bsr gi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    New England Biolabs bsr gi
    Bsr Gi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsr gi/product/New England Biolabs
    Average 95 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    bsr gi - by Bioz Stars, 2020-04
    95/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: The G-rich Repeats in FMR1 and C9orf72 Loci Are Hotspots for Local Unpairing of DNA
    Article Snippet: DNA was fragmented using Hin dIII, Eco RI, Bsr GI, Xba I, and Ssp I, and pretreated, or not, with recombinant RNase H (#B0297S; NEB) overnight. .. The pulled-down material (with and without RNase H treatment) and 1% input DNA were then subjected to quantitative PCR analysis.

    Ethanol Precipitation:

    Article Title: The G-rich Repeats in FMR1 and C9orf72 Loci Are Hotspots for Local Unpairing of DNA
    Article Snippet: Briefly, total nucleic acids were extracted by SDS/Proteinase K treatment at 37°, followed by phenol-chloroform extraction and ethanol precipitation. .. DNA was fragmented using Hin dIII, Eco RI, Bsr GI, Xba I, and Ssp I, and pretreated, or not, with recombinant RNase H (#B0297S; NEB) overnight.

    Recombinant:

    Article Title: The G-rich Repeats in FMR1 and C9orf72 Loci Are Hotspots for Local Unpairing of DNA
    Article Snippet: .. DNA was fragmented using Hin dIII, Eco RI, Bsr GI, Xba I, and Ssp I, and pretreated, or not, with recombinant RNase H (#B0297S; NEB) overnight. .. Then, 4 µg of digested DNA was immunoprecipitated with 10 µg of S9.6 antibody (kindly provided by Clinton E. Leysath, National Institutes of Health, or commercially available from Kerafast) overnight.

    Immunoprecipitation:

    Article Title: The G-rich Repeats in FMR1 and C9orf72 Loci Are Hotspots for Local Unpairing of DNA
    Article Snippet: Paragraph title: DNA:RNA immunoprecipitation assay ... DNA was fragmented using Hin dIII, Eco RI, Bsr GI, Xba I, and Ssp I, and pretreated, or not, with recombinant RNase H (#B0297S; NEB) overnight.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs bsr gi
    Comparison of cloned plasmids produced from an equimolar mixture of three DNA fragments of different sizes by RC and LC. Plasmids retrieved from transformants generated by RC and LC were digested with Bgl II ( A ) or <t>Bsr</t> GI ( B ), and then run on 0.7 or 1.2% agarose gels, respectively. Plasmids were linearized by Bgl II digestion, and inserts were excised from the vector (pSP73) by Bsr GI digestion. Because the resultant clones by RC contained recombination site sequences in the vector portion, the size of the RC plasmid became slightly larger than that of the LC plasmid even when it carried the same insert. In (B), contaminating E.coli chromosomal DNA appeared as the uppermost band in both lanes and the excised <t>βGal</t> fragment, which should run slightly slower than the vectors, was not seen in either lane.
    Bsr Gi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsr gi/product/New England Biolabs
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    bsr gi - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    88
    New England Biolabs bsr gi enzymes
    (A) The flank area with enzymes sequences (yellow: Bgl II, gray: Swa I, pink: Kpn I, orange: <t>Fse</t> I, violet: <t>Bsr</t> gI). (B) The map of the pGEM-b1 vector. (C) pGEM-b1 vector that contain the flank regions and specific restricted enzymes for cloning. (D) The pLexsy-2 vector contain construct after cloning
    Bsr Gi Enzymes, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsr gi enzymes/product/New England Biolabs
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bsr gi enzymes - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    85
    New England Biolabs hin diii bsr gi
    PCR method for generating targetron constructs. A 361 bp linear DNA (top) corresponding to the 5′ exon and 5′ end of the Ll.LtrB group II intron was generated by a two-step PCR using two pairs of partially overlapping primers (primers 1 and 3 and primers 2 and 4) to introduce modifications into IBS1/2 (primer 1), EBS2 (primer 2) and EBS1/δ (primer 4). Primer sequences were: primer 1, AAAAAAGCTTCGTCGATCGGAANNNNNNNNNNNNGTGCGCCCAGATAGGGTG; primer 2, CGCAAGTTTCTAATTTCGGTTNNNNNTCGATAGAGGAAAGTGTCT; primer 3, AACCGAAATTAGAAACTTGCGTTCA; primer 4, CAGATTGTACAAATGTGGTGATAACAGATAAGTCNNNNNNNNNAACTTACCTTTCTTTGT (N indicates nucleotide residues that are changed to retarget the intron to specific genes). The 361 bp PCR product is then used as a megaprimer for a second PCR with a 6.7 kb vector backbone generated by Eco RV digestion of pACD3-RAM-PCR. The final PCR product contains gaps (arrowheads) at different positions, depending on the strand of the 361 bp linear DNA from which priming occurred. EV, Eco RV site; B, <t>Bsr</t> GI site; H, Hin <t>dIII</t> site; ori , P15A replication origin of pACYC184 vector.
    Hin Diii Bsr Gi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hin diii bsr gi/product/New England Biolabs
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hin diii bsr gi - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    Image Search Results


