bspei  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    BspEI
    Description:
    BspEI 5 000 units
    Catalog Number:
    r0540l
    Price:
    282
    Size:
    5 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs bspei
    BspEI
    BspEI 5 000 units
    https://www.bioz.com/result/bspei/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    bspei - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "Induction of proto-oncogene BRF2 in breast cancer cells by the dietary soybean isoflavone daidzein"

    Article Title: Induction of proto-oncogene BRF2 in breast cancer cells by the dietary soybean isoflavone daidzein

    Journal: BMC Cancer

    doi: 10.1186/s12885-015-1914-5

    Daidzein changes DNA methylation at the BRF2 promoter specifically. CpG methylation- sensitive restriction enzymes cut sites are shown. Transcription start site (TSS) is indicated by +1. MethPrimer program was used to predict the location of CpG islands within the BRF2 (402–556 bp) and BRF1 (50–910 bp) promoters, as indicated by black arrow. Black bars denote the binding sites for primers used in the methylation profile analysis. a-d MCF-7 and ( e ) MDA-MB-231 cells were treated with 0, 3, 10 μM daidzein for 48 h. The genomic DNA was harvested and digested with methylation-sensitive restriction enzymes with cut sites within the promoter, noted on BRF2 and BRF1 promoter schematic, and as a negative control one methylation sensitive enzyme with no recognition sites in the promoter was used. BspEI and BsRFI do not have recognition sites in BRF2 and BRF1 promoters, respectively. The digestion profile was then analyzed by qPCR using primers spanning the BRF2 ( a , e, f ) and BRF1 ( b ) promoter regions, U6 ( c ) and tRNA i Met ( d ) genes. DNA methylation levels were calculated using ΔΔCt method with RPS13 expression levels used as a reference for normalization. Data presented are average of three independent experiments. Statistical analysis was performed using one-way ANOVA a Tukey’s post-test with a 95 % confidence interval (Graphpad Prism 3.03); * = p
    Figure Legend Snippet: Daidzein changes DNA methylation at the BRF2 promoter specifically. CpG methylation- sensitive restriction enzymes cut sites are shown. Transcription start site (TSS) is indicated by +1. MethPrimer program was used to predict the location of CpG islands within the BRF2 (402–556 bp) and BRF1 (50–910 bp) promoters, as indicated by black arrow. Black bars denote the binding sites for primers used in the methylation profile analysis. a-d MCF-7 and ( e ) MDA-MB-231 cells were treated with 0, 3, 10 μM daidzein for 48 h. The genomic DNA was harvested and digested with methylation-sensitive restriction enzymes with cut sites within the promoter, noted on BRF2 and BRF1 promoter schematic, and as a negative control one methylation sensitive enzyme with no recognition sites in the promoter was used. BspEI and BsRFI do not have recognition sites in BRF2 and BRF1 promoters, respectively. The digestion profile was then analyzed by qPCR using primers spanning the BRF2 ( a , e, f ) and BRF1 ( b ) promoter regions, U6 ( c ) and tRNA i Met ( d ) genes. DNA methylation levels were calculated using ΔΔCt method with RPS13 expression levels used as a reference for normalization. Data presented are average of three independent experiments. Statistical analysis was performed using one-way ANOVA a Tukey’s post-test with a 95 % confidence interval (Graphpad Prism 3.03); * = p

    Techniques Used: DNA Methylation Assay, CpG Methylation Assay, Binding Assay, Methylation, Multiple Displacement Amplification, Negative Control, Real-time Polymerase Chain Reaction, Expressing

    Related Articles

    Clone Assay:

    Article Title: Quantitative Multiphoton Spectral Imaging and Its Use for Measuring Resonance Energy Transfer
    Article Snippet: ECFP- γ and Venus C1 were digested with Eco47III (Roche) and BspEI (NEB). .. Clones expressing γ -Venus and β -Cerulean were selected based on restriction analysis.

    Article Title: Basal Core Promoter and Precore Mutations in the Hepatitis B Virus Genome Enhance Replication Efficacy of Lamivudine-Resistant Mutants
    Article Snippet: .. HBV 1.0 wt was digested with XhoI and BspEI (796 bp) and cloned into the pACYC177 vector (New England Biolabs, Beverly, Mass.). .. The AflIII-BspEI fragment was then exchanged between the wt and the mutated TOPO-TA vector.

    Article Title: Light-Induced Protein Clustering for Optogenetic Interference and Protein Interaction Analysis in Drosophila S2 Cells
    Article Snippet: Molecular Biology We cloned all LARIAT modules , aPKC, aPKCΔN, and partitioning defective protein 6 (Par6) into Drosophila Gateway vectors. .. To generate pENTR-CIBN-MP, we removed mCerulean from pENTR-CIBN-mCerulean-MP through restriction with AgeI (NEB) and BspEI (NEB). pENTR-CRY2olig(E490G)-VH H was generated through site-directed mutagenesis as in FastCloning [ ] ( ).

    Article Title: Quantitative Multiphoton Spectral Imaging and Its Use for Measuring Resonance Energy Transfer
    Article Snippet: Clones were selected by size and confirmed by restriction analysis. .. A tumor necrosis factor receptor associated factor (TRAF) domain (229 amino acid) was PCR amplified from CFP-TRAF2TRAF-YFP (a gift from Dr. L. He, NIAMS, NIH) primers flanked by BspE1 (sense: AACTCCGGAGAGAGCCTGGAGAAGAAG, antisense: AACTCCGGAGAGCCCTGTCAGGTCCAC) sites ( ).The purified PCR product was digested with BspEI (NEB) and ligated into either Cerulean C1 or CV to generate the CT and CTV constructs.

    Amplification:

    Article Title: An unexpected inhibition of antiviral signaling by virus-encoded tumor suppressor p53 in pancreatic cancer cells
    Article Snippet: To generate TP53-CC, the TP53ΔODRD sequence from the GFP-p53 plasmid was PCR amplified using primers VG283 and VG293 and the CC sequence from the HA-tagged BCR plasmid was PCR amplified using primers VG288 and VG292. .. To create the pUC57-eqFP650-TP53-CC/fs, the pUC57-eqFP650-TP53-CC plasmid was digested with BspEI, filled in with T4 DNA polymerase (NEB, MO203S), and re-ligated.

    Article Title: Contribution of DNMT1 to Neuropathic Pain Genesis Partially through Epigenetically Repressing Kcna2 in Primary Afferent Neurons
    Article Snippet: Mouse cAMP response element binding protein (CREB) cDNA was synthesized and amplified from the total RNA of mouse DRG ( ). .. Fragments bearing full-length CREB were ligated into proviral plasmids (University of North Carolina Vector Core) using the BspEI and NotI restriction sites (New England Biolabs) driven by the cytomegalovirus promoter.

