bsmbi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    New England Biolabs bsmbi
    Engineering mutations with the No See’m approach: ( A ) The position of interest, a glutamate (CAG) to alanine (GTC) mutation at position 13354-56, is targeted and mapped to the <t>MHV-E</t> fragment. The vector sequence, the wild-type fragment, and the mutated fragment are analyzed to determine which type IIs restriction enzymes do not cut any of them, and one of these is selected as the restriction site to add. In this case BbsI is selected. (B ) Primers are designed that add the mutation and the restriction site in proper orientation so that upon digestion the restriction site is eliminated and complementing sticky ends are produced. The BbsI cut sites are highlighted in gray. The mutated codon is bold and underlined. (C ) PCR is conducted using vector specific primers along with the newly designed primers that incorporate the mutation of interest to produce two amplicons. These are cloned and purified, and then digested with BbsI and <t>BsmBI</t> to produce a mutated MHV-E fragment that can then be incorporated into the full-length clone.
    Bsmbi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsmbi/product/New England Biolabs
    Average 93 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    bsmbi - by Bioz Stars, 2020-05
    93/100 stars

    Images

    1) Product Images from "Systematic Assembly and Genetic Manipulation of the Mouse Hepatitis Virus A59 Genome"

    Article Title: Systematic Assembly and Genetic Manipulation of the Mouse Hepatitis Virus A59 Genome

    Journal: SARS- and Other Coronaviruses

    doi: 10.1007/978-1-59745-181-9_21

    Engineering mutations with the No See’m approach: ( A ) The position of interest, a glutamate (CAG) to alanine (GTC) mutation at position 13354-56, is targeted and mapped to the MHV-E fragment. The vector sequence, the wild-type fragment, and the mutated fragment are analyzed to determine which type IIs restriction enzymes do not cut any of them, and one of these is selected as the restriction site to add. In this case BbsI is selected. (B ) Primers are designed that add the mutation and the restriction site in proper orientation so that upon digestion the restriction site is eliminated and complementing sticky ends are produced. The BbsI cut sites are highlighted in gray. The mutated codon is bold and underlined. (C ) PCR is conducted using vector specific primers along with the newly designed primers that incorporate the mutation of interest to produce two amplicons. These are cloned and purified, and then digested with BbsI and BsmBI to produce a mutated MHV-E fragment that can then be incorporated into the full-length clone.
    Figure Legend Snippet: Engineering mutations with the No See’m approach: ( A ) The position of interest, a glutamate (CAG) to alanine (GTC) mutation at position 13354-56, is targeted and mapped to the MHV-E fragment. The vector sequence, the wild-type fragment, and the mutated fragment are analyzed to determine which type IIs restriction enzymes do not cut any of them, and one of these is selected as the restriction site to add. In this case BbsI is selected. (B ) Primers are designed that add the mutation and the restriction site in proper orientation so that upon digestion the restriction site is eliminated and complementing sticky ends are produced. The BbsI cut sites are highlighted in gray. The mutated codon is bold and underlined. (C ) PCR is conducted using vector specific primers along with the newly designed primers that incorporate the mutation of interest to produce two amplicons. These are cloned and purified, and then digested with BbsI and BsmBI to produce a mutated MHV-E fragment that can then be incorporated into the full-length clone.

    Techniques Used: Mutagenesis, Plasmid Preparation, Sequencing, Produced, Polymerase Chain Reaction, Clone Assay, Purification

    2) Product Images from "Systematic Assembly and Genetic Manipulation of the Mouse Hepatitis Virus A59 Genome"

    Article Title: Systematic Assembly and Genetic Manipulation of the Mouse Hepatitis Virus A59 Genome

