bsmbi  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Esp3I (BsmBI)
    Description:
    5'  C  G  T  C  T  C  N1↓ 3'3'  G  C  A  G  A  G  N5↑ 5'Thermo Scientific Esp3I (BsmBI) restriction enzyme recognizes CGTCTC(1/5)^ sites and cuts best at 37°C in Tango (+DTT) buffer. See Reaction Conditions for Restriction Enzymes for a table of enzyme activity, conditions for double digestion, and heat inactivation for this and other restriction enzymes. Note: Also available as a FastDigest enzyme for rapid DNA digestion. Isoschizomers: BsmBI.Thermo Scientific conventional restriction endonucleases are a large collection of high quality restriction enzymes, optimized to work in one of the buffers of the Five Buffer System. In addition, the universal Tango buffer is provided for convenience in double digestions. All of the enzymes exhibit 100% activity in the recommended buffer and reaction conditions. To ensure consistent performance, Thermo Scientific restriction enzyme reaction buffers contain premixed BSA, which enhances the stability of many enzymes and binds contaminants that sent in DNA preparations.Features• Superior quality—stringent quality control and industry leading manufacturing process• Convenient color-coded Five Buffer System• Includes universal Tango buffer for double-digestions• BSA premixed in reaction buffers• Wide selection of restriction endonuclease specificitiesApplications• Molecular cloning• Restriction site mapping• Genotyping• Southern blotting• Restriction fragment length polymorphism (RFLP)• SNPNote: The enzyme requires DTT. Freshly made DTT should be added to the reaction buffer. Esp3I cleaves downstream of its recognition site and can generate any desired 4 base 5'-overhangs. This feature is useful for PCR product cloning. For methylation sensitivity, refer to product specifications.
    Catalog Number:
    ER0451
    Price:
    None
    Applications:
    Cloning|Restriction Enzyme Cloning
    Size:
    200 units
    Category:
    Proteins, Enzymes, & Peptides, PCR & Cloning Enzymes, Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher bsmbi
    Design, Delivery, and Selection of ScanDel Library of CRISPR/Cas9-Programmed Deletions for Identification of Non-coding Regulatory Elements (A) <t>gRNA</t> pairs were designed from a filtered set of protospacers from all Cas9 PAM sequences (5′-NGGs) in the HPRT1 locus (see also <xref ref-type= Figure 2 A). Sites that were > 25 bp apart or > 50 bp away from exons were kept. For tile design, each remaining spacer was paired to two downstream spacers targeting sequence ∼1 and ∼2 kb away. This resulted in high redundancy of independently programmed, overlapping deletions across the locus (see also Figure 2 B). (B) All spacer pairs corresponding to programmed deletions were synthesized on a microarray (inset). Each spacer was also synthesized as a self-pair as a control for its independent effects. If a self-paired spacer scored positively in the screen, any pairs that used that spacer were removed from the analysis ( Figure S1 ). U6 and gRNA backbone sequence flanked the spacer pairs for Gibson-mediated cloning into lentiGuide-Puro, and mirrored BsmBI cut sites separated the spacer pairs to facilitate insertion of a second gRNA backbone and the H1 promoter. In the final library, each gRNA was expressed from its own PolIII promoter. This design facilitates PCR and direct sequencing-based quantification of gRNA-pair abundances. (C) The lentiviral library of gRNA pairs was cloned at a minimum of 20× coverage (in relation to library complexity) and transduced into HAP1 cells stably expressing Cas9 (via lentiCas9-Blast ) at low MOI. After a week of puromycin selection, the cells were sampled for measurement of the baseline abundance of each gRNA pair. The final cell population was harvested after a week of 6-thioguanine (6TG) treatment, which selected for cells that had lost HPRT enzymatic function. The phenotypic prevalence of each programmed deletion was quantified by PCR and deep sequencing of the gRNA pairs before and after selection. " width='250' height="auto" />
    5'  C  G  T  C  T  C  N1↓ 3'3'  G  C  A  G  A  G  N5↑ 5'Thermo Scientific Esp3I (BsmBI) restriction enzyme recognizes CGTCTC(1/5)^ sites and cuts best at 37°C in Tango (+DTT) buffer. See Reaction Conditions for Restriction Enzymes for a table of enzyme activity, conditions for double digestion, and heat inactivation for this and other restriction enzymes. Note: Also available as a FastDigest enzyme for rapid DNA digestion. Isoschizomers: BsmBI.Thermo Scientific conventional restriction endonucleases are a large collection of high quality restriction enzymes, optimized to work in one of the buffers of the Five Buffer System. In addition, the universal Tango buffer is provided for convenience in double digestions. All of the enzymes exhibit 100% activity in the recommended buffer and reaction conditions. To ensure consistent performance, Thermo Scientific restriction enzyme reaction buffers contain premixed BSA, which enhances the stability of many enzymes and binds contaminants that sent in DNA preparations.Features• Superior quality—stringent quality control and industry leading manufacturing process• Convenient color-coded Five Buffer System• Includes universal Tango buffer for double-digestions• BSA premixed in reaction buffers• Wide selection of restriction endonuclease specificitiesApplications• Molecular cloning• Restriction site mapping• Genotyping• Southern blotting• Restriction fragment length polymorphism (RFLP)• SNPNote: The enzyme requires DTT. Freshly made DTT should be added to the reaction buffer. Esp3I cleaves downstream of its recognition site and can generate any desired 4 base 5'-overhangs. This feature is useful for PCR product cloning. For methylation sensitivity, refer to product specifications.
    https://www.bioz.com/result/bsmbi/product/Thermo Fisher
    Average 99 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    bsmbi - by Bioz Stars, 2019-10
    99/100 stars

    Images

    1) Product Images from "CRISPR/Cas9-Mediated Scanning for Regulatory Elements Required for HPRT1 Expression via Thousands of Large, Programmed Genomic Deletions"

    Article Title: CRISPR/Cas9-Mediated Scanning for Regulatory Elements Required for HPRT1 Expression via Thousands of Large, Programmed Genomic Deletions

    Journal:

    doi: 10.1016/j.ajhg.2017.06.010

    Design, Delivery, and Selection of ScanDel Library of CRISPR/Cas9-Programmed Deletions for Identification of Non-coding Regulatory Elements (A) gRNA pairs were designed from a filtered set of protospacers from all Cas9 PAM sequences (5′-NGGs) in the HPRT1 locus (see also <xref ref-type= Figure 2 A). Sites that were > 25 bp apart or > 50 bp away from exons were kept. For tile design, each remaining spacer was paired to two downstream spacers targeting sequence ∼1 and ∼2 kb away. This resulted in high redundancy of independently programmed, overlapping deletions across the locus (see also Figure 2 B). (B) All spacer pairs corresponding to programmed deletions were synthesized on a microarray (inset). Each spacer was also synthesized as a self-pair as a control for its independent effects. If a self-paired spacer scored positively in the screen, any pairs that used that spacer were removed from the analysis ( Figure S1 ). U6 and gRNA backbone sequence flanked the spacer pairs for Gibson-mediated cloning into lentiGuide-Puro, and mirrored BsmBI cut sites separated the spacer pairs to facilitate insertion of a second gRNA backbone and the H1 promoter. In the final library, each gRNA was expressed from its own PolIII promoter. This design facilitates PCR and direct sequencing-based quantification of gRNA-pair abundances. (C) The lentiviral library of gRNA pairs was cloned at a minimum of 20× coverage (in relation to library complexity) and transduced into HAP1 cells stably expressing Cas9 (via lentiCas9-Blast ) at low MOI. After a week of puromycin selection, the cells were sampled for measurement of the baseline abundance of each gRNA pair. The final cell population was harvested after a week of 6-thioguanine (6TG) treatment, which selected for cells that had lost HPRT enzymatic function. The phenotypic prevalence of each programmed deletion was quantified by PCR and deep sequencing of the gRNA pairs before and after selection. " title="... pairs for Gibson-mediated cloning into lentiGuide-Puro, and mirrored BsmBI cut sites separated the spacer pairs to facilitate ..." property="contentUrl" width="100%" height="100%"/>
    Figure Legend Snippet: Design, Delivery, and Selection of ScanDel Library of CRISPR/Cas9-Programmed Deletions for Identification of Non-coding Regulatory Elements (A) gRNA pairs were designed from a filtered set of protospacers from all Cas9 PAM sequences (5′-NGGs) in the HPRT1 locus (see also Figure 2 A). Sites that were > 25 bp apart or > 50 bp away from exons were kept. For tile design, each remaining spacer was paired to two downstream spacers targeting sequence ∼1 and ∼2 kb away. This resulted in high redundancy of independently programmed, overlapping deletions across the locus (see also Figure 2 B). (B) All spacer pairs corresponding to programmed deletions were synthesized on a microarray (inset). Each spacer was also synthesized as a self-pair as a control for its independent effects. If a self-paired spacer scored positively in the screen, any pairs that used that spacer were removed from the analysis ( Figure S1 ). U6 and gRNA backbone sequence flanked the spacer pairs for Gibson-mediated cloning into lentiGuide-Puro, and mirrored BsmBI cut sites separated the spacer pairs to facilitate insertion of a second gRNA backbone and the H1 promoter. In the final library, each gRNA was expressed from its own PolIII promoter. This design facilitates PCR and direct sequencing-based quantification of gRNA-pair abundances. (C) The lentiviral library of gRNA pairs was cloned at a minimum of 20× coverage (in relation to library complexity) and transduced into HAP1 cells stably expressing Cas9 (via lentiCas9-Blast ) at low MOI. After a week of puromycin selection, the cells were sampled for measurement of the baseline abundance of each gRNA pair. The final cell population was harvested after a week of 6-thioguanine (6TG) treatment, which selected for cells that had lost HPRT enzymatic function. The phenotypic prevalence of each programmed deletion was quantified by PCR and deep sequencing of the gRNA pairs before and after selection.

    Techniques Used: Selection, CRISPR, Sequencing, Synthesized, Microarray, Clone Assay, Polymerase Chain Reaction, Stable Transfection, Expressing

    2) Product Images from "A modular toolbox for gRNA–Cas9 genome engineering in plants based on the GoldenBraid standard"

    Article Title: A modular toolbox for gRNA–Cas9 genome engineering in plants based on the GoldenBraid standard

    Journal: Plant Methods

    doi: 10.1186/s13007-016-0101-2

    Targeted mutagenesis using the CRISPR/Cas9 system in transient expression in N. benthamiana. a Schematic representation of the structure of Niben101Scf04205Ctg025 (XT1) and Niben101Scf04551Ctg021 (XT2) (exons in grey , introns in white ) with the sequences of the target sites. Diagnostic restriction sites are underlined and the PAM sequence is shown in bold . b Comparison of the mutation efficiency of hCas9 and pcoCas9 targeting the XT2. Red arrow shows SpeI resistant PCR fragments only visible on the gRNA and hCas9 combination. c PCR/RE assay to detect simultaneous targeted mutations on XT1 and XT2. Red arrows show BsmBI and SpeI resistant PCR fragments amplified from N. benthamiana genomic DNA. d Alignment of XT1 and XT2 sequences obtained from different clones of uncleaved bands (see c ). XT1 target site appears in blue and XT2 target site in green . Red letters and dashes indicate insertions and deletions respectively
    Figure Legend Snippet: Targeted mutagenesis using the CRISPR/Cas9 system in transient expression in N. benthamiana. a Schematic representation of the structure of Niben101Scf04205Ctg025 (XT1) and Niben101Scf04551Ctg021 (XT2) (exons in grey , introns in white ) with the sequences of the target sites. Diagnostic restriction sites are underlined and the PAM sequence is shown in bold . b Comparison of the mutation efficiency of hCas9 and pcoCas9 targeting the XT2. Red arrow shows SpeI resistant PCR fragments only visible on the gRNA and hCas9 combination. c PCR/RE assay to detect simultaneous targeted mutations on XT1 and XT2. Red arrows show BsmBI and SpeI resistant PCR fragments amplified from N. benthamiana genomic DNA. d Alignment of XT1 and XT2 sequences obtained from different clones of uncleaved bands (see c ). XT1 target site appears in blue and XT2 target site in green . Red letters and dashes indicate insertions and deletions respectively

    Techniques Used: Mutagenesis, CRISPR, Expressing, Diagnostic Assay, Sequencing, Polymerase Chain Reaction, Amplification, Clone Assay

    Related Articles

    Clone Assay:

    Article Title: CRISPR/Cas9-Mediated Scanning for Regulatory Elements Required for HPRT1 Expression via Thousands of Large, Programmed Genomic Deletions
    Article Snippet: Contrastingly, the library of individual gRNAs included all of the spacers targeting the same region, excluding those predicted to have 2,000 or more off-targets or to have off-targets with four or fewer mismatches within the targeted HPRT1 region. .. This library cloning method was developed in parallel with similar recently published methods and was modified from the GeCKO individual-gRNA cloning scheme., First, the lentiGuide-Puro backbone (Addgene 52963) was digested with BsmBI (FastDigest Esp3I, Thermo Fisher Scientific) and gel purified. .. The paired spacers (flanked with lentiGuide-Puro overlap sequences) were synthesized twice on a microarray (CustomArray) such that each pairing was represented in both possible orders ( ).

    Article Title: Systems analysis identifies melanoma-enriched pro-oncogenic networks controlled by the RNA binding protein CELF1
    Article Snippet: Downregulation efficacy was determined after puromycin selection (1 µg/mL) by protein immunoblotting or RT-qPCR. .. For CRISPR/Cas9 gRNA cloning, the forward/reverse pair of oligos were phosphorylated, annealed, and ligated with the BsmBI (Thermo Fisher) for cloning into lentiCRISPR v2 plasmid . .. Lentivirus was produced and cells were infected as described previously .

    Article Title: Competitive endogenous RNA is an intrinsic component of EMT regulatory circuits and modulates EMT
    Article Snippet: A549 and MCF-10A were infected by the lentivirus containing LentiCas-Blast first (MOI = 0.3) and selected with 8 µg/ml Blasticidin for 5 days. .. To generate desired vector for mutagenesis, the guide RNA vector was digested with BsmBI (Fermentas) and a pair of annealed oligos containing the sgRNA was cloned into the single guide RNA scaffold. .. The A549-Cas9 cells and MCF10A-Cas9 cells were infected with the lentivirus contained guide RNA (MOI = 0.3) and selected with 1ug/ml Puromycin for 3 days.