    Article Title: Light-Induced Protein Clustering for Optogenetic Interference and Protein Interaction Analysis in Drosophila S2 Cells
    Article Snippet: After PCR amplification with Phusion Polymerase (New England Biolabs (NEB), Ipswich, MA, USA), we destroyed template DNA with DpnI (NEB) and transformed chemically competent TOP10 Escherichia coli cells with the insert and pENTR PCR mixes. .. To generate pENTR-CIBN-MP, we removed mCerulean from pENTR-CIBN-mCerulean-MP through restriction with AgeI (NEB) and BspEI (NEB). pENTR-CRY2olig(E490G)-VH H was generated through site-directed mutagenesis as in FastCloning [ ] ( ).

    Article Title: Quantitative Multiphoton Spectral Imaging and Its Use for Measuring Resonance Energy Transfer
    Article Snippet: .. A tumor necrosis factor receptor associated factor (TRAF) domain (229 amino acid) was PCR amplified from CFP-TRAF2TRAF-YFP (a gift from Dr. L. He, NIAMS, NIH) primers flanked by BspE1 (sense: AACTCCGGAGAGAGCCTGGAGAAGAAG, antisense: AACTCCGGAGAGCCCTGTCAGGTCCAC) sites ( ).The purified PCR product was digested with BspEI (NEB) and ligated into either Cerulean C1 or CV to generate the CT and CTV constructs. .. Clones were selected by size and confirmed by restriction and sequence analysis.

    Synthesized:

    Article Title: Contribution of DNMT1 to Neuropathic Pain Genesis Partially through Epigenetically Repressing Kcna2 in Primary Afferent Neurons
    Article Snippet: Mouse cAMP response element binding protein (CREB) cDNA was synthesized and amplified from the total RNA of mouse DRG ( ). .. Fragments bearing full-length CREB were ligated into proviral plasmids (University of North Carolina Vector Core) using the BspEI and NotI restriction sites (New England Biolabs) driven by the cytomegalovirus promoter.

    Construct:

    Article Title: Quantitative Multiphoton Spectral Imaging and Its Use for Measuring Resonance Energy Transfer
    Article Snippet: The γ -Venus construct was generated by removing ECFP from ECFP- γ and replacing it with Venus. .. ECFP- γ and Venus C1 were digested with Eco47III (Roche) and BspEI (NEB).

    Article Title: Basal Core Promoter and Precore Mutations in the Hepatitis B Virus Genome Enhance Replication Efficacy of Lamivudine-Resistant Mutants
    Article Snippet: The single HBV genome (“HBV 1.0”) from the replication-competent HBV 1.28 constructs wt, rtM204I, and rtL180M/rtM204V ( ) was excised using RsrII and cloned into RsrII-Bluescript. .. HBV 1.0 wt was digested with XhoI and BspEI (796 bp) and cloned into the pACYC177 vector (New England Biolabs, Beverly, Mass.).

    Article Title: Uveal melanoma cell-based vaccines express MHC II molecules that traffic via the endocytic and secretory pathways and activate CD8+ cytotoxic, tumor-specific T cells
    Article Snippet: Paragraph title: Retroviral constructs, transductions, and drug selection ... DR1β-eGFP pcDNA3 and pLNCX2/DR1 were digested separately with Not I (Fermentas Inc., Glen Burnie, MD) and Bsp EI (New England Biolabs, Ipswich, MA), which created identical and annealing 5′ ends.

    Article Title: Light-Induced Protein Clustering for Optogenetic Interference and Protein Interaction Analysis in Drosophila S2 Cells
    Article Snippet: To generate pENTR-CIBN-MP, we removed mCerulean from pENTR-CIBN-mCerulean-MP through restriction with AgeI (NEB) and BspEI (NEB). pENTR-CRY2olig(E490G)-VH H was generated through site-directed mutagenesis as in FastCloning [ ] ( ). .. Then, we recombined aPKC and aPKCΔN into pHGW, Par6 into pHWR, CIBN constructs into pHW, and CRY2 constructs into pHRW through LR Clonase II (Thermo Fisher Scientific, Waltham, MA, USA)-mediated recombination.

    Article Title: Quantitative Multiphoton Spectral Imaging and Its Use for Measuring Resonance Energy Transfer
    Article Snippet: .. A tumor necrosis factor receptor associated factor (TRAF) domain (229 amino acid) was PCR amplified from CFP-TRAF2TRAF-YFP (a gift from Dr. L. He, NIAMS, NIH) primers flanked by BspE1 (sense: AACTCCGGAGAGAGCCTGGAGAAGAAG, antisense: AACTCCGGAGAGCCCTGTCAGGTCCAC) sites ( ).The purified PCR product was digested with BspEI (NEB) and ligated into either Cerulean C1 or CV to generate the CT and CTV constructs. .. Clones were selected by size and confirmed by restriction and sequence analysis.

    Real-time Polymerase Chain Reaction:

    Article Title: Induction of proto-oncogene BRF2 in breast cancer cells by the dietary soybean isoflavone daidzein
    Article Snippet: Restriction enzymes AciI, AscI, BanI, BfuAI, BsrFI, BsrBI, BseYI, BfuAI, BspEI, Cac81, FspI, NciI, NruI (New England Biolabs) and HpyCH4III/Taal (Fermentas) were used. .. Restriction digestions were then analyzed by real time PCR using Universal SYBR Green (BioRad) and primers spanning the promoters regions and primers spanning the promoters regions (BRF2-forward, 5’-GGC CTC CAA AAG CGT T-3’; BRF2-reverse, 5’-AGC TGG CTC TGC GAA TAG T-3’; BRF1-forward, 5’-GGG GTT GGG TCC CAG GTC GC-3’; BRF1-reverse, 5’-GTC CTC CAG CAC TGA GCC GC-3’; U6-forward, 5’- AAG TAT TTC GAT TTC TTG GC-3’; U6-reverse, 5’- AAT ATG GAA CGC TTC ACG-3’; tRNAi Met -forward, 5’-TAG ATA GCA GAG TGG CGC A-3’; tRNAi Met -reverse, 5’-AAC TCC GAT AGC AGA GGA TG-3’).