    Comparison of cloned plasmids produced from an equimolar mixture of three DNA fragments of different sizes by RC and LC. Plasmids retrieved from transformants generated by RC and LC were digested with Bgl II ( A ) or Bsr GI ( B ), and then run on 0.7 or 1.2% agarose gels, respectively. Plasmids were linearized by Bgl II digestion, and inserts were excised from the vector (pSP73) by Bsr GI digestion. Because the resultant clones by RC contained recombination site sequences in the vector portion, the size of the RC plasmid became slightly larger than that of the LC plasmid even when it carried the same insert. In (B), contaminating E.coli chromosomal DNA appeared as the uppermost band in both lanes and the excised βGal fragment, which should run slightly slower than the vectors, was not seen in either lane.

    Journal: Nucleic Acids Research

    Article Title: Directional cDNA library construction assisted by the in vitro recombination reaction

    doi:

    Figure Lengend Snippet: Comparison of cloned plasmids produced from an equimolar mixture of three DNA fragments of different sizes by RC and LC. Plasmids retrieved from transformants generated by RC and LC were digested with Bgl II ( A ) or Bsr GI ( B ), and then run on 0.7 or 1.2% agarose gels, respectively. Plasmids were linearized by Bgl II digestion, and inserts were excised from the vector (pSP73) by Bsr GI digestion. Because the resultant clones by RC contained recombination site sequences in the vector portion, the size of the RC plasmid became slightly larger than that of the LC plasmid even when it carried the same insert. In (B), contaminating E.coli chromosomal DNA appeared as the uppermost band in both lanes and the excised βGal fragment, which should run slightly slower than the vectors, was not seen in either lane.

    Article Snippet: MCS, Tet and βGal thus obtained were digested with Bsr GI (New England BioLabs), which cleaves at the TGTACA sequence within the common 15 bp core region of each att sequence, leaving four-base 5′ overhangs.

    Techniques: Clone Assay, Produced, Generated, Plasmid Preparation

    (A) The flank area with enzymes sequences (yellow: Bgl II, gray: Swa I, pink: Kpn I, orange: Fse I, violet: Bsr gI). (B) The map of the pGEM-b1 vector. (C) pGEM-b1 vector that contain the flank regions and specific restricted enzymes for cloning. (D) The pLexsy-2 vector contain construct after cloning

    Journal: Iranian Journal of Parasitology

    Article Title: Designing and Cloning Molecular Constructs to Knock Out N-Acetylglucosamine Phosphatidylinositol De-N-Acetylase (GPI12) Gene in Leishmania major (MRHO/IR/75/ER)

    doi:

    Figure Lengend Snippet: (A) The flank area with enzymes sequences (yellow: Bgl II, gray: Swa I, pink: Kpn I, orange: Fse I, violet: Bsr gI). (B) The map of the pGEM-b1 vector. (C) pGEM-b1 vector that contain the flank regions and specific restricted enzymes for cloning. (D) The pLexsy-2 vector contain construct after cloning

    Article Snippet: The PCR fragments were cut by Fse I and Bsr gI enzymes (New England Biolabs, UK).

    Techniques: Plasmid Preparation, Clone Assay, Construct

    In all figures, lane 1 shows molecular size marker. (A) The sequences of flank areas on which PCR was performed by primerM13; Lane 2 shows the amplified ∼1kb band. (B) The PCR fragments which were cut with Bgl II and Kpn I enzymes. The PCR product which was divided into 3 pieces of 600, 300 and 100 bp; Lane 2 shows the 300 bp fragment. (C) The pLEXSY vector, which was cut by Fse I and Bsr gI enzymes; Lane 2 shows the ∼ 0.7 kb fragment is separated from the vector. (D) The pLEXSY vector, which was cut by Bgl II and Kpn I enzymes. Lane 2 shows the ∼1 kb fragment is separated from the vector. (E) The PCR fragments which were cut with Fse I and Bsr gI enzymes. The PCR product which was divided into 3 pieces of 500, 400 and 100 bp; Lane 2 shows the 500 bp fragment