    Journal: SARS- and Other Coronaviruses

    doi: 10.1007/978-1-59745-181-9_21

    Engineering mutations with the No See’m approach: ( A ) The position of interest, a glutamate (CAG) to alanine (GTC) mutation at position 13354-56, is targeted and mapped to the MHV-E fragment. The vector sequence, the wild-type fragment, and the mutated fragment are analyzed to determine which type IIs restriction enzymes do not cut any of them, and one of these is selected as the restriction site to add. In this case BbsI is selected. (B ) Primers are designed that add the mutation and the restriction site in proper orientation so that upon digestion the restriction site is eliminated and complementing sticky ends are produced. The BbsI cut sites are highlighted in gray. The mutated codon is bold and underlined. (C ) PCR is conducted using vector specific primers along with the newly designed primers that incorporate the mutation of interest to produce two amplicons. These are cloned and purified, and then digested with BbsI and BsmBI to produce a mutated MHV-E fragment that can then be incorporated into the full-length clone.
    Figure Legend Snippet: Engineering mutations with the No See’m approach: ( A ) The position of interest, a glutamate (CAG) to alanine (GTC) mutation at position 13354-56, is targeted and mapped to the MHV-E fragment. The vector sequence, the wild-type fragment, and the mutated fragment are analyzed to determine which type IIs restriction enzymes do not cut any of them, and one of these is selected as the restriction site to add. In this case BbsI is selected. (B ) Primers are designed that add the mutation and the restriction site in proper orientation so that upon digestion the restriction site is eliminated and complementing sticky ends are produced. The BbsI cut sites are highlighted in gray. The mutated codon is bold and underlined. (C ) PCR is conducted using vector specific primers along with the newly designed primers that incorporate the mutation of interest to produce two amplicons. These are cloned and purified, and then digested with BbsI and BsmBI to produce a mutated MHV-E fragment that can then be incorporated into the full-length clone.

    Techniques Used: Mutagenesis, Plasmid Preparation, Sequencing, Produced, Polymerase Chain Reaction, Clone Assay, Purification

    Related Articles

    Agarose Gel Electrophoresis:

    Article Title: Combinatorial CRISPR-Cas9 screens for de novo mapping of genetic interactions
    Article Snippet: .. Step II: Insertion of the gRNA scaffold and the mouse U6 promoter The step 1 library plasmids were digested by BsmBI (NEB) as per the following reaction at 55°C for 3 hours: Step 1 library 4 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL After digestion, the linearized plasmids were treated with 2 μL of Calf Intestinal Alkaline Phosphatase (NEB) at 37°C for 30 minutes; cut plasmids were gel-purified via 0.6% agarose gel electrophoresis and QIAquick gel extraction (QIAGEN). .. Concurrently, the step 2 inserts, synthesized commercially (Integrated DNA Technologies) and cloned into a TOPO vector, were digested by BsmBI (NEB) per the following reaction at 55 °C for 3 hours: Purified step 2 insert PCR product 0.8 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL Sequence of the step 2 insert, with left-gRNA scaffold ( underlined ) and mU6 promoters ( bold ): TATGAGGACGAATCTCCCGCTTATACGTCTCTGTTTCAGAGCTATGCTGGAAACTGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT GTACTGAGTCGCCCA GTCTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT GAGAGACGGTACAAGCACACGTTTGTCAAGACC Subsequently, the following ligation reaction was set up, involving overnight incubation at 16°C followed by heat inactivation at 65°C for 10 minutes: 10X T4 DNA Ligase Buffer 2 μL Step 1 library, digested 100 ng Step 2 insert, digested 100 ng T4 DNA Ligase (high concentration) 1 μL H2O Up to 20 μL 4 μL of the reaction was transformed into 100 μL of ElectroMAX Stbl4 Competent Cells (Invitrogen) according to the manufacturer’s protocol using an Eppendorf Electroporator.

    Ligation:

    Article Title: Estrogen receptor signaling is reprogrammed during breast tumorigenesis
    Article Snippet: .. Lentiviral gRNAs targeting GRHL2 were generated by ligation of targeted oligos into LentiCRISPR-v2 vector (Addgene) linearized with BsmBI using quick ligase (NEB). .. Lentivirus-enriched supernatant targeting GRHL2 was then generated from 293FT cells as previously described, and MCF-7 cells were infected at a low MOI (0.3–0.5) ( ).