    Luciferase:

    Article Title: The Interaction of the Chaperonin Tailless Complex Polypeptide 1 (Tcp1) Ring Complex (Tric) with Ribosome-Bound Nascent Chains Examined Using Photo-Cross-Linking
    Article Snippet: Preparation of mRNA pGEM-mouse β-actin was linearized in the coding region by digestion with BglII, SnaBI, Asp718, ScaI, or ApaLI, and pGEM-luciferase was linearized by digestion with HnfI, BslI, BbvI, AflIII, EcoRI, or BspEI restriction endonucleases (New England Biolabs, Inc.). .. The nascent luciferase polypeptides contained 77, 92, 125, 164, 197, or 232 amino acids and 6, 6, 6, 13, 14, or 15 lysines, respectively. pBSK-enolase (p-eno46; ) was linearized by digestion with DdeI, EcoRI, or BglI to yield polypeptides of 137, 251, or 375 amino acids (and 12, 22, and 34 lysines, respectively) by in vitro RNA transcription with T3 polymerase.

    Expressing:

    Article Title: Quantitative Multiphoton Spectral Imaging and Its Use for Measuring Resonance Energy Transfer
    Article Snippet: ECFP- γ and Venus C1 were digested with Eco47III (Roche) and BspEI (NEB). .. Clones expressing γ -Venus and β -Cerulean were selected based on restriction analysis.

    Article Title: Quantitative Multiphoton Spectral Imaging and Its Use for Measuring Resonance Energy Transfer
    Article Snippet: Paragraph title: Construction of expression vectors encoding RET-stoichiometry standards ... A tumor necrosis factor receptor associated factor (TRAF) domain (229 amino acid) was PCR amplified from CFP-TRAF2TRAF-YFP (a gift from Dr. L. He, NIAMS, NIH) primers flanked by BspE1 (sense: AACTCCGGAGAGAGCCTGGAGAAGAAG, antisense: AACTCCGGAGAGCCCTGTCAGGTCCAC) sites ( ).The purified PCR product was digested with BspEI (NEB) and ligated into either Cerulean C1 or CV to generate the CT and CTV constructs.

    Article Title: Induction of proto-oncogene BRF2 in breast cancer cells by the dietary soybean isoflavone daidzein
    Article Snippet: Restriction enzymes AciI, AscI, BanI, BfuAI, BsrFI, BsrBI, BseYI, BfuAI, BspEI, Cac81, FspI, NciI, NruI (New England Biolabs) and HpyCH4III/Taal (Fermentas) were used. .. Results were quantified using the ΔΔCt method and normalized to RPS13 expression levels.

    Modification:

    Article Title: An unexpected inhibition of antiviral signaling by virus-encoded tumor suppressor p53 in pancreatic cancer cells
    Article Snippet: To create the pUC57-eqFP650-TP53-CC/fs, the pUC57-eqFP650-TP53-CC plasmid was digested with BspEI, filled in with T4 DNA polymerase (NEB, MO203S), and re-ligated. .. Recombinant VSVs were rescued as previously described , which is a modification of the original protocol in ( ).

    Transformation Assay:

    Article Title: Quantitative Multiphoton Spectral Imaging and Its Use for Measuring Resonance Energy Transfer
    Article Snippet: ECFP- γ and Venus C1 were digested with Eco47III (Roche) and BspEI (NEB). .. The Venus and γ -vector products were gel purified (QiaExII gel purification kit, Qiagen), ligated (Rapid ligation kit, Roche), and transformed into Top 10 bacteria.

    Article Title: Light-Induced Protein Clustering for Optogenetic Interference and Protein Interaction Analysis in Drosophila S2 Cells
    Article Snippet: After PCR amplification with Phusion Polymerase (New England Biolabs (NEB), Ipswich, MA, USA), we destroyed template DNA with DpnI (NEB) and transformed chemically competent TOP10 Escherichia coli cells with the insert and pENTR PCR mixes. .. To generate pENTR-CIBN-MP, we removed mCerulean from pENTR-CIBN-mCerulean-MP through restriction with AgeI (NEB) and BspEI (NEB). pENTR-CRY2olig(E490G)-VH H was generated through site-directed mutagenesis as in FastCloning [ ] ( ).

    Article Title: A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo
    Article Snippet: To generate a large number of uniquely barcoded vectors, we ligated 300 ng of each XmaI, BamHI-digested Lenti-sgRNA-Cre vector with 180ng of each BspEI, BamHI-digested PCR product using T4 Ligase (NEB, M0202L) and standard protocols (80 μl total reaction volume). .. To obtain a pool of the greatest possible number of uniquely barcoded Lenti-sgRNA/Cre vectors, 1 μl of purified ligation was transformed into 20 μl of ElectroMAX DH10B cells (Thermo Fisher, 18290015).

    Gel Purification:

    Article Title: Quantitative Multiphoton Spectral Imaging and Its Use for Measuring Resonance Energy Transfer
    Article Snippet: ECFP- γ and Venus C1 were digested with Eco47III (Roche) and BspEI (NEB). .. The Venus and γ -vector products were gel purified (QiaExII gel purification kit, Qiagen), ligated (Rapid ligation kit, Roche), and transformed into Top 10 bacteria.

    Transfection:

    Article Title: Light-Induced Protein Clustering for Optogenetic Interference and Protein Interaction Analysis in Drosophila S2 Cells
    Article Snippet: To generate pENTR-CIBN-MP, we removed mCerulean from pENTR-CIBN-mCerulean-MP through restriction with AgeI (NEB) and BspEI (NEB). pENTR-CRY2olig(E490G)-VH H was generated through site-directed mutagenesis as in FastCloning [ ] ( ). .. For S2 cell transfection, we joined CIBN and CRY2 constructs in the same plasmid through Circular Polymerase Extension Cloning (CPEC) [ ].

    Article Title: Quantitative Multiphoton Spectral Imaging and Its Use for Measuring Resonance Energy Transfer
    Article Snippet: Blue and yellow fluorescent emission was detected from cells transfected with these constructs. .. A tumor necrosis factor receptor associated factor (TRAF) domain (229 amino acid) was PCR amplified from CFP-TRAF2TRAF-YFP (a gift from Dr. L. He, NIAMS, NIH) primers flanked by BspE1 (sense: AACTCCGGAGAGAGCCTGGAGAAGAAG, antisense: AACTCCGGAGAGCCCTGTCAGGTCCAC) sites ( ).The purified PCR product was digested with BspEI (NEB) and ligated into either Cerulean C1 or CV to generate the CT and CTV constructs.

    Ligation:

    Article Title: Quantitative Multiphoton Spectral Imaging and Its Use for Measuring Resonance Energy Transfer
    Article Snippet: ECFP- γ and Venus C1 were digested with Eco47III (Roche) and BspEI (NEB). .. The Venus and γ -vector products were gel purified (QiaExII gel purification kit, Qiagen), ligated (Rapid ligation kit, Roche), and transformed into Top 10 bacteria.