    Article Title: Optimization of a novel biophysical model using large scale in vivo antisense hybridization data displays improved prediction capabilities of structurally accessible RNA regions
    Article Snippet: All asRNA sequences within the plasmid , besides 11 asRNAs corresponding to regions within the gI intron that were previously synthesized and published , were either ordered from GenScript Inc., synthesized by a site-directed mutagenesis approach (QuikChange II Site-Directed Mutagenesis Kit, Agilent Technologies) by modifying a previously synthesized asRNA, synthesized via Gibson Assembly ( ) or synthesized by using a high throughput Golden Gate approach as described in ( ) on our iRS3 -GG plasmid. .. For the Golden Gate approach, complementary primers (ordered from IDT) containing each asRNA sequence with the proper flanking overhangs were annealed and cloned after digestion with BsmbI (Thermo Scientific) to replace the p-chlorophenylalanine negative selection cassette. .. To increase cloning throughput, two to five asRNAs were combined into a single reaction and later transformed into DH5α chemically-competent cells or NEB Turbo electro-competent cells and plated in Luria–Bertani (LB)/Agar media supplemented with p-cholorophenylalanine (p-Cl-Phe) to select for the clones harboring the appropriate asRNA.

    Article Title: lincRNA-Cox2 regulates NLRP3 inflammasome and autophagy mediated neuroinflammation
    Article Snippet: The sgRNAs sequences are as follows: lincRNA-Cox2-dnstrm-g1 ATCATTAACCTGTTATCATA; lincRNA-Cox2-dnstrm-g2 CTTCAATAGACATATCTTTA; lincRNA-Cox2-upstrm-g1 TCTTTGATGCAAGGAACTAC; lincRNA-Cox2-upstrm-g2 TTACACTGTTTATCGCTGGT. .. The sgRNAs included a 5-bp overhang for the forward (CACCG) and the reverse (CAAA) oligos to enable cloning into the BsmBI (Thermo Scientific, Waltham, MA) site of the LentiCRISPR V2. .. Positive clones were selected and the plasmids were further verified by DNA sequencing (Genewiz, Suzhou, China).

    Article Title: Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria
    Article Snippet: We performed the Golden Gate assembly reaction with 1,000 ng of part4 plasmid (pHLL214 or pHLL215) and 40 ng of the barcode PCR product using BsmBI (Esp3I from Thermo Fisher) and T4 DNA ligase under the following cycling conditions: 10 cycles, with 1 cycle consisting of 5 min at 37°C and 10 min at 16°C, followed by a final digestion step at 37°C for 30 min. We then purified the Golden Gate assembly reaction with the DNA Clean & Concentrator kit (Zymo Research) and digested the DNA overnight with BsmBI. .. We then purified the DNA again with the DNA Clean & Concentrator kit (Zymo Research) and transformed the vector into E. coli .

    Article Title: A CRISPR Resource for Individual, Combinatorial, or Multiplexed Gene Knockout
    Article Snippet: These molecules were amplified by PCR (forward primer (FP): TTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG, reverse primer (RP): GGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC) and cloned by Gibson assembly into a 3rd generation lentiviral vector harboring a U6 promoter, an sgRNA backbone, and a ZsGreen-P2A-PuromycrinR transcript driven by a spleen focus-forming virus promoter (pCRoatan-singleSgRNA). .. The amplicon was digested with BbsI (NEB) and ligated into a 3rd generation lentiviral vector (pCRoatan-dualSgRNA) previously digested with BsmBI (ThermoFischer).

    Article Title: Dysregulation of mitochondrial dynamics proteins are a targetable feature of human tumors
    Article Snippet: Paragraph title: Cloning CRISPR constructs ... Inserts were cleaned with Axygen PCR clean-up beads (1.8×; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (hygro) was digested with BsmBI (Thermo Fisher) for 2 h at 37 °C.

    Article Title: A CRISPR Resource for Individual, Combinatorial, or Multiplexed Gene Knockout
    Article Snippet: Subsequently, the hU6 and cU6 promoters driving the sgRNAs were added to the vector. .. The hU6 promoter was amplified from lentiCrisprv2 (Addgene #52961) by PCR (FP: AGTACCGTCTCTGGTGTTTCGTCCTTTCCACAAG, RP: GTACCTACGCGTGAGGGCCTATTTCCCATGATTC), and cloned by ligation using the BsmBI (ThermoFischer) and MluI (NEB) restriction sites. .. The cU6 promoter (cU6-3, ) was amplified from a gBlock (IDT) by PCR (FP: ATCGATCTCGAGGCGCCGCCGCTCCTTCAGGCA, RP: TGATCCTGGTCTCACGACTAAGAGCATCGAGACTGC), and cloned by ligation using the BsaI (NEB) and XhoI (NEB) restriction sites.

    Article Title: A multiplatform approach identifies miR-152-3p as a common epigenetically regulated onco-suppressor in prostate cancer targeting TMEM97
    Article Snippet: Paragraph title: sgRNA cloning ... Annealed oligos were diluted at 1:100 in sterile water and ligated to plasmid vector lentiCRISPRv2 (gift from Feng Zhang (Addgene plasmid #52961)) using the following parameters: 50 ng BsmBI (Fermentas) digested plasmid, 1 μl diluted oligo duplex, 1× Ligation Buffer (Roche), and 5 U T4 DNA Ligase (Roche) incubated at RT/30 min.

    Article Title: Systematic interrogation of β-catenin co-dependent genes facilitated by integrated genetic and proteomic approaches
    Article Snippet: To generate a pooled double sgRNA library, 115 sgRNAs were individually PCR amplified together with the S. Pyogenes tracer sequence and inserted into position 1 (AgeI/EcoRI restriction sites). .. Vectors containing an sgRNA in position 1 were pooled and digested with BsmBI (Thermo Scientific) and a pool of the same 115 sgRNAs was ligated into the BsmBI cloning sites (exactly as described above for single sgRNA pooled library). .. Following ligation the library was electroporated into Stbl4 cells (Life Technologies) grown at 30°C.

    Article Title: CRISPR/Cas9 knockouts reveal genetic interaction between strain-transcendent erythrocyte determinants of Plasmodium falciparum invasion
    Article Snippet: Paragraph title: Cloning and Lentivirus Generation. ... Primer pairs were phosphorylated using T4 polynucleotide kinase (New England Biolabs) and ligated using Quick Ligase (New England Biolabs) into the lentiGuide-Puro vector , which had previously been digested with BsmBI (Thermo Fisher Scientific) and dephosphorylated with FastAP alkaline phosphatase (Thermo Fisher Scientific).

    Article Title: DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs
    Article Snippet: Insert-1 sequences were designed by combining the two designed target sequences with simple design template (available as Additional file : File S1). .. These were synthesised as DNA oligonucleotides (gBlock, IDT) of 165 bp at a concentration of 20 ng/ul, and cloned using Gibson assembly method [ ] into lenti-guide puro plasmid (Addgene ref. 52963) [ ] digested with BsmBI (Thermo Fisher). .. We mixed 20 ng of Insert-1 with 100–150 ng of BsmBI-digested plasmid in 10 ul volume, with 10 ul of 2x Gibson mix (note that this step could also be carried out using commercially-available Gibson assembly reagents).

    Article Title: Effect of transcription terminator usage on the establishment of transgene transcriptional gene silencing
    Article Snippet: BsmBI (ThermoFisher), BsaI and BtgZI (New England BioLabs) and T4 Ligase (Promega) were used. ffLUC and FUS3short were domesticated into pUPD vectors using BsmBI enzyme. p35S, ffLUC, FUS3short and Thsp or T35S in pUPD vectors were assembled into pDBG_2alpha2. .. After digestion/ligation, 10 µl of reaction were transformed into E. coli DH5α chemically competent cells.

    Article Title: A landscape of therapeutic cooperativity in KRAS mutant cancers reveals principles for controlling tumor evolution
    Article Snippet: Paragraph title: Cloning CRISPR drug-sensitivity library ... Five unique sgRNA inserts along with 50 non-targeting controls were synthesized by Custom Array of the form: GGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC “X” denotes unique 20mer sgRNA sequence The oligo pool was diluted 1:10 in water and amplified using NEB Phusion Hotstart Flex enzyme master mix and the following primers: ArrayF: TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG ArrayR: ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC PCR Protocol: 98°C/30s, 18x[98°C/10s, 63°C/10s, 72°C/15s], 72°C/3min Inserts were cleaned with Axygen PCR clean-up beads (1.8x; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (Addgene ID# 52961) was digested with BsmBI (Thermo Fisher) for 2 hours at 37°C.

    Centrifugation:

    Article Title: A modular toolbox for gRNA–Cas9 genome engineering in plants based on the GoldenBraid standard
    Article Snippet: The supernatant was removed after centrifugation (5 min at 14,000×g) and the DNA was washed twice with 70 % ethanol. .. The resulting PCR products were purified with the QIAquick PCR purification kit (QIAGEN) following the manufacturer’s protocol and restriction reactions were set up with 500 ng of purified DNA and the corresponding restriction enzyme; BsmBI (Fermentas) for XT1 and SpeI (Fermentas) for XT2.

    Article Title: Epithelial-to-Mesenchymal Transition of RPE Cells In Vitro Confers Increased β1,6-N-Glycosylation and Increased Susceptibility to Galectin-3 Binding
    Article Snippet: Briefly, for each gRNA expression vector, two oligonucleotides were created (as described in Sanjana et al. 2014 and protocols published at http://genome-engineering.org/gecko/ ), phosphorylated, annealed, and ligated with the BsmBI (Thermo Fisher) digested vector “lentiCRISPRv2” (addgene #52961) [ ]. .. Briefly, for each gRNA expression vector, two oligonucleotides were created (as described in Sanjana et al. 2014 and protocols published at http://genome-engineering.org/gecko/ ), phosphorylated, annealed, and ligated with the BsmBI (Thermo Fisher) digested vector “lentiCRISPRv2” (addgene #52961) [ ].

    Amplification:

    Article Title: CRISPR/Cas9-Mediated Scanning for Regulatory Elements Required for HPRT1 Expression via Thousands of Large, Programmed Genomic Deletions
    Article Snippet: This library cloning method was developed in parallel with similar recently published methods and was modified from the GeCKO individual-gRNA cloning scheme., First, the lentiGuide-Puro backbone (Addgene 52963) was digested with BsmBI (FastDigest Esp3I, Thermo Fisher Scientific) and gel purified. .. The paired spacers (flanked with lentiGuide-Puro overlap sequences) were synthesized twice on a microarray (CustomArray) such that each pairing was represented in both possible orders ( ).

    Article Title: Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria
    Article Snippet: To construct the two randomly DNA barcoded part4 vectors, pHLL214_NN1 and pHLL215_NN1, we first PCR amplified a short 46-bp oligonucleotide with 20 random base pairs in the middle (ofeba282) with oligonucleotides ofeba285 and ofeba286 using Phusion DNA polymerase. .. We performed the Golden Gate assembly reaction with 1,000 ng of part4 plasmid (pHLL214 or pHLL215) and 40 ng of the barcode PCR product using BsmBI (Esp3I from Thermo Fisher) and T4 DNA ligase under the following cycling conditions: 10 cycles, with 1 cycle consisting of 5 min at 37°C and 10 min at 16°C, followed by a final digestion step at 37°C for 30 min. We then purified the Golden Gate assembly reaction with the DNA Clean & Concentrator kit (Zymo Research) and digested the DNA overnight with BsmBI.

    Article Title: A CRISPR Resource for Individual, Combinatorial, or Multiplexed Gene Knockout
    Article Snippet: Primers containing these sequences were ordered from IDT ( ) and used to amplify a hU6-EM7-ZeocinR -cU6 cassette (pCRoatan-dualPromoter). .. The amplicon was digested with BbsI (NEB) and ligated into a 3rd generation lentiviral vector (pCRoatan-dualSgRNA) previously digested with BsmBI (ThermoFischer). .. Combinatorial sgRNA libraries were built using DNA chips (CustomArray, Inc.) containing 10K molecules harboring a barcode and two flanking sgRNA sequences ( ).

    Article Title: Dysregulation of mitochondrial dynamics proteins are a targetable feature of human tumors
    Article Snippet: The oligo pool was diluted 1:100 in water and amplified using NEB Phusion Hotstart Flex enzyme master mix and the following primers: ArrayF: TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG ArrayR: ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC PCR protocol: 98 °C/30 s, 18 × [98 °C/10 s, 63 °C/10 s, 72 °C/15 s], 72 °C/3 min. .. Inserts were cleaned with Axygen PCR clean-up beads (1.8×; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (hygro) was digested with BsmBI (Thermo Fisher) for 2 h at 37 °C.

    Article Title: A CRISPR Resource for Individual, Combinatorial, or Multiplexed Gene Knockout
    Article Snippet: Subsequently, the hU6 and cU6 promoters driving the sgRNAs were added to the vector. .. The hU6 promoter was amplified from lentiCrisprv2 (Addgene #52961) by PCR (FP: AGTACCGTCTCTGGTGTTTCGTCCTTTCCACAAG, RP: GTACCTACGCGTGAGGGCCTATTTCCCATGATTC), and cloned by ligation using the BsmBI (ThermoFischer) and MluI (NEB) restriction sites. .. The cU6 promoter (cU6-3, ) was amplified from a gBlock (IDT) by PCR (FP: ATCGATCTCGAGGCGCCGCCGCTCCTTCAGGCA, RP: TGATCCTGGTCTCACGACTAAGAGCATCGAGACTGC), and cloned by ligation using the BsaI (NEB) and XhoI (NEB) restriction sites.

    Article Title: Systematic interrogation of β-catenin co-dependent genes facilitated by integrated genetic and proteomic approaches
    Article Snippet: To generate a pooled double sgRNA library, 115 sgRNAs were individually PCR amplified together with the S. Pyogenes tracer sequence and inserted into position 1 (AgeI/EcoRI restriction sites). .. Vectors containing an sgRNA in position 1 were pooled and digested with BsmBI (Thermo Scientific) and a pool of the same 115 sgRNAs was ligated into the BsmBI cloning sites (exactly as described above for single sgRNA pooled library).

    Article Title: Effect of transcription terminator usage on the establishment of transgene transcriptional gene silencing
    Article Snippet: Phusion Hot Start II DNA Polymerase (ThermoFisher) was used for DNA amplification. .. BsmBI (ThermoFisher), BsaI and BtgZI (New England BioLabs) and T4 Ligase (Promega) were used. ffLUC and FUS3short were domesticated into pUPD vectors using BsmBI enzyme. p35S, ffLUC, FUS3short and Thsp or T35S in pUPD vectors were assembled into pDBG_2alpha2.