    Generated:

    Article Title: Estrogen receptor signaling is reprogrammed during breast tumorigenesis
    Article Snippet: .. Lentiviral gRNAs targeting GRHL2 were generated by ligation of targeted oligos into LentiCRISPR-v2 vector (Addgene) linearized with BsmBI using quick ligase (NEB). .. Lentivirus-enriched supernatant targeting GRHL2 was then generated from 293FT cells as previously described, and MCF-7 cells were infected at a low MOI (0.3–0.5) ( ).

    Purification:

    Article Title: Combinatorial CRISPR-Cas9 screens for de novo mapping of genetic interactions
    Article Snippet: .. Subsequently, the gRNA-LGP vector (Addgene 52963) was digested by BsmBI (NEB) via the following reaction at 55°C for 3 hours: gRNA-LGP vector 4 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL After digestion, the vector was treated with 2 μL of Calf Intestinal Alkaline Phosphatase (NEB) at 37°C for 30 minutes, then purified by QIAquick PCR Purification Kit (Qiagen). .. To assemble the paired gRNAs into the vector, 10 Gibson assembly reactions were performed as follows: Linearized gRNA-LGP vector 200 ng Dual gRNA inserts 36 ng (molar ratio 1:10) 2× Gibson Assembly Master Mix (NEB) 10 μL H2O Up to 20 μL After incubation at 50°C for 1 hour, the product was purified by QIAquick PCR Purification Kit (QIAGEN) and then transformed into One Shot Stbl3 Chemically Competent E. coli (Invitrogen).

    Polymerase Chain Reaction:

    Article Title: Combinatorial CRISPR-Cas9 screens for de novo mapping of genetic interactions
    Article Snippet: .. Subsequently, the gRNA-LGP vector (Addgene 52963) was digested by BsmBI (NEB) via the following reaction at 55°C for 3 hours: gRNA-LGP vector 4 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL After digestion, the vector was treated with 2 μL of Calf Intestinal Alkaline Phosphatase (NEB) at 37°C for 30 minutes, then purified by QIAquick PCR Purification Kit (Qiagen). .. To assemble the paired gRNAs into the vector, 10 Gibson assembly reactions were performed as follows: Linearized gRNA-LGP vector 200 ng Dual gRNA inserts 36 ng (molar ratio 1:10) 2× Gibson Assembly Master Mix (NEB) 10 μL H2O Up to 20 μL After incubation at 50°C for 1 hour, the product was purified by QIAquick PCR Purification Kit (QIAGEN) and then transformed into One Shot Stbl3 Chemically Competent E. coli (Invitrogen).

    Incubation:

    Article Title: A set of Yarrowia lipolytica CRISPR/Cas9 vectors for exploiting wild-type strain diversity
    Article Snippet: .. The gRNA double-stranded insert was assembled with the pGGA_CRISPRyl acceptor vector via the Golden Gate method as follows: we mixed 2 μL gRNA insert, 100 ng pGGA_CRISPRyl, 2 μL T4 Ligase Buffer (New England Biolabs), 1 μL BsmBI (New England Biolabs), 1 μL T7 Ligase (New England Biolabs), and 20 µl H2 O, and we incubated the mixture in a thermocycler using the following program: [5 min at 55 °C, 5 min at 16 °C] × 30, 5 min at 50 °C, and 5 min at 80 °C. ..

    Sequencing:

    Article Title: Characterization of Cas12a nucleases reveals diverse PAM profiles between closely-related orthologs.
    Article Snippet: .. The plasmids containing the empty Hk and PiCas12a gRNAs were then digested with BsmBI (NEB, Cat: R0580S) and ligated with 5′ phosphorylated and annealed oligos containing a target sequence-of-interest. .. GFP reporter assay using a cell-free transcription-translation (TXTL) system The materials and methods to perform this assay was described in detail elsewhere (31,32).