    Article Title: A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo
    Article Snippet: To generate a large number of uniquely barcoded vectors, we ligated 300 ng of each XmaI, BamHI-digested Lenti-sgRNA-Cre vector with 180ng of each BspEI, BamHI-digested PCR product using T4 Ligase (NEB, M0202L) and standard protocols (80 μl total reaction volume). .. To obtain a pool of the greatest possible number of uniquely barcoded Lenti-sgRNA/Cre vectors, 1 μl of purified ligation was transformed into 20 μl of ElectroMAX DH10B cells (Thermo Fisher, 18290015).

    Introduce:

    Article Title: Basal Core Promoter and Precore Mutations in the Hepatitis B Virus Genome Enhance Replication Efficacy of Lamivudine-Resistant Mutants
    Article Snippet: In order to introduce the PC mutations G1896A and C1858T, the NspI fragment (2,437 bp) was excised from the HBV 1.0 wt and used as a template for PCR with the mutagenesis primer 1858Stop-sense (5′ GTA CAT GTC C T A CTG TTC AAG CCT CCA AGC TGT GCC TTG GGT GGC TTT A GG GCA TGG 3′) and the primer BspEIanti (5′ GTA GTT TCC GGA AGT GTT GA 3′). .. HBV 1.0 wt was digested with XhoI and BspEI (796 bp) and cloned into the pACYC177 vector (New England Biolabs, Beverly, Mass.).

    Generated:

    Article Title: Quantitative Multiphoton Spectral Imaging and Its Use for Measuring Resonance Energy Transfer
    Article Snippet: The γ -Venus construct was generated by removing ECFP from ECFP- γ and replacing it with Venus. .. ECFP- γ and Venus C1 were digested with Eco47III (Roche) and BspEI (NEB).

    Article Title: Light-Induced Protein Clustering for Optogenetic Interference and Protein Interaction Analysis in Drosophila S2 Cells
    Article Snippet: .. To generate pENTR-CIBN-MP, we removed mCerulean from pENTR-CIBN-mCerulean-MP through restriction with AgeI (NEB) and BspEI (NEB). pENTR-CRY2olig(E490G)-VH H was generated through site-directed mutagenesis as in FastCloning [ ] ( ). .. Then, we recombined aPKC and aPKCΔN into pHGW, Par6 into pHWR, CIBN constructs into pHW, and CRY2 constructs into pHRW through LR Clonase II (Thermo Fisher Scientific, Waltham, MA, USA)-mediated recombination.

    Article Title: The Interaction of the Chaperonin Tailless Complex Polypeptide 1 (Tcp1) Ring Complex (Tric) with Ribosome-Bound Nascent Chains Examined Using Photo-Cross-Linking
    Article Snippet: Preparation of mRNA pGEM-mouse β-actin was linearized in the coding region by digestion with BglII, SnaBI, Asp718, ScaI, or ApaLI, and pGEM-luciferase was linearized by digestion with HnfI, BslI, BbvI, AflIII, EcoRI, or BspEI restriction endonucleases (New England Biolabs, Inc.). .. Truncated mRNAs coding for nascent actin polypeptides were generated by RNA transcription of these linearized plasmids in vitro, using SP6 RNA polymerase as before ( ; ).

    other:

    Article Title: A protocol for the production of recombinant spider silk-like proteins for artificial fiber spinning
    Article Snippet: Restriction endonucleases: Bam HI, Bsp EI, Nde I, Sca I, Xma I (New England Biolabs Inc., cat. no. R0136S, R0540S, R0111S, R0122S, R0180S, respectively) T4 DNA ligase (Promega, cat. no. M1801) Lysozyme (Aldrich-Sigma Chemical Co. Ltd, cat. no. 62970) DNAse I (Aldrich-Sigma Chemical Co. Ltd, cat. no. D7291-5MG) RNAse A (Aldrich-Sigma Chemical Co. Ltd, cat. no. R6513-10MG) 6× His mAb–HRP conjugate (Clontech, cat. no. 631210)

    Sequencing:

    Article Title: An unexpected inhibition of antiviral signaling by virus-encoded tumor suppressor p53 in pancreatic cancer cells
    Article Snippet: To generate TP53-CC, the TP53ΔODRD sequence from the GFP-p53 plasmid was PCR amplified using primers VG283 and VG293 and the CC sequence from the HA-tagged BCR plasmid was PCR amplified using primers VG288 and VG292. .. To create the pUC57-eqFP650-TP53-CC/fs, the pUC57-eqFP650-TP53-CC plasmid was digested with BspEI, filled in with T4 DNA polymerase (NEB, MO203S), and re-ligated.

    Article Title: Single-molecule imaging correlates decreasing nuclear volume with increasing TF-chromatin associations during zebrafish development
    Article Snippet: The Sox19b (uniprot ID Q9DDD7) sequence was extracted from 1-cell stage zebrafish cDNA as previously described using the SuperScript VILO cDNA synthesis kit (Invitrogen). .. For 2xHA-mEos2-TBP and 2xHA-mEos2-Sox19b, mEos2 in pCS2+ was exchanged for 2xHA-mEos2 using restriction enzymes BamHI and BspEI (New England BioLabs).

    Article Title: Quantitative Multiphoton Spectral Imaging and Its Use for Measuring Resonance Energy Transfer
    Article Snippet: A tumor necrosis factor receptor associated factor (TRAF) domain (229 amino acid) was PCR amplified from CFP-TRAF2TRAF-YFP (a gift from Dr. L. He, NIAMS, NIH) primers flanked by BspE1 (sense: AACTCCGGAGAGAGCCTGGAGAAGAAG, antisense: AACTCCGGAGAGCCCTGTCAGGTCCAC) sites ( ).The purified PCR product was digested with BspEI (NEB) and ligated into either Cerulean C1 or CV to generate the CT and CTV constructs. .. Clones were selected by size and confirmed by restriction and sequence analysis.

    Binding Assay:

    Article Title: Contribution of DNMT1 to Neuropathic Pain Genesis Partially through Epigenetically Repressing Kcna2 in Primary Afferent Neurons
    Article Snippet: Mouse cAMP response element binding protein (CREB) cDNA was synthesized and amplified from the total RNA of mouse DRG ( ). .. Fragments bearing full-length CREB were ligated into proviral plasmids (University of North Carolina Vector Core) using the BspEI and NotI restriction sites (New England Biolabs) driven by the cytomegalovirus promoter.