    Article Title: A landscape of therapeutic cooperativity in KRAS mutant cancers reveals principles for controlling tumor evolution
    Article Snippet: Our sub-genomic CRISPR library was cloned following previous methods ( ) using previously characterized sgRNAs ( ). .. Five unique sgRNA inserts along with 50 non-targeting controls were synthesized by Custom Array of the form: GGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC “X” denotes unique 20mer sgRNA sequence The oligo pool was diluted 1:10 in water and amplified using NEB Phusion Hotstart Flex enzyme master mix and the following primers: ArrayF: TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG ArrayR: ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC PCR Protocol: 98°C/30s, 18x[98°C/10s, 63°C/10s, 72°C/15s], 72°C/3min Inserts were cleaned with Axygen PCR clean-up beads (1.8x; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (Addgene ID# 52961) was digested with BsmBI (Thermo Fisher) for 2 hours at 37°C. .. The large ~ 13 kB band was gel extracted after size-selection on a 1% agarose gel.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Influenza NA and PB1 Gene Segments Interact during the Formation of Viral Progeny: Localization of the Binding Region within the PB1 Gene
    Article Snippet: DNA corresponding to the chimeric PB1 or Udorn NA genes was inserted between the BsmBI (ThermoFisher Scientific, Illkirch, France) sites of a pUC2000 vector after excision from the corresponding pHW2000 plasmid. .. After 3 h of incubation, samples were treated with 50 U of RNase-free DNase I ((Roche, Meylan, France)) for 2 h at 37 °C, vRNAs were extracted with phenol/chloroform (Carl Roth GmbH, Karsruhe, Germany), ethanol precipitated and purified on a TSK G2000SW column (Tosoh Bioscience GmbH, Stuttgart, Germany).

    Synthesized:

    Article Title: Optimization of a novel biophysical model using large scale in vivo antisense hybridization data displays improved prediction capabilities of structurally accessible RNA regions
    Article Snippet: All asRNA sequences within the plasmid , besides 11 asRNAs corresponding to regions within the gI intron that were previously synthesized and published , were either ordered from GenScript Inc., synthesized by a site-directed mutagenesis approach (QuikChange II Site-Directed Mutagenesis Kit, Agilent Technologies) by modifying a previously synthesized asRNA, synthesized via Gibson Assembly ( ) or synthesized by using a high throughput Golden Gate approach as described in ( ) on our iRS3 -GG plasmid. .. For the Golden Gate approach, complementary primers (ordered from IDT) containing each asRNA sequence with the proper flanking overhangs were annealed and cloned after digestion with BsmbI (Thermo Scientific) to replace the p-chlorophenylalanine negative selection cassette.

    Article Title: Dysregulation of mitochondrial dynamics proteins are a targetable feature of human tumors
    Article Snippet: CRISPR constructs were cloned following previous methods using previously characterized sgRNAs . sgRNA inserts were synthesized by IDT of the form: GGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC "X" denotes unique 20mer sgRNA sequence (see “20-mer sequences” below). .. Inserts were cleaned with Axygen PCR clean-up beads (1.8×; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (hygro) was digested with BsmBI (Thermo Fisher) for 2 h at 37 °C.

    Article Title: CRISPR/Cas9 knockouts reveal genetic interaction between strain-transcendent erythrocyte determinants of Plasmodium falciparum invasion
    Article Snippet: Primers for the top three hits for BSG and CD44 were synthesized (Integrated DNA Technologies): BSG-1-F 5ʹ–CACCGGCGAGGAATAGGAATCATGG; BSG-1-RC 5ʹ–AAACCCATGATTCCTATTCCTCGCC; BSG-2-F 5ʹ–CACCGTCTTCATCTACGAGAAGCGC; BSG-2-RC 5ʹ–AAACGCGCTTCTCGTAGATGAAGAC; BSG-3-F 5ʹ–CACCGCGTTGCACCGGTACTGGCCG; BSG-3-RC 5ʹ–AAACCGGCCAGTACCGGTGCAACGC; CD44-1-F 5′–CACCGCGTGGAATACACCTGCAAAG; CD44-1-RC 5′–AAACCTTTGCAGGTGTATTCCACGC; CD44-2-F 5′–CACCGACTGATGATGACGTGAGCAG; CD44-2-RC 5′–AAACCTGCTCACGTCATCATCAGTC; CD44-3-F 5′–CACCGCTGTGCAGCAAACAACACAG; and CD44-3-RC 5′–AAACCTGTGTTGTTTGCTGCACAGC. .. Primer pairs were phosphorylated using T4 polynucleotide kinase (New England Biolabs) and ligated using Quick Ligase (New England Biolabs) into the lentiGuide-Puro vector , which had previously been digested with BsmBI (Thermo Fisher Scientific) and dephosphorylated with FastAP alkaline phosphatase (Thermo Fisher Scientific).

    Article Title: A landscape of therapeutic cooperativity in KRAS mutant cancers reveals principles for controlling tumor evolution
    Article Snippet: Our sub-genomic CRISPR library was cloned following previous methods ( ) using previously characterized sgRNAs ( ). .. Five unique sgRNA inserts along with 50 non-targeting controls were synthesized by Custom Array of the form: GGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC “X” denotes unique 20mer sgRNA sequence The oligo pool was diluted 1:10 in water and amplified using NEB Phusion Hotstart Flex enzyme master mix and the following primers: ArrayF: TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG ArrayR: ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC PCR Protocol: 98°C/30s, 18x[98°C/10s, 63°C/10s, 72°C/15s], 72°C/3min Inserts were cleaned with Axygen PCR clean-up beads (1.8x; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (Addgene ID# 52961) was digested with BsmBI (Thermo Fisher) for 2 hours at 37°C. .. The large ~ 13 kB band was gel extracted after size-selection on a 1% agarose gel.

    Quantitative RT-PCR:

    Article Title: Systems analysis identifies melanoma-enriched pro-oncogenic networks controlled by the RNA binding protein CELF1
    Article Snippet: Downregulation efficacy was determined after puromycin selection (1 µg/mL) by protein immunoblotting or RT-qPCR. .. For CRISPR/Cas9 gRNA cloning, the forward/reverse pair of oligos were phosphorylated, annealed, and ligated with the BsmBI (Thermo Fisher) for cloning into lentiCRISPR v2 plasmid .

    Real-time Polymerase Chain Reaction:

    Article Title: lincRNA-Cox2 regulates NLRP3 inflammasome and autophagy mediated neuroinflammation
    Article Snippet: The sgRNAs included a 5-bp overhang for the forward (CACCG) and the reverse (CAAA) oligos to enable cloning into the BsmBI (Thermo Scientific, Waltham, MA) site of the LentiCRISPR V2. .. The sgRNAs included a 5-bp overhang for the forward (CACCG) and the reverse (CAAA) oligos to enable cloning into the BsmBI (Thermo Scientific, Waltham, MA) site of the LentiCRISPR V2.

    Incubation:

    Article Title: Influenza NA and PB1 Gene Segments Interact during the Formation of Viral Progeny: Localization of the Binding Region within the PB1 Gene
    Article Snippet: DNA corresponding to the chimeric PB1 or Udorn NA genes was inserted between the BsmBI (ThermoFisher Scientific, Illkirch, France) sites of a pUC2000 vector after excision from the corresponding pHW2000 plasmid. .. DNA corresponding to the chimeric PB1 or Udorn NA genes was inserted between the BsmBI (ThermoFisher Scientific, Illkirch, France) sites of a pUC2000 vector after excision from the corresponding pHW2000 plasmid.

    Article Title: Dysregulation of mitochondrial dynamics proteins are a targetable feature of human tumors
    Article Snippet: Inserts were cleaned with Axygen PCR clean-up beads (1.8×; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (hygro) was digested with BsmBI (Thermo Fisher) for 2 h at 37 °C. .. Inserts were cleaned with Axygen PCR clean-up beads (1.8×; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (hygro) was digested with BsmBI (Thermo Fisher) for 2 h at 37 °C.

    Article Title: A multiplatform approach identifies miR-152-3p as a common epigenetically regulated onco-suppressor in prostate cancer targeting TMEM97
    Article Snippet: Complementary single-stranded oligos (Additional file : Table S1) were phosphorylated and annealed by combining 100 μM oligos, 1× T4 PNK Buffer, 1 mM ATP, 5 U T4 PNK and incubating the reaction at 37 °C/30 min, 95 °C/5 min followed by a ramp down to 25 °C at 5 °C/min. .. Annealed oligos were diluted at 1:100 in sterile water and ligated to plasmid vector lentiCRISPRv2 (gift from Feng Zhang (Addgene plasmid #52961)) using the following parameters: 50 ng BsmBI (Fermentas) digested plasmid, 1 μl diluted oligo duplex, 1× Ligation Buffer (Roche), and 5 U T4 DNA Ligase (Roche) incubated at RT/30 min. .. The ligation reactions were used to transform highly competent Escherichia coli cells according to the manufacturer’s protocol [ ].

    Article Title: DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs
    Article Snippet: These were synthesised as DNA oligonucleotides (gBlock, IDT) of 165 bp at a concentration of 20 ng/ul, and cloned using Gibson assembly method [ ] into lenti-guide puro plasmid (Addgene ref. 52963) [ ] digested with BsmBI (Thermo Fisher). .. We mixed 20 ng of Insert-1 with 100–150 ng of BsmBI-digested plasmid in 10 ul volume, with 10 ul of 2x Gibson mix (note that this step could also be carried out using commercially-available Gibson assembly reagents).

    Article Title: A landscape of therapeutic cooperativity in KRAS mutant cancers reveals principles for controlling tumor evolution
    Article Snippet: Five unique sgRNA inserts along with 50 non-targeting controls were synthesized by Custom Array of the form: GGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC “X” denotes unique 20mer sgRNA sequence The oligo pool was diluted 1:10 in water and amplified using NEB Phusion Hotstart Flex enzyme master mix and the following primers: ArrayF: TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG ArrayR: ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC PCR Protocol: 98°C/30s, 18x[98°C/10s, 63°C/10s, 72°C/15s], 72°C/3min Inserts were cleaned with Axygen PCR clean-up beads (1.8x; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (Addgene ID# 52961) was digested with BsmBI (Thermo Fisher) for 2 hours at 37°C. .. Five unique sgRNA inserts along with 50 non-targeting controls were synthesized by Custom Array of the form: GGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC “X” denotes unique 20mer sgRNA sequence The oligo pool was diluted 1:10 in water and amplified using NEB Phusion Hotstart Flex enzyme master mix and the following primers: ArrayF: TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG ArrayR: ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC PCR Protocol: 98°C/30s, 18x[98°C/10s, 63°C/10s, 72°C/15s], 72°C/3min Inserts were cleaned with Axygen PCR clean-up beads (1.8x; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (Addgene ID# 52961) was digested with BsmBI (Thermo Fisher) for 2 hours at 37°C.

    Luciferase:

    Article Title: Effect of transcription terminator usage on the establishment of transgene transcriptional gene silencing
    Article Snippet: Firefly luciferase was amplified from GB0255 using primers 1678 (5′-GCGCCGTCTCGCTCGAATGGAAGACGCCAAAAACATAAAG-3′)/1679 (5′-GCGCCGTCTCGCTCGCTGCTTACACGGCGATCTTTCCGC-3′). .. BsmBI (ThermoFisher), BsaI and BtgZI (New England BioLabs) and T4 Ligase (Promega) were used. ffLUC and FUS3short were domesticated into pUPD vectors using BsmBI enzyme. p35S, ffLUC, FUS3short and Thsp or T35S in pUPD vectors were assembled into pDBG_2alpha2.

    High Throughput Screening Assay:

    Article Title: Optimization of a novel biophysical model using large scale in vivo antisense hybridization data displays improved prediction capabilities of structurally accessible RNA regions
    Article Snippet: All asRNA sequences within the plasmid , besides 11 asRNAs corresponding to regions within the gI intron that were previously synthesized and published , were either ordered from GenScript Inc., synthesized by a site-directed mutagenesis approach (QuikChange II Site-Directed Mutagenesis Kit, Agilent Technologies) by modifying a previously synthesized asRNA, synthesized via Gibson Assembly ( ) or synthesized by using a high throughput Golden Gate approach as described in ( ) on our iRS3 -GG plasmid. .. For the Golden Gate approach, complementary primers (ordered from IDT) containing each asRNA sequence with the proper flanking overhangs were annealed and cloned after digestion with BsmbI (Thermo Scientific) to replace the p-chlorophenylalanine negative selection cassette.

    Expressing:

    Article Title: Optimization of a novel biophysical model using large scale in vivo antisense hybridization data displays improved prediction capabilities of structurally accessible RNA regions
    Article Snippet: For the Golden Gate approach, complementary primers (ordered from IDT) containing each asRNA sequence with the proper flanking overhangs were annealed and cloned after digestion with BsmbI (Thermo Scientific) to replace the p-chlorophenylalanine negative selection cassette. .. For the Golden Gate approach, complementary primers (ordered from IDT) containing each asRNA sequence with the proper flanking overhangs were annealed and cloned after digestion with BsmbI (Thermo Scientific) to replace the p-chlorophenylalanine negative selection cassette.

    Article Title: lincRNA-Cox2 regulates NLRP3 inflammasome and autophagy mediated neuroinflammation
    Article Snippet: The sgRNAs included a 5-bp overhang for the forward (CACCG) and the reverse (CAAA) oligos to enable cloning into the BsmBI (Thermo Scientific, Waltham, MA) site of the LentiCRISPR V2. .. The sgRNAs included a 5-bp overhang for the forward (CACCG) and the reverse (CAAA) oligos to enable cloning into the BsmBI (Thermo Scientific, Waltham, MA) site of the LentiCRISPR V2.

    Article Title: A CRISPR Resource for Individual, Combinatorial, or Multiplexed Gene Knockout
    Article Snippet: The hU6 promoter was amplified from lentiCrisprv2 (Addgene #52961) by PCR (FP: AGTACCGTCTCTGGTGTTTCGTCCTTTCCACAAG, RP: GTACCTACGCGTGAGGGCCTATTTCCCATGATTC), and cloned by ligation using the BsmBI (ThermoFischer) and MluI (NEB) restriction sites. .. The cU6 promoter (cU6-3, ) was amplified from a gBlock (IDT) by PCR (FP: ATCGATCTCGAGGCGCCGCCGCTCCTTCAGGCA, RP: TGATCCTGGTCTCACGACTAAGAGCATCGAGACTGC), and cloned by ligation using the BsaI (NEB) and XhoI (NEB) restriction sites.