    Gel Extraction:

    Article Title: Combinatorial CRISPR-Cas9 screens for de novo mapping of genetic interactions
    Article Snippet: .. Step II: Insertion of the gRNA scaffold and the mouse U6 promoter The step 1 library plasmids were digested by BsmBI (NEB) as per the following reaction at 55°C for 3 hours: Step 1 library 4 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL After digestion, the linearized plasmids were treated with 2 μL of Calf Intestinal Alkaline Phosphatase (NEB) at 37°C for 30 minutes; cut plasmids were gel-purified via 0.6% agarose gel electrophoresis and QIAquick gel extraction (QIAGEN). .. Concurrently, the step 2 inserts, synthesized commercially (Integrated DNA Technologies) and cloned into a TOPO vector, were digested by BsmBI (NEB) per the following reaction at 55 °C for 3 hours: Purified step 2 insert PCR product 0.8 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL Sequence of the step 2 insert, with left-gRNA scaffold ( underlined ) and mU6 promoters ( bold ): TATGAGGACGAATCTCCCGCTTATACGTCTCTGTTTCAGAGCTATGCTGGAAACTGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT GTACTGAGTCGCCCA GTCTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT GAGAGACGGTACAAGCACACGTTTGTCAAGACC Subsequently, the following ligation reaction was set up, involving overnight incubation at 16°C followed by heat inactivation at 65°C for 10 minutes: 10X T4 DNA Ligase Buffer 2 μL Step 1 library, digested 100 ng Step 2 insert, digested 100 ng T4 DNA Ligase (high concentration) 1 μL H2O Up to 20 μL 4 μL of the reaction was transformed into 100 μL of ElectroMAX Stbl4 Competent Cells (Invitrogen) according to the manufacturer’s protocol using an Eppendorf Electroporator.

    Plasmid Preparation:

    Article Title: Estrogen receptor signaling is reprogrammed during breast tumorigenesis
    Article Snippet: .. Lentiviral gRNAs targeting GRHL2 were generated by ligation of targeted oligos into LentiCRISPR-v2 vector (Addgene) linearized with BsmBI using quick ligase (NEB). .. Lentivirus-enriched supernatant targeting GRHL2 was then generated from 293FT cells as previously described, and MCF-7 cells were infected at a low MOI (0.3–0.5) ( ).

    Article Title: Systematic Assembly and Genetic Manipulation of the Mouse Hepatitis Virus A59 Genome
    Article Snippet: .. Incubate at 55°C for 2 h. pSMART-MHV-F: 150 μl plasmid, 10 μl BsmBI, 20 μl NEB Buffer 3, 20 μl water. .. Incubate at 55°C for 2 h. pSMART-MHV-G: 150 μl plasmid, 10 μl SfiI, 2 μl BSA, 20 μl NEB Buffer 2, 18 μl water.

    Article Title: Combinatorial CRISPR-Cas9 screens for de novo mapping of genetic interactions
    Article Snippet: .. Subsequently, the gRNA-LGP vector (Addgene 52963) was digested by BsmBI (NEB) via the following reaction at 55°C for 3 hours: gRNA-LGP vector 4 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL After digestion, the vector was treated with 2 μL of Calf Intestinal Alkaline Phosphatase (NEB) at 37°C for 30 minutes, then purified by QIAquick PCR Purification Kit (Qiagen). .. To assemble the paired gRNAs into the vector, 10 Gibson assembly reactions were performed as follows: Linearized gRNA-LGP vector 200 ng Dual gRNA inserts 36 ng (molar ratio 1:10) 2× Gibson Assembly Master Mix (NEB) 10 μL H2O Up to 20 μL After incubation at 50°C for 1 hour, the product was purified by QIAquick PCR Purification Kit (QIAGEN) and then transformed into One Shot Stbl3 Chemically Competent E. coli (Invitrogen).

    Article Title: Rational targeting of a NuRD subcomplex guided by comprehensive in situ mutagenesis
    Article Snippet: .. LentiGuide-Puro (Addgene plasmid 52963) was digested with BsmBI in 1X buffer 3.1 at 37°C (New England Biolabs) for linearization. .. One unit of TSAP thermosensitive alkaline phosphatase (Promega) was added for 1 hour at 37°C to dephosphorylate the linearized lentiGuide and then TSAP was heat inactivated at 74°C for 15 minutes.