    Cellular Antioxidant Activity Assay:

    Article Title: Induction of proto-oncogene BRF2 in breast cancer cells by the dietary soybean isoflavone daidzein
    Article Snippet: Restriction enzymes AciI, AscI, BanI, BfuAI, BsrFI, BsrBI, BseYI, BfuAI, BspEI, Cac81, FspI, NciI, NruI (New England Biolabs) and HpyCH4III/Taal (Fermentas) were used. .. Restriction digestions were then analyzed by real time PCR using Universal SYBR Green (BioRad) and primers spanning the promoters regions and primers spanning the promoters regions (BRF2-forward, 5’-GGC CTC CAA AAG CGT T-3’; BRF2-reverse, 5’-AGC TGG CTC TGC GAA TAG T-3’; BRF1-forward, 5’-GGG GTT GGG TCC CAG GTC GC-3’; BRF1-reverse, 5’-GTC CTC CAG CAC TGA GCC GC-3’; U6-forward, 5’- AAG TAT TTC GAT TTC TTG GC-3’; U6-reverse, 5’- AAT ATG GAA CGC TTC ACG-3’; tRNAi Met -forward, 5’-TAG ATA GCA GAG TGG CGC A-3’; tRNAi Met -reverse, 5’-AAC TCC GAT AGC AGA GGA TG-3’).

    Fluorescence:

    Article Title: Uveal melanoma cell-based vaccines express MHC II molecules that traffic via the endocytic and secretory pathways and activate CD8+ cytotoxic, tumor-specific T cells
    Article Snippet: To generate the MHC II-eGFP (enhanced green fluorescence protein) construct, the β chain of the pLNCX2/DR1 plasmid [ ] was replaced with the DR1β-eGFP gene from DR1β-eGFP pcDNA3 [ ]. .. DR1β-eGFP pcDNA3 and pLNCX2/DR1 were digested separately with Not I (Fermentas Inc., Glen Burnie, MD) and Bsp EI (New England Biolabs, Ipswich, MA), which created identical and annealing 5′ ends.

    Methylation:

    Article Title: Induction of proto-oncogene BRF2 in breast cancer cells by the dietary soybean isoflavone daidzein
    Article Snippet: Paragraph title: Methylation analysis ... Restriction enzymes AciI, AscI, BanI, BfuAI, BsrFI, BsrBI, BseYI, BfuAI, BspEI, Cac81, FspI, NciI, NruI (New England Biolabs) and HpyCH4III/Taal (Fermentas) were used.

    Mutagenesis:

    Article Title: Basal Core Promoter and Precore Mutations in the Hepatitis B Virus Genome Enhance Replication Efficacy of Lamivudine-Resistant Mutants
    Article Snippet: In order to introduce the PC mutations G1896A and C1858T, the NspI fragment (2,437 bp) was excised from the HBV 1.0 wt and used as a template for PCR with the mutagenesis primer 1858Stop-sense (5′ GTA CAT GTC C T A CTG TTC AAG CCT CCA AGC TGT GCC TTG GGT GGC TTT A GG GCA TGG 3′) and the primer BspEIanti (5′ GTA GTT TCC GGA AGT GTT GA 3′). .. HBV 1.0 wt was digested with XhoI and BspEI (796 bp) and cloned into the pACYC177 vector (New England Biolabs, Beverly, Mass.).

    Article Title: Light-Induced Protein Clustering for Optogenetic Interference and Protein Interaction Analysis in Drosophila S2 Cells
    Article Snippet: .. To generate pENTR-CIBN-MP, we removed mCerulean from pENTR-CIBN-mCerulean-MP through restriction with AgeI (NEB) and BspEI (NEB). pENTR-CRY2olig(E490G)-VH H was generated through site-directed mutagenesis as in FastCloning [ ] ( ). .. Then, we recombined aPKC and aPKCΔN into pHGW, Par6 into pHWR, CIBN constructs into pHW, and CRY2 constructs into pHRW through LR Clonase II (Thermo Fisher Scientific, Waltham, MA, USA)-mediated recombination.

    Purification:

    Article Title: Quantitative Multiphoton Spectral Imaging and Its Use for Measuring Resonance Energy Transfer
    Article Snippet: ECFP- γ and Venus C1 were digested with Eco47III (Roche) and BspEI (NEB). .. The Venus and γ -vector products were gel purified (QiaExII gel purification kit, Qiagen), ligated (Rapid ligation kit, Roche), and transformed into Top 10 bacteria.

    Article Title: Uveal melanoma cell-based vaccines express MHC II molecules that traffic via the endocytic and secretory pathways and activate CD8+ cytotoxic, tumor-specific T cells
    Article Snippet: DR1β-eGFP pcDNA3 and pLNCX2/DR1 were digested separately with Not I (Fermentas Inc., Glen Burnie, MD) and Bsp EI (New England Biolabs, Ipswich, MA), which created identical and annealing 5′ ends. .. The appropriate bands were excised, purified using a QIAEX II Gel Extraction Kit (Qiagen, Valencia, CA) and ligated with T4 DNA ligase (Invitrogen, Carlsbad, CA) at a ratio of 2:1 of vector to insert.

    Article Title: Contribution of DNMT1 to Neuropathic Pain Genesis Partially through Epigenetically Repressing Kcna2 in Primary Afferent Neurons
    Article Snippet: After the plasmid was digested by XbaI/BamHI, full-length C/EBPβ cDNA was gel purified and ligated into proviral plasmids ( ). .. Fragments bearing full-length CREB were ligated into proviral plasmids (University of North Carolina Vector Core) using the BspEI and NotI restriction sites (New England Biolabs) driven by the cytomegalovirus promoter.

    Article Title: Quantitative Multiphoton Spectral Imaging and Its Use for Measuring Resonance Energy Transfer
    Article Snippet: .. A tumor necrosis factor receptor associated factor (TRAF) domain (229 amino acid) was PCR amplified from CFP-TRAF2TRAF-YFP (a gift from Dr. L. He, NIAMS, NIH) primers flanked by BspE1 (sense: AACTCCGGAGAGAGCCTGGAGAAGAAG, antisense: AACTCCGGAGAGCCCTGTCAGGTCCAC) sites ( ).The purified PCR product was digested with BspEI (NEB) and ligated into either Cerulean C1 or CV to generate the CT and CTV constructs. .. Clones were selected by size and confirmed by restriction and sequence analysis.

    Article Title: A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo
    Article Snippet: PCR was performed using PrimeSTAR® HS DNA Polymerase (premix) (Clontech, R040A) and PCR products were purified using the Qiagen® PCR Purification Kit (28106). .. To generate a large number of uniquely barcoded vectors, we ligated 300 ng of each XmaI, BamHI-digested Lenti-sgRNA-Cre vector with 180ng of each BspEI, BamHI-digested PCR product using T4 Ligase (NEB, M0202L) and standard protocols (80 μl total reaction volume).