    Article Title: Epithelial-to-Mesenchymal Transition of RPE Cells In Vitro Confers Increased β1,6-N-Glycosylation and Increased Susceptibility to Galectin-3 Binding
    Article Snippet: Lentiviruses were created in HEK293T cells (Life Technologies) by co-transfection of three plasmids as described in [ , ]. .. Briefly, for each gRNA expression vector, two oligonucleotides were created (as described in Sanjana et al. 2014 and protocols published at http://genome-engineering.org/gecko/ ), phosphorylated, annealed, and ligated with the BsmBI (Thermo Fisher) digested vector “lentiCRISPRv2” (addgene #52961) [ ]. .. For the production of each lentivirus, 80% confluent HEK293T cells were co-transfected in 8 ml OptiMEM (Life Technologies) with 5μg and 7.5μg of packaging plasmids pMD2.G (addgene #12259) and psPAX2 (addgene #12260), respectively, and 10μg of the transfer plasmid (see above), using 100 μl Plus Reagent™ (Life Technologies) and 50μl Lipofectamine 2000™ (Life Technologies).

    Modification:

    Article Title: CRISPR/Cas9-Mediated Scanning for Regulatory Elements Required for HPRT1 Expression via Thousands of Large, Programmed Genomic Deletions
    Article Snippet: Contrastingly, the library of individual gRNAs included all of the spacers targeting the same region, excluding those predicted to have 2,000 or more off-targets or to have off-targets with four or fewer mismatches within the targeted HPRT1 region. .. This library cloning method was developed in parallel with similar recently published methods and was modified from the GeCKO individual-gRNA cloning scheme., First, the lentiGuide-Puro backbone (Addgene 52963) was digested with BsmBI (FastDigest Esp3I, Thermo Fisher Scientific) and gel purified. .. The paired spacers (flanked with lentiGuide-Puro overlap sequences) were synthesized twice on a microarray (CustomArray) such that each pairing was represented in both possible orders ( ).

    Article Title: Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria
    Article Snippet: We performed the Golden Gate assembly reaction with 1,000 ng of part4 plasmid (pHLL214 or pHLL215) and 40 ng of the barcode PCR product using BsmBI (Esp3I from Thermo Fisher) and T4 DNA ligase under the following cycling conditions: 10 cycles, with 1 cycle consisting of 5 min at 37°C and 10 min at 16°C, followed by a final digestion step at 37°C for 30 min. We then purified the Golden Gate assembly reaction with the DNA Clean & Concentrator kit (Zymo Research) and digested the DNA overnight with BsmBI. .. The part2 (antibiotic marker upstream region), part3 (open reading frame [ORF] of the antibiotic selection marker), and part5 (transposase upstream region and 5′ end of the transposase) portions were mostly cloned into the universal holding vector pJW52, amplified with oligonucleotides ofeba134 and ofeba137 ( ).

    Transformation Assay:

    Article Title: CRISPR/Cas9-Mediated Scanning for Regulatory Elements Required for HPRT1 Expression via Thousands of Large, Programmed Genomic Deletions
    Article Snippet: This library cloning method was developed in parallel with similar recently published methods and was modified from the GeCKO individual-gRNA cloning scheme., First, the lentiGuide-Puro backbone (Addgene 52963) was digested with BsmBI (FastDigest Esp3I, Thermo Fisher Scientific) and gel purified. .. To ensure quality of array synthesis, we amplified 1 ng of the oligonucleotide (oligo) pool with Kapa HiFi Hotstart ReadyMix (KHF, Kapa Biosystems) and ran it on a gel to confirm that the oligos were of the expected 108 bp length.

    Article Title: Optimization of a novel biophysical model using large scale in vivo antisense hybridization data displays improved prediction capabilities of structurally accessible RNA regions
    Article Snippet: For the Golden Gate approach, complementary primers (ordered from IDT) containing each asRNA sequence with the proper flanking overhangs were annealed and cloned after digestion with BsmbI (Thermo Scientific) to replace the p-chlorophenylalanine negative selection cassette. .. To increase cloning throughput, two to five asRNAs were combined into a single reaction and later transformed into DH5α chemically-competent cells or NEB Turbo electro-competent cells and plated in Luria–Bertani (LB)/Agar media supplemented with p-cholorophenylalanine (p-Cl-Phe) to select for the clones harboring the appropriate asRNA.

    Article Title: Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria
    Article Snippet: We performed the Golden Gate assembly reaction with 1,000 ng of part4 plasmid (pHLL214 or pHLL215) and 40 ng of the barcode PCR product using BsmBI (Esp3I from Thermo Fisher) and T4 DNA ligase under the following cycling conditions: 10 cycles, with 1 cycle consisting of 5 min at 37°C and 10 min at 16°C, followed by a final digestion step at 37°C for 30 min. We then purified the Golden Gate assembly reaction with the DNA Clean & Concentrator kit (Zymo Research) and digested the DNA overnight with BsmBI. .. We performed the Golden Gate assembly reaction with 1,000 ng of part4 plasmid (pHLL214 or pHLL215) and 40 ng of the barcode PCR product using BsmBI (Esp3I from Thermo Fisher) and T4 DNA ligase under the following cycling conditions: 10 cycles, with 1 cycle consisting of 5 min at 37°C and 10 min at 16°C, followed by a final digestion step at 37°C for 30 min. We then purified the Golden Gate assembly reaction with the DNA Clean & Concentrator kit (Zymo Research) and digested the DNA overnight with BsmBI.

    Article Title: Dysregulation of mitochondrial dynamics proteins are a targetable feature of human tumors
    Article Snippet: Inserts were cleaned with Axygen PCR clean-up beads (1.8×; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (hygro) was digested with BsmBI (Thermo Fisher) for 2 h at 37 °C. .. Inserts were cleaned with Axygen PCR clean-up beads (1.8×; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (hygro) was digested with BsmBI (Thermo Fisher) for 2 h at 37 °C.

    Article Title: A multiplatform approach identifies miR-152-3p as a common epigenetically regulated onco-suppressor in prostate cancer targeting TMEM97
    Article Snippet: Annealed oligos were diluted at 1:100 in sterile water and ligated to plasmid vector lentiCRISPRv2 (gift from Feng Zhang (Addgene plasmid #52961)) using the following parameters: 50 ng BsmBI (Fermentas) digested plasmid, 1 μl diluted oligo duplex, 1× Ligation Buffer (Roche), and 5 U T4 DNA Ligase (Roche) incubated at RT/30 min. .. The ligation reactions were used to transform highly competent Escherichia coli cells according to the manufacturer’s protocol [ ].

    Article Title: DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs
    Article Snippet: These were synthesised as DNA oligonucleotides (gBlock, IDT) of 165 bp at a concentration of 20 ng/ul, and cloned using Gibson assembly method [ ] into lenti-guide puro plasmid (Addgene ref. 52963) [ ] digested with BsmBI (Thermo Fisher). .. We mixed 20 ng of Insert-1 with 100–150 ng of BsmBI-digested plasmid in 10 ul volume, with 10 ul of 2x Gibson mix (note that this step could also be carried out using commercially-available Gibson assembly reagents).

    Article Title: Effect of transcription terminator usage on the establishment of transgene transcriptional gene silencing
    Article Snippet: Paragraph title: Generation of transformation plasmids ... BsmBI (ThermoFisher), BsaI and BtgZI (New England BioLabs) and T4 Ligase (Promega) were used. ffLUC and FUS3short were domesticated into pUPD vectors using BsmBI enzyme. p35S, ffLUC, FUS3short and Thsp or T35S in pUPD vectors were assembled into pDBG_2alpha2.

    Article Title: A landscape of therapeutic cooperativity in KRAS mutant cancers reveals principles for controlling tumor evolution
    Article Snippet: Five unique sgRNA inserts along with 50 non-targeting controls were synthesized by Custom Array of the form: GGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC “X” denotes unique 20mer sgRNA sequence The oligo pool was diluted 1:10 in water and amplified using NEB Phusion Hotstart Flex enzyme master mix and the following primers: ArrayF: TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG ArrayR: ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC PCR Protocol: 98°C/30s, 18x[98°C/10s, 63°C/10s, 72°C/15s], 72°C/3min Inserts were cleaned with Axygen PCR clean-up beads (1.8x; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (Addgene ID# 52961) was digested with BsmBI (Thermo Fisher) for 2 hours at 37°C. .. Five unique sgRNA inserts along with 50 non-targeting controls were synthesized by Custom Array of the form: GGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC “X” denotes unique 20mer sgRNA sequence The oligo pool was diluted 1:10 in water and amplified using NEB Phusion Hotstart Flex enzyme master mix and the following primers: ArrayF: TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG ArrayR: ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC PCR Protocol: 98°C/30s, 18x[98°C/10s, 63°C/10s, 72°C/15s], 72°C/3min Inserts were cleaned with Axygen PCR clean-up beads (1.8x; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (Addgene ID# 52961) was digested with BsmBI (Thermo Fisher) for 2 hours at 37°C.

    Electroporation:

    Article Title: A CRISPR Resource for Individual, Combinatorial, or Multiplexed Gene Knockout
    Article Snippet: The hU6 promoter was amplified from lentiCrisprv2 (Addgene #52961) by PCR (FP: AGTACCGTCTCTGGTGTTTCGTCCTTTCCACAAG, RP: GTACCTACGCGTGAGGGCCTATTTCCCATGATTC), and cloned by ligation using the BsmBI (ThermoFischer) and MluI (NEB) restriction sites. .. Following these three steps, the full sgRNA1-hU6-EM7-ZeocinR -Barcode-cU6-sgRNA2 cassette was digested from the intermediate cloning vector using BbsI and ligated in the lentiviral expression vector (pCRoatan-dualSgRNA) as described previously.

    Ligation:

    Article Title: A CRISPR Resource for Individual, Combinatorial, or Multiplexed Gene Knockout
    Article Snippet: The amplicon was digested with BbsI (NEB) and ligated into a 3rd generation lentiviral vector (pCRoatan-dualSgRNA) previously digested with BsmBI (ThermoFischer). .. Chips were amplified by 5 separate 18-cycle PCRs to ensure high-complexity end product.

    Article Title: A CRISPR Resource for Individual, Combinatorial, or Multiplexed Gene Knockout
    Article Snippet: Subsequently, the hU6 and cU6 promoters driving the sgRNAs were added to the vector. .. The hU6 promoter was amplified from lentiCrisprv2 (Addgene #52961) by PCR (FP: AGTACCGTCTCTGGTGTTTCGTCCTTTCCACAAG, RP: GTACCTACGCGTGAGGGCCTATTTCCCATGATTC), and cloned by ligation using the BsmBI (ThermoFischer) and MluI (NEB) restriction sites. .. The cU6 promoter (cU6-3, ) was amplified from a gBlock (IDT) by PCR (FP: ATCGATCTCGAGGCGCCGCCGCTCCTTCAGGCA, RP: TGATCCTGGTCTCACGACTAAGAGCATCGAGACTGC), and cloned by ligation using the BsaI (NEB) and XhoI (NEB) restriction sites.

    Article Title: A multiplatform approach identifies miR-152-3p as a common epigenetically regulated onco-suppressor in prostate cancer targeting TMEM97
    Article Snippet: Complementary single-stranded oligos (Additional file : Table S1) were phosphorylated and annealed by combining 100 μM oligos, 1× T4 PNK Buffer, 1 mM ATP, 5 U T4 PNK and incubating the reaction at 37 °C/30 min, 95 °C/5 min followed by a ramp down to 25 °C at 5 °C/min. .. Annealed oligos were diluted at 1:100 in sterile water and ligated to plasmid vector lentiCRISPRv2 (gift from Feng Zhang (Addgene plasmid #52961)) using the following parameters: 50 ng BsmBI (Fermentas) digested plasmid, 1 μl diluted oligo duplex, 1× Ligation Buffer (Roche), and 5 U T4 DNA Ligase (Roche) incubated at RT/30 min. .. The ligation reactions were used to transform highly competent Escherichia coli cells according to the manufacturer’s protocol [ ].

    Atomic Absorption Spectroscopy:

    Article Title: Effect of transcription terminator usage on the establishment of transgene transcriptional gene silencing
    Article Snippet: FUS3short was amplified from Arabidopsis genomic DNA using primers 1668 (5′-GCGCCGTCTCGCTCGGCAGGGAAATGTTCTTACTATTATCCAGTCAT-3′)/1676 (5′-GCGCCGTCTCGCTCGAAGCTTATCCACCCAAAAAATCGAG-3′) to include FUS3 AAs 246–283. .. BsmBI (ThermoFisher), BsaI and BtgZI (New England BioLabs) and T4 Ligase (Promega) were used. ffLUC and FUS3short were domesticated into pUPD vectors using BsmBI enzyme. p35S, ffLUC, FUS3short and Thsp or T35S in pUPD vectors were assembled into pDBG_2alpha2.

    Infection:

    Article Title: Competitive endogenous RNA is an intrinsic component of EMT regulatory circuits and modulates EMT
    Article Snippet: A549 and MCF-10A were infected by the lentivirus containing LentiCas-Blast first (MOI = 0.3) and selected with 8 µg/ml Blasticidin for 5 days. .. To generate desired vector for mutagenesis, the guide RNA vector was digested with BsmBI (Fermentas) and a pair of annealed oligos containing the sgRNA was cloned into the single guide RNA scaffold.

    DNA Sequencing:

    Article Title: Competitive endogenous RNA is an intrinsic component of EMT regulatory circuits and modulates EMT
    Article Snippet: To generate desired vector for mutagenesis, the guide RNA vector was digested with BsmBI (Fermentas) and a pair of annealed oligos containing the sgRNA was cloned into the single guide RNA scaffold. .. To generate single clone for downstream experiments, the pool of infected cells were selected using the 96-well plate limiting dilution assay.

    Article Title: Optimization of a novel biophysical model using large scale in vivo antisense hybridization data displays improved prediction capabilities of structurally accessible RNA regions
    Article Snippet: For the Golden Gate approach, complementary primers (ordered from IDT) containing each asRNA sequence with the proper flanking overhangs were annealed and cloned after digestion with BsmbI (Thermo Scientific) to replace the p-chlorophenylalanine negative selection cassette. .. To increase cloning throughput, two to five asRNAs were combined into a single reaction and later transformed into DH5α chemically-competent cells or NEB Turbo electro-competent cells and plated in Luria–Bertani (LB)/Agar media supplemented with p-cholorophenylalanine (p-Cl-Phe) to select for the clones harboring the appropriate asRNA.

    Polymerase Chain Reaction:

    Article Title: CRISPR/Cas9-Mediated Scanning for Regulatory Elements Required for HPRT1 Expression via Thousands of Large, Programmed Genomic Deletions
    Article Snippet: This library cloning method was developed in parallel with similar recently published methods and was modified from the GeCKO individual-gRNA cloning scheme., First, the lentiGuide-Puro backbone (Addgene 52963) was digested with BsmBI (FastDigest Esp3I, Thermo Fisher Scientific) and gel purified. .. To ensure quality of array synthesis, we amplified 1 ng of the oligonucleotide (oligo) pool with Kapa HiFi Hotstart ReadyMix (KHF, Kapa Biosystems) and ran it on a gel to confirm that the oligos were of the expected 108 bp length.

