bsmbi v2  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    New England Biolabs bsmbi v2
    Example of data-optimized assembly design. (A) The Ligase Fidelity Viewer was used to estimate assembly fidelity of the 11 standard overhangs used in plant synthetic biology ( GGAG, TGAC, TCCC, TACT, CCAT, AATG, AGCC, TTCG, GCTT, GGTA, CGCT ). Overhang sequences are written 5′ to 3′. For this example, we choose the <t>BsmBI-v2</t> restriction enzyme and 42°C/16°C thermocycling protocol. Under these conditions, the estimated assembly fidelity for this set was 81%. (B) The GetSet tool was used to add 9 additional overhangs ( ACCT, CCGC, ACAA, AACA, GAAA, CAAG, GCAC, TAGA, AAAT ). The estimated assembly fidelity for the combined set of 20 overhangs was 80%.
    Bsmbi V2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 40 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsmbi v2/product/New England Biolabs
    Average 95 stars, based on 40 article reviews
    Price from $9.99 to $1999.99
    bsmbi v2 - by Bioz Stars, 2022-10
    95/100 stars

    Images

    1) Product Images from "Enabling one-pot Golden Gate assemblies of unprecedented complexity using data-optimized assembly design"

    Article Title: Enabling one-pot Golden Gate assemblies of unprecedented complexity using data-optimized assembly design

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0238592

    Example of data-optimized assembly design. (A) The Ligase Fidelity Viewer was used to estimate assembly fidelity of the 11 standard overhangs used in plant synthetic biology ( GGAG, TGAC, TCCC, TACT, CCAT, AATG, AGCC, TTCG, GCTT, GGTA, CGCT ). Overhang sequences are written 5′ to 3′. For this example, we choose the BsmBI-v2 restriction enzyme and 42°C/16°C thermocycling protocol. Under these conditions, the estimated assembly fidelity for this set was 81%. (B) The GetSet tool was used to add 9 additional overhangs ( ACCT, CCGC, ACAA, AACA, GAAA, CAAG, GCAC, TAGA, AAAT ). The estimated assembly fidelity for the combined set of 20 overhangs was 80%.
    Figure Legend Snippet: Example of data-optimized assembly design. (A) The Ligase Fidelity Viewer was used to estimate assembly fidelity of the 11 standard overhangs used in plant synthetic biology ( GGAG, TGAC, TCCC, TACT, CCAT, AATG, AGCC, TTCG, GCTT, GGTA, CGCT ). Overhang sequences are written 5′ to 3′. For this example, we choose the BsmBI-v2 restriction enzyme and 42°C/16°C thermocycling protocol. Under these conditions, the estimated assembly fidelity for this set was 81%. (B) The GetSet tool was used to add 9 additional overhangs ( ACCT, CCGC, ACAA, AACA, GAAA, CAAG, GCAC, TAGA, AAAT ). The estimated assembly fidelity for the combined set of 20 overhangs was 80%.

    Techniques Used:

    Nucleotide mismatches in assembly reactions with T4 DNA ligase and Type IIS restriction enzymes generating four-base overhangs. Mismatch frequencies for assembly reactions with T4 DNA ligase and BsaI-HFv2 (blue), BsmBI-v2 (orange), Esp3I (gray), or BbsI-HF (yellow) were grouped according to nucleotide mispair (A:A, A:C, A:G, C:C, C:T, G:G, G:T, T:T). The error bars depict the range between the maximum and minimum observed mismatch frequencies for two experimental replicates.
    Figure Legend Snippet: Nucleotide mismatches in assembly reactions with T4 DNA ligase and Type IIS restriction enzymes generating four-base overhangs. Mismatch frequencies for assembly reactions with T4 DNA ligase and BsaI-HFv2 (blue), BsmBI-v2 (orange), Esp3I (gray), or BbsI-HF (yellow) were grouped according to nucleotide mispair (A:A, A:C, A:G, C:C, C:T, G:G, G:T, T:T). The error bars depict the range between the maximum and minimum observed mismatch frequencies for two experimental replicates.

    Techniques Used:

    High capacity Golden Gate assembly with T4 DNA ligase and BsmBI-v2. (A) Schematic of the 35-fragment lac operon cassette test system (B) Results of the assembly reactions. Four replicate experiments were carried out to quantify the number of colony-forming units harboring correct and incorrect assembly products per 50 μL of E . coli outgrowth plated (0.1 μL of the assembly reaction). On average, 71% of the observed transformants harbored correctly assembled products. (C) Representative agar plate with blue and white colonies. Blue transformants harbor correct assembly constructs, and white transformants harbor inaccurate assembly products.
    Figure Legend Snippet: High capacity Golden Gate assembly with T4 DNA ligase and BsmBI-v2. (A) Schematic of the 35-fragment lac operon cassette test system (B) Results of the assembly reactions. Four replicate experiments were carried out to quantify the number of colony-forming units harboring correct and incorrect assembly products per 50 μL of E . coli outgrowth plated (0.1 μL of the assembly reaction). On average, 71% of the observed transformants harbored correctly assembled products. (C) Representative agar plate with blue and white colonies. Blue transformants harbor correct assembly constructs, and white transformants harbor inaccurate assembly products.