    Article Title: A set of Yarrowia lipolytica CRISPR/Cas9 vectors for exploiting wild-type strain diversity
    Article Snippet: .. The gRNA double-stranded insert was assembled with the pGGA_CRISPRyl acceptor vector via the Golden Gate method as follows: we mixed 2 μL gRNA insert, 100 ng pGGA_CRISPRyl, 2 μL T4 Ligase Buffer (New England Biolabs), 1 μL BsmBI (New England Biolabs), 1 μL T7 Ligase (New England Biolabs), and 20 µl H2 O, and we incubated the mixture in a thermocycler using the following program: [5 min at 55 °C, 5 min at 16 °C] × 30, 5 min at 50 °C, and 5 min at 80 °C. ..

    Article Title: Systematic Assembly and Genetic Manipulation of the Mouse Hepatitis Virus A59 Genome
    Article Snippet: .. Incubate at 55°C for 2 h. Add 10 μl Ahd I and incubate at 37°C for an additional 1.5 h. Ahd I cuts the vector into two fragments, which allows the MHV-D fragment to be the largest band. pSMART-MHV-E: 150 μl plasmid, 10 μl BsmBI, 20 μl NEB Buffer 3, 20 μl water. .. Incubate at 55°C for 2 h. pSMART-MHV-F: 150 μl plasmid, 10 μl BsmBI, 20 μl NEB Buffer 3, 20 μl water.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs bsmbi
    Construction of the mutant libraries. (A) A schematic representation of the fitness profiling experiment is shown. A 240 bp insert was generated by error-prone PCR and <t>BsaI</t> digestion. The corresponding vector was generated by high-fidelity PCR and <t>BsmBI</t> digestion. Each of the nine plasmid libraries in this study consist of ∼ 50,000 clones. Each viral mutant library was rescued by transfecting ∼ 35 million 293T cells. Each infection was performed with ∼ 10 million A549 cells. (B) A schematic representation of the sequencing library preparation is shown. DNA plasmid mutant library or viral cDNA was used for PCR. This PCR amplified the 240 bp randomized region. The amplicon product was then digested with BpmI, end-repaired, dA-tailed, ligated to sequencing adapters, and sequenced using the Illumina MiSeq platform. BpmI digestion removed the primer region in the amplicon PCR, resulting in sequencing reads covering only the barcode for multiplex sequencing and the 240 bp region that was randomized in the mutant library. With this experimental design, the number of mutations carried by individual genomes in the mutant libraries could be precisely determined.
    Bsmbi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsmbi/product/New England Biolabs
    Average 99 stars, based on 28 article reviews
    Price from $9.99 to $1999.99
    bsmbi - by Bioz Stars, 2020-05
    99/100 stars
      Buy from Supplier

    N/A
    BsmBI v2 is a Type IIS restriction enzyme and isoschizomer of Esp3I It has been engineered for improved performance in Golden Gate Assembly BsmBI will be discontinued on March 31
      Buy from Supplier

    Image Search Results


    Construction of the mutant libraries. (A) A schematic representation of the fitness profiling experiment is shown. A 240 bp insert was generated by error-prone PCR and BsaI digestion. The corresponding vector was generated by high-fidelity PCR and BsmBI digestion. Each of the nine plasmid libraries in this study consist of ∼ 50,000 clones. Each viral mutant library was rescued by transfecting ∼ 35 million 293T cells. Each infection was performed with ∼ 10 million A549 cells. (B) A schematic representation of the sequencing library preparation is shown. DNA plasmid mutant library or viral cDNA was used for PCR. This PCR amplified the 240 bp randomized region. The amplicon product was then digested with BpmI, end-repaired, dA-tailed, ligated to sequencing adapters, and sequenced using the Illumina MiSeq platform. BpmI digestion removed the primer region in the amplicon PCR, resulting in sequencing reads covering only the barcode for multiplex sequencing and the 240 bp region that was randomized in the mutant library. With this experimental design, the number of mutations carried by individual genomes in the mutant libraries could be precisely determined.