    Article Title: A modular toolbox for gRNA–Cas9 genome engineering in plants based on the GoldenBraid standard
    Article Snippet: DNA amplicons covering the XT1 and XT2 target sites were obtained by PCR of genomic DNA using the Phusion High-Fidelity DNA polymerase (Thermo Scientific) and two pairs of gene specific primers: XT1_F/XT1_R for XT1 and XT2_F/XT2 _R for XT2 (Additional file : Table S1). .. The resulting PCR products were purified with the QIAquick PCR purification kit (QIAGEN) following the manufacturer’s protocol and restriction reactions were set up with 500 ng of purified DNA and the corresponding restriction enzyme; BsmBI (Fermentas) for XT1 and SpeI (Fermentas) for XT2. .. Band intensities were estimated using the ‘Benchling Gels’ ( https://benchling.com ) tool.

    Article Title: Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria
    Article Snippet: The barcode PCR products were purified with the DNA Clean & Concentrator kit (Zymo Research) and included in a Golden Gate assembly reaction with either pHLL214 or pHLL215. .. We performed the Golden Gate assembly reaction with 1,000 ng of part4 plasmid (pHLL214 or pHLL215) and 40 ng of the barcode PCR product using BsmBI (Esp3I from Thermo Fisher) and T4 DNA ligase under the following cycling conditions: 10 cycles, with 1 cycle consisting of 5 min at 37°C and 10 min at 16°C, followed by a final digestion step at 37°C for 30 min. We then purified the Golden Gate assembly reaction with the DNA Clean & Concentrator kit (Zymo Research) and digested the DNA overnight with BsmBI. .. We performed this additional digestion step to further eliminate nonbarcoded vectors.

    Article Title: A CRISPR Resource for Individual, Combinatorial, or Multiplexed Gene Knockout
    Article Snippet: These molecules were amplified by PCR (forward primer (FP): TTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG, reverse primer (RP): GGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC) and cloned by Gibson assembly into a 3rd generation lentiviral vector harboring a U6 promoter, an sgRNA backbone, and a ZsGreen-P2A-PuromycrinR transcript driven by a spleen focus-forming virus promoter (pCRoatan-singleSgRNA). .. The amplicon was digested with BbsI (NEB) and ligated into a 3rd generation lentiviral vector (pCRoatan-dualSgRNA) previously digested with BsmBI (ThermoFischer).

    Article Title: Dysregulation of mitochondrial dynamics proteins are a targetable feature of human tumors
    Article Snippet: The oligo pool was diluted 1:100 in water and amplified using NEB Phusion Hotstart Flex enzyme master mix and the following primers: ArrayF: TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG ArrayR: ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC PCR protocol: 98 °C/30 s, 18 × [98 °C/10 s, 63 °C/10 s, 72 °C/15 s], 72 °C/3 min. .. Inserts were cleaned with Axygen PCR clean-up beads (1.8×; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (hygro) was digested with BsmBI (Thermo Fisher) for 2 h at 37 °C. .. The large ~13 kB band was gel extracted after size-selection on a 1% agarose gel.

    Article Title: A CRISPR Resource for Individual, Combinatorial, or Multiplexed Gene Knockout
    Article Snippet: Subsequently, the hU6 and cU6 promoters driving the sgRNAs were added to the vector. .. The hU6 promoter was amplified from lentiCrisprv2 (Addgene #52961) by PCR (FP: AGTACCGTCTCTGGTGTTTCGTCCTTTCCACAAG, RP: GTACCTACGCGTGAGGGCCTATTTCCCATGATTC), and cloned by ligation using the BsmBI (ThermoFischer) and MluI (NEB) restriction sites. .. The cU6 promoter (cU6-3, ) was amplified from a gBlock (IDT) by PCR (FP: ATCGATCTCGAGGCGCCGCCGCTCCTTCAGGCA, RP: TGATCCTGGTCTCACGACTAAGAGCATCGAGACTGC), and cloned by ligation using the BsaI (NEB) and XhoI (NEB) restriction sites.

    Article Title: Systematic interrogation of β-catenin co-dependent genes facilitated by integrated genetic and proteomic approaches
    Article Snippet: To generate a pooled double sgRNA library, 115 sgRNAs were individually PCR amplified together with the S. Pyogenes tracer sequence and inserted into position 1 (AgeI/EcoRI restriction sites). .. Vectors containing an sgRNA in position 1 were pooled and digested with BsmBI (Thermo Scientific) and a pool of the same 115 sgRNAs was ligated into the BsmBI cloning sites (exactly as described above for single sgRNA pooled library).

    Article Title: A landscape of therapeutic cooperativity in KRAS mutant cancers reveals principles for controlling tumor evolution
    Article Snippet: Our sub-genomic CRISPR library was cloned following previous methods ( ) using previously characterized sgRNAs ( ). .. Five unique sgRNA inserts along with 50 non-targeting controls were synthesized by Custom Array of the form: GGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC “X” denotes unique 20mer sgRNA sequence The oligo pool was diluted 1:10 in water and amplified using NEB Phusion Hotstart Flex enzyme master mix and the following primers: ArrayF: TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG ArrayR: ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC PCR Protocol: 98°C/30s, 18x[98°C/10s, 63°C/10s, 72°C/15s], 72°C/3min Inserts were cleaned with Axygen PCR clean-up beads (1.8x; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (Addgene ID# 52961) was digested with BsmBI (Thermo Fisher) for 2 hours at 37°C. .. The large ~ 13 kB band was gel extracted after size-selection on a 1% agarose gel.

    Binding Assay:

    Article Title: Competitive endogenous RNA is an intrinsic component of EMT regulatory circuits and modulates EMT
    Article Snippet: To generate desired vector for mutagenesis, the guide RNA vector was digested with BsmBI (Fermentas) and a pair of annealed oligos containing the sgRNA was cloned into the single guide RNA scaffold. .. To generate desired vector for mutagenesis, the guide RNA vector was digested with BsmBI (Fermentas) and a pair of annealed oligos containing the sgRNA was cloned into the single guide RNA scaffold.

    DNA Extraction:

    Article Title: A modular toolbox for gRNA–Cas9 genome engineering in plants based on the GoldenBraid standard
    Article Snippet: Paragraph title: Genomic DNA extraction and PCR/restriction enzyme assay ... The resulting PCR products were purified with the QIAquick PCR purification kit (QIAGEN) following the manufacturer’s protocol and restriction reactions were set up with 500 ng of purified DNA and the corresponding restriction enzyme; BsmBI (Fermentas) for XT1 and SpeI (Fermentas) for XT2.

    Mutagenesis:

    Article Title: Competitive endogenous RNA is an intrinsic component of EMT regulatory circuits and modulates EMT
    Article Snippet: A549 and MCF-10A were infected by the lentivirus containing LentiCas-Blast first (MOI = 0.3) and selected with 8 µg/ml Blasticidin for 5 days. .. To generate desired vector for mutagenesis, the guide RNA vector was digested with BsmBI (Fermentas) and a pair of annealed oligos containing the sgRNA was cloned into the single guide RNA scaffold. .. The A549-Cas9 cells and MCF10A-Cas9 cells were infected with the lentivirus contained guide RNA (MOI = 0.3) and selected with 1ug/ml Puromycin for 3 days.

    Article Title: Optimization of a novel biophysical model using large scale in vivo antisense hybridization data displays improved prediction capabilities of structurally accessible RNA regions
    Article Snippet: All asRNA sequences within the plasmid , besides 11 asRNAs corresponding to regions within the gI intron that were previously synthesized and published , were either ordered from GenScript Inc., synthesized by a site-directed mutagenesis approach (QuikChange II Site-Directed Mutagenesis Kit, Agilent Technologies) by modifying a previously synthesized asRNA, synthesized via Gibson Assembly ( ) or synthesized by using a high throughput Golden Gate approach as described in ( ) on our iRS3 -GG plasmid. .. For the Golden Gate approach, complementary primers (ordered from IDT) containing each asRNA sequence with the proper flanking overhangs were annealed and cloned after digestion with BsmbI (Thermo Scientific) to replace the p-chlorophenylalanine negative selection cassette.

    Article Title: Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria
    Article Snippet: We performed the Golden Gate assembly reaction with 1,000 ng of part4 plasmid (pHLL214 or pHLL215) and 40 ng of the barcode PCR product using BsmBI (Esp3I from Thermo Fisher) and T4 DNA ligase under the following cycling conditions: 10 cycles, with 1 cycle consisting of 5 min at 37°C and 10 min at 16°C, followed by a final digestion step at 37°C for 30 min. We then purified the Golden Gate assembly reaction with the DNA Clean & Concentrator kit (Zymo Research) and digested the DNA overnight with BsmBI. .. The part2 (antibiotic marker upstream region), part3 (open reading frame [ORF] of the antibiotic selection marker), and part5 (transposase upstream region and 5′ end of the transposase) portions were mostly cloned into the universal holding vector pJW52, amplified with oligonucleotides ofeba134 and ofeba137 ( ).

    Isolation:

    Article Title: lincRNA-Cox2 regulates NLRP3 inflammasome and autophagy mediated neuroinflammation
    Article Snippet: The sgRNAs included a 5-bp overhang for the forward (CACCG) and the reverse (CAAA) oligos to enable cloning into the BsmBI (Thermo Scientific, Waltham, MA) site of the LentiCRISPR V2. .. The sgRNAs included a 5-bp overhang for the forward (CACCG) and the reverse (CAAA) oligos to enable cloning into the BsmBI (Thermo Scientific, Waltham, MA) site of the LentiCRISPR V2.

    Purification:

    Article Title: CRISPR/Cas9-Mediated Scanning for Regulatory Elements Required for HPRT1 Expression via Thousands of Large, Programmed Genomic Deletions
    Article Snippet: Contrastingly, the library of individual gRNAs included all of the spacers targeting the same region, excluding those predicted to have 2,000 or more off-targets or to have off-targets with four or fewer mismatches within the targeted HPRT1 region. .. This library cloning method was developed in parallel with similar recently published methods and was modified from the GeCKO individual-gRNA cloning scheme., First, the lentiGuide-Puro backbone (Addgene 52963) was digested with BsmBI (FastDigest Esp3I, Thermo Fisher Scientific) and gel purified. .. The paired spacers (flanked with lentiGuide-Puro overlap sequences) were synthesized twice on a microarray (CustomArray) such that each pairing was represented in both possible orders ( ).

    Article Title: A modular toolbox for gRNA–Cas9 genome engineering in plants based on the GoldenBraid standard
    Article Snippet: DNA amplicons covering the XT1 and XT2 target sites were obtained by PCR of genomic DNA using the Phusion High-Fidelity DNA polymerase (Thermo Scientific) and two pairs of gene specific primers: XT1_F/XT1_R for XT1 and XT2_F/XT2 _R for XT2 (Additional file : Table S1). .. The resulting PCR products were purified with the QIAquick PCR purification kit (QIAGEN) following the manufacturer’s protocol and restriction reactions were set up with 500 ng of purified DNA and the corresponding restriction enzyme; BsmBI (Fermentas) for XT1 and SpeI (Fermentas) for XT2. .. Band intensities were estimated using the ‘Benchling Gels’ ( https://benchling.com ) tool.

    Article Title: Influenza NA and PB1 Gene Segments Interact during the Formation of Viral Progeny: Localization of the Binding Region within the PB1 Gene
    Article Snippet: DNA corresponding to the chimeric PB1 or Udorn NA genes was inserted between the BsmBI (ThermoFisher Scientific, Illkirch, France) sites of a pUC2000 vector after excision from the corresponding pHW2000 plasmid. .. DNA corresponding to the chimeric PB1 or Udorn NA genes was inserted between the BsmBI (ThermoFisher Scientific, Illkirch, France) sites of a pUC2000 vector after excision from the corresponding pHW2000 plasmid.

    Article Title: Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria
    Article Snippet: The barcode PCR products were purified with the DNA Clean & Concentrator kit (Zymo Research) and included in a Golden Gate assembly reaction with either pHLL214 or pHLL215. .. We performed the Golden Gate assembly reaction with 1,000 ng of part4 plasmid (pHLL214 or pHLL215) and 40 ng of the barcode PCR product using BsmBI (Esp3I from Thermo Fisher) and T4 DNA ligase under the following cycling conditions: 10 cycles, with 1 cycle consisting of 5 min at 37°C and 10 min at 16°C, followed by a final digestion step at 37°C for 30 min. We then purified the Golden Gate assembly reaction with the DNA Clean & Concentrator kit (Zymo Research) and digested the DNA overnight with BsmBI. .. We performed this additional digestion step to further eliminate nonbarcoded vectors.

    Article Title: CRISPR/Cas9 knockouts reveal genetic interaction between strain-transcendent erythrocyte determinants of Plasmodium falciparum invasion
    Article Snippet: Primer pairs were phosphorylated using T4 polynucleotide kinase (New England Biolabs) and ligated using Quick Ligase (New England Biolabs) into the lentiGuide-Puro vector , which had previously been digested with BsmBI (Thermo Fisher Scientific) and dephosphorylated with FastAP alkaline phosphatase (Thermo Fisher Scientific). .. Correctly integrated sgRNAs were confirmed by Sanger sequencing using the U6 promoter 5ʹ–GACTATCATATGCTTACCGT ( ).

    Article Title: Epithelial-to-Mesenchymal Transition of RPE Cells In Vitro Confers Increased β1,6-N-Glycosylation and Increased Susceptibility to Galectin-3 Binding
    Article Snippet: Briefly, for each gRNA expression vector, two oligonucleotides were created (as described in Sanjana et al. 2014 and protocols published at http://genome-engineering.org/gecko/ ), phosphorylated, annealed, and ligated with the BsmBI (Thermo Fisher) digested vector “lentiCRISPRv2” (addgene #52961) [ ]. .. Briefly, for each gRNA expression vector, two oligonucleotides were created (as described in Sanjana et al. 2014 and protocols published at http://genome-engineering.org/gecko/ ), phosphorylated, annealed, and ligated with the BsmBI (Thermo Fisher) digested vector “lentiCRISPRv2” (addgene #52961) [ ].

    Sequencing:

    Article Title: Competitive endogenous RNA is an intrinsic component of EMT regulatory circuits and modulates EMT
    Article Snippet: To generate desired vector for mutagenesis, the guide RNA vector was digested with BsmBI (Fermentas) and a pair of annealed oligos containing the sgRNA was cloned into the single guide RNA scaffold. .. To generate single clone for downstream experiments, the pool of infected cells were selected using the 96-well plate limiting dilution assay.