    Techniques Used: Construct

    Golden Gate assembly fidelity predictions as a function of the overhang pairs in the assembly reaction. (A) The GetSet tool was used to estimate the fidelity of assembly reactions containing up to 30 overhang pairs with T4 DNA ligase and SapI. (B) GetSet was used to estimate assembly fidelity for overhangs sets with up to 40 overhang pairs in an assembly reaction with T4 DNA ligase and BsmBI-v2. Overhang pairs were selected using Data-optimized Assembly Design (DAD; blue), traditional rules for overhang selection by hand (gray), or by random overhang selection of non-palindromic overhang pairs (orange). The error bars indicate estimated fidelity scores based on replicate data analysis (see S1 Text for details).
    Figure Legend Snippet: Golden Gate assembly fidelity predictions as a function of the overhang pairs in the assembly reaction. (A) The GetSet tool was used to estimate the fidelity of assembly reactions containing up to 30 overhang pairs with T4 DNA ligase and SapI. (B) GetSet was used to estimate assembly fidelity for overhangs sets with up to 40 overhang pairs in an assembly reaction with T4 DNA ligase and BsmBI-v2. Overhang pairs were selected using Data-optimized Assembly Design (DAD; blue), traditional rules for overhang selection by hand (gray), or by random overhang selection of non-palindromic overhang pairs (orange). The error bars indicate estimated fidelity scores based on replicate data analysis (see S1 Text for details).

    Techniques Used: Selection

    2) Product Images from "Enabling one-pot Golden Gate assemblies of unprecedented complexity using data-optimized assembly design"

    Article Title: Enabling one-pot Golden Gate assemblies of unprecedented complexity using data-optimized assembly design

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0238592

    Example of data-optimized assembly design. (A) The Ligase Fidelity Viewer was used to estimate assembly fidelity of the 11 standard overhangs used in plant synthetic biology ( GGAG, TGAC, TCCC, TACT, CCAT, AATG, AGCC, TTCG, GCTT, GGTA, CGCT ). Overhang sequences are written 5′ to 3′. For this example, we choose the BsmBI-v2 restriction enzyme and 42°C/16°C thermocycling protocol. Under these conditions, the estimated assembly fidelity for this set was 81%. (B) The GetSet tool was used to add 9 additional overhangs ( ACCT, CCGC, ACAA, AACA, GAAA, CAAG, GCAC, TAGA, AAAT ). The estimated assembly fidelity for the combined set of 20 overhangs was 80%.
    Figure Legend Snippet: Example of data-optimized assembly design. (A) The Ligase Fidelity Viewer was used to estimate assembly fidelity of the 11 standard overhangs used in plant synthetic biology ( GGAG, TGAC, TCCC, TACT, CCAT, AATG, AGCC, TTCG, GCTT, GGTA, CGCT ). Overhang sequences are written 5′ to 3′. For this example, we choose the BsmBI-v2 restriction enzyme and 42°C/16°C thermocycling protocol. Under these conditions, the estimated assembly fidelity for this set was 81%. (B) The GetSet tool was used to add 9 additional overhangs ( ACCT, CCGC, ACAA, AACA, GAAA, CAAG, GCAC, TAGA, AAAT ). The estimated assembly fidelity for the combined set of 20 overhangs was 80%.

    Techniques Used:

    Nucleotide mismatches in assembly reactions with T4 DNA ligase and Type IIS restriction enzymes generating four-base overhangs. Mismatch frequencies for assembly reactions with T4 DNA ligase and BsaI-HFv2 (blue), BsmBI-v2 (orange), Esp3I (gray), or BbsI-HF (yellow) were grouped according to nucleotide mispair (A:A, A:C, A:G, C:C, C:T, G:G, G:T, T:T). The error bars depict the range between the maximum and minimum observed mismatch frequencies for two experimental replicates.
    Figure Legend Snippet: Nucleotide mismatches in assembly reactions with T4 DNA ligase and Type IIS restriction enzymes generating four-base overhangs. Mismatch frequencies for assembly reactions with T4 DNA ligase and BsaI-HFv2 (blue), BsmBI-v2 (orange), Esp3I (gray), or BbsI-HF (yellow) were grouped according to nucleotide mispair (A:A, A:C, A:G, C:C, C:T, G:G, G:T, T:T). The error bars depict the range between the maximum and minimum observed mismatch frequencies for two experimental replicates.

    Techniques Used:

    High capacity Golden Gate assembly with T4 DNA ligase and BsmBI-v2. (A) Schematic of the 35-fragment lac operon cassette test system (B) Results of the assembly reactions. Four replicate experiments were carried out to quantify the number of colony-forming units harboring correct and incorrect assembly products per 50 μL of E . coli outgrowth plated (0.1 μL of the assembly reaction). On average, 71% of the observed transformants harbored correctly assembled products. (C) Representative agar plate with blue and white colonies. Blue transformants harbor correct assembly constructs, and white transformants harbor inaccurate assembly products.
    Figure Legend Snippet: High capacity Golden Gate assembly with T4 DNA ligase and BsmBI-v2. (A) Schematic of the 35-fragment lac operon cassette test system (B) Results of the assembly reactions. Four replicate experiments were carried out to quantify the number of colony-forming units harboring correct and incorrect assembly products per 50 μL of E . coli outgrowth plated (0.1 μL of the assembly reaction). On average, 71% of the observed transformants harbored correctly assembled products. (C) Representative agar plate with blue and white colonies. Blue transformants harbor correct assembly constructs, and white transformants harbor inaccurate assembly products.