    Journal: PLoS Genetics

    Article Title: Functional Constraint Profiling of a Viral Protein Reveals Discordance of Evolutionary Conservation and Functionality

    doi: 10.1371/journal.pgen.1005310

    Figure Lengend Snippet: Construction of the mutant libraries. (A) A schematic representation of the fitness profiling experiment is shown. A 240 bp insert was generated by error-prone PCR and BsaI digestion. The corresponding vector was generated by high-fidelity PCR and BsmBI digestion. Each of the nine plasmid libraries in this study consist of ∼ 50,000 clones. Each viral mutant library was rescued by transfecting ∼ 35 million 293T cells. Each infection was performed with ∼ 10 million A549 cells. (B) A schematic representation of the sequencing library preparation is shown. DNA plasmid mutant library or viral cDNA was used for PCR. This PCR amplified the 240 bp randomized region. The amplicon product was then digested with BpmI, end-repaired, dA-tailed, ligated to sequencing adapters, and sequenced using the Illumina MiSeq platform. BpmI digestion removed the primer region in the amplicon PCR, resulting in sequencing reads covering only the barcode for multiplex sequencing and the 240 bp region that was randomized in the mutant library. With this experimental design, the number of mutations carried by individual genomes in the mutant libraries could be precisely determined.

    Article Snippet: The insert was then digested by BsaI (New England Biolabs, Ipswich, MA), whereas the vector was digested by BsmBI (New England Biolabs).

    Techniques: Mutagenesis, Generated, Polymerase Chain Reaction, Plasmid Preparation, Clone Assay, Infection, Sequencing, Amplification, Multiplex Assay

    Yeast Golden Gate (yGG) to assemble transcription units (TUs) flanked by VEGAS adapters. ( A ) yGG reactions to build TUs destined for VEGAS pathway assembly in S. cerevisiae include five parts: a left VEGAS adapter (LVA), a promoter (PRO), a coding sequence (CDS), a terminator (TER) and a right VEGAS adapter (RVA). Each part is flanked by inwardly facing recognition sequences for the BsaI restriction enzyme, an ‘offset cutter’ which cuts outside its recognition sequence (at positions 1/5 bp downstream) to expose the indicated four base-pair overhangs. All parts are cloned into vectors encoding kanamycin resistance (KAN R ) and an E. coli replication origin (Ori). ( B ) The yGG acceptor vector for VEGAS is designed such that outwardly facing BsaI sites expose overhangs corresponding to the 5′ LVA and 3′ RVA overhangs to promote assembly of the TU in the vector during a one-pot restriction-digestion reaction. The RFP cassette, built for expression in E. coli , is cut out of the vector when a TU correctly assembles, enabling white–red screening. The yGG acceptor vector encodes resistance to ampicillin (AMP R ) ( C ) The structure of a VA-flanked TU assembled by yGG. An assembled TU plus the flanking VA sequences may be released from the yGG acceptor vector by digestion with BsmBI.

    Journal: Nucleic Acids Research

    Article Title: Versatile genetic assembly system (VEGAS) to assemble pathways for expression in S. cerevisiae

    doi: 10.1093/nar/gkv466

    Figure Lengend Snippet: Yeast Golden Gate (yGG) to assemble transcription units (TUs) flanked by VEGAS adapters. ( A ) yGG reactions to build TUs destined for VEGAS pathway assembly in S. cerevisiae include five parts: a left VEGAS adapter (LVA), a promoter (PRO), a coding sequence (CDS), a terminator (TER) and a right VEGAS adapter (RVA). Each part is flanked by inwardly facing recognition sequences for the BsaI restriction enzyme, an ‘offset cutter’ which cuts outside its recognition sequence (at positions 1/5 bp downstream) to expose the indicated four base-pair overhangs. All parts are cloned into vectors encoding kanamycin resistance (KAN R ) and an E. coli replication origin (Ori). ( B ) The yGG acceptor vector for VEGAS is designed such that outwardly facing BsaI sites expose overhangs corresponding to the 5′ LVA and 3′ RVA overhangs to promote assembly of the TU in the vector during a one-pot restriction-digestion reaction. The RFP cassette, built for expression in E. coli , is cut out of the vector when a TU correctly assembles, enabling white–red screening. The yGG acceptor vector encodes resistance to ampicillin (AMP R ) ( C ) The structure of a VA-flanked TU assembled by yGG. An assembled TU plus the flanking VA sequences may be released from the yGG acceptor vector by digestion with BsmBI.