    Polymerase Chain Reaction:

    Article Title: Basal Core Promoter and Precore Mutations in the Hepatitis B Virus Genome Enhance Replication Efficacy of Lamivudine-Resistant Mutants
    Article Snippet: The PCR product containing the PC mutations was introduced into a TOPO-TA cloning vector (Invitrogen, Carlsbad, Calif.) and digested with AflIII and BspEI (479 bp). .. HBV 1.0 wt was digested with XhoI and BspEI (796 bp) and cloned into the pACYC177 vector (New England Biolabs, Beverly, Mass.).

    Article Title: An unexpected inhibition of antiviral signaling by virus-encoded tumor suppressor p53 in pancreatic cancer cells
    Article Snippet: All PCR products were digested sequentially with NheI and BspEI restriction enzymes and ligated into the NheI-BspEI digested pUC57-eqFP650 vector fragment to generate pUC57-eqFP650-TP53wt, pUC57-eqFP650-TP53ΔODRD, pUC57-eqFP650-CC, and pUC57-eqFP650-TP53-CC. .. To create the pUC57-eqFP650-TP53-CC/fs, the pUC57-eqFP650-TP53-CC plasmid was digested with BspEI, filled in with T4 DNA polymerase (NEB, MO203S), and re-ligated.

    Article Title: Light-Induced Protein Clustering for Optogenetic Interference and Protein Interaction Analysis in Drosophila S2 Cells
    Article Snippet: After PCR amplification with Phusion Polymerase (New England Biolabs (NEB), Ipswich, MA, USA), we destroyed template DNA with DpnI (NEB) and transformed chemically competent TOP10 Escherichia coli cells with the insert and pENTR PCR mixes. .. To generate pENTR-CIBN-MP, we removed mCerulean from pENTR-CIBN-mCerulean-MP through restriction with AgeI (NEB) and BspEI (NEB). pENTR-CRY2olig(E490G)-VH H was generated through site-directed mutagenesis as in FastCloning [ ] ( ).

    Article Title: Single-molecule imaging correlates decreasing nuclear volume with increasing TF-chromatin associations during zebrafish development
    Article Snippet: PCR was done with Q5 High-Fidelity DNA Polymerase (New England BioLabs) with addition of GC enhancer using the primers listed in Supplementary Table . .. For 2xHA-mEos2-TBP and 2xHA-mEos2-Sox19b, mEos2 in pCS2+ was exchanged for 2xHA-mEos2 using restriction enzymes BamHI and BspEI (New England BioLabs).

    Article Title: Quantitative Multiphoton Spectral Imaging and Its Use for Measuring Resonance Energy Transfer
    Article Snippet: .. A tumor necrosis factor receptor associated factor (TRAF) domain (229 amino acid) was PCR amplified from CFP-TRAF2TRAF-YFP (a gift from Dr. L. He, NIAMS, NIH) primers flanked by BspE1 (sense: AACTCCGGAGAGAGCCTGGAGAAGAAG, antisense: AACTCCGGAGAGCCCTGTCAGGTCCAC) sites ( ).The purified PCR product was digested with BspEI (NEB) and ligated into either Cerulean C1 or CV to generate the CT and CTV constructs. .. Clones were selected by size and confirmed by restriction and sequence analysis.

    Article Title: A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo
    Article Snippet: .. To generate a large number of uniquely barcoded vectors, we ligated 300 ng of each XmaI, BamHI-digested Lenti-sgRNA-Cre vector with 180ng of each BspEI, BamHI-digested PCR product using T4 Ligase (NEB, M0202L) and standard protocols (80 μl total reaction volume). .. Ligations were PCR purified using the Qiagen® PCR Purification Kit to remove residual salt.

    Selection:

    Article Title: Uveal melanoma cell-based vaccines express MHC II molecules that traffic via the endocytic and secretory pathways and activate CD8+ cytotoxic, tumor-specific T cells
    Article Snippet: Paragraph title: Retroviral constructs, transductions, and drug selection ... DR1β-eGFP pcDNA3 and pLNCX2/DR1 were digested separately with Not I (Fermentas Inc., Glen Burnie, MD) and Bsp EI (New England Biolabs, Ipswich, MA), which created identical and annealing 5′ ends.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Basal Core Promoter and Precore Mutations in the Hepatitis B Virus Genome Enhance Replication Efficacy of Lamivudine-Resistant Mutants
    Article Snippet: In order to introduce the PC mutations G1896A and C1858T, the NspI fragment (2,437 bp) was excised from the HBV 1.0 wt and used as a template for PCR with the mutagenesis primer 1858Stop-sense (5′ GTA CAT GTC C T A CTG TTC AAG CCT CCA AGC TGT GCC TTG GGT GGC TTT A GG GCA TGG 3′) and the primer BspEIanti (5′ GTA GTT TCC GGA AGT GTT GA 3′). .. HBV 1.0 wt was digested with XhoI and BspEI (796 bp) and cloned into the pACYC177 vector (New England Biolabs, Beverly, Mass.).

    Plasmid Preparation:

    Article Title: Quantitative Multiphoton Spectral Imaging and Its Use for Measuring Resonance Energy Transfer
    Article Snippet: ECFP- γ and Venus C1 were digested with Eco47III (Roche) and BspEI (NEB). .. The Venus and γ -vector products were gel purified (QiaExII gel purification kit, Qiagen), ligated (Rapid ligation kit, Roche), and transformed into Top 10 bacteria.

    Article Title: Basal Core Promoter and Precore Mutations in the Hepatitis B Virus Genome Enhance Replication Efficacy of Lamivudine-Resistant Mutants
    Article Snippet: .. HBV 1.0 wt was digested with XhoI and BspEI (796 bp) and cloned into the pACYC177 vector (New England Biolabs, Beverly, Mass.). .. The AflIII-BspEI fragment was then exchanged between the wt and the mutated TOPO-TA vector.

    Article Title: Uveal melanoma cell-based vaccines express MHC II molecules that traffic via the endocytic and secretory pathways and activate CD8+ cytotoxic, tumor-specific T cells
    Article Snippet: To generate the MHC II-eGFP (enhanced green fluorescence protein) construct, the β chain of the pLNCX2/DR1 plasmid [ ] was replaced with the DR1β-eGFP gene from DR1β-eGFP pcDNA3 [ ]. .. DR1β-eGFP pcDNA3 and pLNCX2/DR1 were digested separately with Not I (Fermentas Inc., Glen Burnie, MD) and Bsp EI (New England Biolabs, Ipswich, MA), which created identical and annealing 5′ ends.