    Journal: Iranian Journal of Parasitology

    Article Title: Designing and Cloning Molecular Constructs to Knock Out N-Acetylglucosamine Phosphatidylinositol De-N-Acetylase (GPI12) Gene in Leishmania major (MRHO/IR/75/ER)

    doi:

    Figure Lengend Snippet: In all figures, lane 1 shows molecular size marker. (A) The sequences of flank areas on which PCR was performed by primerM13; Lane 2 shows the amplified ∼1kb band. (B) The PCR fragments which were cut with Bgl II and Kpn I enzymes. The PCR product which was divided into 3 pieces of 600, 300 and 100 bp; Lane 2 shows the 300 bp fragment. (C) The pLEXSY vector, which was cut by Fse I and Bsr gI enzymes; Lane 2 shows the ∼ 0.7 kb fragment is separated from the vector. (D) The pLEXSY vector, which was cut by Bgl II and Kpn I enzymes. Lane 2 shows the ∼1 kb fragment is separated from the vector. (E) The PCR fragments which were cut with Fse I and Bsr gI enzymes. The PCR product which was divided into 3 pieces of 500, 400 and 100 bp; Lane 2 shows the 500 bp fragment

    Article Snippet: The PCR fragments were cut by Fse I and Bsr gI enzymes (New England Biolabs, UK).

    Techniques: Marker, Polymerase Chain Reaction, Amplification, Plasmid Preparation

    PCR method for generating targetron constructs. A 361 bp linear DNA (top) corresponding to the 5′ exon and 5′ end of the Ll.LtrB group II intron was generated by a two-step PCR using two pairs of partially overlapping primers (primers 1 and 3 and primers 2 and 4) to introduce modifications into IBS1/2 (primer 1), EBS2 (primer 2) and EBS1/δ (primer 4). Primer sequences were: primer 1, AAAAAAGCTTCGTCGATCGGAANNNNNNNNNNNNGTGCGCCCAGATAGGGTG; primer 2, CGCAAGTTTCTAATTTCGGTTNNNNNTCGATAGAGGAAAGTGTCT; primer 3, AACCGAAATTAGAAACTTGCGTTCA; primer 4, CAGATTGTACAAATGTGGTGATAACAGATAAGTCNNNNNNNNNAACTTACCTTTCTTTGT (N indicates nucleotide residues that are changed to retarget the intron to specific genes). The 361 bp PCR product is then used as a megaprimer for a second PCR with a 6.7 kb vector backbone generated by Eco RV digestion of pACD3-RAM-PCR. The final PCR product contains gaps (arrowheads) at different positions, depending on the strand of the 361 bp linear DNA from which priming occurred. EV, Eco RV site; B, Bsr GI site; H, Hin dIII site; ori , P15A replication origin of pACYC184 vector.

    Journal: Nucleic Acids Research

    Article Title: Targeted and random bacterial gene disruption using a group II intron (targetron) vector containing a retrotransposition-activated selectable marker

    doi:

    Figure Lengend Snippet: PCR method for generating targetron constructs. A 361 bp linear DNA (top) corresponding to the 5′ exon and 5′ end of the Ll.LtrB group II intron was generated by a two-step PCR using two pairs of partially overlapping primers (primers 1 and 3 and primers 2 and 4) to introduce modifications into IBS1/2 (primer 1), EBS2 (primer 2) and EBS1/δ (primer 4). Primer sequences were: primer 1, AAAAAAGCTTCGTCGATCGGAANNNNNNNNNNNNGTGCGCCCAGATAGGGTG; primer 2, CGCAAGTTTCTAATTTCGGTTNNNNNTCGATAGAGGAAAGTGTCT; primer 3, AACCGAAATTAGAAACTTGCGTTCA; primer 4, CAGATTGTACAAATGTGGTGATAACAGATAAGTCNNNNNNNNNAACTTACCTTTCTTTGT (N indicates nucleotide residues that are changed to retarget the intron to specific genes). The 361 bp PCR product is then used as a megaprimer for a second PCR with a 6.7 kb vector backbone generated by Eco RV digestion of pACD3-RAM-PCR. The final PCR product contains gaps (arrowheads) at different positions, depending on the strand of the 361 bp linear DNA from which priming occurred. EV, Eco RV site; B, Bsr GI site; H, Hin dIII site; ori , P15A replication origin of pACYC184 vector.

    Article Snippet: Alternatively, the 361 bp PCR product and pACD3-RAM were both digested with Hin dIII + Bsr GI and then ligated with T4 DNA ligase (400 U) (New England Biolabs, Beverly, MA) for 1 h at room temperature, prior to transformation.

    Techniques: Polymerase Chain Reaction, Construct, Generated, Introduce, Plasmid Preparation