PACE cleavage sites are shown below the ADAMTS17-PCD construct. Cleavage at site R223 results in mature (“M”) ADAMTS17. ( b ) Western blot analysis of conditioned medium (Med) and cell lysate (Lys) from full-length ADAMTS17 (17), the active site mutant ADAMTS17 EA (17-EA), and empty vector (v) expressing HEK293F cells. Western blots were probed with the indicated antibodies and detected with enhanced chemiluminescence. ( c ) Western blot analysis of conditioned medium (Med) and cell lysate (Lys) from ADAMTS17-PCD (PCD), ADAMTS17-PCD EA (PCD-EA), and empty vector (v) expressing HEK293F cells. The asterisk indicates a band which is reactive with anti-propeptide antibody (anti-PP, green), but not anti-myc (red), and which is absent in ADAMTS17-PCD EA . ( d ) Western blot analysis of conditioned medium (Med) and cell lysate (Lys) from ADAMTS17-AD (AD) and empty vector (v) expressing HEK293F cells. The asterisk indicates intact ADAMTS17-AD (yellow), reactive with anti-myc (red) and anti-ancillary domain antibody (anti-AD, green). Arrowheads indicate species reactive with only anti-myc, but not anti-AD (red). ( e ) Semi-tryptic peptides resulting from ADAMTS17 autoproteolysis and identified by LC-MS/MS (blue: enriched in ADAMTS17, black: enriched in ADAMTS17 EA , red: present only in wild-type ADAMTS17) ( f ) Location of semi-tryptic peptides in ADAMTS17. Numbers and color coding correspond to the list in e. mAb, monoclonal antibody; M, mature enzyme; pAb, polyclonal antibody; v, vector; Z, zymogen.

    Journal: Scientific Reports

    Article Title: Unusual life cycle and impact on microfibril assembly of ADAMTS17, a secreted metalloprotease mutated in genetic eye disease

    doi: 10.1038/srep41871

    Figure Lengend Snippet: ADAMTS17 undergoes autocatalytic processing. ( a ) Domain organization of ADAMTS17 and the constructs ADAMTS17-PCD and ADAMTS17-AD. The location of the ADAMTS17 antibody epitopes (black line) and the sites of site-directed mutagenesis (furin-site: R 223 A, active site: E 390 A) are indicated above the ADAMTS17 domains. The predicted furin/PACE cleavage sites are shown below the ADAMTS17-PCD construct. Cleavage at site R223 results in mature (“M”) ADAMTS17. ( b ) Western blot analysis of conditioned medium (Med) and cell lysate (Lys) from full-length ADAMTS17 (17), the active site mutant ADAMTS17 EA (17-EA), and empty vector (v) expressing HEK293F cells. Western blots were probed with the indicated antibodies and detected with enhanced chemiluminescence. ( c ) Western blot analysis of conditioned medium (Med) and cell lysate (Lys) from ADAMTS17-PCD (PCD), ADAMTS17-PCD EA (PCD-EA), and empty vector (v) expressing HEK293F cells. The asterisk indicates a band which is reactive with anti-propeptide antibody (anti-PP, green), but not anti-myc (red), and which is absent in ADAMTS17-PCD EA . ( d ) Western blot analysis of conditioned medium (Med) and cell lysate (Lys) from ADAMTS17-AD (AD) and empty vector (v) expressing HEK293F cells. The asterisk indicates intact ADAMTS17-AD (yellow), reactive with anti-myc (red) and anti-ancillary domain antibody (anti-AD, green). Arrowheads indicate species reactive with only anti-myc, but not anti-AD (red). ( e ) Semi-tryptic peptides resulting from ADAMTS17 autoproteolysis and identified by LC-MS/MS (blue: enriched in ADAMTS17, black: enriched in ADAMTS17 EA , red: present only in wild-type ADAMTS17) ( f ) Location of semi-tryptic peptides in ADAMTS17. Numbers and color coding correspond to the list in e. mAb, monoclonal antibody; M, mature enzyme; pAb, polyclonal antibody; v, vector; Z, zymogen.