    Article Title: Optimization of a novel biophysical model using large scale in vivo antisense hybridization data displays improved prediction capabilities of structurally accessible RNA regions
    Article Snippet: All asRNA sequences within the plasmid , besides 11 asRNAs corresponding to regions within the gI intron that were previously synthesized and published , were either ordered from GenScript Inc., synthesized by a site-directed mutagenesis approach (QuikChange II Site-Directed Mutagenesis Kit, Agilent Technologies) by modifying a previously synthesized asRNA, synthesized via Gibson Assembly ( ) or synthesized by using a high throughput Golden Gate approach as described in ( ) on our iRS3 -GG plasmid. .. For the Golden Gate approach, complementary primers (ordered from IDT) containing each asRNA sequence with the proper flanking overhangs were annealed and cloned after digestion with BsmbI (Thermo Scientific) to replace the p-chlorophenylalanine negative selection cassette. .. To increase cloning throughput, two to five asRNAs were combined into a single reaction and later transformed into DH5α chemically-competent cells or NEB Turbo electro-competent cells and plated in Luria–Bertani (LB)/Agar media supplemented with p-cholorophenylalanine (p-Cl-Phe) to select for the clones harboring the appropriate asRNA.

    Article Title: Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria
    Article Snippet: We performed the Golden Gate assembly reaction with 1,000 ng of part4 plasmid (pHLL214 or pHLL215) and 40 ng of the barcode PCR product using BsmBI (Esp3I from Thermo Fisher) and T4 DNA ligase under the following cycling conditions: 10 cycles, with 1 cycle consisting of 5 min at 37°C and 10 min at 16°C, followed by a final digestion step at 37°C for 30 min. We then purified the Golden Gate assembly reaction with the DNA Clean & Concentrator kit (Zymo Research) and digested the DNA overnight with BsmBI. .. The part2 (antibiotic marker upstream region), part3 (open reading frame [ORF] of the antibiotic selection marker), and part5 (transposase upstream region and 5′ end of the transposase) portions were mostly cloned into the universal holding vector pJW52, amplified with oligonucleotides ofeba134 and ofeba137 ( ).

    Article Title: Dysregulation of mitochondrial dynamics proteins are a targetable feature of human tumors
    Article Snippet: CRISPR constructs were cloned following previous methods using previously characterized sgRNAs . sgRNA inserts were synthesized by IDT of the form: GGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC "X" denotes unique 20mer sgRNA sequence (see “20-mer sequences” below). .. Inserts were cleaned with Axygen PCR clean-up beads (1.8×; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (hygro) was digested with BsmBI (Thermo Fisher) for 2 h at 37 °C.

    Article Title: A multiplatform approach identifies miR-152-3p as a common epigenetically regulated onco-suppressor in prostate cancer targeting TMEM97
    Article Snippet: Annealed oligos were diluted at 1:100 in sterile water and ligated to plasmid vector lentiCRISPRv2 (gift from Feng Zhang (Addgene plasmid #52961)) using the following parameters: 50 ng BsmBI (Fermentas) digested plasmid, 1 μl diluted oligo duplex, 1× Ligation Buffer (Roche), and 5 U T4 DNA Ligase (Roche) incubated at RT/30 min. .. After colony selection, they grew in liquid LB and plasmid DNA was harvested using PureLink HiPure Plasmid Maxiprep Kit (Invitrogen, Carlsbad, CA, USA).

    Article Title: Systematic interrogation of β-catenin co-dependent genes facilitated by integrated genetic and proteomic approaches
    Article Snippet: To generate a pooled double sgRNA library, 115 sgRNAs were individually PCR amplified together with the S. Pyogenes tracer sequence and inserted into position 1 (AgeI/EcoRI restriction sites). .. Vectors containing an sgRNA in position 1 were pooled and digested with BsmBI (Thermo Scientific) and a pool of the same 115 sgRNAs was ligated into the BsmBI cloning sites (exactly as described above for single sgRNA pooled library).

    Article Title: CRISPR/Cas9 knockouts reveal genetic interaction between strain-transcendent erythrocyte determinants of Plasmodium falciparum invasion
    Article Snippet: Primer pairs were phosphorylated using T4 polynucleotide kinase (New England Biolabs) and ligated using Quick Ligase (New England Biolabs) into the lentiGuide-Puro vector , which had previously been digested with BsmBI (Thermo Fisher Scientific) and dephosphorylated with FastAP alkaline phosphatase (Thermo Fisher Scientific). .. Ligated plasmids were transformed into Stbl3 bacteria (Thermo Fisher Scientific) and were selected with 100 μg/mL carbenicillin on LB agar plates.

    Article Title: DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs
    Article Snippet: These were synthesised as DNA oligonucleotides (gBlock, IDT) of 165 bp at a concentration of 20 ng/ul, and cloned using Gibson assembly method [ ] into lenti-guide puro plasmid (Addgene ref. 52963) [ ] digested with BsmBI (Thermo Fisher). .. The resulting intermediate plasmid, that contained additional internal BsmBI sites, was digested with BsmBI and dephosphorylated with alkaline phosphatase (Thermo Fisher EF0654).

    Article Title: Epithelial-to-Mesenchymal Transition of RPE Cells In Vitro Confers Increased β1,6-N-Glycosylation and Increased Susceptibility to Galectin-3 Binding
    Article Snippet: The sequence of the gRNAs (20 nucleotides in length) for Mgat5 was 5´-GTGGTGGATGGGCCATACGC-´3. .. Briefly, for each gRNA expression vector, two oligonucleotides were created (as described in Sanjana et al. 2014 and protocols published at http://genome-engineering.org/gecko/ ), phosphorylated, annealed, and ligated with the BsmBI (Thermo Fisher) digested vector “lentiCRISPRv2” (addgene #52961) [ ].

    Article Title: A landscape of therapeutic cooperativity in KRAS mutant cancers reveals principles for controlling tumor evolution
    Article Snippet: Our sub-genomic CRISPR library was cloned following previous methods ( ) using previously characterized sgRNAs ( ). .. Five unique sgRNA inserts along with 50 non-targeting controls were synthesized by Custom Array of the form: GGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC “X” denotes unique 20mer sgRNA sequence The oligo pool was diluted 1:10 in water and amplified using NEB Phusion Hotstart Flex enzyme master mix and the following primers: ArrayF: TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG ArrayR: ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC PCR Protocol: 98°C/30s, 18x[98°C/10s, 63°C/10s, 72°C/15s], 72°C/3min Inserts were cleaned with Axygen PCR clean-up beads (1.8x; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (Addgene ID# 52961) was digested with BsmBI (Thermo Fisher) for 2 hours at 37°C. .. The large ~ 13 kB band was gel extracted after size-selection on a 1% agarose gel.

    Selection:

    Article Title: Systems analysis identifies melanoma-enriched pro-oncogenic networks controlled by the RNA binding protein CELF1
    Article Snippet: Downregulation efficacy was determined after puromycin selection (1 µg/mL) by protein immunoblotting or RT-qPCR. .. For CRISPR/Cas9 gRNA cloning, the forward/reverse pair of oligos were phosphorylated, annealed, and ligated with the BsmBI (Thermo Fisher) for cloning into lentiCRISPR v2 plasmid .

    Article Title: Optimization of a novel biophysical model using large scale in vivo antisense hybridization data displays improved prediction capabilities of structurally accessible RNA regions
    Article Snippet: All asRNA sequences within the plasmid , besides 11 asRNAs corresponding to regions within the gI intron that were previously synthesized and published , were either ordered from GenScript Inc., synthesized by a site-directed mutagenesis approach (QuikChange II Site-Directed Mutagenesis Kit, Agilent Technologies) by modifying a previously synthesized asRNA, synthesized via Gibson Assembly ( ) or synthesized by using a high throughput Golden Gate approach as described in ( ) on our iRS3 -GG plasmid. .. For the Golden Gate approach, complementary primers (ordered from IDT) containing each asRNA sequence with the proper flanking overhangs were annealed and cloned after digestion with BsmbI (Thermo Scientific) to replace the p-chlorophenylalanine negative selection cassette. .. To increase cloning throughput, two to five asRNAs were combined into a single reaction and later transformed into DH5α chemically-competent cells or NEB Turbo electro-competent cells and plated in Luria–Bertani (LB)/Agar media supplemented with p-cholorophenylalanine (p-Cl-Phe) to select for the clones harboring the appropriate asRNA.

    Article Title: Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria
    Article Snippet: We performed the Golden Gate assembly reaction with 1,000 ng of part4 plasmid (pHLL214 or pHLL215) and 40 ng of the barcode PCR product using BsmBI (Esp3I from Thermo Fisher) and T4 DNA ligase under the following cycling conditions: 10 cycles, with 1 cycle consisting of 5 min at 37°C and 10 min at 16°C, followed by a final digestion step at 37°C for 30 min. We then purified the Golden Gate assembly reaction with the DNA Clean & Concentrator kit (Zymo Research) and digested the DNA overnight with BsmBI. .. We then purified the DNA again with the DNA Clean & Concentrator kit (Zymo Research) and transformed the vector into E. coli .

    Article Title: A multiplatform approach identifies miR-152-3p as a common epigenetically regulated onco-suppressor in prostate cancer targeting TMEM97
    Article Snippet: Annealed oligos were diluted at 1:100 in sterile water and ligated to plasmid vector lentiCRISPRv2 (gift from Feng Zhang (Addgene plasmid #52961)) using the following parameters: 50 ng BsmBI (Fermentas) digested plasmid, 1 μl diluted oligo duplex, 1× Ligation Buffer (Roche), and 5 U T4 DNA Ligase (Roche) incubated at RT/30 min. .. Transformation mixtures were plated in LB-agar plates.

    Article Title: Systematic interrogation of β-catenin co-dependent genes facilitated by integrated genetic and proteomic approaches
    Article Snippet: Vectors containing an sgRNA in position 1 were pooled and digested with BsmBI (Thermo Scientific) and a pool of the same 115 sgRNAs was ligated into the BsmBI cloning sites (exactly as described above for single sgRNA pooled library). .. Lentiviral particles containing the combinatorial CRISPR-Cas9 library were transduced (3 replicates/cell line) into 4 Cas9-expressing cell lines (DLD1, HCT116, HT29 and RKO).

    Construct:

    Article Title: lincRNA-Cox2 regulates NLRP3 inflammasome and autophagy mediated neuroinflammation
    Article Snippet: To establish a lentiviral CRISPR-Cas9-mediated knockout system, designed sgRNA sequences were constructed into the LentiCRISPR V2 (addgene). .. The sgRNAs included a 5-bp overhang for the forward (CACCG) and the reverse (CAAA) oligos to enable cloning into the BsmBI (Thermo Scientific, Waltham, MA) site of the LentiCRISPR V2.

    Article Title: Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria
    Article Snippet: To construct the two randomly DNA barcoded part4 vectors, pHLL214_NN1 and pHLL215_NN1, we first PCR amplified a short 46-bp oligonucleotide with 20 random base pairs in the middle (ofeba282) with oligonucleotides ofeba285 and ofeba286 using Phusion DNA polymerase. .. We performed the Golden Gate assembly reaction with 1,000 ng of part4 plasmid (pHLL214 or pHLL215) and 40 ng of the barcode PCR product using BsmBI (Esp3I from Thermo Fisher) and T4 DNA ligase under the following cycling conditions: 10 cycles, with 1 cycle consisting of 5 min at 37°C and 10 min at 16°C, followed by a final digestion step at 37°C for 30 min. We then purified the Golden Gate assembly reaction with the DNA Clean & Concentrator kit (Zymo Research) and digested the DNA overnight with BsmBI.

    Article Title: Dysregulation of mitochondrial dynamics proteins are a targetable feature of human tumors
    Article Snippet: Paragraph title: Cloning CRISPR constructs ... Inserts were cleaned with Axygen PCR clean-up beads (1.8×; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (hygro) was digested with BsmBI (Thermo Fisher) for 2 h at 37 °C.

    Cotransfection:

    Article Title: Epithelial-to-Mesenchymal Transition of RPE Cells In Vitro Confers Increased β1,6-N-Glycosylation and Increased Susceptibility to Galectin-3 Binding
    Article Snippet: Lentiviruses were created in HEK293T cells (Life Technologies) by co-transfection of three plasmids as described in [ , ]. .. Briefly, for each gRNA expression vector, two oligonucleotides were created (as described in Sanjana et al. 2014 and protocols published at http://genome-engineering.org/gecko/ ), phosphorylated, annealed, and ligated with the BsmBI (Thermo Fisher) digested vector “lentiCRISPRv2” (addgene #52961) [ ].

    CRISPR:

    Article Title: Systems analysis identifies melanoma-enriched pro-oncogenic networks controlled by the RNA binding protein CELF1
    Article Snippet: Downregulation efficacy was determined after puromycin selection (1 µg/mL) by protein immunoblotting or RT-qPCR. .. For CRISPR/Cas9 gRNA cloning, the forward/reverse pair of oligos were phosphorylated, annealed, and ligated with the BsmBI (Thermo Fisher) for cloning into lentiCRISPR v2 plasmid . .. Lentivirus was produced and cells were infected as described previously .

    Article Title: Competitive endogenous RNA is an intrinsic component of EMT regulatory circuits and modulates EMT
    Article Snippet: Paragraph title: Mutagenesis with CRISPR-Cas9 ... To generate desired vector for mutagenesis, the guide RNA vector was digested with BsmBI (Fermentas) and a pair of annealed oligos containing the sgRNA was cloned into the single guide RNA scaffold.

    Article Title: lincRNA-Cox2 regulates NLRP3 inflammasome and autophagy mediated neuroinflammation
    Article Snippet: To establish a lentiviral CRISPR-Cas9-mediated knockout system, designed sgRNA sequences were constructed into the LentiCRISPR V2 (addgene). .. The sgRNAs included a 5-bp overhang for the forward (CACCG) and the reverse (CAAA) oligos to enable cloning into the BsmBI (Thermo Scientific, Waltham, MA) site of the LentiCRISPR V2.

    Article Title: Dysregulation of mitochondrial dynamics proteins are a targetable feature of human tumors
    Article Snippet: Paragraph title: Cloning CRISPR constructs ... Inserts were cleaned with Axygen PCR clean-up beads (1.8×; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (hygro) was digested with BsmBI (Thermo Fisher) for 2 h at 37 °C.

    Article Title: Systematic interrogation of β-catenin co-dependent genes facilitated by integrated genetic and proteomic approaches
    Article Snippet: Paragraph title: Combinatorial CRISPR-Cas9 loss of function screen ... Vectors containing an sgRNA in position 1 were pooled and digested with BsmBI (Thermo Scientific) and a pool of the same 115 sgRNAs was ligated into the BsmBI cloning sites (exactly as described above for single sgRNA pooled library).