    Article Snippet: Terminal homology VEGAS ∼1 μg of yGG-assembled, VA-flanked TU constructs were digested with BsmBI (New England Biolabs, R0580) in a final volume of 20 μl.

    Techniques: Sequencing, Clone Assay, Plasmid Preparation, Expressing

    VEGAS with adapter homology to assemble the carotenoid pathway in S. cerevisiae . ( A ) The four β-carotene pathway genes ( crtE, crtI, crtYB and tHMG1 ), assembled as TUs flanked by the indicated VAs (see Table 2 for PRO and TER parts), were released from the yGG acceptor vector with BsmBI digestion and co-transformed into yeast with the linearized VEGAS assembly vector. ( B ) S. cerevisiae colonies encoding assembled pathways develop a bright yellow color on medium lacking uracil (SC–Ura; left panel) as well as on YPD medium supplemented with G418 (right panel).

    Journal: Nucleic Acids Research

    Article Title: Versatile genetic assembly system (VEGAS) to assemble pathways for expression in S. cerevisiae

    doi: 10.1093/nar/gkv466

    Figure Lengend Snippet: VEGAS with adapter homology to assemble the carotenoid pathway in S. cerevisiae . ( A ) The four β-carotene pathway genes ( crtE, crtI, crtYB and tHMG1 ), assembled as TUs flanked by the indicated VAs (see Table 2 for PRO and TER parts), were released from the yGG acceptor vector with BsmBI digestion and co-transformed into yeast with the linearized VEGAS assembly vector. ( B ) S. cerevisiae colonies encoding assembled pathways develop a bright yellow color on medium lacking uracil (SC–Ura; left panel) as well as on YPD medium supplemented with G418 (right panel).

    Article Snippet: Terminal homology VEGAS ∼1 μg of yGG-assembled, VA-flanked TU constructs were digested with BsmBI (New England Biolabs, R0580) in a final volume of 20 μl.

    Techniques: Plasmid Preparation, Transformation Assay

    VEGAS with adapter homology to assemble a five-gene pathway. ( A ) The pathway consisting of VA-flanked TUs assembled by yGG may be released in one piece from the yGG acceptor vector by digestion with BsmBI (scissors). ( B ) A genetic pathway may be assembled into the linearized VEGAS assembly vector in S. cerevisiae by homologous recombination between VAs that flank TUs (TU1–5). X's indicate homologous recombination.

    Journal: Nucleic Acids Research

    Article Title: Versatile genetic assembly system (VEGAS) to assemble pathways for expression in S. cerevisiae

    doi: 10.1093/nar/gkv466

    Figure Lengend Snippet: VEGAS with adapter homology to assemble a five-gene pathway. ( A ) The pathway consisting of VA-flanked TUs assembled by yGG may be released in one piece from the yGG acceptor vector by digestion with BsmBI (scissors). ( B ) A genetic pathway may be assembled into the linearized VEGAS assembly vector in S. cerevisiae by homologous recombination between VAs that flank TUs (TU1–5). X's indicate homologous recombination.

    Article Snippet: Terminal homology VEGAS ∼1 μg of yGG-assembled, VA-flanked TU constructs were digested with BsmBI (New England Biolabs, R0580) in a final volume of 20 μl.

    Techniques: Plasmid Preparation, Homologous Recombination

    gRNA library construction using a semi-random primer. ( A ) Semi-random primer. Poly(A), polyadenylate. ( B ) Type III and type IIS restriction sites to cut out the 20-bp guide sequence. Ec, Eco P15I; Ac, Acu I. ( C ) Scheme of gRNA library construction. Bg, Bgl II; Xb, Xba I; Bs, Bsm BI; Aa, Aat II. PCR, polymerase chain reaction; lentiCRISPR v2, lentiCRISPR version 2. ( D ) Short-range PCR for PCR cycle optimization and size fractionation of the guide sequence. PCR products were run on 20% polyacrylamide gels. A 10-bp ladder was used as the size marker. Bands of the expected sizes are marked by triangles.