    Article Snippet: To introduce the Arg223 to Ala (RA) furin site mutation, two overlapping PCR products were assembled together with Not I × Bsr GI digested ADAMTS17-PCD using the NEBuilder® HiFi DNA Assembly Kit (New England Biolabs, Ipswich, MA).

    Techniques: Construct, Mutagenesis, Western Blot, Plasmid Preparation, Expressing, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

    ADAMTS17-PCD does not cleave fibrillin-1 or fibrillin-2. ( a ) Coomassie-blue stained SDS-PAGE of fibrillin-1 (FBN1-N, FBN1-C) and fibrillin-2 (FBN2-N, FBN2-C) peptides (5 μg/lane) (see Fig. 6a ) incubated with (+) or without (−) recombinant ADAMTS17-PCD (5 μg/lane) shows no evidence for proteolysis of fibrillin-1 or fibrillin-2 in vitro . M = mature enzyme; Z = zymogen. ( b ) Western blot analysis of conditioned medium (Med) and cell lysate (Lys) from HEK293F cells stably expressing fibrillin-1 and transiently expressing ADAMTS17 (17), ADAMTS17 EA (17-EA), ADAMTS17-PCD (PCD) or empty vector (v). Western blots were probed with antibodies against fibrillin-1 (anti-FBN1-C, green) and the recombinant ADAMTS17 peptides (ant i-myc, red). ( c ) Western blot analysis of conditioned medium (Med) and cell lysate (Lys) from HEK293F cells stably expressing FBN2-N or FBN2-C with ADAMTS17 (17), ADAMTS17 EA (17-EA), ADAMTS17-PCD (PCD), or empty vector (v) shows no evidence of cleavage. Western blots were probed with antibodies detecting fibrillin-2 (anti-FBN2-N or anti-FBN2-C, green) and the recombinant ADAMTS17 peptides (anti-myc, red).

    Journal: Scientific Reports

    Article Title: Unusual life cycle and impact on microfibril assembly of ADAMTS17, a secreted metalloprotease mutated in genetic eye disease

    doi: 10.1038/srep41871

    Figure Lengend Snippet: ADAMTS17-PCD does not cleave fibrillin-1 or fibrillin-2. ( a ) Coomassie-blue stained SDS-PAGE of fibrillin-1 (FBN1-N, FBN1-C) and fibrillin-2 (FBN2-N, FBN2-C) peptides (5 μg/lane) (see Fig. 6a ) incubated with (+) or without (−) recombinant ADAMTS17-PCD (5 μg/lane) shows no evidence for proteolysis of fibrillin-1 or fibrillin-2 in vitro . M = mature enzyme; Z = zymogen. ( b ) Western blot analysis of conditioned medium (Med) and cell lysate (Lys) from HEK293F cells stably expressing fibrillin-1 and transiently expressing ADAMTS17 (17), ADAMTS17 EA (17-EA), ADAMTS17-PCD (PCD) or empty vector (v). Western blots were probed with antibodies against fibrillin-1 (anti-FBN1-C, green) and the recombinant ADAMTS17 peptides (ant i-myc, red). ( c ) Western blot analysis of conditioned medium (Med) and cell lysate (Lys) from HEK293F cells stably expressing FBN2-N or FBN2-C with ADAMTS17 (17), ADAMTS17 EA (17-EA), ADAMTS17-PCD (PCD), or empty vector (v) shows no evidence of cleavage. Western blots were probed with antibodies detecting fibrillin-2 (anti-FBN2-N or anti-FBN2-C, green) and the recombinant ADAMTS17 peptides (anti-myc, red).

    Article Snippet: To introduce the Arg223 to Ala (RA) furin site mutation, two overlapping PCR products were assembled together with Not I × Bsr GI digested ADAMTS17-PCD using the NEBuilder® HiFi DNA Assembly Kit (New England Biolabs, Ipswich, MA).

    Techniques: Staining, SDS Page, Incubation, Recombinant, In Vitro, Western Blot, Stable Transfection, Expressing, Plasmid Preparation