    Article Title: Epithelial-to-Mesenchymal Transition of RPE Cells In Vitro Confers Increased β1,6-N-Glycosylation and Increased Susceptibility to Galectin-3 Binding
    Article Snippet: To select an appropriate gRNA the CRISPR design tool was used ( http://crispr.mit.edu/ ) [ ]. .. Briefly, for each gRNA expression vector, two oligonucleotides were created (as described in Sanjana et al. 2014 and protocols published at http://genome-engineering.org/gecko/ ), phosphorylated, annealed, and ligated with the BsmBI (Thermo Fisher) digested vector “lentiCRISPRv2” (addgene #52961) [ ].

    Article Title: A landscape of therapeutic cooperativity in KRAS mutant cancers reveals principles for controlling tumor evolution
    Article Snippet: Paragraph title: Cloning CRISPR drug-sensitivity library ... Five unique sgRNA inserts along with 50 non-targeting controls were synthesized by Custom Array of the form: GGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC “X” denotes unique 20mer sgRNA sequence The oligo pool was diluted 1:10 in water and amplified using NEB Phusion Hotstart Flex enzyme master mix and the following primers: ArrayF: TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG ArrayR: ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC PCR Protocol: 98°C/30s, 18x[98°C/10s, 63°C/10s, 72°C/15s], 72°C/3min Inserts were cleaned with Axygen PCR clean-up beads (1.8x; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (Addgene ID# 52961) was digested with BsmBI (Thermo Fisher) for 2 hours at 37°C.

    Plasmid Preparation:

    Article Title: Systems analysis identifies melanoma-enriched pro-oncogenic networks controlled by the RNA binding protein CELF1
    Article Snippet: Downregulation efficacy was determined after puromycin selection (1 µg/mL) by protein immunoblotting or RT-qPCR. .. For CRISPR/Cas9 gRNA cloning, the forward/reverse pair of oligos were phosphorylated, annealed, and ligated with the BsmBI (Thermo Fisher) for cloning into lentiCRISPR v2 plasmid . .. Lentivirus was produced and cells were infected as described previously .

    Article Title: Influenza NA and PB1 Gene Segments Interact during the Formation of Viral Progeny: Localization of the Binding Region within the PB1 Gene
    Article Snippet: Reaction conditions, primers (Geneworks, Thebarton, SA, Australia) and TaqMan (Integrated DNA Technologies, Baulkham Hills, NSW, Australia) probe sequences are available on request. .. DNA corresponding to the chimeric PB1 or Udorn NA genes was inserted between the BsmBI (ThermoFisher Scientific, Illkirch, France) sites of a pUC2000 vector after excision from the corresponding pHW2000 plasmid. .. These vectors were obtained as previously described and contain a T7 promoter, the cloning cassette of pHW2000 containing two BsmBI sites and unique Bsh1236I or Ecl36II restriction sites between the PstI and EcoRI sites [ ].

    Article Title: Competitive endogenous RNA is an intrinsic component of EMT regulatory circuits and modulates EMT
    Article Snippet: A549 and MCF-10A were infected by the lentivirus containing LentiCas-Blast first (MOI = 0.3) and selected with 8 µg/ml Blasticidin for 5 days. .. To generate desired vector for mutagenesis, the guide RNA vector was digested with BsmBI (Fermentas) and a pair of annealed oligos containing the sgRNA was cloned into the single guide RNA scaffold. .. The A549-Cas9 cells and MCF10A-Cas9 cells were infected with the lentivirus contained guide RNA (MOI = 0.3) and selected with 1ug/ml Puromycin for 3 days.

    Article Title: Optimization of a novel biophysical model using large scale in vivo antisense hybridization data displays improved prediction capabilities of structurally accessible RNA regions
    Article Snippet: All asRNA sequences within the plasmid , besides 11 asRNAs corresponding to regions within the gI intron that were previously synthesized and published , were either ordered from GenScript Inc., synthesized by a site-directed mutagenesis approach (QuikChange II Site-Directed Mutagenesis Kit, Agilent Technologies) by modifying a previously synthesized asRNA, synthesized via Gibson Assembly ( ) or synthesized by using a high throughput Golden Gate approach as described in ( ) on our iRS3 -GG plasmid. .. For the Golden Gate approach, complementary primers (ordered from IDT) containing each asRNA sequence with the proper flanking overhangs were annealed and cloned after digestion with BsmbI (Thermo Scientific) to replace the p-chlorophenylalanine negative selection cassette.

    Article Title: Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria
    Article Snippet: The barcode PCR products were purified with the DNA Clean & Concentrator kit (Zymo Research) and included in a Golden Gate assembly reaction with either pHLL214 or pHLL215. .. We performed the Golden Gate assembly reaction with 1,000 ng of part4 plasmid (pHLL214 or pHLL215) and 40 ng of the barcode PCR product using BsmBI (Esp3I from Thermo Fisher) and T4 DNA ligase under the following cycling conditions: 10 cycles, with 1 cycle consisting of 5 min at 37°C and 10 min at 16°C, followed by a final digestion step at 37°C for 30 min. We then purified the Golden Gate assembly reaction with the DNA Clean & Concentrator kit (Zymo Research) and digested the DNA overnight with BsmBI. .. We performed this additional digestion step to further eliminate nonbarcoded vectors.

    Article Title: A CRISPR Resource for Individual, Combinatorial, or Multiplexed Gene Knockout
    Article Snippet: Primers containing these sequences were ordered from IDT ( ) and used to amplify a hU6-EM7-ZeocinR -cU6 cassette (pCRoatan-dualPromoter). .. The amplicon was digested with BbsI (NEB) and ligated into a 3rd generation lentiviral vector (pCRoatan-dualSgRNA) previously digested with BsmBI (ThermoFischer). .. Combinatorial sgRNA libraries were built using DNA chips (CustomArray, Inc.) containing 10K molecules harboring a barcode and two flanking sgRNA sequences ( ).

    Article Title: Dysregulation of mitochondrial dynamics proteins are a targetable feature of human tumors
    Article Snippet: Inserts were cleaned with Axygen PCR clean-up beads (1.8×; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (hygro) was digested with BsmBI (Thermo Fisher) for 2 h at 37 °C. .. After Gibson assembly, 1 μL of the reaction was transformed into electrocompetent Lucigen cells and spread on LB-ampicillin plates and incubated overnight.

    Article Title: A CRISPR Resource for Individual, Combinatorial, or Multiplexed Gene Knockout
    Article Snippet: Subsequently, the hU6 and cU6 promoters driving the sgRNAs were added to the vector. .. The hU6 promoter was amplified from lentiCrisprv2 (Addgene #52961) by PCR (FP: AGTACCGTCTCTGGTGTTTCGTCCTTTCCACAAG, RP: GTACCTACGCGTGAGGGCCTATTTCCCATGATTC), and cloned by ligation using the BsmBI (ThermoFischer) and MluI (NEB) restriction sites.

    Article Title: A multiplatform approach identifies miR-152-3p as a common epigenetically regulated onco-suppressor in prostate cancer targeting TMEM97
    Article Snippet: Complementary single-stranded oligos (Additional file : Table S1) were phosphorylated and annealed by combining 100 μM oligos, 1× T4 PNK Buffer, 1 mM ATP, 5 U T4 PNK and incubating the reaction at 37 °C/30 min, 95 °C/5 min followed by a ramp down to 25 °C at 5 °C/min. .. Annealed oligos were diluted at 1:100 in sterile water and ligated to plasmid vector lentiCRISPRv2 (gift from Feng Zhang (Addgene plasmid #52961)) using the following parameters: 50 ng BsmBI (Fermentas) digested plasmid, 1 μl diluted oligo duplex, 1× Ligation Buffer (Roche), and 5 U T4 DNA Ligase (Roche) incubated at RT/30 min. .. The ligation reactions were used to transform highly competent Escherichia coli cells according to the manufacturer’s protocol [ ].

    Article Title: CRISPR/Cas9 knockouts reveal genetic interaction between strain-transcendent erythrocyte determinants of Plasmodium falciparum invasion
    Article Snippet: Primers for the top three hits for BSG and CD44 were synthesized (Integrated DNA Technologies): BSG-1-F 5ʹ–CACCGGCGAGGAATAGGAATCATGG; BSG-1-RC 5ʹ–AAACCCATGATTCCTATTCCTCGCC; BSG-2-F 5ʹ–CACCGTCTTCATCTACGAGAAGCGC; BSG-2-RC 5ʹ–AAACGCGCTTCTCGTAGATGAAGAC; BSG-3-F 5ʹ–CACCGCGTTGCACCGGTACTGGCCG; BSG-3-RC 5ʹ–AAACCGGCCAGTACCGGTGCAACGC; CD44-1-F 5′–CACCGCGTGGAATACACCTGCAAAG; CD44-1-RC 5′–AAACCTTTGCAGGTGTATTCCACGC; CD44-2-F 5′–CACCGACTGATGATGACGTGAGCAG; CD44-2-RC 5′–AAACCTGCTCACGTCATCATCAGTC; CD44-3-F 5′–CACCGCTGTGCAGCAAACAACACAG; and CD44-3-RC 5′–AAACCTGTGTTGTTTGCTGCACAGC. .. Primer pairs were phosphorylated using T4 polynucleotide kinase (New England Biolabs) and ligated using Quick Ligase (New England Biolabs) into the lentiGuide-Puro vector , which had previously been digested with BsmBI (Thermo Fisher Scientific) and dephosphorylated with FastAP alkaline phosphatase (Thermo Fisher Scientific). .. Ligated plasmids were transformed into Stbl3 bacteria (Thermo Fisher Scientific) and were selected with 100 μg/mL carbenicillin on LB agar plates.

    Article Title: DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs
    Article Snippet: Insert-1 sequences were designed by combining the two designed target sequences with simple design template (available as Additional file : File S1). .. These were synthesised as DNA oligonucleotides (gBlock, IDT) of 165 bp at a concentration of 20 ng/ul, and cloned using Gibson assembly method [ ] into lenti-guide puro plasmid (Addgene ref. 52963) [ ] digested with BsmBI (Thermo Fisher). .. We mixed 20 ng of Insert-1 with 100–150 ng of BsmBI-digested plasmid in 10 ul volume, with 10 ul of 2x Gibson mix (note that this step could also be carried out using commercially-available Gibson assembly reagents).

    Article Title: Epithelial-to-Mesenchymal Transition of RPE Cells In Vitro Confers Increased β1,6-N-Glycosylation and Increased Susceptibility to Galectin-3 Binding
    Article Snippet: Lentiviruses were created in HEK293T cells (Life Technologies) by co-transfection of three plasmids as described in [ , ]. .. Briefly, for each gRNA expression vector, two oligonucleotides were created (as described in Sanjana et al. 2014 and protocols published at http://genome-engineering.org/gecko/ ), phosphorylated, annealed, and ligated with the BsmBI (Thermo Fisher) digested vector “lentiCRISPRv2” (addgene #52961) [ ]. .. For the production of each lentivirus, 80% confluent HEK293T cells were co-transfected in 8 ml OptiMEM (Life Technologies) with 5μg and 7.5μg of packaging plasmids pMD2.G (addgene #12259) and psPAX2 (addgene #12260), respectively, and 10μg of the transfer plasmid (see above), using 100 μl Plus Reagent™ (Life Technologies) and 50μl Lipofectamine 2000™ (Life Technologies).

    Article Title: Effect of transcription terminator usage on the establishment of transgene transcriptional gene silencing
    Article Snippet: BsmBI (ThermoFisher), BsaI and BtgZI (New England BioLabs) and T4 Ligase (Promega) were used. ffLUC and FUS3short were domesticated into pUPD vectors using BsmBI enzyme. p35S, ffLUC, FUS3short and Thsp or T35S in pUPD vectors were assembled into pDBG_2alpha2. .. BsmBI (ThermoFisher), BsaI and BtgZI (New England BioLabs) and T4 Ligase (Promega) were used. ffLUC and FUS3short were domesticated into pUPD vectors using BsmBI enzyme. p35S, ffLUC, FUS3short and Thsp or T35S in pUPD vectors were assembled into pDBG_2alpha2.

    Article Title: A landscape of therapeutic cooperativity in KRAS mutant cancers reveals principles for controlling tumor evolution
    Article Snippet: Five unique sgRNA inserts along with 50 non-targeting controls were synthesized by Custom Array of the form: GGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC “X” denotes unique 20mer sgRNA sequence The oligo pool was diluted 1:10 in water and amplified using NEB Phusion Hotstart Flex enzyme master mix and the following primers: ArrayF: TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG ArrayR: ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC PCR Protocol: 98°C/30s, 18x[98°C/10s, 63°C/10s, 72°C/15s], 72°C/3min Inserts were cleaned with Axygen PCR clean-up beads (1.8x; Fisher Scientific) and resuspended in molecular biology grade water. lentiCRISPRv2 (Addgene ID# 52961) was digested with BsmBI (Thermo Fisher) for 2 hours at 37°C. .. After Gibson assembly, 1μL of the reaction was transformed into electrocompetent Lucigen cells and spread on LB-ampicillin plates and incubated overnight.

    shRNA:

    Article Title: Systems analysis identifies melanoma-enriched pro-oncogenic networks controlled by the RNA binding protein CELF1
    Article Snippet: Virus production for shRNA and gRNA infections were performed in 293FT cells by classical calcium phosphate precipitation . .. For CRISPR/Cas9 gRNA cloning, the forward/reverse pair of oligos were phosphorylated, annealed, and ligated with the BsmBI (Thermo Fisher) for cloning into lentiCRISPR v2 plasmid .

    In Vitro:

    Article Title: Influenza NA and PB1 Gene Segments Interact during the Formation of Viral Progeny: Localization of the Binding Region within the PB1 Gene
    Article Snippet: Paragraph title: 2.8. In Vitro Transcription and Electrophoretic Mobility Assay ... DNA corresponding to the chimeric PB1 or Udorn NA genes was inserted between the BsmBI (ThermoFisher Scientific, Illkirch, France) sites of a pUC2000 vector after excision from the corresponding pHW2000 plasmid.

    Enzymatic Assay:

    Article Title: A modular toolbox for gRNA–Cas9 genome engineering in plants based on the GoldenBraid standard
    Article Snippet: Paragraph title: Genomic DNA extraction and PCR/restriction enzyme assay ... The resulting PCR products were purified with the QIAquick PCR purification kit (QIAGEN) following the manufacturer’s protocol and restriction reactions were set up with 500 ng of purified DNA and the corresponding restriction enzyme; BsmBI (Fermentas) for XT1 and SpeI (Fermentas) for XT2.