    Article Title: An unexpected inhibition of antiviral signaling by virus-encoded tumor suppressor p53 in pancreatic cancer cells
    Article Snippet: .. To create the pUC57-eqFP650-TP53-CC/fs, the pUC57-eqFP650-TP53-CC plasmid was digested with BspEI, filled in with T4 DNA polymerase (NEB, MO203S), and re-ligated. .. All pUC57 plasmids containing the eqFP650-fusion genes were double digested with XhoI and NheI restriction enzymes and the inserts were ligated into the XhoI-NheI digested VSV-XN2-ΔM51 plasmid.

    Article Title: Contribution of DNMT1 to Neuropathic Pain Genesis Partially through Epigenetically Repressing Kcna2 in Primary Afferent Neurons
    Article Snippet: .. Fragments bearing full-length CREB were ligated into proviral plasmids (University of North Carolina Vector Core) using the BspEI and NotI restriction sites (New England Biolabs) driven by the cytomegalovirus promoter. .. Packaging of the rAAV5 viral particles encoding the respective plasmids was performed by the University of North Carolina Vector Core.

    Article Title: Light-Induced Protein Clustering for Optogenetic Interference and Protein Interaction Analysis in Drosophila S2 Cells
    Article Snippet: We amplified the CIB1 N-terminal (CIBN, amino acids 1–170) fused with mCerulean and the oligomerization domain from CaMKIIα (amino acids 315–478) from pCMV-CIB1-mCerulean-CaMKIIα multimerization domain from (MP) (Addgene plasmid #58366, gift from Won do Heo, Institute for Basic Science (IBS) and Korea Advanced Institute of Science and Technology (KAIST), Daejeon, Republic of Korea) [ ], CRY2 photolyase homology region (amino acids 1–498) fused with an anti-GFP nanobody (VH H) from pCMV-SNAP-CRY2-VH H(GFP) (Addgene plasmid #58370, gift from Won do Heo) [ ] and aPKC, aPKCΔN (amino acids 180–606), and Par6 from their respective complementary DNAs (Berkeley Drosophila Genome Project (BDGP) Gold collection). .. To generate pENTR-CIBN-MP, we removed mCerulean from pENTR-CIBN-mCerulean-MP through restriction with AgeI (NEB) and BspEI (NEB). pENTR-CRY2olig(E490G)-VH H was generated through site-directed mutagenesis as in FastCloning [ ] ( ).

    Article Title: Single-molecule imaging correlates decreasing nuclear volume with increasing TF-chromatin associations during zebrafish development
    Article Snippet: A pCS2+ plasmid backbone containing eGFP-Lap2β was a gift from Nadine Vastenhouw and originates from Marija Matejcic from the Caren Norden lab (Max Planck Institute of Molecular Cell Biology and Genetics, Dresden, Germany). .. For 2xHA-mEos2-TBP and 2xHA-mEos2-Sox19b, mEos2 in pCS2+ was exchanged for 2xHA-mEos2 using restriction enzymes BamHI and BspEI (New England BioLabs).

    Article Title: A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo
    Article Snippet: .. To generate a large number of uniquely barcoded vectors, we ligated 300 ng of each XmaI, BamHI-digested Lenti-sgRNA-Cre vector with 180ng of each BspEI, BamHI-digested PCR product using T4 Ligase (NEB, M0202L) and standard protocols (80 μl total reaction volume). .. Ligations were PCR purified using the Qiagen® PCR Purification Kit to remove residual salt.

    SYBR Green Assay:

    Article Title: Induction of proto-oncogene BRF2 in breast cancer cells by the dietary soybean isoflavone daidzein
    Article Snippet: Restriction enzymes AciI, AscI, BanI, BfuAI, BsrFI, BsrBI, BseYI, BfuAI, BspEI, Cac81, FspI, NciI, NruI (New England Biolabs) and HpyCH4III/Taal (Fermentas) were used. .. Restriction digestions were then analyzed by real time PCR using Universal SYBR Green (BioRad) and primers spanning the promoters regions and primers spanning the promoters regions (BRF2-forward, 5’-GGC CTC CAA AAG CGT T-3’; BRF2-reverse, 5’-AGC TGG CTC TGC GAA TAG T-3’; BRF1-forward, 5’-GGG GTT GGG TCC CAG GTC GC-3’; BRF1-reverse, 5’-GTC CTC CAG CAC TGA GCC GC-3’; U6-forward, 5’- AAG TAT TTC GAT TTC TTG GC-3’; U6-reverse, 5’- AAT ATG GAA CGC TTC ACG-3’; tRNAi Met -forward, 5’-TAG ATA GCA GAG TGG CGC A-3’; tRNAi Met -reverse, 5’-AAC TCC GAT AGC AGA GGA TG-3’).

    Recombinant:

    Article Title: An unexpected inhibition of antiviral signaling by virus-encoded tumor suppressor p53 in pancreatic cancer cells
    Article Snippet: Paragraph title: Generation of novel recombinant VSVs ... To create the pUC57-eqFP650-TP53-CC/fs, the pUC57-eqFP650-TP53-CC plasmid was digested with BspEI, filled in with T4 DNA polymerase (NEB, MO203S), and re-ligated.

    In Vitro:

    Article Title: The Interaction of the Chaperonin Tailless Complex Polypeptide 1 (Tcp1) Ring Complex (Tric) with Ribosome-Bound Nascent Chains Examined Using Photo-Cross-Linking
    Article Snippet: Preparation of mRNA pGEM-mouse β-actin was linearized in the coding region by digestion with BglII, SnaBI, Asp718, ScaI, or ApaLI, and pGEM-luciferase was linearized by digestion with HnfI, BslI, BbvI, AflIII, EcoRI, or BspEI restriction endonucleases (New England Biolabs, Inc.). .. Truncated mRNAs coding for nascent actin polypeptides were generated by RNA transcription of these linearized plasmids in vitro, using SP6 RNA polymerase as before ( ; ).

    CTG Assay:

    Article Title: Basal Core Promoter and Precore Mutations in the Hepatitis B Virus Genome Enhance Replication Efficacy of Lamivudine-Resistant Mutants
    Article Snippet: In order to introduce the PC mutations G1896A and C1858T, the NspI fragment (2,437 bp) was excised from the HBV 1.0 wt and used as a template for PCR with the mutagenesis primer 1858Stop-sense (5′ GTA CAT GTC C T A CTG TTC AAG CCT CCA AGC TGT GCC TTG GGT GGC TTT A GG GCA TGG 3′) and the primer BspEIanti (5′ GTA GTT TCC GGA AGT GTT GA 3′). .. HBV 1.0 wt was digested with XhoI and BspEI (796 bp) and cloned into the pACYC177 vector (New England Biolabs, Beverly, Mass.).