    Techniques Used: Construct

    Golden Gate assembly fidelity predictions as a function of the overhang pairs in the assembly reaction. (A) The GetSet tool was used to estimate the fidelity of assembly reactions containing up to 30 overhang pairs with T4 DNA ligase and SapI. (B) GetSet was used to estimate assembly fidelity for overhangs sets with up to 40 overhang pairs in an assembly reaction with T4 DNA ligase and BsmBI-v2. Overhang pairs were selected using Data-optimized Assembly Design (DAD; blue), traditional rules for overhang selection by hand (gray), or by random overhang selection of non-palindromic overhang pairs (orange). The error bars indicate estimated fidelity scores based on replicate data analysis (see S1 Text for details).
    Figure Legend Snippet: Golden Gate assembly fidelity predictions as a function of the overhang pairs in the assembly reaction. (A) The GetSet tool was used to estimate the fidelity of assembly reactions containing up to 30 overhang pairs with T4 DNA ligase and SapI. (B) GetSet was used to estimate assembly fidelity for overhangs sets with up to 40 overhang pairs in an assembly reaction with T4 DNA ligase and BsmBI-v2. Overhang pairs were selected using Data-optimized Assembly Design (DAD; blue), traditional rules for overhang selection by hand (gray), or by random overhang selection of non-palindromic overhang pairs (orange). The error bars indicate estimated fidelity scores based on replicate data analysis (see S1 Text for details).

    Techniques Used: Selection

    3) Product Images from "Enabling one-pot Golden Gate assemblies of unprecedented complexity using data-optimized assembly design"

    Article Title: Enabling one-pot Golden Gate assemblies of unprecedented complexity using data-optimized assembly design

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0238592

    Example of data-optimized assembly design. (A) The Ligase Fidelity Viewer was used to estimate assembly fidelity of the 11 standard overhangs used in plant synthetic biology ( GGAG, TGAC, TCCC, TACT, CCAT, AATG, AGCC, TTCG, GCTT, GGTA, CGCT ). Overhang sequences are written 5′ to 3′. For this example, we choose the BsmBI-v2 restriction enzyme and 42°C/16°C thermocycling protocol. Under these conditions, the estimated assembly fidelity for this set was 81%. (B) The GetSet tool was used to add 9 additional overhangs ( ACCT, CCGC, ACAA, AACA, GAAA, CAAG, GCAC, TAGA, AAAT ). The estimated assembly fidelity for the combined set of 20 overhangs was 80%.
    Figure Legend Snippet: Example of data-optimized assembly design. (A) The Ligase Fidelity Viewer was used to estimate assembly fidelity of the 11 standard overhangs used in plant synthetic biology ( GGAG, TGAC, TCCC, TACT, CCAT, AATG, AGCC, TTCG, GCTT, GGTA, CGCT ). Overhang sequences are written 5′ to 3′. For this example, we choose the BsmBI-v2 restriction enzyme and 42°C/16°C thermocycling protocol. Under these conditions, the estimated assembly fidelity for this set was 81%. (B) The GetSet tool was used to add 9 additional overhangs ( ACCT, CCGC, ACAA, AACA, GAAA, CAAG, GCAC, TAGA, AAAT ). The estimated assembly fidelity for the combined set of 20 overhangs was 80%.

    Techniques Used:

    Nucleotide mismatches in assembly reactions with T4 DNA ligase and Type IIS restriction enzymes generating four-base overhangs. Mismatch frequencies for assembly reactions with T4 DNA ligase and BsaI-HFv2 (blue), BsmBI-v2 (orange), Esp3I (gray), or BbsI-HF (yellow) were grouped according to nucleotide mispair (A:A, A:C, A:G, C:C, C:T, G:G, G:T, T:T). The error bars depict the range between the maximum and minimum observed mismatch frequencies for two experimental replicates.
    Figure Legend Snippet: Nucleotide mismatches in assembly reactions with T4 DNA ligase and Type IIS restriction enzymes generating four-base overhangs. Mismatch frequencies for assembly reactions with T4 DNA ligase and BsaI-HFv2 (blue), BsmBI-v2 (orange), Esp3I (gray), or BbsI-HF (yellow) were grouped according to nucleotide mispair (A:A, A:C, A:G, C:C, C:T, G:G, G:T, T:T). The error bars depict the range between the maximum and minimum observed mismatch frequencies for two experimental replicates.

    Techniques Used:

    High capacity Golden Gate assembly with T4 DNA ligase and BsmBI-v2. (A) Schematic of the 35-fragment lac operon cassette test system (B) Results of the assembly reactions. Four replicate experiments were carried out to quantify the number of colony-forming units harboring correct and incorrect assembly products per 50 μL of E . coli outgrowth plated (0.1 μL of the assembly reaction). On average, 71% of the observed transformants harbored correctly assembled products. (C) Representative agar plate with blue and white colonies. Blue transformants harbor correct assembly constructs, and white transformants harbor inaccurate assembly products.
    Figure Legend Snippet: High capacity Golden Gate assembly with T4 DNA ligase and BsmBI-v2. (A) Schematic of the 35-fragment lac operon cassette test system (B) Results of the assembly reactions. Four replicate experiments were carried out to quantify the number of colony-forming units harboring correct and incorrect assembly products per 50 μL of E . coli outgrowth plated (0.1 μL of the assembly reaction). On average, 71% of the observed transformants harbored correctly assembled products. (C) Representative agar plate with blue and white colonies. Blue transformants harbor correct assembly constructs, and white transformants harbor inaccurate assembly products.