    Knock-Out:

    Article Title: Competitive endogenous RNA is an intrinsic component of EMT regulatory circuits and modulates EMT
    Article Snippet: To generate desired vector for mutagenesis, the guide RNA vector was digested with BsmBI (Fermentas) and a pair of annealed oligos containing the sgRNA was cloned into the single guide RNA scaffold. .. To generate single clone for downstream experiments, the pool of infected cells were selected using the 96-well plate limiting dilution assay.

    Article Title: lincRNA-Cox2 regulates NLRP3 inflammasome and autophagy mediated neuroinflammation
    Article Snippet: To establish a lentiviral CRISPR-Cas9-mediated knockout system, designed sgRNA sequences were constructed into the LentiCRISPR V2 (addgene). .. The sgRNAs included a 5-bp overhang for the forward (CACCG) and the reverse (CAAA) oligos to enable cloning into the BsmBI (Thermo Scientific, Waltham, MA) site of the LentiCRISPR V2.

    Concentration Assay:

    Article Title: DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs
    Article Snippet: Insert-1 sequences were designed by combining the two designed target sequences with simple design template (available as Additional file : File S1). .. These were synthesised as DNA oligonucleotides (gBlock, IDT) of 165 bp at a concentration of 20 ng/ul, and cloned using Gibson assembly method [ ] into lenti-guide puro plasmid (Addgene ref. 52963) [ ] digested with BsmBI (Thermo Fisher). .. We mixed 20 ng of Insert-1 with 100–150 ng of BsmBI-digested plasmid in 10 ul volume, with 10 ul of 2x Gibson mix (note that this step could also be carried out using commercially-available Gibson assembly reagents).

    Limiting Dilution Assay:

    Article Title: Competitive endogenous RNA is an intrinsic component of EMT regulatory circuits and modulates EMT
    Article Snippet: To generate desired vector for mutagenesis, the guide RNA vector was digested with BsmBI (Fermentas) and a pair of annealed oligos containing the sgRNA was cloned into the single guide RNA scaffold. .. The A549-Cas9 cells and MCF10A-Cas9 cells were infected with the lentivirus contained guide RNA (MOI = 0.3) and selected with 1ug/ml Puromycin for 3 days.

    Marker:

    Article Title: Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria
    Article Snippet: We performed the Golden Gate assembly reaction with 1,000 ng of part4 plasmid (pHLL214 or pHLL215) and 40 ng of the barcode PCR product using BsmBI (Esp3I from Thermo Fisher) and T4 DNA ligase under the following cycling conditions: 10 cycles, with 1 cycle consisting of 5 min at 37°C and 10 min at 16°C, followed by a final digestion step at 37°C for 30 min. We then purified the Golden Gate assembly reaction with the DNA Clean & Concentrator kit (Zymo Research) and digested the DNA overnight with BsmBI. .. We then purified the DNA again with the DNA Clean & Concentrator kit (Zymo Research) and transformed the vector into E. coli .

    Article Title: Epithelial-to-Mesenchymal Transition of RPE Cells In Vitro Confers Increased β1,6-N-Glycosylation and Increased Susceptibility to Galectin-3 Binding
    Article Snippet: This cassette codes for the guide RNA (gRNA—guides the nuclease to the respective gene), the nuclease Cas9, and a marker protein (puromycin resistance). .. Briefly, for each gRNA expression vector, two oligonucleotides were created (as described in Sanjana et al. 2014 and protocols published at http://genome-engineering.org/gecko/ ), phosphorylated, annealed, and ligated with the BsmBI (Thermo Fisher) digested vector “lentiCRISPRv2” (addgene #52961) [ ].

    Variant Assay:

    Article Title: Systematic interrogation of β-catenin co-dependent genes facilitated by integrated genetic and proteomic approaches
    Article Snippet: To minimize recombination events between repetitive sequences, we inserted a variant U6 promoter downstream of the U6 promoter in pXRP003 ( ). .. Vectors containing an sgRNA in position 1 were pooled and digested with BsmBI (Thermo Scientific) and a pool of the same 115 sgRNAs was ligated into the BsmBI cloning sites (exactly as described above for single sgRNA pooled library).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Thermo Fisher bsmbi digestion enzyme
    CRISPR vector design for knockout of A 2A R in K562 Cells. ( a ) Map of human chromosomes, with chromosome 22q11.23 highlighted, showing the location of the A 2A R gene. Additional arrowheads indicate genes with similar regions to the A 2A R gene, including the A 2B R gene on chromosome 17. ( b ) Left, guide-RNAs found for the A 2A R gene. Right, guide sequence #1 was selected for insertion into the <t>plentiCRISPR</t> loxP vector plasmid DNA. <t>BsmBI</t> cut sites were added to gRNA #1 to facilitate insertion. ( c ) Top, Cas9 cut site in the A 2A R gene. Bottom, map of the plentiCRISPR construct. ( d ) T7 E1 INDEL assay for CRISPR targeting efficiency. Lanes 1 and 5, universal marker. Lane 2, PCR product. Lanes 3 and 4, PCR product after denaturing and renaturing, without (3) and with (4) T7 EI enzyme. Arrowheads indicate T7 E1 cutting.
    Bsmbi Digestion Enzyme, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsmbi digestion enzyme/product/Thermo Fisher
    Average 85 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    bsmbi digestion enzyme - by Bioz Stars, 2019-10
    85/100 stars
      Buy from Supplier

    Image Search Results


    CRISPR vector design for knockout of A 2A R in K562 Cells. ( a ) Map of human chromosomes, with chromosome 22q11.23 highlighted, showing the location of the A 2A R gene. Additional arrowheads indicate genes with similar regions to the A 2A R gene, including the A 2B R gene on chromosome 17. ( b ) Left, guide-RNAs found for the A 2A R gene. Right, guide sequence #1 was selected for insertion into the plentiCRISPR loxP vector plasmid DNA. BsmBI cut sites were added to gRNA #1 to facilitate insertion. ( c ) Top, Cas9 cut site in the A 2A R gene. Bottom, map of the plentiCRISPR construct. ( d ) T7 E1 INDEL assay for CRISPR targeting efficiency. Lanes 1 and 5, universal marker. Lane 2, PCR product. Lanes 3 and 4, PCR product after denaturing and renaturing, without (3) and with (4) T7 EI enzyme. Arrowheads indicate T7 E1 cutting.

    Journal: Scientific Reports

    Article Title: A Novel Method for Screening Adenosine Receptor Specific Agonists for Use in Adenosine Drug Development

    doi: 10.1038/srep44816

    Figure Lengend Snippet: CRISPR vector design for knockout of A 2A R in K562 Cells. ( a ) Map of human chromosomes, with chromosome 22q11.23 highlighted, showing the location of the A 2A R gene. Additional arrowheads indicate genes with similar regions to the A 2A R gene, including the A 2B R gene on chromosome 17. ( b ) Left, guide-RNAs found for the A 2A R gene. Right, guide sequence #1 was selected for insertion into the plentiCRISPR loxP vector plasmid DNA. BsmBI cut sites were added to gRNA #1 to facilitate insertion. ( c ) Top, Cas9 cut site in the A 2A R gene. Bottom, map of the plentiCRISPR construct. ( d ) T7 E1 INDEL assay for CRISPR targeting efficiency. Lanes 1 and 5, universal marker. Lane 2, PCR product. Lanes 3 and 4, PCR product after denaturing and renaturing, without (3) and with (4) T7 EI enzyme. Arrowheads indicate T7 E1 cutting.

    Article Snippet: Using the BsmBI digestion enzyme (Thermo Fisher Scientific), the plentiCRISPR loxP plasmid was linearized and eluted for insertion of the A2A R guide RNA (gRNA).

    Techniques: CRISPR, Plasmid Preparation, Knock-Out, Sequencing, Construct, Marker, Polymerase Chain Reaction

    Cpf1–Flip–Cre-inducible sequential mutagenesis by a single crRNA FlipArray. a Schematic of vectors used in the study. The Cpf1-Flip construct contains an EFS promoter driving expression of Cpf1 and puromycin resistance, and a U6 expression cassette containing two inverted BsmbI restriction sites, flanked by a lox66 sequence and an inverted lox71 sequence. After BsmbI digestion, a crRNA FlipArray is cloned in. The FlipArray inverts upon Cre recombination, thereby switching the crRNA that is expressed. b Schematic of experimental design. Cells were first infected with lentivirus containing EFS-Cpf1-puro; U6-FlipArray. After 7 days, cells were then infected with lentivirus containing EFS-Cre to induce inversion of the FlipArray. Prior to Cre recombination, only crNf1 is expressed; following Cre recombination, crPten becomes expressed. c Sequences of the FlipArray construct before and after Cre recombination. Red boxes denote mutants from wild-type loxP . Prior to Cre, single mutant lox66 and lox71 sites are present. After Cre recombination, a wild-type loxP site and a double mutant lox72 site are generated

    Journal: Nature Communications

    Article Title: Programmable sequential mutagenesis by inducible Cpf1 crRNA array inversion

    doi: 10.1038/s41467-018-04158-z

    Figure Lengend Snippet: Cpf1–Flip–Cre-inducible sequential mutagenesis by a single crRNA FlipArray. a Schematic of vectors used in the study. The Cpf1-Flip construct contains an EFS promoter driving expression of Cpf1 and puromycin resistance, and a U6 expression cassette containing two inverted BsmbI restriction sites, flanked by a lox66 sequence and an inverted lox71 sequence. After BsmbI digestion, a crRNA FlipArray is cloned in. The FlipArray inverts upon Cre recombination, thereby switching the crRNA that is expressed. b Schematic of experimental design. Cells were first infected with lentivirus containing EFS-Cpf1-puro; U6-FlipArray. After 7 days, cells were then infected with lentivirus containing EFS-Cre to induce inversion of the FlipArray. Prior to Cre recombination, only crNf1 is expressed; following Cre recombination, crPten becomes expressed. c Sequences of the FlipArray construct before and after Cre recombination. Red boxes denote mutants from wild-type loxP . Prior to Cre, single mutant lox66 and lox71 sites are present. After Cre recombination, a wild-type loxP site and a double mutant lox72 site are generated

    Article Snippet: After BsmbI digestion (FastDigest Esp3I, ThermoScientific) to linearize the U6 crRNA expression cassette, oligo cloning was performed to insert a lox66 sequence, a DR, two BsmbI sites, and an inverted lox71 .

    Techniques: Mutagenesis, Construct, Expressing, Sequencing, Clone Assay, Infection, Generated

    Design, Delivery, and Selection of ScanDel Library of CRISPR/Cas9-Programmed Deletions for Identification of Non-coding Regulatory Elements (A) gRNA pairs were designed from a filtered set of protospacers from all Cas9 PAM sequences (5′-NGGs) in the HPRT1 locus (see also <xref ref-type= Figure 2 A). Sites that were > 25 bp apart or > 50 bp away from exons were kept. For tile design, each remaining spacer was paired to two downstream spacers targeting sequence ∼1 and ∼2 kb away. This resulted in high redundancy of independently programmed, overlapping deletions across the locus (see also Figure 2 B). (B) All spacer pairs corresponding to programmed deletions were synthesized on a microarray (inset). Each spacer was also synthesized as a self-pair as a control for its independent effects. If a self-paired spacer scored positively in the screen, any pairs that used that spacer were removed from the analysis ( Figure S1 ). U6 and gRNA backbone sequence flanked the spacer pairs for Gibson-mediated cloning into lentiGuide-Puro, and mirrored BsmBI cut sites separated the spacer pairs to facilitate insertion of a second gRNA backbone and the H1 promoter. In the final library, each gRNA was expressed from its own PolIII promoter. This design facilitates PCR and direct sequencing-based quantification of gRNA-pair abundances. (C) The lentiviral library of gRNA pairs was cloned at a minimum of 20× coverage (in relation to library complexity) and transduced into HAP1 cells stably expressing Cas9 (via lentiCas9-Blast ) at low MOI. After a week of puromycin selection, the cells were sampled for measurement of the baseline abundance of each gRNA pair. The final cell population was harvested after a week of 6-thioguanine (6TG) treatment, which selected for cells that had lost HPRT enzymatic function. The phenotypic prevalence of each programmed deletion was quantified by PCR and deep sequencing of the gRNA pairs before and after selection. " width="100%" height="100%">

    Journal:

    Article Title: CRISPR/Cas9-Mediated Scanning for Regulatory Elements Required for HPRT1 Expression via Thousands of Large, Programmed Genomic Deletions

    doi: 10.1016/j.ajhg.2017.06.010

    Figure Lengend Snippet: Design, Delivery, and Selection of ScanDel Library of CRISPR/Cas9-Programmed Deletions for Identification of Non-coding Regulatory Elements (A) gRNA pairs were designed from a filtered set of protospacers from all Cas9 PAM sequences (5′-NGGs) in the HPRT1 locus (see also Figure 2 A). Sites that were > 25 bp apart or > 50 bp away from exons were kept. For tile design, each remaining spacer was paired to two downstream spacers targeting sequence ∼1 and ∼2 kb away. This resulted in high redundancy of independently programmed, overlapping deletions across the locus (see also Figure 2 B). (B) All spacer pairs corresponding to programmed deletions were synthesized on a microarray (inset). Each spacer was also synthesized as a self-pair as a control for its independent effects. If a self-paired spacer scored positively in the screen, any pairs that used that spacer were removed from the analysis ( Figure S1 ). U6 and gRNA backbone sequence flanked the spacer pairs for Gibson-mediated cloning into lentiGuide-Puro, and mirrored BsmBI cut sites separated the spacer pairs to facilitate insertion of a second gRNA backbone and the H1 promoter. In the final library, each gRNA was expressed from its own PolIII promoter. This design facilitates PCR and direct sequencing-based quantification of gRNA-pair abundances. (C) The lentiviral library of gRNA pairs was cloned at a minimum of 20× coverage (in relation to library complexity) and transduced into HAP1 cells stably expressing Cas9 (via lentiCas9-Blast ) at low MOI. After a week of puromycin selection, the cells were sampled for measurement of the baseline abundance of each gRNA pair. The final cell population was harvested after a week of 6-thioguanine (6TG) treatment, which selected for cells that had lost HPRT enzymatic function. The phenotypic prevalence of each programmed deletion was quantified by PCR and deep sequencing of the gRNA pairs before and after selection.

    Article Snippet: This library cloning method was developed in parallel with similar recently published methods and was modified from the GeCKO individual-gRNA cloning scheme., First, the lentiGuide-Puro backbone (Addgene 52963) was digested with BsmBI (FastDigest Esp3I, Thermo Fisher Scientific) and gel purified.

    Techniques: Selection, CRISPR, Sequencing, Synthesized, Microarray, Clone Assay, Polymerase Chain Reaction, Stable Transfection, Expressing