    Journal: Science Advances

    Article Title: A method to convert mRNA into a gRNA library for CRISPR/Cas9 editing of any organism

    doi: 10.1126/sciadv.1600699

    Figure Lengend Snippet: gRNA library construction using a semi-random primer. ( A ) Semi-random primer. Poly(A), polyadenylate. ( B ) Type III and type IIS restriction sites to cut out the 20-bp guide sequence. Ec, Eco P15I; Ac, Acu I. ( C ) Scheme of gRNA library construction. Bg, Bgl II; Xb, Xba I; Bs, Bsm BI; Aa, Aat II. PCR, polymerase chain reaction; lentiCRISPR v2, lentiCRISPR version 2. ( D ) Short-range PCR for PCR cycle optimization and size fractionation of the guide sequence. PCR products were run on 20% polyacrylamide gels. A 10-bp ladder was used as the size marker. Bands of the expected sizes are marked by triangles.

    Article Snippet: Bsm BI/Aat II digestion The PCR product was digested with 10 μl of Bsm BI (10 U/μl; NEB) in 1× NEBuffer 3.1 in a 100-μl volume at 55°C for 6 hours, and then 5 μl of Aat II (20 U/μl; NEB) was added to the solution, which was left at 37°C overnight.

    Techniques: Sequencing, Polymerase Chain Reaction, Fractionation, Marker

    Engineering mutations with the No See’m approach: ( A ) The position of interest, a glutamate (CAG) to alanine (GTC) mutation at position 13354-56, is targeted and mapped to the MHV-E fragment. The vector sequence, the wild-type fragment, and the mutated fragment are analyzed to determine which type IIs restriction enzymes do not cut any of them, and one of these is selected as the restriction site to add. In this case BbsI is selected. (B ) Primers are designed that add the mutation and the restriction site in proper orientation so that upon digestion the restriction site is eliminated and complementing sticky ends are produced. The BbsI cut sites are highlighted in gray. The mutated codon is bold and underlined. (C ) PCR is conducted using vector specific primers along with the newly designed primers that incorporate the mutation of interest to produce two amplicons. These are cloned and purified, and then digested with BbsI and BsmBI to produce a mutated MHV-E fragment that can then be incorporated into the full-length clone.

    Journal: SARS- and Other Coronaviruses

    Article Title: Systematic Assembly and Genetic Manipulation of the Mouse Hepatitis Virus A59 Genome

    doi: 10.1007/978-1-59745-181-9_21

    Figure Lengend Snippet: Engineering mutations with the No See’m approach: ( A ) The position of interest, a glutamate (CAG) to alanine (GTC) mutation at position 13354-56, is targeted and mapped to the MHV-E fragment. The vector sequence, the wild-type fragment, and the mutated fragment are analyzed to determine which type IIs restriction enzymes do not cut any of them, and one of these is selected as the restriction site to add. In this case BbsI is selected. (B ) Primers are designed that add the mutation and the restriction site in proper orientation so that upon digestion the restriction site is eliminated and complementing sticky ends are produced. The BbsI cut sites are highlighted in gray. The mutated codon is bold and underlined. (C ) PCR is conducted using vector specific primers along with the newly designed primers that incorporate the mutation of interest to produce two amplicons. These are cloned and purified, and then digested with BbsI and BsmBI to produce a mutated MHV-E fragment that can then be incorporated into the full-length clone.

    Article Snippet: Incubate at 55°C for 2 h. pSMART-MHV-F: 150 μl plasmid, 10 μl BsmBI, 20 μl NEB Buffer 3, 20 μl water.

    Techniques: Mutagenesis, Plasmid Preparation, Sequencing, Produced, Polymerase Chain Reaction, Clone Assay, Purification