    Techniques Used: Construct

    Golden Gate assembly fidelity predictions as a function of the overhang pairs in the assembly reaction. (A) The GetSet tool was used to estimate the fidelity of assembly reactions containing up to 30 overhang pairs with T4 DNA ligase and SapI. (B) GetSet was used to estimate assembly fidelity for overhangs sets with up to 40 overhang pairs in an assembly reaction with T4 DNA ligase and BsmBI-v2. Overhang pairs were selected using Data-optimized Assembly Design (DAD; blue), traditional rules for overhang selection by hand (gray), or by random overhang selection of non-palindromic overhang pairs (orange). The error bars indicate estimated fidelity scores based on replicate data analysis (see S1 Text for details).
    Figure Legend Snippet: Golden Gate assembly fidelity predictions as a function of the overhang pairs in the assembly reaction. (A) The GetSet tool was used to estimate the fidelity of assembly reactions containing up to 30 overhang pairs with T4 DNA ligase and SapI. (B) GetSet was used to estimate assembly fidelity for overhangs sets with up to 40 overhang pairs in an assembly reaction with T4 DNA ligase and BsmBI-v2. Overhang pairs were selected using Data-optimized Assembly Design (DAD; blue), traditional rules for overhang selection by hand (gray), or by random overhang selection of non-palindromic overhang pairs (orange). The error bars indicate estimated fidelity scores based on replicate data analysis (see S1 Text for details).

    Techniques Used: Selection

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs bsmbi
    Schematic representation of the swine pol I-based influenza reverse genetic system. The murine pol I termination signal (mTerm) and a Gaussia luciferease reporter flanked by NS non-coding regions (NS NCR) was subcloned from the (A) human pol I vector pDP-GLuc(NS) and placed in front of the (B) swine pol I promoter to construct a viral RNA expression <t>vector</t> <t>pPIG-vGLuc(NS).</t> (C) The cassette was then subcloned between the RNA pol II promoter (pCMV) and the bovine growth hormone polyadenylation signal (BGH polyA) to construct a bidirectional vector <t>pPIG2012(BsmbI)</t> containing 2 BsmbI restriction enzyme sites flanking the cloning site.
    Bsmbi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsmbi/product/New England Biolabs
    Average 95 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    bsmbi - by Bioz Stars, 2022-10
    95/100 stars
      Buy from Supplier

    99
    New England Biolabs t4 dna ligase
    Golden Gate assembly assay schematic. (A) Hairpin DNA substrates containing a Type IIS recognition sequence (orange), randomized nucleotides at the Type IIS restriction site (NNNN), an internal 6-base random barcode (black), and a PacBio SMRTbell adapter sequence (blue) were synthesized. Golden Gate assembly of these substrates was carried out with <t>T4</t> DNA ligase and a Type IIS restriction enzyme to produce circular assembly products. The assembly products were sequenced utilizing the PacBio Single-Molecule Real-Time sequencing platform. (B) For each sequenced assembly product, the overhang pair identity was extracted. The relative frequency of each overhang pair was determined and was represented as a frequency heat map (log-scaled). Overhangs are listed alphabetically left to right (AAAA, AAAC…TTTG, TTTT) and bottom to top such that the Watson–Crick pairings are shown on the diagonal represented above.
    T4 Dna Ligase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase - by Bioz Stars, 2022-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Schematic representation of the swine pol I-based influenza reverse genetic system. The murine pol I termination signal (mTerm) and a Gaussia luciferease reporter flanked by NS non-coding regions (NS NCR) was subcloned from the (A) human pol I vector pDP-GLuc(NS) and placed in front of the (B) swine pol I promoter to construct a viral RNA expression vector pPIG-vGLuc(NS). (C) The cassette was then subcloned between the RNA pol II promoter (pCMV) and the bovine growth hormone polyadenylation signal (BGH polyA) to construct a bidirectional vector pPIG2012(BsmbI) containing 2 BsmbI restriction enzyme sites flanking the cloning site.

    Journal: Journal of virological methods

    Article Title: Development of a swine RNA polymerase I driven Influenza reverse genetics system for the rescue of type A and B Influenza viruses

    doi: 10.1016/j.jviromet.2020.114011

    Figure Lengend Snippet: Schematic representation of the swine pol I-based influenza reverse genetic system. The murine pol I termination signal (mTerm) and a Gaussia luciferease reporter flanked by NS non-coding regions (NS NCR) was subcloned from the (A) human pol I vector pDP-GLuc(NS) and placed in front of the (B) swine pol I promoter to construct a viral RNA expression vector pPIG-vGLuc(NS). (C) The cassette was then subcloned between the RNA pol II promoter (pCMV) and the bovine growth hormone polyadenylation signal (BGH polyA) to construct a bidirectional vector pPIG2012(BsmbI) containing 2 BsmbI restriction enzyme sites flanking the cloning site.

    Article Snippet: To produce the reverse genetics vector pPIG2012, the pPIG2012_Gluc(NS) plasmid was amplified by inverse PCR with the primer set 5′-ATATCGTCTCGTCCCCCCCAACTTCGGAGGTCG-3′ and 5′-TATTCGTCTCGATCTACCTGGTGACAGAAAAGG-3′ and digested with BsmBI (NEB, Ipswich, MA) to remove the vGluc(NS) cassette.

    Techniques: Plasmid Preparation, Construct, RNA Expression, Clone Assay

    Construction of CRISPR mutants for CgCRZ 1. A . The plasmid pV1382 contains CgCAS9, the nourseothricin resistant gene (Nat R ) and SNR52 promoter that control the expression of the desired sgRNA. B . pV1382 permits a rapid cloning by BsmB I digestion followed by ligation of annealed oligos (boldface type) containing the Cg CRZ1 sequence of synthetic guide RNA (in red bracket). C . Scheme of Cg CRZ1 mutagenesis mediated by CRISPR/Cas9. sg CRZ1 guides the nuclease Cas9 to the specific genomic site and allows DSB next to protospacer adjacent motif (PAM). Homology directed repair (HDR) with a repair template containing two stop codons (TAA-TGA) and one BamH I restriction site allows further analysis of crz1 mutants by PCR.

    Journal: PLoS ONE

    Article Title: CRISPR-Cas9 approach confirms Calcineurin-responsive zinc finger 1 (Crz1) transcription factor as a promising therapeutic target in echinocandin-resistant Candida glabrata

    doi: 10.1371/journal.pone.0265777

    Figure Lengend Snippet: Construction of CRISPR mutants for CgCRZ 1. A . The plasmid pV1382 contains CgCAS9, the nourseothricin resistant gene (Nat R ) and SNR52 promoter that control the expression of the desired sgRNA. B . pV1382 permits a rapid cloning by BsmB I digestion followed by ligation of annealed oligos (boldface type) containing the Cg CRZ1 sequence of synthetic guide RNA (in red bracket). C . Scheme of Cg CRZ1 mutagenesis mediated by CRISPR/Cas9. sg CRZ1 guides the nuclease Cas9 to the specific genomic site and allows DSB next to protospacer adjacent motif (PAM). Homology directed repair (HDR) with a repair template containing two stop codons (TAA-TGA) and one BamH I restriction site allows further analysis of crz1 mutants by PCR.

    Article Snippet: C . glabrata isolates CAGL1875 and CAGL1256 were used as the parent strain to construct the CRISPR-Cas9 mutants for CgCRZ1 . sgRNAs were generated by phosphorylation and annealing of complementary single stranded DNA oligonucleotides sgCRZ1 -up ( GATCGATAACCATAATTTCTCGACCG ) and sgCRZ1 -rev ( AAAACGGTCGAGAAATTATGGTTATC ) and inserted into the pV1083 vector previously digested with BsmB I and treated with calf intestinal phosphatase CIP (NEB) to generate the recombinant plasmid pV1382-sgRNA.

    Techniques: CRISPR, Plasmid Preparation, Expressing, Clone Assay, Ligation, Sequencing, Mutagenesis, Polymerase Chain Reaction

    Example of data-optimized assembly design. (A) The Ligase Fidelity Viewer was used to estimate assembly fidelity of the 11 standard overhangs used in plant synthetic biology ( GGAG, TGAC, TCCC, TACT, CCAT, AATG, AGCC, TTCG, GCTT, GGTA, CGCT ). Overhang sequences are written 5′ to 3′. For this example, we choose the BsmBI-v2 restriction enzyme and 42°C/16°C thermocycling protocol. Under these conditions, the estimated assembly fidelity for this set was 81%. (B) The GetSet tool was used to add 9 additional overhangs ( ACCT, CCGC, ACAA, AACA, GAAA, CAAG, GCAC, TAGA, AAAT ). The estimated assembly fidelity for the combined set of 20 overhangs was 80%.

    Journal: PLoS ONE

    Article Title: Enabling one-pot Golden Gate assemblies of unprecedented complexity using data-optimized assembly design

    doi: 10.1371/journal.pone.0238592

    Figure Lengend Snippet: Example of data-optimized assembly design. (A) The Ligase Fidelity Viewer was used to estimate assembly fidelity of the 11 standard overhangs used in plant synthetic biology ( GGAG, TGAC, TCCC, TACT, CCAT, AATG, AGCC, TTCG, GCTT, GGTA, CGCT ). Overhang sequences are written 5′ to 3′. For this example, we choose the BsmBI-v2 restriction enzyme and 42°C/16°C thermocycling protocol. Under these conditions, the estimated assembly fidelity for this set was 81%. (B) The GetSet tool was used to add 9 additional overhangs ( ACCT, CCGC, ACAA, AACA, GAAA, CAAG, GCAC, TAGA, AAAT ). The estimated assembly fidelity for the combined set of 20 overhangs was 80%.

    Article Snippet: Assembly reactions (20 μL final volume) with BsmBI-v2 and T4 DNA ligase (NEB Golden Gate assembly kit BsmBI-v2) were carried out with 3 nM of each PCR assembly fragment, 75 ng of pGGAselect destination vector, and 2 μL of NEB Golden Gate Enzyme Mix in 1X T4 DNA ligase buffer (final concentration).

    Techniques:

    Nucleotide mismatches in assembly reactions with T4 DNA ligase and Type IIS restriction enzymes generating four-base overhangs. Mismatch frequencies for assembly reactions with T4 DNA ligase and BsaI-HFv2 (blue), BsmBI-v2 (orange), Esp3I (gray), or BbsI-HF (yellow) were grouped according to nucleotide mispair (A:A, A:C, A:G, C:C, C:T, G:G, G:T, T:T). The error bars depict the range between the maximum and minimum observed mismatch frequencies for two experimental replicates.

    Journal: PLoS ONE

    Article Title: Enabling one-pot Golden Gate assemblies of unprecedented complexity using data-optimized assembly design

    doi: 10.1371/journal.pone.0238592

    Figure Lengend Snippet: Nucleotide mismatches in assembly reactions with T4 DNA ligase and Type IIS restriction enzymes generating four-base overhangs. Mismatch frequencies for assembly reactions with T4 DNA ligase and BsaI-HFv2 (blue), BsmBI-v2 (orange), Esp3I (gray), or BbsI-HF (yellow) were grouped according to nucleotide mispair (A:A, A:C, A:G, C:C, C:T, G:G, G:T, T:T). The error bars depict the range between the maximum and minimum observed mismatch frequencies for two experimental replicates.

    Article Snippet: Assembly reactions (20 μL final volume) with BsmBI-v2 and T4 DNA ligase (NEB Golden Gate assembly kit BsmBI-v2) were carried out with 3 nM of each PCR assembly fragment, 75 ng of pGGAselect destination vector, and 2 μL of NEB Golden Gate Enzyme Mix in 1X T4 DNA ligase buffer (final concentration).

    Techniques:

    High capacity Golden Gate assembly with T4 DNA ligase and BsmBI-v2. (A) Schematic of the 35-fragment lac operon cassette test system (B) Results of the assembly reactions. Four replicate experiments were carried out to quantify the number of colony-forming units harboring correct and incorrect assembly products per 50 μL of E . coli outgrowth plated (0.1 μL of the assembly reaction). On average, 71% of the observed transformants harbored correctly assembled products. (C) Representative agar plate with blue and white colonies. Blue transformants harbor correct assembly constructs, and white transformants harbor inaccurate assembly products.

    Journal: PLoS ONE

    Article Title: Enabling one-pot Golden Gate assemblies of unprecedented complexity using data-optimized assembly design

    doi: 10.1371/journal.pone.0238592

    Figure Lengend Snippet: High capacity Golden Gate assembly with T4 DNA ligase and BsmBI-v2. (A) Schematic of the 35-fragment lac operon cassette test system (B) Results of the assembly reactions. Four replicate experiments were carried out to quantify the number of colony-forming units harboring correct and incorrect assembly products per 50 μL of E . coli outgrowth plated (0.1 μL of the assembly reaction). On average, 71% of the observed transformants harbored correctly assembled products. (C) Representative agar plate with blue and white colonies. Blue transformants harbor correct assembly constructs, and white transformants harbor inaccurate assembly products.

    Article Snippet: Assembly reactions (20 μL final volume) with BsmBI-v2 and T4 DNA ligase (NEB Golden Gate assembly kit BsmBI-v2) were carried out with 3 nM of each PCR assembly fragment, 75 ng of pGGAselect destination vector, and 2 μL of NEB Golden Gate Enzyme Mix in 1X T4 DNA ligase buffer (final concentration).

    Techniques: Construct

    Golden Gate assembly fidelity predictions as a function of the overhang pairs in the assembly reaction. (A) The GetSet tool was used to estimate the fidelity of assembly reactions containing up to 30 overhang pairs with T4 DNA ligase and SapI. (B) GetSet was used to estimate assembly fidelity for overhangs sets with up to 40 overhang pairs in an assembly reaction with T4 DNA ligase and BsmBI-v2. Overhang pairs were selected using Data-optimized Assembly Design (DAD; blue), traditional rules for overhang selection by hand (gray), or by random overhang selection of non-palindromic overhang pairs (orange). The error bars indicate estimated fidelity scores based on replicate data analysis (see S1 Text for details).

    Journal: PLoS ONE

    Article Title: Enabling one-pot Golden Gate assemblies of unprecedented complexity using data-optimized assembly design

    doi: 10.1371/journal.pone.0238592

    Figure Lengend Snippet: Golden Gate assembly fidelity predictions as a function of the overhang pairs in the assembly reaction. (A) The GetSet tool was used to estimate the fidelity of assembly reactions containing up to 30 overhang pairs with T4 DNA ligase and SapI. (B) GetSet was used to estimate assembly fidelity for overhangs sets with up to 40 overhang pairs in an assembly reaction with T4 DNA ligase and BsmBI-v2. Overhang pairs were selected using Data-optimized Assembly Design (DAD; blue), traditional rules for overhang selection by hand (gray), or by random overhang selection of non-palindromic overhang pairs (orange). The error bars indicate estimated fidelity scores based on replicate data analysis (see S1 Text for details).

    Article Snippet: Assembly reactions (20 μL final volume) with BsmBI-v2 and T4 DNA ligase (NEB Golden Gate assembly kit BsmBI-v2) were carried out with 3 nM of each PCR assembly fragment, 75 ng of pGGAselect destination vector, and 2 μL of NEB Golden Gate Enzyme Mix in 1X T4 DNA ligase buffer (final concentration).

    Techniques: Selection

    Golden Gate assembly assay schematic. (A) Hairpin DNA substrates containing a Type IIS recognition sequence (orange), randomized nucleotides at the Type IIS restriction site (NNNN), an internal 6-base random barcode (black), and a PacBio SMRTbell adapter sequence (blue) were synthesized. Golden Gate assembly of these substrates was carried out with T4 DNA ligase and a Type IIS restriction enzyme to produce circular assembly products. The assembly products were sequenced utilizing the PacBio Single-Molecule Real-Time sequencing platform. (B) For each sequenced assembly product, the overhang pair identity was extracted. The relative frequency of each overhang pair was determined and was represented as a frequency heat map (log-scaled). Overhangs are listed alphabetically left to right (AAAA, AAAC…TTTG, TTTT) and bottom to top such that the Watson–Crick pairings are shown on the diagonal represented above.

    Journal: PLoS ONE

    Article Title: Enabling one-pot Golden Gate assemblies of unprecedented complexity using data-optimized assembly design

    doi: 10.1371/journal.pone.0238592

    Figure Lengend Snippet: Golden Gate assembly assay schematic. (A) Hairpin DNA substrates containing a Type IIS recognition sequence (orange), randomized nucleotides at the Type IIS restriction site (NNNN), an internal 6-base random barcode (black), and a PacBio SMRTbell adapter sequence (blue) were synthesized. Golden Gate assembly of these substrates was carried out with T4 DNA ligase and a Type IIS restriction enzyme to produce circular assembly products. The assembly products were sequenced utilizing the PacBio Single-Molecule Real-Time sequencing platform. (B) For each sequenced assembly product, the overhang pair identity was extracted. The relative frequency of each overhang pair was determined and was represented as a frequency heat map (log-scaled). Overhangs are listed alphabetically left to right (AAAA, AAAC…TTTG, TTTT) and bottom to top such that the Watson–Crick pairings are shown on the diagonal represented above.

    Article Snippet: Assembly reactions (20 μL final volume) with BsmBI-v2 and T4 DNA ligase (NEB Golden Gate assembly kit BsmBI-v2) were carried out with 3 nM of each PCR assembly fragment, 75 ng of pGGAselect destination vector, and 2 μL of NEB Golden Gate Enzyme Mix in 1X T4 DNA ligase buffer (final concentration).

    Techniques: Sequencing, Synthesized

    Assembly bias with T4 DNA ligase and Type IIS restriction enzymes generating four-base overhangs. (A) The normalized overhang ligation frequencies for all 120 non-palindromic Watson-Crick pairs were plotted for DNA assembly reactions containing T4 DNA ligase and the indicated Type IIS restriction enzyme. (B-C) The most and least frequently observed overhang pairs and their relative frequency per 100,000 ligation events are shown. The overhangs are written in a 5′ to 3′ orientation. The overhang pairs are color-coded according to their frequency relative to the average in terms of the number of standard deviations.

    Journal: PLoS ONE

    Article Title: Enabling one-pot Golden Gate assemblies of unprecedented complexity using data-optimized assembly design

    doi: 10.1371/journal.pone.0238592

    Figure Lengend Snippet: Assembly bias with T4 DNA ligase and Type IIS restriction enzymes generating four-base overhangs. (A) The normalized overhang ligation frequencies for all 120 non-palindromic Watson-Crick pairs were plotted for DNA assembly reactions containing T4 DNA ligase and the indicated Type IIS restriction enzyme. (B-C) The most and least frequently observed overhang pairs and their relative frequency per 100,000 ligation events are shown. The overhangs are written in a 5′ to 3′ orientation. The overhang pairs are color-coded according to their frequency relative to the average in terms of the number of standard deviations.

    Article Snippet: Assembly reactions (20 μL final volume) with BsmBI-v2 and T4 DNA ligase (NEB Golden Gate assembly kit BsmBI-v2) were carried out with 3 nM of each PCR assembly fragment, 75 ng of pGGAselect destination vector, and 2 μL of NEB Golden Gate Enzyme Mix in 1X T4 DNA ligase buffer (final concentration).

    Techniques: Ligation

    High capacity Golden Gate assembly with T4 DNA ligase and SapI. (A) Schematic of the 13-fragment lac operon cassette test system. (B) Results of the assembly reactions. Four replicate experiments were carried out to quantify the number of colony-forming units harboring correct and incorrect assembly products per μL of E . coli outgrowth plated (0.002 μL of the assembly reaction). On average, 91% of the observed transformants harbored correctly assembled products. (C) Representative agar plate with blue and white colonies. Blue transformants harbor correct assembly constructs, and white transformants harbor inaccurate assembly products.

    Journal: PLoS ONE

    Article Title: Enabling one-pot Golden Gate assemblies of unprecedented complexity using data-optimized assembly design

    doi: 10.1371/journal.pone.0238592

    Figure Lengend Snippet: High capacity Golden Gate assembly with T4 DNA ligase and SapI. (A) Schematic of the 13-fragment lac operon cassette test system. (B) Results of the assembly reactions. Four replicate experiments were carried out to quantify the number of colony-forming units harboring correct and incorrect assembly products per μL of E . coli outgrowth plated (0.002 μL of the assembly reaction). On average, 91% of the observed transformants harbored correctly assembled products. (C) Representative agar plate with blue and white colonies. Blue transformants harbor correct assembly constructs, and white transformants harbor inaccurate assembly products.

    Article Snippet: Assembly reactions (20 μL final volume) with BsmBI-v2 and T4 DNA ligase (NEB Golden Gate assembly kit BsmBI-v2) were carried out with 3 nM of each PCR assembly fragment, 75 ng of pGGAselect destination vector, and 2 μL of NEB Golden Gate Enzyme Mix in 1X T4 DNA ligase buffer (final concentration).

    Techniques: Construct

    Nucleotide mismatches in assembly reactions with T4 DNA ligase and Type IIS restriction enzymes generating four-base overhangs. Mismatch frequencies for assembly reactions with T4 DNA ligase and BsaI-HFv2 (blue), BsmBI-v2 (orange), Esp3I (gray), or BbsI-HF (yellow) were grouped according to nucleotide mispair (A:A, A:C, A:G, C:C, C:T, G:G, G:T, T:T). The error bars depict the range between the maximum and minimum observed mismatch frequencies for two experimental replicates.

    Journal: PLoS ONE

    Article Title: Enabling one-pot Golden Gate assemblies of unprecedented complexity using data-optimized assembly design

    doi: 10.1371/journal.pone.0238592

    Figure Lengend Snippet: Nucleotide mismatches in assembly reactions with T4 DNA ligase and Type IIS restriction enzymes generating four-base overhangs. Mismatch frequencies for assembly reactions with T4 DNA ligase and BsaI-HFv2 (blue), BsmBI-v2 (orange), Esp3I (gray), or BbsI-HF (yellow) were grouped according to nucleotide mispair (A:A, A:C, A:G, C:C, C:T, G:G, G:T, T:T). The error bars depict the range between the maximum and minimum observed mismatch frequencies for two experimental replicates.

    Article Snippet: Assembly reactions (20 μL final volume) with BsmBI-v2 and T4 DNA ligase (NEB Golden Gate assembly kit BsmBI-v2) were carried out with 3 nM of each PCR assembly fragment, 75 ng of pGGAselect destination vector, and 2 μL of NEB Golden Gate Enzyme Mix in 1X T4 DNA ligase buffer (final concentration).

    Techniques:

    High capacity Golden Gate assembly with T4 DNA ligase and BsmBI-v2. (A) Schematic of the 35-fragment lac operon cassette test system (B) Results of the assembly reactions. Four replicate experiments were carried out to quantify the number of colony-forming units harboring correct and incorrect assembly products per 50 μL of E . coli outgrowth plated (0.1 μL of the assembly reaction). On average, 71% of the observed transformants harbored correctly assembled products. (C) Representative agar plate with blue and white colonies. Blue transformants harbor correct assembly constructs, and white transformants harbor inaccurate assembly products.

    Journal: PLoS ONE

    Article Title: Enabling one-pot Golden Gate assemblies of unprecedented complexity using data-optimized assembly design

    doi: 10.1371/journal.pone.0238592

    Figure Lengend Snippet: High capacity Golden Gate assembly with T4 DNA ligase and BsmBI-v2. (A) Schematic of the 35-fragment lac operon cassette test system (B) Results of the assembly reactions. Four replicate experiments were carried out to quantify the number of colony-forming units harboring correct and incorrect assembly products per 50 μL of E . coli outgrowth plated (0.1 μL of the assembly reaction). On average, 71% of the observed transformants harbored correctly assembled products. (C) Representative agar plate with blue and white colonies. Blue transformants harbor correct assembly constructs, and white transformants harbor inaccurate assembly products.

    Article Snippet: Assembly reactions (20 μL final volume) with BsmBI-v2 and T4 DNA ligase (NEB Golden Gate assembly kit BsmBI-v2) were carried out with 3 nM of each PCR assembly fragment, 75 ng of pGGAselect destination vector, and 2 μL of NEB Golden Gate Enzyme Mix in 1X T4 DNA ligase buffer (final concentration).

    Techniques: Construct

    Golden Gate assembly fidelity predictions as a function of the overhang pairs in the assembly reaction. (A) The GetSet tool was used to estimate the fidelity of assembly reactions containing up to 30 overhang pairs with T4 DNA ligase and SapI. (B) GetSet was used to estimate assembly fidelity for overhangs sets with up to 40 overhang pairs in an assembly reaction with T4 DNA ligase and BsmBI-v2. Overhang pairs were selected using Data-optimized Assembly Design (DAD; blue), traditional rules for overhang selection by hand (gray), or by random overhang selection of non-palindromic overhang pairs (orange). The error bars indicate estimated fidelity scores based on replicate data analysis (see S1 Text for details).

    Journal: PLoS ONE

    Article Title: Enabling one-pot Golden Gate assemblies of unprecedented complexity using data-optimized assembly design

    doi: 10.1371/journal.pone.0238592

    Figure Lengend Snippet: Golden Gate assembly fidelity predictions as a function of the overhang pairs in the assembly reaction. (A) The GetSet tool was used to estimate the fidelity of assembly reactions containing up to 30 overhang pairs with T4 DNA ligase and SapI. (B) GetSet was used to estimate assembly fidelity for overhangs sets with up to 40 overhang pairs in an assembly reaction with T4 DNA ligase and BsmBI-v2. Overhang pairs were selected using Data-optimized Assembly Design (DAD; blue), traditional rules for overhang selection by hand (gray), or by random overhang selection of non-palindromic overhang pairs (orange). The error bars indicate estimated fidelity scores based on replicate data analysis (see S1 Text for details).

    Article Snippet: Assembly reactions (20 μL final volume) with BsmBI-v2 and T4 DNA ligase (NEB Golden Gate assembly kit BsmBI-v2) were carried out with 3 nM of each PCR assembly fragment, 75 ng of pGGAselect destination vector, and 2 μL of NEB Golden Gate Enzyme Mix in 1X T4 DNA ligase buffer (final concentration).

    Techniques: Selection