    Gel Extraction:

    Article Title: Uveal melanoma cell-based vaccines express MHC II molecules that traffic via the endocytic and secretory pathways and activate CD8+ cytotoxic, tumor-specific T cells
    Article Snippet: DR1β-eGFP pcDNA3 and pLNCX2/DR1 were digested separately with Not I (Fermentas Inc., Glen Burnie, MD) and Bsp EI (New England Biolabs, Ipswich, MA), which created identical and annealing 5′ ends. .. The appropriate bands were excised, purified using a QIAEX II Gel Extraction Kit (Qiagen, Valencia, CA) and ligated with T4 DNA ligase (Invitrogen, Carlsbad, CA) at a ratio of 2:1 of vector to insert.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs bspei
    Daidzein changes DNA methylation at the BRF2 promoter specifically. CpG methylation- sensitive restriction enzymes cut sites are shown. Transcription start site (TSS) is indicated by +1. MethPrimer program was used to predict the location of CpG islands within the BRF2 (402–556 bp) and BRF1 (50–910 bp) promoters, as indicated by black arrow. Black bars denote the binding sites for primers used in the methylation profile analysis. a-d MCF-7 and ( e ) MDA-MB-231 cells were treated with 0, 3, 10 μM daidzein for 48 h. The genomic DNA was harvested and digested with methylation-sensitive restriction enzymes with cut sites within the promoter, noted on BRF2 and BRF1 promoter schematic, and as a negative control one methylation sensitive enzyme with no recognition sites in the promoter was used. <t>BspEI</t> and <t>BsRFI</t> do not have recognition sites in BRF2 and BRF1 promoters, respectively. The digestion profile was then analyzed by qPCR using primers spanning the BRF2 ( a , e, f ) and BRF1 ( b ) promoter regions, U6 ( c ) and tRNA i Met ( d ) genes. DNA methylation levels were calculated using ΔΔCt method with RPS13 expression levels used as a reference for normalization. Data presented are average of three independent experiments. Statistical analysis was performed using one-way ANOVA a Tukey’s post-test with a 95 % confidence interval (Graphpad Prism 3.03); * = p
    Bspei, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bspei/product/New England Biolabs
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    bspei - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Daidzein changes DNA methylation at the BRF2 promoter specifically. CpG methylation- sensitive restriction enzymes cut sites are shown. Transcription start site (TSS) is indicated by +1. MethPrimer program was used to predict the location of CpG islands within the BRF2 (402–556 bp) and BRF1 (50–910 bp) promoters, as indicated by black arrow. Black bars denote the binding sites for primers used in the methylation profile analysis. a-d MCF-7 and ( e ) MDA-MB-231 cells were treated with 0, 3, 10 μM daidzein for 48 h. The genomic DNA was harvested and digested with methylation-sensitive restriction enzymes with cut sites within the promoter, noted on BRF2 and BRF1 promoter schematic, and as a negative control one methylation sensitive enzyme with no recognition sites in the promoter was used. BspEI and BsRFI do not have recognition sites in BRF2 and BRF1 promoters, respectively. The digestion profile was then analyzed by qPCR using primers spanning the BRF2 ( a , e, f ) and BRF1 ( b ) promoter regions, U6 ( c ) and tRNA i Met ( d ) genes. DNA methylation levels were calculated using ΔΔCt method with RPS13 expression levels used as a reference for normalization. Data presented are average of three independent experiments. Statistical analysis was performed using one-way ANOVA a Tukey’s post-test with a 95 % confidence interval (Graphpad Prism 3.03); * = p

    Journal: BMC Cancer

    Article Title: Induction of proto-oncogene BRF2 in breast cancer cells by the dietary soybean isoflavone daidzein

    doi: 10.1186/s12885-015-1914-5

    Figure Lengend Snippet: Daidzein changes DNA methylation at the BRF2 promoter specifically. CpG methylation- sensitive restriction enzymes cut sites are shown. Transcription start site (TSS) is indicated by +1. MethPrimer program was used to predict the location of CpG islands within the BRF2 (402–556 bp) and BRF1 (50–910 bp) promoters, as indicated by black arrow. Black bars denote the binding sites for primers used in the methylation profile analysis. a-d MCF-7 and ( e ) MDA-MB-231 cells were treated with 0, 3, 10 μM daidzein for 48 h. The genomic DNA was harvested and digested with methylation-sensitive restriction enzymes with cut sites within the promoter, noted on BRF2 and BRF1 promoter schematic, and as a negative control one methylation sensitive enzyme with no recognition sites in the promoter was used. BspEI and BsRFI do not have recognition sites in BRF2 and BRF1 promoters, respectively. The digestion profile was then analyzed by qPCR using primers spanning the BRF2 ( a , e, f ) and BRF1 ( b ) promoter regions, U6 ( c ) and tRNA i Met ( d ) genes. DNA methylation levels were calculated using ΔΔCt method with RPS13 expression levels used as a reference for normalization. Data presented are average of three independent experiments. Statistical analysis was performed using one-way ANOVA a Tukey’s post-test with a 95 % confidence interval (Graphpad Prism 3.03); * = p

    Article Snippet: Restriction enzymes AciI, AscI, BanI, BfuAI, BsrFI, BsrBI, BseYI, BfuAI, BspEI, Cac81, FspI, NciI, NruI (New England Biolabs) and HpyCH4III/Taal (Fermentas) were used.

    Techniques: DNA Methylation Assay, CpG Methylation Assay, Binding Assay, Methylation, Multiple Displacement Amplification, Negative Control, Real-time Polymerase Chain Reaction, Expressing

    were subjected to restriction digestion with Xma I and Bsp

    Journal: Nature protocols

    Article Title: A protocol for the production of recombinant spider silk-like proteins for artificial fiber spinning

    doi: 10.1038/nprot.2008.250

    Figure Lengend Snippet: were subjected to restriction digestion with Xma I and Bsp

    Article Snippet: Restriction endonucleases: Bam HI, Bsp EI, Nde I, Sca I, Xma I (New England Biolabs Inc., cat. no. R0136S, R0540S, R0111S, R0122S, R0180S, respectively) T4 DNA ligase (Promega, cat. no. M1801) Lysozyme (Aldrich-Sigma Chemical Co. Ltd, cat. no. 62970) DNAse I (Aldrich-Sigma Chemical Co. Ltd, cat. no. D7291-5MG) RNAse A (Aldrich-Sigma Chemical Co. Ltd, cat. no. R6513-10MG) 6× His mAb–HRP conjugate (Clontech, cat. no. 631210)

    Techniques: