bsai  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    BsaI-HF
    Description:

    Catalog Number:
    R3535L
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs bsai
    Characterization of poly(A) tract stability in pEVL. ( a ) Stability of the encoded poly(A) tracts following overnight induction of pEVL for template preparation. <t>BFP-pEVL-200</t> through 500 were grown overnight with induction at 30 °C and then maxiprepped. Each maxiprepped sample was digested with BsiWI and <t>BsaI</t> to release the poly(A) tail fragment from the rest of the plasmid. The tail length was determined by gel electrophoresis with comparison to a known molecular weight s tandard. ( b ) Shortening of poly(A) tracts upon cloning into standard circular or linear plasmid cloning vectors at 30 °C. BFP followed by poly(A) tract inserts of 70, 172, and 325 base pairs bounded by restriction enzyme sites DraIII and SwaI were generated via restriction enzyme digest from the linear plasmid cloning vectors pEVL-100, pEVL-200, and pEVL-300. The inserts were ligated into the circular cloning vector pWNY or subcloned into pEVL and transformed via electroporation. Transformed bacteria were grown with ampicillin (pWNY) or kanamycin (pEVL) selection at 30 °C. Individual colonies were amplified by PCR using primers flanking the poly(A) tract, and the length of the poly(A) tract was determined based on the resulting band size as in Figure 1 . Typically, a band was obtained at the expected size, or a smaller size, reflecting shortening of the poly(A) tract during transformation. Colonies were scored for whether the poly(A) tract fragment was approximately of the expected size (open circle), or was substantially shortened (closed circle). ( c ) Stability of encoded poly(A) tracts under extended propagation conditions. To test the stability of the poly(A) tail under stringent propagation conditions, pEVL 100 through 500 were grown for 2 weeks at 30 °C and 37 °C with reseeding into fresh media at a 1:1000 dilution every 24 hours. At days 0, 6, and 13, each sample was similarly reseeded into induction media and grown overnight before being miniprepped. Parallel analysis was performed with the circular vectors described in ( b ), in which the poly(A) tract fragment was sub-cloned into a circular vector (pWNY). As these are already high-copy plasmids, no inducing agent was added to the cultures. For the circular vectors, samples were miniprepped daily for 7 days. For both pEVL and the circular vectors, the tail length of the induced minipreps was determined by gel elctrophoresis as described above. The expected tail band size for each construct is indicated with an arrow.

    https://www.bioz.com/result/bsai/product/New England Biolabs
    Average 99 stars, based on 37 article reviews
    Price from $9.99 to $1999.99
    bsai - by Bioz Stars, 2019-10
    99/100 stars

    Images

    1) Product Images from "pEVL: A Linear Plasmid for Generating mRNA IVT Templates With Extended Encoded Poly(A) Sequences"

    Article Title: pEVL: A Linear Plasmid for Generating mRNA IVT Templates With Extended Encoded Poly(A) Sequences

    Journal: Molecular Therapy. Nucleic Acids

    doi: 10.1038/mtna.2016.21

    Characterization of poly(A) tract stability in pEVL. ( a ) Stability of the encoded poly(A) tracts following overnight induction of pEVL for template preparation. BFP-pEVL-200 through 500 were grown overnight with induction at 30 °C and then maxiprepped. Each maxiprepped sample was digested with BsiWI and BsaI to release the poly(A) tail fragment from the rest of the plasmid. The tail length was determined by gel electrophoresis with comparison to a known molecular weight s tandard. ( b ) Shortening of poly(A) tracts upon cloning into standard circular or linear plasmid cloning vectors at 30 °C. BFP followed by poly(A) tract inserts of 70, 172, and 325 base pairs bounded by restriction enzyme sites DraIII and SwaI were generated via restriction enzyme digest from the linear plasmid cloning vectors pEVL-100, pEVL-200, and pEVL-300. The inserts were ligated into the circular cloning vector pWNY or subcloned into pEVL and transformed via electroporation. Transformed bacteria were grown with ampicillin (pWNY) or kanamycin (pEVL) selection at 30 °C. Individual colonies were amplified by PCR using primers flanking the poly(A) tract, and the length of the poly(A) tract was determined based on the resulting band size as in Figure 1 . Typically, a band was obtained at the expected size, or a smaller size, reflecting shortening of the poly(A) tract during transformation. Colonies were scored for whether the poly(A) tract fragment was approximately of the expected size (open circle), or was substantially shortened (closed circle). ( c ) Stability of encoded poly(A) tracts under extended propagation conditions. To test the stability of the poly(A) tail under stringent propagation conditions, pEVL 100 through 500 were grown for 2 weeks at 30 °C and 37 °C with reseeding into fresh media at a 1:1000 dilution every 24 hours. At days 0, 6, and 13, each sample was similarly reseeded into induction media and grown overnight before being miniprepped. Parallel analysis was performed with the circular vectors described in ( b ), in which the poly(A) tract fragment was sub-cloned into a circular vector (pWNY). As these are already high-copy plasmids, no inducing agent was added to the cultures. For the circular vectors, samples were miniprepped daily for 7 days. For both pEVL and the circular vectors, the tail length of the induced minipreps was determined by gel elctrophoresis as described above. The expected tail band size for each construct is indicated with an arrow.
    Figure Legend Snippet: Characterization of poly(A) tract stability in pEVL. ( a ) Stability of the encoded poly(A) tracts following overnight induction of pEVL for template preparation. BFP-pEVL-200 through 500 were grown overnight with induction at 30 °C and then maxiprepped. Each maxiprepped sample was digested with BsiWI and BsaI to release the poly(A) tail fragment from the rest of the plasmid. The tail length was determined by gel electrophoresis with comparison to a known molecular weight s tandard. ( b ) Shortening of poly(A) tracts upon cloning into standard circular or linear plasmid cloning vectors at 30 °C. BFP followed by poly(A) tract inserts of 70, 172, and 325 base pairs bounded by restriction enzyme sites DraIII and SwaI were generated via restriction enzyme digest from the linear plasmid cloning vectors pEVL-100, pEVL-200, and pEVL-300. The inserts were ligated into the circular cloning vector pWNY or subcloned into pEVL and transformed via electroporation. Transformed bacteria were grown with ampicillin (pWNY) or kanamycin (pEVL) selection at 30 °C. Individual colonies were amplified by PCR using primers flanking the poly(A) tract, and the length of the poly(A) tract was determined based on the resulting band size as in Figure 1 . Typically, a band was obtained at the expected size, or a smaller size, reflecting shortening of the poly(A) tract during transformation. Colonies were scored for whether the poly(A) tract fragment was approximately of the expected size (open circle), or was substantially shortened (closed circle). ( c ) Stability of encoded poly(A) tracts under extended propagation conditions. To test the stability of the poly(A) tail under stringent propagation conditions, pEVL 100 through 500 were grown for 2 weeks at 30 °C and 37 °C with reseeding into fresh media at a 1:1000 dilution every 24 hours. At days 0, 6, and 13, each sample was similarly reseeded into induction media and grown overnight before being miniprepped. Parallel analysis was performed with the circular vectors described in ( b ), in which the poly(A) tract fragment was sub-cloned into a circular vector (pWNY). As these are already high-copy plasmids, no inducing agent was added to the cultures. For the circular vectors, samples were miniprepped daily for 7 days. For both pEVL and the circular vectors, the tail length of the induced minipreps was determined by gel elctrophoresis as described above. The expected tail band size for each construct is indicated with an arrow.

    Techniques Used: Plasmid Preparation, Nucleic Acid Electrophoresis, Molecular Weight, Clone Assay, Generated, Transformation Assay, Electroporation, Selection, Amplification, Polymerase Chain Reaction, Construct

    Generation and characterization of mRNA from pEVL-encoded templates . ( a ) IVT mRNA encoding blue fluorescent protein (mTagBFP2) generated from pWNY with enzymatic tailing and pEVL-100 through pEVL-500. BFP-pEVL-100 to 500 were digested with XbaI and BsaI, and pWNY with ScaI and BsiWI, to generate template for IVT. IVT was carried out with antireverse cap analog capping, and for pWNY, enzymatic tailing with EPAP. After purification, 200 ng of each transcript was imaged via gel electrophoresis on the FlashGel system. Typically, pEVL produces a single band of defined length, whereas pWNY with enzymatic tailing produces transcripts of a more heterogenous length. ( b ) Relative potency of mRNA encoding BFP generated from a circular plasmid vector with enzymatic polyadenylation or from pEVL-300 and representative flow plots. 1 μg of IVT mRNA from the indicated template was electroporated into prestimulated primary human T cells. After a 24-hour cold shock at 30 ° C, the cells were analyzed each day for 5 days by flow cytometry for the percentage of cells expressing BFP as well as the mean fluorescence intensity (MFI) of the BFP in BFP+ cells. Flow plots are shown as side scatter (SSC) versus BFP. ( c ) Relative potency of mRNA encoding BFP generated from pEVL-100 through pEVL-500 and representative flow plots. Equimolar amounts of IVT mRNA from BFP-pEVL-100 to 500 were electroporated into prestimulated primary human T cells. After an initial 24-hour cold shock at 30 ° C, the cells were grown at 37 °C for 6 more days. Every 24 hours after electroporation, the percentage of cells expressing BFP and the BFI MFI of the BFP+ cells was analyzed by flow cytometry. Flow plots are shown as side scatter (SSC) versus BFP. BFP, blue fluorescent protein; IVT, in vitro transcribed; pEVL, p(Extended Variable Length).
    Figure Legend Snippet: Generation and characterization of mRNA from pEVL-encoded templates . ( a ) IVT mRNA encoding blue fluorescent protein (mTagBFP2) generated from pWNY with enzymatic tailing and pEVL-100 through pEVL-500. BFP-pEVL-100 to 500 were digested with XbaI and BsaI, and pWNY with ScaI and BsiWI, to generate template for IVT. IVT was carried out with antireverse cap analog capping, and for pWNY, enzymatic tailing with EPAP. After purification, 200 ng of each transcript was imaged via gel electrophoresis on the FlashGel system. Typically, pEVL produces a single band of defined length, whereas pWNY with enzymatic tailing produces transcripts of a more heterogenous length. ( b ) Relative potency of mRNA encoding BFP generated from a circular plasmid vector with enzymatic polyadenylation or from pEVL-300 and representative flow plots. 1 μg of IVT mRNA from the indicated template was electroporated into prestimulated primary human T cells. After a 24-hour cold shock at 30 ° C, the cells were analyzed each day for 5 days by flow cytometry for the percentage of cells expressing BFP as well as the mean fluorescence intensity (MFI) of the BFP in BFP+ cells. Flow plots are shown as side scatter (SSC) versus BFP. ( c ) Relative potency of mRNA encoding BFP generated from pEVL-100 through pEVL-500 and representative flow plots. Equimolar amounts of IVT mRNA from BFP-pEVL-100 to 500 were electroporated into prestimulated primary human T cells. After an initial 24-hour cold shock at 30 ° C, the cells were grown at 37 °C for 6 more days. Every 24 hours after electroporation, the percentage of cells expressing BFP and the BFI MFI of the BFP+ cells was analyzed by flow cytometry. Flow plots are shown as side scatter (SSC) versus BFP. BFP, blue fluorescent protein; IVT, in vitro transcribed; pEVL, p(Extended Variable Length).

    Techniques Used: Generated, Purification, Nucleic Acid Electrophoresis, Plasmid Preparation, Flow Cytometry, Cytometry, Expressing, Fluorescence, Electroporation, In Vitro

    Generation of pEVL: a linear plasmid vector for generation of mRNA with extended encoded poly(A) tracts. ( a ) Schematic of pJazz and conversion to pEVL. The plasmids are shown with orange arrows denoting genes, red circles with T's denoting transcriptional terminators, open circles denoting terminal hairpin loops, yellow blocks denoting BsaI sites, and green blocks denoting the poly(A) tail. ( b ) Schematic of pEVL and method used for generation of extended poly(A) tracts in pEVL.
    Figure Legend Snippet: Generation of pEVL: a linear plasmid vector for generation of mRNA with extended encoded poly(A) tracts. ( a ) Schematic of pJazz and conversion to pEVL. The plasmids are shown with orange arrows denoting genes, red circles with T's denoting transcriptional terminators, open circles denoting terminal hairpin loops, yellow blocks denoting BsaI sites, and green blocks denoting the poly(A) tail. ( b ) Schematic of pEVL and method used for generation of extended poly(A) tracts in pEVL.

    Techniques Used: Plasmid Preparation

    2) Product Images from "Bacillus SEVA siblings: A Golden Gate-based toolbox to create personalized integrative vectors for Bacillus subtilis"

    Article Title: Bacillus SEVA siblings: A Golden Gate-based toolbox to create personalized integrative vectors for Bacillus subtilis

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-14329-5

    Architecture of the MCS-IIS C2. This DNA-sequence is located on the cargo vector between the E. coli ori and the Bacillus antibiotic marker. The recognition sites for five type IIS restriction enzymes (AarI, BtgZI, BbsI, BsaI, BsmBI), each designed to create a 5′ GCGA-overhang are encoded on the DNA stretch. Architecture of all MCS-IIS can be found in Fig. S1 .
    Figure Legend Snippet: Architecture of the MCS-IIS C2. This DNA-sequence is located on the cargo vector between the E. coli ori and the Bacillus antibiotic marker. The recognition sites for five type IIS restriction enzymes (AarI, BtgZI, BbsI, BsaI, BsmBI), each designed to create a 5′ GCGA-overhang are encoded on the DNA stretch. Architecture of all MCS-IIS can be found in Fig. S1 .

    Techniques Used: Sequencing, Plasmid Preparation, Marker

    3) Product Images from "Rapid Restriction Enzyme-Free Cloning of PCR Products: A High-Throughput Method Applicable for Library Construction"

    Article Title: Rapid Restriction Enzyme-Free Cloning of PCR Products: A High-Throughput Method Applicable for Library Construction

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0111538

    Cloning strategy. The vector contains two appropriately oriented BsaI sites (A) upon digestion with BsaI linearized vector is obtained with ends having 4-base 5′-overhangs (B) shown in red. The recognition sequence of restriction enzyme BsaI are underlined and the cleavage site is marked. The Gene Of Interest (GOI) is amplified using two gene-specific primers with 7-base long additional sequence at the 5′ end (C) shown in bold. Treatment of PCR product with T4 DNA polymerase and dTTP produces two different four-base overhangs that are complementary to two ends of the linearized vector shown in red (D). The ligation results in direction cloning of the insert into the vector (E).
    Figure Legend Snippet: Cloning strategy. The vector contains two appropriately oriented BsaI sites (A) upon digestion with BsaI linearized vector is obtained with ends having 4-base 5′-overhangs (B) shown in red. The recognition sequence of restriction enzyme BsaI are underlined and the cleavage site is marked. The Gene Of Interest (GOI) is amplified using two gene-specific primers with 7-base long additional sequence at the 5′ end (C) shown in bold. Treatment of PCR product with T4 DNA polymerase and dTTP produces two different four-base overhangs that are complementary to two ends of the linearized vector shown in red (D). The ligation results in direction cloning of the insert into the vector (E).

    Techniques Used: Clone Assay, Plasmid Preparation, Sequencing, Amplification, Polymerase Chain Reaction, Ligation

    4) Product Images from "Seven novel mutations in the long isoform of the USH2A gene in Chinese families with nonsyndromic retinitis pigmentosa and Usher syndrome Type II"

    Article Title: Seven novel mutations in the long isoform of the USH2A gene in Chinese families with nonsyndromic retinitis pigmentosa and Usher syndrome Type II

    Journal: Molecular Vision

    doi:

    A restriction fragment length analysis of the four mutations detected in this study. A : c.2802T > G abolished a HincII restriction site that co-segregated with the affected individuals and the carriers (42 bp, 57 bp, 99 bp, 717 bp, and 774 bp), but not with unaffected individuals and normal controls (42 bp, 57 bp, and 717 bp). B : c.8232G > C created a new HpyCH4V restriction site that co-segregated with the affected individuals and the carriers (88 bp, 186 bp, 218 bp, and 274 bp), but not with unaffected individuals and normal controls (218 bp, 274 bp). C : c.3788G > A abolished a BsaI restriction site that co-segregated with the affected individuals and the carriers (70 bp, 132 bp, 422 bp, and 492 bp), but not with unaffected individuals and normal controls (70 bp, 132 bp, and 422 bp). D : c.14403C > G created a SpeI restriction site that co-segregated with the affected individuals and the carriers (145 bp, 300 bp, and 445 bp), but not with unaffected individuals and normal controls (445 bp). A participant identification number is given above each lane. N represents normal controls.
    Figure Legend Snippet: A restriction fragment length analysis of the four mutations detected in this study. A : c.2802T > G abolished a HincII restriction site that co-segregated with the affected individuals and the carriers (42 bp, 57 bp, 99 bp, 717 bp, and 774 bp), but not with unaffected individuals and normal controls (42 bp, 57 bp, and 717 bp). B : c.8232G > C created a new HpyCH4V restriction site that co-segregated with the affected individuals and the carriers (88 bp, 186 bp, 218 bp, and 274 bp), but not with unaffected individuals and normal controls (218 bp, 274 bp). C : c.3788G > A abolished a BsaI restriction site that co-segregated with the affected individuals and the carriers (70 bp, 132 bp, 422 bp, and 492 bp), but not with unaffected individuals and normal controls (70 bp, 132 bp, and 422 bp). D : c.14403C > G created a SpeI restriction site that co-segregated with the affected individuals and the carriers (145 bp, 300 bp, and 445 bp), but not with unaffected individuals and normal controls (445 bp). A participant identification number is given above each lane. N represents normal controls.

    Techniques Used:

    5) Product Images from "MetClo: methylase-assisted hierarchical DNA assembly using a single type IIS restriction enzyme"

    Article Title: MetClo: methylase-assisted hierarchical DNA assembly using a single type IIS restriction enzyme

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky596

    Identification of suitable methylases for methylation-switching. ( A ) Initial screening of functional methylases for selective blocking of overlapping methylation/restriction sites. The diagrams show the design of overlapping sites for screening of methylase activity. The table shows the screening result using methylases expressed in vivo from an F-ori based low copy number vector. Restriction enzyme recognition sites are boxed in solid lines. The adhesive ends generated by the restriction enzyme are shown by solid lines. Methylase recognition sites are boxed in dashed lines, and methylated bases are in bold font. All the listed methylases modify N6-adenine, except M.SacI and M.AspJHL3I, which modify C5-cytosine and N4-cytosine respectively. ( B ) Experimental designs to test blocking of methylation-switchable type IIS restriction enzyme sites by in vivo methylation. For each methylase/restriction enzyme combination tested, the test plasmid contains a head-to-head potentially methylation-switchable restriction site and a non-methylatable restriction site. Restriction digestion of test plasmid prepared from a normal E. coli strain would result in cutting at both sites and the release of a 600 bp fragment from the 4.3 kb vector backbone. Restriction digestion of test plasmid prepared from a strain expressing the switch methylase would result in a single 4.9 kb band, due to blocking of the methylation-switchable restriction sites by in vivo methylation. The restriction sites of the test plasmids for each restriction enzyme are shown, with the restriction site boxed in solid line, the methylase recognition site boxed in dashed line, and the methylated bases in bold. The head-to-head arrangement of overlapping methylation/restriction site allows the same assay to be used to detect any residual single strand nicking activity of the restriction enzyme towards the methylated restriction site. ( C ) Agarose gel electrophoresis analysis of the test plasmids for each methylation-switchable restriction site after preparation of the plasmids in a normal strain (–) or in a strain expressing the appropriate DNA methylase (+) and digested with the corresponding type IIS restriction enzymes. The combinations tested were BsaI with M.Osp807II methylase using test plasmid pMOP_BsaINC, BpiI with M2.NmeMC58II methylase using test plasmid pMOP_BpiINC, and LguI with M.XmnI methylase using test plasmid pMOP_LguINC. Test conditions were 60 fmol test plasmid digested using 5 U BsaI or BpiI, or 2.5 U LguI in 10 μl reactions at 37°C for 1 h. The results show that in vivo methylation by each of the methylases successfully blocked the restriction site for the corresponding type IIS restriction enzyme when the methylase recognition site overlapped the restriction enzyme site. The data shown represents results from three independent experiments.
    Figure Legend Snippet: Identification of suitable methylases for methylation-switching. ( A ) Initial screening of functional methylases for selective blocking of overlapping methylation/restriction sites. The diagrams show the design of overlapping sites for screening of methylase activity. The table shows the screening result using methylases expressed in vivo from an F-ori based low copy number vector. Restriction enzyme recognition sites are boxed in solid lines. The adhesive ends generated by the restriction enzyme are shown by solid lines. Methylase recognition sites are boxed in dashed lines, and methylated bases are in bold font. All the listed methylases modify N6-adenine, except M.SacI and M.AspJHL3I, which modify C5-cytosine and N4-cytosine respectively. ( B ) Experimental designs to test blocking of methylation-switchable type IIS restriction enzyme sites by in vivo methylation. For each methylase/restriction enzyme combination tested, the test plasmid contains a head-to-head potentially methylation-switchable restriction site and a non-methylatable restriction site. Restriction digestion of test plasmid prepared from a normal E. coli strain would result in cutting at both sites and the release of a 600 bp fragment from the 4.3 kb vector backbone. Restriction digestion of test plasmid prepared from a strain expressing the switch methylase would result in a single 4.9 kb band, due to blocking of the methylation-switchable restriction sites by in vivo methylation. The restriction sites of the test plasmids for each restriction enzyme are shown, with the restriction site boxed in solid line, the methylase recognition site boxed in dashed line, and the methylated bases in bold. The head-to-head arrangement of overlapping methylation/restriction site allows the same assay to be used to detect any residual single strand nicking activity of the restriction enzyme towards the methylated restriction site. ( C ) Agarose gel electrophoresis analysis of the test plasmids for each methylation-switchable restriction site after preparation of the plasmids in a normal strain (–) or in a strain expressing the appropriate DNA methylase (+) and digested with the corresponding type IIS restriction enzymes. The combinations tested were BsaI with M.Osp807II methylase using test plasmid pMOP_BsaINC, BpiI with M2.NmeMC58II methylase using test plasmid pMOP_BpiINC, and LguI with M.XmnI methylase using test plasmid pMOP_LguINC. Test conditions were 60 fmol test plasmid digested using 5 U BsaI or BpiI, or 2.5 U LguI in 10 μl reactions at 37°C for 1 h. The results show that in vivo methylation by each of the methylases successfully blocked the restriction site for the corresponding type IIS restriction enzyme when the methylase recognition site overlapped the restriction enzyme site. The data shown represents results from three independent experiments.

    Techniques Used: Methylation, Functional Assay, Blocking Assay, Activity Assay, In Vivo, Low Copy Number, Plasmid Preparation, Generated, Expressing, Agarose Gel Electrophoresis

    BsaI-M.Osp807II based MetClo system. The donor plasmids contain DNA fragments to be assembled (Fragments A–D) flanked by BsaI sites that generate compatible adhesive ends (schematically labelled aaaa-eeee). The BsaI sites overlap with the M.Osp807II methylase recognition sequence. Donor plasmids were prepared from a normal strain that does not express the M.Osp807II switch methylase. As a result, the BsaI sites are not methylated and so the insert DNA fragments can be released by BsaI digestion. The recipient assembly vector contains a LacZα selection marker flanked by head-to-head BsaI sites. The outer pair of BsaI sites closer to the vector backbone overlap with an M.Osp807II methylation sequence and so are methylation-switchable, whereas the inner pair of BsaI sites are not. Preparation of the assembly vector in the M.Osp807II switch methylase-expressing DH10B strain results in selective blocking of the outer pair of BsaI sites. The LacZα fragment can be released by BsaI through cutting at inner pair of BsaI sites. Following a one-pot reaction using BsaI and T4 DNA ligase, ligation among compatible adhesive ends results in ordered assembly of DNA fragments into the assembly vector backbone. The assembled fragment in the assembled plasmid is flanked by methylated BsaI sites, which are not cut by BsaI. Following transformation into a normal strain that does not express the M.Osp807II switch methylase, methylation of the flanking restriction sites is lost, and the assembled fragment can be released by BsaI for the next stage assembly.
    Figure Legend Snippet: BsaI-M.Osp807II based MetClo system. The donor plasmids contain DNA fragments to be assembled (Fragments A–D) flanked by BsaI sites that generate compatible adhesive ends (schematically labelled aaaa-eeee). The BsaI sites overlap with the M.Osp807II methylase recognition sequence. Donor plasmids were prepared from a normal strain that does not express the M.Osp807II switch methylase. As a result, the BsaI sites are not methylated and so the insert DNA fragments can be released by BsaI digestion. The recipient assembly vector contains a LacZα selection marker flanked by head-to-head BsaI sites. The outer pair of BsaI sites closer to the vector backbone overlap with an M.Osp807II methylation sequence and so are methylation-switchable, whereas the inner pair of BsaI sites are not. Preparation of the assembly vector in the M.Osp807II switch methylase-expressing DH10B strain results in selective blocking of the outer pair of BsaI sites. The LacZα fragment can be released by BsaI through cutting at inner pair of BsaI sites. Following a one-pot reaction using BsaI and T4 DNA ligase, ligation among compatible adhesive ends results in ordered assembly of DNA fragments into the assembly vector backbone. The assembled fragment in the assembled plasmid is flanked by methylated BsaI sites, which are not cut by BsaI. Following transformation into a normal strain that does not express the M.Osp807II switch methylase, methylation of the flanking restriction sites is lost, and the assembled fragment can be released by BsaI for the next stage assembly.

    Techniques Used: Sequencing, Methylation, Plasmid Preparation, Selection, Marker, Expressing, Blocking Assay, Ligation, Transformation Assay

    Design of a standard MetClo vector set. Three types of adaptor sequences were designed for the standard MetClo vector set. The vectors contain two head-to-head BsaI sites (boxed) flanking the negative selection marker LacZα. The pair of unmethylated BsaI sites closest to the negative selection marker can be used to release LacZα and generates adhesive ends ‘p’ and ‘q’. This allows any fragments that start with adhesive end ‘p’ and end with adhesive end ‘q’ to be cloned into any of the three types of adaptor sequences (types ‘Start’, ‘Middle’, ‘End’). The outer pair of BsaI sites closest to the vector backbone overlap with the M.Osp807II recognition sequence and are both methylated at the adenine bases highlighted in bold when the vector is prepared in M.Osp807II-expressing E. coli strain. A DNA fragment assembled into these vectors, following transformation into a normal E. coli strain which lacks this switch methylase activity, can be released from the assembled plasmid using BsaI, which can now recognize this unmethylated BsaI site. The released fragment will carry different adhesive ends depending on the type of the vector used. Assembly into a type ‘Start’ vector will generate a fragment flanked by adaptors ‘p-a’; assembly into a type ‘Middle’ vector will generate a fragment flanked by ‘a-b’, ‘b-c’, ‘c-d’ or ‘d-e’; assembly into a type ‘End’ vector will generate a fragment flanked by ‘a-q’, ‘b-q’, ‘c-q’, ‘d-q’ or ‘e-q’. The design of these LacZα selection cassettes flanked by unique adaptors are represented in the figure by the letter codes for the outside adaptor sequences.
    Figure Legend Snippet: Design of a standard MetClo vector set. Three types of adaptor sequences were designed for the standard MetClo vector set. The vectors contain two head-to-head BsaI sites (boxed) flanking the negative selection marker LacZα. The pair of unmethylated BsaI sites closest to the negative selection marker can be used to release LacZα and generates adhesive ends ‘p’ and ‘q’. This allows any fragments that start with adhesive end ‘p’ and end with adhesive end ‘q’ to be cloned into any of the three types of adaptor sequences (types ‘Start’, ‘Middle’, ‘End’). The outer pair of BsaI sites closest to the vector backbone overlap with the M.Osp807II recognition sequence and are both methylated at the adenine bases highlighted in bold when the vector is prepared in M.Osp807II-expressing E. coli strain. A DNA fragment assembled into these vectors, following transformation into a normal E. coli strain which lacks this switch methylase activity, can be released from the assembled plasmid using BsaI, which can now recognize this unmethylated BsaI site. The released fragment will carry different adhesive ends depending on the type of the vector used. Assembly into a type ‘Start’ vector will generate a fragment flanked by adaptors ‘p-a’; assembly into a type ‘Middle’ vector will generate a fragment flanked by ‘a-b’, ‘b-c’, ‘c-d’ or ‘d-e’; assembly into a type ‘End’ vector will generate a fragment flanked by ‘a-q’, ‘b-q’, ‘c-q’, ‘d-q’ or ‘e-q’. The design of these LacZα selection cassettes flanked by unique adaptors are represented in the figure by the letter codes for the outside adaptor sequences.

    Techniques Used: Plasmid Preparation, Selection, Marker, Clone Assay, Sequencing, Methylation, Expressing, Transformation Assay, Activity Assay

    6) Product Images from "Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence"

    Article Title: Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence

    Journal: BMC Biochemistry

    doi: 10.1186/1471-2091-12-47

    Incorporation of double and single BrdU residues by Bst exo - DNA Polymerase into the 466 bp hybrid molecule . Incorporation reactions using BrdUTP alone or in combination with dTTP were carried out with Bst exo - DNA Polymerase. Lanes M, Perfect 100 bp Ladder (selected bands marked). Enzyme purity and reaction steps controls: lane 1, uncut 437 bp PCR fragment amplified from pGCN1 plasmid; lane 2, uncut 480 bp PCR fragment amplified from pGCN2 plasmid; lane 3, BsaI-cut 437 bp fragment; lane 4, BsaI-cut 480 bp fragment; lane 5, BsaI restriction fragment I (191 bp) filled in with BrdUTP isolated from agarose gel; lane 6, BsaI restriction fragment III (270 bp) filled in with BrdUTP isolated from agarose gel; lane 7, BsaI-cut 437 bp fragment, purified and back-ligated; lane 8, BsaI-cut 437 bp fragment, purified, incubated with Bst exo- DNA Pol without dNTPs and back-ligated. Incorporation reaction: lane 9, fragment I (191 bp) filled in with dTTP, ligated to BrdU-labeled fragment III (270 bp); lane 10, fragment I (191 bp) filled in with BrdUTP, ligated to BrdU-labeled fragment III (270 bp). I, III BsaI restriction fragments numbered as in Figure 1.
    Figure Legend Snippet: Incorporation of double and single BrdU residues by Bst exo - DNA Polymerase into the 466 bp hybrid molecule . Incorporation reactions using BrdUTP alone or in combination with dTTP were carried out with Bst exo - DNA Polymerase. Lanes M, Perfect 100 bp Ladder (selected bands marked). Enzyme purity and reaction steps controls: lane 1, uncut 437 bp PCR fragment amplified from pGCN1 plasmid; lane 2, uncut 480 bp PCR fragment amplified from pGCN2 plasmid; lane 3, BsaI-cut 437 bp fragment; lane 4, BsaI-cut 480 bp fragment; lane 5, BsaI restriction fragment I (191 bp) filled in with BrdUTP isolated from agarose gel; lane 6, BsaI restriction fragment III (270 bp) filled in with BrdUTP isolated from agarose gel; lane 7, BsaI-cut 437 bp fragment, purified and back-ligated; lane 8, BsaI-cut 437 bp fragment, purified, incubated with Bst exo- DNA Pol without dNTPs and back-ligated. Incorporation reaction: lane 9, fragment I (191 bp) filled in with dTTP, ligated to BrdU-labeled fragment III (270 bp); lane 10, fragment I (191 bp) filled in with BrdUTP, ligated to BrdU-labeled fragment III (270 bp). I, III BsaI restriction fragments numbered as in Figure 1.

    Techniques Used: Polymerase Chain Reaction, Amplification, Plasmid Preparation, Isolation, Agarose Gel Electrophoresis, Purification, Incubation, Labeling

    Assessment of various DNA polymerases for their ability to incorporate BrdU . Complete and incomplete specific incorporation reactions (Figure 1) were carried out with 5 DNA Polymerases: Bst exo - (thermophilic), T4 (mesophilic), Taq (thermophilic), OptiTaq (thermophilic blend) and Pfu (hyperthermophilic) in the presence of BrdUTP. Lanes M, Perfect 100 bp Ladder; lane 1, PCR 1 fragment (379 bp); lane 2, BsaI-cleaved PCR 1 fragment; lane 3, PCR 2 fragment (625 bp); lane 4, BsaI-cleaved PCR 2 fragment; lane 5, BsaI restriction fragments: I (363 bp) and III (609 bp). Lanes 6-18 reactions with specified DNA Polymerases: lane 6, restriction fragments: I and III, T4; lane 7, restriction fragments: I and III, Bst exo - ; lane 8, restriction fragments: I and III, Bst exo - , T4 DNA Ligase; lane 9, restriction fragments: I and III, T4; lane 10, restriction fragments: I and III, T4, T4 DNA Ligase; lane 11, restriction fragments: I and III, Taq; lane 12, restriction fragments: I and III, Taq, T4 DNA Ligase; lane 13, restriction fragments: I and III, OptiTaq; lane 14, restriction fragments: I and III, OptiTaq, T4 DNA Ligase; lane 15, restriction fragments: I and III, Tfl; lane 16, restriction fragments: I and III, Tfl, T4 DNA Ligase; lane 17, restriction fragments: I and III, Pfu; lane 18, restriction fragments: I and III, Pfu, T4 DNA Ligase. I, III BsaI restriction fragments numbered as in Figure 1.
    Figure Legend Snippet: Assessment of various DNA polymerases for their ability to incorporate BrdU . Complete and incomplete specific incorporation reactions (Figure 1) were carried out with 5 DNA Polymerases: Bst exo - (thermophilic), T4 (mesophilic), Taq (thermophilic), OptiTaq (thermophilic blend) and Pfu (hyperthermophilic) in the presence of BrdUTP. Lanes M, Perfect 100 bp Ladder; lane 1, PCR 1 fragment (379 bp); lane 2, BsaI-cleaved PCR 1 fragment; lane 3, PCR 2 fragment (625 bp); lane 4, BsaI-cleaved PCR 2 fragment; lane 5, BsaI restriction fragments: I (363 bp) and III (609 bp). Lanes 6-18 reactions with specified DNA Polymerases: lane 6, restriction fragments: I and III, T4; lane 7, restriction fragments: I and III, Bst exo - ; lane 8, restriction fragments: I and III, Bst exo - , T4 DNA Ligase; lane 9, restriction fragments: I and III, T4; lane 10, restriction fragments: I and III, T4, T4 DNA Ligase; lane 11, restriction fragments: I and III, Taq; lane 12, restriction fragments: I and III, Taq, T4 DNA Ligase; lane 13, restriction fragments: I and III, OptiTaq; lane 14, restriction fragments: I and III, OptiTaq, T4 DNA Ligase; lane 15, restriction fragments: I and III, Tfl; lane 16, restriction fragments: I and III, Tfl, T4 DNA Ligase; lane 17, restriction fragments: I and III, Pfu; lane 18, restriction fragments: I and III, Pfu, T4 DNA Ligase. I, III BsaI restriction fragments numbered as in Figure 1.

    Techniques Used: Polymerase Chain Reaction

    Incorporation of double and single BrdU residues by Bst exo - DNA Polymerase into the 441 bp hybrid molecule . Incorporation reactions using BrdUTP alone or in combination with dTTP were carried out with Bst exo - DNA Polymerase. Lanes M, Perfect 100 bp Ladder (selected bands marked); lane 1, 260 bp BsaI-cleaved PCR (restriction fragment I); lane 2, 208 bp BsaI-cleaved PCR (restriction fragment III); lane 3, BrdUTP-filled restriction fragments I and III, T4 DNA ligase; lane 4, BrdUTP-filled restriction fragments I and III; lane 5, dTTP-filled restriction fragment I and BrdUTP-filled restriction fragment III, T4 DNA ligase; lane 6, dTTP-filled restriction fragment I and BrdU-filled restriction fragment III. Lanes 7-9, controls of enzymes functional purity: lane 7, control PCR fragment with internal BsaI site; lane 8, BsaI-cleaved control PCR fragment; lane 9, BsaI-cleaved control PCR fragment after addition of T4 DNA Ligase; lane M, Perfect 100 bp Ladder. I, III BsaI restriction fragments numbered as in Figure 1.
    Figure Legend Snippet: Incorporation of double and single BrdU residues by Bst exo - DNA Polymerase into the 441 bp hybrid molecule . Incorporation reactions using BrdUTP alone or in combination with dTTP were carried out with Bst exo - DNA Polymerase. Lanes M, Perfect 100 bp Ladder (selected bands marked); lane 1, 260 bp BsaI-cleaved PCR (restriction fragment I); lane 2, 208 bp BsaI-cleaved PCR (restriction fragment III); lane 3, BrdUTP-filled restriction fragments I and III, T4 DNA ligase; lane 4, BrdUTP-filled restriction fragments I and III; lane 5, dTTP-filled restriction fragment I and BrdUTP-filled restriction fragment III, T4 DNA ligase; lane 6, dTTP-filled restriction fragment I and BrdU-filled restriction fragment III. Lanes 7-9, controls of enzymes functional purity: lane 7, control PCR fragment with internal BsaI site; lane 8, BsaI-cleaved control PCR fragment; lane 9, BsaI-cleaved control PCR fragment after addition of T4 DNA Ligase; lane M, Perfect 100 bp Ladder. I, III BsaI restriction fragments numbered as in Figure 1.

    Techniques Used: Polymerase Chain Reaction, Functional Assay

    7) Product Images from "YeastFab: the design and construction of standard biological parts for metabolic engineering in Saccharomyces cerevisiae"

    Article Title: YeastFab: the design and construction of standard biological parts for metabolic engineering in Saccharomyces cerevisiae

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv464

    Overall scheme to construct standard biological parts, transcription units and pathways. ( A ) Overall strategy to construct the standard biological parts and to profile their functions. All parts generated in this study are derived from native sequences, amplified from S. cerevisiae genome by PCR. Each part is verified by sequencing. ( B ) Use of the part libraries to assemble transcription units (TUs) and pathways. Each part within a library is compatible with the parts from other libraries, allowing compositional assemblies. The TUs can be used for a second round of assembly, leading to the construction of multiple-gene pathways. The assembled pathways can be integrated into either a designated genomic locus or a plasmid. ( C ) Schematic representation of the acceptor vectors for parts. Each vector contains two different type IIs restriction enzyme recognition sites. BsaI was used to release the RFP marker, allowing quick identification of the correctly assembled parts. BsmBI was used to put different parts together to construct the transcription units.
    Figure Legend Snippet: Overall scheme to construct standard biological parts, transcription units and pathways. ( A ) Overall strategy to construct the standard biological parts and to profile their functions. All parts generated in this study are derived from native sequences, amplified from S. cerevisiae genome by PCR. Each part is verified by sequencing. ( B ) Use of the part libraries to assemble transcription units (TUs) and pathways. Each part within a library is compatible with the parts from other libraries, allowing compositional assemblies. The TUs can be used for a second round of assembly, leading to the construction of multiple-gene pathways. The assembled pathways can be integrated into either a designated genomic locus or a plasmid. ( C ) Schematic representation of the acceptor vectors for parts. Each vector contains two different type IIs restriction enzyme recognition sites. BsaI was used to release the RFP marker, allowing quick identification of the correctly assembled parts. BsmBI was used to put different parts together to construct the transcription units.

    Techniques Used: Construct, Generated, Derivative Assay, Amplification, Polymerase Chain Reaction, Sequencing, Plasmid Preparation, Marker

    8) Product Images from "Combinatorial Analysis of Secretory Immunoglobulin A (sIgA) Expression in Plants"

    Article Title: Combinatorial Analysis of Secretory Immunoglobulin A (sIgA) Expression in Plants

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms14036205

    Assembly process of the secretory immunoglobulin A (sIgA). ( a ) Collection of basic parts necessary to construct a secretory IgA. Each basic part is cloned in a pGem-T vector. 35S, SP, VH-CH, VL-CL, SC, JC, Tnos, correspond, respectively, to the 35s CMV promoter, pectate lyase signal peptide, variable and constant regions of the heavy chain, variable and constant regions of the light chain, secretory component, J-chain and nopaline synthase terminator; ( b ) Example of domestication of a basic part. The 35s promoter is flanked by fixed BsmbI recognition-cleavage sites. The overhangs left by the BsmbI restriction enzyme converge with GB pDGB vectors on 5′ and on 3′, with the next basic part to assemble; ( c ) Multipartite assembly of the basic parts to form the four different transcriptional units: heavy chain (HC), light chain (LC), secretory component (SC) and J-chain (JC), into level Ω-GB destiny vectors (pDGB_1AB3 and pDGB_3AB2); ( d ) Binary assembly of transcriptional units in level α-GB destination vectors (pDGB_C12B and pDGB_A12C), in order to construct two different composite parts—IgA and JC-SC; ( e ) Last construct of sIgA by binary assembly of two composite parts in a final pDGB; ( f ) Example of restriction analysis of four colonies of each construct: left, BglII (expected bands of 2825, 1886 and 1197) and BglI (expected bands of 2345, 1790, 1498 and 275) restriction analysis of the HC transcriptional unit; middle, BglII (expected bands of 4183, 2495 and 1228 kDa) restriction analysis of IgA; right, BamHI (expected bands of 6815, 5857 and 913 kDa) and BsaI (expected bands of 10,664 + 2921 kDa) restriction analysis of sIgA.
    Figure Legend Snippet: Assembly process of the secretory immunoglobulin A (sIgA). ( a ) Collection of basic parts necessary to construct a secretory IgA. Each basic part is cloned in a pGem-T vector. 35S, SP, VH-CH, VL-CL, SC, JC, Tnos, correspond, respectively, to the 35s CMV promoter, pectate lyase signal peptide, variable and constant regions of the heavy chain, variable and constant regions of the light chain, secretory component, J-chain and nopaline synthase terminator; ( b ) Example of domestication of a basic part. The 35s promoter is flanked by fixed BsmbI recognition-cleavage sites. The overhangs left by the BsmbI restriction enzyme converge with GB pDGB vectors on 5′ and on 3′, with the next basic part to assemble; ( c ) Multipartite assembly of the basic parts to form the four different transcriptional units: heavy chain (HC), light chain (LC), secretory component (SC) and J-chain (JC), into level Ω-GB destiny vectors (pDGB_1AB3 and pDGB_3AB2); ( d ) Binary assembly of transcriptional units in level α-GB destination vectors (pDGB_C12B and pDGB_A12C), in order to construct two different composite parts—IgA and JC-SC; ( e ) Last construct of sIgA by binary assembly of two composite parts in a final pDGB; ( f ) Example of restriction analysis of four colonies of each construct: left, BglII (expected bands of 2825, 1886 and 1197) and BglI (expected bands of 2345, 1790, 1498 and 275) restriction analysis of the HC transcriptional unit; middle, BglII (expected bands of 4183, 2495 and 1228 kDa) restriction analysis of IgA; right, BamHI (expected bands of 6815, 5857 and 913 kDa) and BsaI (expected bands of 10,664 + 2921 kDa) restriction analysis of sIgA.

    Techniques Used: Construct, Clone Assay, Plasmid Preparation, Liquid Chromatography

    9) Product Images from "Efficient CRISPR/Cas9-based genome editing and its application to conditional genetic analysis in Marchantia polymorpha"

    Article Title: Efficient CRISPR/Cas9-based genome editing and its application to conditional genetic analysis in Marchantia polymorpha

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0205117

    All-in-one vector systems for genome editing in M . polymorpha . (A) Designs of Gateway-based all-in-one binary vectors and entry plasmids for gRNA cloning. pMpGE010 and pMpGE011 contain a cassette for the expression of Atco-Cas9 fused with an NLS under the control of Mp EF pro , a Gateway cassette, and a cassette for the expression of hygromycin phosphotransferase ( HPT ) in pMpGE010 and mutated acetolactate synthase ( mALS ) in pMpGE011. pMpGE_En01 contains recognition sites for two restriction enzymes, SacI and PstI, upstream of a gRNA backbone for the insertion of a guide sequence by In-Fusion/Gibson cloning, which automatically places a G nucleotide for transcription initiation by RNA polymerase III (extra initial G). Expression of single guide RNAs is controlled by a 2 kbp fragment of Mp U6-1 pro . pMpGE_En02 and pMpGE_En03 contain two BsaI recognition sites upstream of the gRNA backbone for the insertion of a guide sequence by ligation without or with an “extra initial G,” whose expression is under the control of a 500 bp Mp U6-1 pro fragment. For all the entry vectors, the gRNA cassette is flanked by the attL1 and attL2 sequences and is thus transferrable to the Gateway cassette in pMpGE010 or pMpGWB011 by the LR reaction. (B) Designs of all-in-one binary vectors for direct gRNA cloning. pMpGE013 ( HPT marker) and pMpGE014 ( mALS marker) contain the Atco-Cas9-NLS expression cassette, a unique AarI site in the upstream of the gRNA backbone for insertion of a guide sequence by ligation with an “extra initial G,” whose expression is under the control of a 500 bp Mp U6-1 pro fragment.
    Figure Legend Snippet: All-in-one vector systems for genome editing in M . polymorpha . (A) Designs of Gateway-based all-in-one binary vectors and entry plasmids for gRNA cloning. pMpGE010 and pMpGE011 contain a cassette for the expression of Atco-Cas9 fused with an NLS under the control of Mp EF pro , a Gateway cassette, and a cassette for the expression of hygromycin phosphotransferase ( HPT ) in pMpGE010 and mutated acetolactate synthase ( mALS ) in pMpGE011. pMpGE_En01 contains recognition sites for two restriction enzymes, SacI and PstI, upstream of a gRNA backbone for the insertion of a guide sequence by In-Fusion/Gibson cloning, which automatically places a G nucleotide for transcription initiation by RNA polymerase III (extra initial G). Expression of single guide RNAs is controlled by a 2 kbp fragment of Mp U6-1 pro . pMpGE_En02 and pMpGE_En03 contain two BsaI recognition sites upstream of the gRNA backbone for the insertion of a guide sequence by ligation without or with an “extra initial G,” whose expression is under the control of a 500 bp Mp U6-1 pro fragment. For all the entry vectors, the gRNA cassette is flanked by the attL1 and attL2 sequences and is thus transferrable to the Gateway cassette in pMpGE010 or pMpGWB011 by the LR reaction. (B) Designs of all-in-one binary vectors for direct gRNA cloning. pMpGE013 ( HPT marker) and pMpGE014 ( mALS marker) contain the Atco-Cas9-NLS expression cassette, a unique AarI site in the upstream of the gRNA backbone for insertion of a guide sequence by ligation with an “extra initial G,” whose expression is under the control of a 500 bp Mp U6-1 pro fragment.

    Techniques Used: Plasmid Preparation, Clone Assay, Expressing, Sequencing, Ligation, Marker

    10) Product Images from "MetClo: methylase-assisted hierarchical DNA assembly using a single type IIS restriction enzyme"

    Article Title: MetClo: methylase-assisted hierarchical DNA assembly using a single type IIS restriction enzyme

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky596

    Identification of suitable methylases for methylation-switching. ( A ) Initial screening of functional methylases for selective blocking of overlapping methylation/restriction sites. The diagrams show the design of overlapping sites for screening of methylase activity. The table shows the screening result using methylases expressed in vivo from an F-ori based low copy number vector. Restriction enzyme recognition sites are boxed in solid lines. The adhesive ends generated by the restriction enzyme are shown by solid lines. Methylase recognition sites are boxed in dashed lines, and methylated bases are in bold font. All the listed methylases modify N6-adenine, except M.SacI and M.AspJHL3I, which modify C5-cytosine and N4-cytosine respectively. ( B ) Experimental designs to test blocking of methylation-switchable type IIS restriction enzyme sites by in vivo methylation. For each methylase/restriction enzyme combination tested, the test plasmid contains a head-to-head potentially methylation-switchable restriction site and a non-methylatable restriction site. Restriction digestion of test plasmid prepared from a normal E. coli strain would result in cutting at both sites and the release of a 600 bp fragment from the 4.3 kb vector backbone. Restriction digestion of test plasmid prepared from a strain expressing the switch methylase would result in a single 4.9 kb band, due to blocking of the methylation-switchable restriction sites by in vivo methylation. The restriction sites of the test plasmids for each restriction enzyme are shown, with the restriction site boxed in solid line, the methylase recognition site boxed in dashed line, and the methylated bases in bold. The head-to-head arrangement of overlapping methylation/restriction site allows the same assay to be used to detect any residual single strand nicking activity of the restriction enzyme towards the methylated restriction site. ( C ) Agarose gel electrophoresis analysis of the test plasmids for each methylation-switchable restriction site after preparation of the plasmids in a normal strain (–) or in a strain expressing the appropriate DNA methylase (+) and digested with the corresponding type IIS restriction enzymes. The combinations tested were BsaI with M.Osp807II methylase using test plasmid pMOP_BsaINC, BpiI with M2.NmeMC58II methylase using test plasmid pMOP_BpiINC, and LguI with M.XmnI methylase using test plasmid pMOP_LguINC. Test conditions were 60 fmol test plasmid digested using 5 U BsaI or BpiI, or 2.5 U LguI in 10 μl reactions at 37°C for 1 h. The results show that in vivo methylation by each of the methylases successfully blocked the restriction site for the corresponding type IIS restriction enzyme when the methylase recognition site overlapped the restriction enzyme site. The data shown represents results from three independent experiments.
    Figure Legend Snippet: Identification of suitable methylases for methylation-switching. ( A ) Initial screening of functional methylases for selective blocking of overlapping methylation/restriction sites. The diagrams show the design of overlapping sites for screening of methylase activity. The table shows the screening result using methylases expressed in vivo from an F-ori based low copy number vector. Restriction enzyme recognition sites are boxed in solid lines. The adhesive ends generated by the restriction enzyme are shown by solid lines. Methylase recognition sites are boxed in dashed lines, and methylated bases are in bold font. All the listed methylases modify N6-adenine, except M.SacI and M.AspJHL3I, which modify C5-cytosine and N4-cytosine respectively. ( B ) Experimental designs to test blocking of methylation-switchable type IIS restriction enzyme sites by in vivo methylation. For each methylase/restriction enzyme combination tested, the test plasmid contains a head-to-head potentially methylation-switchable restriction site and a non-methylatable restriction site. Restriction digestion of test plasmid prepared from a normal E. coli strain would result in cutting at both sites and the release of a 600 bp fragment from the 4.3 kb vector backbone. Restriction digestion of test plasmid prepared from a strain expressing the switch methylase would result in a single 4.9 kb band, due to blocking of the methylation-switchable restriction sites by in vivo methylation. The restriction sites of the test plasmids for each restriction enzyme are shown, with the restriction site boxed in solid line, the methylase recognition site boxed in dashed line, and the methylated bases in bold. The head-to-head arrangement of overlapping methylation/restriction site allows the same assay to be used to detect any residual single strand nicking activity of the restriction enzyme towards the methylated restriction site. ( C ) Agarose gel electrophoresis analysis of the test plasmids for each methylation-switchable restriction site after preparation of the plasmids in a normal strain (–) or in a strain expressing the appropriate DNA methylase (+) and digested with the corresponding type IIS restriction enzymes. The combinations tested were BsaI with M.Osp807II methylase using test plasmid pMOP_BsaINC, BpiI with M2.NmeMC58II methylase using test plasmid pMOP_BpiINC, and LguI with M.XmnI methylase using test plasmid pMOP_LguINC. Test conditions were 60 fmol test plasmid digested using 5 U BsaI or BpiI, or 2.5 U LguI in 10 μl reactions at 37°C for 1 h. The results show that in vivo methylation by each of the methylases successfully blocked the restriction site for the corresponding type IIS restriction enzyme when the methylase recognition site overlapped the restriction enzyme site. The data shown represents results from three independent experiments.

    Techniques Used: Methylation, Functional Assay, Blocking Assay, Activity Assay, In Vivo, Low Copy Number, Plasmid Preparation, Generated, Expressing, Agarose Gel Electrophoresis

    BsaI-M.Osp807II based MetClo system. The donor plasmids contain DNA fragments to be assembled (Fragments A–D) flanked by BsaI sites that generate compatible adhesive ends (schematically labelled aaaa-eeee). The BsaI sites overlap with the M.Osp807II methylase recognition sequence. Donor plasmids were prepared from a normal strain that does not express the M.Osp807II switch methylase. As a result, the BsaI sites are not methylated and so the insert DNA fragments can be released by BsaI digestion. The recipient assembly vector contains a LacZα selection marker flanked by head-to-head BsaI sites. The outer pair of BsaI sites closer to the vector backbone overlap with an M.Osp807II methylation sequence and so are methylation-switchable, whereas the inner pair of BsaI sites are not. Preparation of the assembly vector in the M.Osp807II switch methylase-expressing DH10B strain results in selective blocking of the outer pair of BsaI sites. The LacZα fragment can be released by BsaI through cutting at inner pair of BsaI sites. Following a one-pot reaction using BsaI and T4 DNA ligase, ligation among compatible adhesive ends results in ordered assembly of DNA fragments into the assembly vector backbone. The assembled fragment in the assembled plasmid is flanked by methylated BsaI sites, which are not cut by BsaI. Following transformation into a normal strain that does not express the M.Osp807II switch methylase, methylation of the flanking restriction sites is lost, and the assembled fragment can be released by BsaI for the next stage assembly.
    Figure Legend Snippet: BsaI-M.Osp807II based MetClo system. The donor plasmids contain DNA fragments to be assembled (Fragments A–D) flanked by BsaI sites that generate compatible adhesive ends (schematically labelled aaaa-eeee). The BsaI sites overlap with the M.Osp807II methylase recognition sequence. Donor plasmids were prepared from a normal strain that does not express the M.Osp807II switch methylase. As a result, the BsaI sites are not methylated and so the insert DNA fragments can be released by BsaI digestion. The recipient assembly vector contains a LacZα selection marker flanked by head-to-head BsaI sites. The outer pair of BsaI sites closer to the vector backbone overlap with an M.Osp807II methylation sequence and so are methylation-switchable, whereas the inner pair of BsaI sites are not. Preparation of the assembly vector in the M.Osp807II switch methylase-expressing DH10B strain results in selective blocking of the outer pair of BsaI sites. The LacZα fragment can be released by BsaI through cutting at inner pair of BsaI sites. Following a one-pot reaction using BsaI and T4 DNA ligase, ligation among compatible adhesive ends results in ordered assembly of DNA fragments into the assembly vector backbone. The assembled fragment in the assembled plasmid is flanked by methylated BsaI sites, which are not cut by BsaI. Following transformation into a normal strain that does not express the M.Osp807II switch methylase, methylation of the flanking restriction sites is lost, and the assembled fragment can be released by BsaI for the next stage assembly.

    Techniques Used: Sequencing, Methylation, Plasmid Preparation, Selection, Marker, Expressing, Blocking Assay, Ligation, Transformation Assay

    Design of a standard MetClo vector set. Three types of adaptor sequences were designed for the standard MetClo vector set. The vectors contain two head-to-head BsaI sites (boxed) flanking the negative selection marker LacZα. The pair of unmethylated BsaI sites closest to the negative selection marker can be used to release LacZα and generates adhesive ends ‘p’ and ‘q’. This allows any fragments that start with adhesive end ‘p’ and end with adhesive end ‘q’ to be cloned into any of the three types of adaptor sequences (types ‘Start’, ‘Middle’, ‘End’). The outer pair of BsaI sites closest to the vector backbone overlap with the M.Osp807II recognition sequence and are both methylated at the adenine bases highlighted in bold when the vector is prepared in M.Osp807II-expressing E. coli strain. A DNA fragment assembled into these vectors, following transformation into a normal E. coli strain which lacks this switch methylase activity, can be released from the assembled plasmid using BsaI, which can now recognize this unmethylated BsaI site. The released fragment will carry different adhesive ends depending on the type of the vector used. Assembly into a type ‘Start’ vector will generate a fragment flanked by adaptors ‘p-a’; assembly into a type ‘Middle’ vector will generate a fragment flanked by ‘a-b’, ‘b-c’, ‘c-d’ or ‘d-e’; assembly into a type ‘End’ vector will generate a fragment flanked by ‘a-q’, ‘b-q’, ‘c-q’, ‘d-q’ or ‘e-q’. The design of these LacZα selection cassettes flanked by unique adaptors are represented in the figure by the letter codes for the outside adaptor sequences.
    Figure Legend Snippet: Design of a standard MetClo vector set. Three types of adaptor sequences were designed for the standard MetClo vector set. The vectors contain two head-to-head BsaI sites (boxed) flanking the negative selection marker LacZα. The pair of unmethylated BsaI sites closest to the negative selection marker can be used to release LacZα and generates adhesive ends ‘p’ and ‘q’. This allows any fragments that start with adhesive end ‘p’ and end with adhesive end ‘q’ to be cloned into any of the three types of adaptor sequences (types ‘Start’, ‘Middle’, ‘End’). The outer pair of BsaI sites closest to the vector backbone overlap with the M.Osp807II recognition sequence and are both methylated at the adenine bases highlighted in bold when the vector is prepared in M.Osp807II-expressing E. coli strain. A DNA fragment assembled into these vectors, following transformation into a normal E. coli strain which lacks this switch methylase activity, can be released from the assembled plasmid using BsaI, which can now recognize this unmethylated BsaI site. The released fragment will carry different adhesive ends depending on the type of the vector used. Assembly into a type ‘Start’ vector will generate a fragment flanked by adaptors ‘p-a’; assembly into a type ‘Middle’ vector will generate a fragment flanked by ‘a-b’, ‘b-c’, ‘c-d’ or ‘d-e’; assembly into a type ‘End’ vector will generate a fragment flanked by ‘a-q’, ‘b-q’, ‘c-q’, ‘d-q’ or ‘e-q’. The design of these LacZα selection cassettes flanked by unique adaptors are represented in the figure by the letter codes for the outside adaptor sequences.

    Techniques Used: Plasmid Preparation, Selection, Marker, Clone Assay, Sequencing, Methylation, Expressing, Transformation Assay, Activity Assay

    11) Product Images from "Sequence-Specific DNA Detection at 10 fM by Electromechanical Signal Transduction"

    Article Title: Sequence-Specific DNA Detection at 10 fM by Electromechanical Signal Transduction

    Journal: Analytical Chemistry

    doi: 10.1021/ac5021408

    Schematic of DNA oligomer preparation. (a) Purified pET-21b plasmids were enzymatically digested by selected pairs of ScaI, PvuI, Pst I, BsaI, and EcoNI restriction enzymes, producing fragments of different lengths. The target DNA sequence complementary to the PNA probe is located beginning at plasmid position 4427 (orange band). Plasmid digestion by ScaI and PvuI produced a 110-base, target-containing fragment, T1. Plasmid digestion by PvuI and PstI produced a 125-base, target-free control fragment, C1. Other fragments were produced similarly: T2 (235 bases) using ScaI and PstI, T3 (419 bases) using ScaI and BsaI, T4 (1613 bases) using by PvuI and EcoNI), C2 (184 bases) using PstI and BsaI, C3 (309 bases) using PvuI and BsaI, and C4 (1503 bases) using ScaI and EcoNI. (b) Following digestion, the DNA was isolated by gel electrophoresis, extracted, and purified. (c) Purified double-stranded DNA was denatured and hybridized with bead–PNA probe conjugates. (d) DNA–PNA–bead mixture was injected into the micropipette for electrical detection.
    Figure Legend Snippet: Schematic of DNA oligomer preparation. (a) Purified pET-21b plasmids were enzymatically digested by selected pairs of ScaI, PvuI, Pst I, BsaI, and EcoNI restriction enzymes, producing fragments of different lengths. The target DNA sequence complementary to the PNA probe is located beginning at plasmid position 4427 (orange band). Plasmid digestion by ScaI and PvuI produced a 110-base, target-containing fragment, T1. Plasmid digestion by PvuI and PstI produced a 125-base, target-free control fragment, C1. Other fragments were produced similarly: T2 (235 bases) using ScaI and PstI, T3 (419 bases) using ScaI and BsaI, T4 (1613 bases) using by PvuI and EcoNI), C2 (184 bases) using PstI and BsaI, C3 (309 bases) using PvuI and BsaI, and C4 (1503 bases) using ScaI and EcoNI. (b) Following digestion, the DNA was isolated by gel electrophoresis, extracted, and purified. (c) Purified double-stranded DNA was denatured and hybridized with bead–PNA probe conjugates. (d) DNA–PNA–bead mixture was injected into the micropipette for electrical detection.

    Techniques Used: Purification, Positron Emission Tomography, Sequencing, Plasmid Preparation, Produced, Isolation, Nucleic Acid Electrophoresis, Injection

    12) Product Images from "Programmed Evolution for Optimization of Orthogonal Metabolic Output in Bacteria"

    Article Title: Programmed Evolution for Optimization of Orthogonal Metabolic Output in Bacteria

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0118322

    Combinatorics Module. (A) Junction-Golden Gate Assembly (J-GGA) introduces genetic variation into a single gene expression cassette as shown, or multiple gene expression cassettes arranged in tandem. PCR amplifies the vector and adds BsaI restriction sites and sticky ends complementary to the elements to be inserted. J-GGA inserts element(s) using standardized PCR primers regardless of the insert sequences. (B) The online Golden Gate Assembly Junction Evaluative Tool (GGAJET) enables users to design junctions with compatible sticky ends and specific primers with similar melting temperatures. GGAJET is available at gcat.davidson.edu/SynBio13/GGAJET/ .
    Figure Legend Snippet: Combinatorics Module. (A) Junction-Golden Gate Assembly (J-GGA) introduces genetic variation into a single gene expression cassette as shown, or multiple gene expression cassettes arranged in tandem. PCR amplifies the vector and adds BsaI restriction sites and sticky ends complementary to the elements to be inserted. J-GGA inserts element(s) using standardized PCR primers regardless of the insert sequences. (B) The online Golden Gate Assembly Junction Evaluative Tool (GGAJET) enables users to design junctions with compatible sticky ends and specific primers with similar melting temperatures. GGAJET is available at gcat.davidson.edu/SynBio13/GGAJET/ .

    Techniques Used: Expressing, Polymerase Chain Reaction, Plasmid Preparation

    Related Articles

    Clone Assay:

    Article Title: Fungal-type carbohydrate binding modules from the coccolithophore Emiliania huxleyi show binding affinity to cellulose and chitin
    Article Snippet: The pelB, linker, and CBM1 sequences were ordered as GeneArt Strings (ThermoFisher) and the AP segment was obtained with PCR (using KAPA HiFi DNA Polymerase from KAPA Biosystems and primers from Eurofins), all flanked with BsaI restriction sites and appropriate 4bp overlaps. .. Using the Golden Gate cloning method [ ] the pieces were combined (digest with BsaI-HF from NEB) and ligated (T4 DNA Ligase NEB) into a pET28a (+) expression vector and transformed in chemically competent TOP10 E . coli cells. .. The resulting plasmids were obtained by miniprep (NucleoSpin Plasmid from Macherey-Nagel).

    Article Title: YeastFab: the design and construction of standard biological parts for metabolic engineering in Saccharomyces cerevisiae
    Article Snippet: 1.5 μl PCR fragments and 15 ng reporter plasmids were mixed together with 3 U of BsaI-HF (NEB), 0.5 U of T4 DNA ligase (Thermo Scientific) in 1× T4 ligase Buffer (Thermo Scientific). .. The correct reporter constructs were transformed into the yeast strain following the standard protocol and selected on synthetic complete medium lacking leucine (SC-Leu).

    Article Title: CRISPR/Cas9 Editing of the Bacillus subtilis Genome
    Article Snippet: Prepare pPB41 digested with the restriction endonuclease Bsa I ( ) Assemble 50 μl restriction digest reaction: 1x Cutsmart buffer (NEB), 2 μl Bsa I-HF (20,000 U/ml; NEB), and 5 μg pPB41. .. Notes: The plasmid pPB41 is typically used, but we also generated a derivative, pPB105, wherein the spectinomycin resistance cassette was replaced with a chloramphenicol resistance cassette (see ).

    Article Title: Quantitative analysis of TALE-DNA interactions suggests polarity effects
    Article Snippet: Designed TALE (dTALE) repeat arrays were modularly assembled using the Golden Gate cloning reagents described in , with slight modifications to the procedures. .. Each cut-ligation reaction used 75 ng of appropriate plasmids with Bsa I-HF (New England Biolabs) and T4 ligase (New England Biolabs) that were incubated at 37°C for 5 h. On sequence verification, the three segments were assembled in a second cut-ligation reaction using a vector containing the last half-repeat to form a complete 17.5-repeat array (5 + 5 + 7 + 0.5 = 17.5).

    Article Title: Smart DNA Fabrication Using Sound Waves
    Article Snippet: Bacteria carrying the residual RFP plasmid will give a bright red pigment, which would facilitate the visual identification of correct assembled clones (white colonies; see ). .. The Golden Gate master mix was made of 35 µL T4 ligase (2000 U/µl, New England Biolabs, NEB), 35 µL BsaI-HF (NEB), 52.5 µL 10× T4 buffer (NEB), and 25 µL 200× BSA (NEB).

    Article Title: Development of a low-cost cellulase production process using Trichoderma reesei for Brazilian biorefineries
    Article Snippet: All restriction enzymes used in this study were FastDigest enzymes from Thermo Scientific, except for BsaI-HF (NEB). .. All restriction enzymes used in this study were FastDigest enzymes from Thermo Scientific, except for BsaI-HF (NEB).

    Article Title: Efficient Targeted Mutagenesis in Medaka Using Custom-Designed Transcription Activator-Like Effector Nucleases
    Article Snippet: Each module containing an RVD was excised from each module plasmid (pNI, pHD, pNN, and pNG vectors) using Bsa I-HF (New England Biolabs, Ipswich, MA), and then the fragment was purified using NucleoSpin Gel and PCR Clean-up kit (MACHEREY-NAGEL, Düren, Germany). .. Each module containing an RVD was excised from each module plasmid (pNI, pHD, pNN, and pNG vectors) using Bsa I-HF (New England Biolabs, Ipswich, MA), and then the fragment was purified using NucleoSpin Gel and PCR Clean-up kit (MACHEREY-NAGEL, Düren, Germany).

    Article Title: MutS2 Promotes Homologous Recombination in Bacillus subtilis
    Article Snippet: First, the spacer was incorporated into the CRISPR array via restriction digestion and ligation cloning. .. The plasmid was digested with BsaI-HF (NEB) in CutSmart buffer at 37°C.

    Article Title: GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis
    Article Snippet: Even more importantly, the activity of the restriction endonuclease is a limiting factor for GreenGate cloning. .. We found both Bsa I-HF from NewEngland Biolabs, as well as the isoschizomer FastDigest Eco 31I from Fermentas to be highly sensitive to temperature fluctuations in a batch dependent manner.

    Amplification:

    Article Title: Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides
    Article Snippet: Paragraph title: Pseudogene in vitro amplification ... We applied the same procedure to get the linear 378 nt long ODN pseudogene but using ampicillin (100 µg/ml) in the 5 ml LB culture and BsaI-HF as restriction enzyme (New England Biolabs).

    Article Title: interleukin-11 induces and maintains progenitors of different cell lineages during Xenopus tadpole tail regeneration
    Article Snippet: In brief, DR274 plasmid was digested with Bsa I-HF (New England Biolabs, MA), annealed with oligonucleotide, and they were ligated. .. Some of the gRNA template plasmids were assembled using a PCR-amplified DR274 fragment, an oligonucleotide, and an In-Fusion HD Cloning Kit (TaKaRa).

    Article Title: Reprograming the replisome of a semi-synthetic organism for the expansion of the genetic alphabet
    Article Snippet: BsaI-HF (0.33 U/μL) and T5 exonuclease (0.16 U/μL, New England Biolabs) were then added, and the reaction was incubated at 37 °C for 1 h to remove any pUCX2 without an insert. .. The 150 bp DNA was produced with a 50-μL PCR using the same reaction solution conditions as above and the following temperature regime (time in mm:ss): [98 °C 02:00 | 5 × (98 °C 00:10 | 50 °C 00:10 | 68 °C 04:00) | 15 × (98 °C 00:10 | 58 °C 00:10 | 68 °C 04:00)].

    Article Title: Multiplex target capture with double-stranded DNA probes
    Article Snippet: The protocol of ssLPP construction by PCR amplification from lambda DNA was described previously [ , ]. .. The purified PCR products are simultaneously digested for 1 hour at 37°C using MlyI and BsaI-HF (NEB, Ipswich, MA, USA), only leaving the target sequences at each probe end, respectively.

    Article Title: Smart DNA Fabrication Using Sound Waves
    Article Snippet: We amplified the promoter pMBP1 (500 bp) directly from yeast BY4741 (MATa,leu2∆0 met15∆0 ura3∆0 his3∆1 ) genomic DNA with primers YCp2395 and YCp2396 and added a pair of inward-facing BsaI sites to flank the promoter part ( ). .. The Golden Gate master mix was made of 35 µL T4 ligase (2000 U/µl, New England Biolabs, NEB), 35 µL BsaI-HF (NEB), 52.5 µL 10× T4 buffer (NEB), and 25 µL 200× BSA (NEB).

    Article Title: Construction of a novel anaerobic pathway in Escherichia coli for propionate production
    Article Snippet: Double terminator DNA fragment was PCR amplified using the c-lac-dbl term primer set. .. In a 10 μL Golden Gate reaction mixture, 100 ng of the linearized vector backbone and equimolar amounts of the other assembly pieces were blended with 0.5 μL BsaI-HF, 0.5 μL T4 ligase and 1× T4 ligase buffer (New England Biolabs, Ipswich, MA).

    Article Title: A high-efficiency CRISPR/Cas9 system for targeted mutagenesis in Cotton (Gossypium hirsutum L.)
    Article Snippet: The GhMYB25-like-sgRNA1 and GhMYB25-like-sgRNA2 expression module was assembled by direct PCR amplification using pCBC-DT1T2 template as described previously . .. And then this PCR product was purified for the Golden Gate assembly of Cas9 expression module through the Type IIS restriction endonucleases (REases) BsaI reaction (R3535L, New England Biolabs).

    Article Title: BtsCI and BseGI display sequence preference in the nucleotides flanking the recognition sequence
    Article Snippet: Briefly, we incubated 20 μg of pPDGF plasmid DNA containing our insert (sequence in Data A in , ThermoFischer Scientific) with BsaI-HF (New England Biolabs(NEB)) for 4h in NEB4 buffer (50mM Potassium acetate, 20mM Tris-acetate, 10mM Mg-acetate, 1mM DTT). .. Briefly, we incubated 20 μg of pPDGF plasmid DNA containing our insert (sequence in Data A in , ThermoFischer Scientific) with BsaI-HF (New England Biolabs(NEB)) for 4h in NEB4 buffer (50mM Potassium acetate, 20mM Tris-acetate, 10mM Mg-acetate, 1mM DTT).

    Positive Control:

    Article Title: Smart DNA Fabrication Using Sound Waves
    Article Snippet: The Golden Gate master mix was made of 35 µL T4 ligase (2000 U/µl, New England Biolabs, NEB), 35 µL BsaI-HF (NEB), 52.5 µL 10× T4 buffer (NEB), and 25 µL 200× BSA (NEB). .. The Golden Gate master mix was made of 35 µL T4 ligase (2000 U/µl, New England Biolabs, NEB), 35 µL BsaI-HF (NEB), 52.5 µL 10× T4 buffer (NEB), and 25 µL 200× BSA (NEB).

    Synthesized:

    Article Title: mKast is dispensable for normal development and sexual maturation of the male European honeybee
    Article Snippet: RNA synthesis of sgRNA and Cas9 mRNA were conducted as described previously . .. For synthesis of the sgRNA, oligo DNAs containing sequences corresponding to the sgRNA target site and restriction enzyme recognition site were synthesized (Fasmac, Japan), and annealed oligomers were ligated into the vector pDR274 (Addgene, UK) and cut with Bsa I-HF (New England Biolabs, Japan). .. After linearization using Dra I (Takara, Japan), the sgRNA was in vitro -transcribed using the T7- Flash Transcription Kit (Epicentre, USA), purified by phenol/chloroform extraction and ethanol precipitation, and stored at −80 °C until use.

    Article Title: Reprograming the replisome of a semi-synthetic organism for the expansion of the genetic alphabet
    Article Snippet: UBP containing dsDNA was produced with a 50-μL PCR with chemically synthesized UBP containing oligonucleotides (0.025 ng/μL), primers introducing BsaI sites and vector homology (1 μM, ), d TPT3 TP (100 μM), d NaM TP (100 μM), dNTPs (200 μM), MgSO4 (1.2 mM), One Taq DNA Polymerase (0.025 U/μL), and One Taq Standard Reaction Buffer (1×, New England Biolabs). .. BsaI-HF (0.33 U/μL) and T5 exonuclease (0.16 U/μL, New England Biolabs) were then added, and the reaction was incubated at 37 °C for 1 h to remove any pUCX2 without an insert.

    Lambda DNA Preparation:

    Article Title: Multiplex target capture with double-stranded DNA probes
    Article Snippet: In brief, oligonucleotide primers containing MlyI (forward primer) and/or BsaI (reverse primer) sites at their 5' ends, genomic target sequences (18 to 28 bp) in the middle, and bacteriophage lambda sequences at 3' ends, are used to amplify the probes' common spacer backbone of approximately 280 bp from bacteriophage lambda DNA. .. The purified PCR products are simultaneously digested for 1 hour at 37°C using MlyI and BsaI-HF (NEB, Ipswich, MA, USA), only leaving the target sequences at each probe end, respectively.

    Construct:

    Article Title: Fungal-type carbohydrate binding modules from the coccolithophore Emiliania huxleyi show binding affinity to cellulose and chitin
    Article Snippet: The CBM1 constructs were designed to have a carrier protein fused to the CBM1 domain by a flexible linker, in addition to the N-terminal pelB signal peptide and a 6His purification tag on the C-terminus. .. Using the Golden Gate cloning method [ ] the pieces were combined (digest with BsaI-HF from NEB) and ligated (T4 DNA Ligase NEB) into a pET28a (+) expression vector and transformed in chemically competent TOP10 E . coli cells.

    Article Title: YeastFab: the design and construction of standard biological parts for metabolic engineering in Saccharomyces cerevisiae
    Article Snippet: 1.5 μl PCR fragments and 15 ng reporter plasmids were mixed together with 3 U of BsaI-HF (NEB), 0.5 U of T4 DNA ligase (Thermo Scientific) in 1× T4 ligase Buffer (Thermo Scientific). .. The plasmid DNA from positive colony PCR candidates was isolated and sequenced.

    Article Title: Reprograming the replisome of a semi-synthetic organism for the expansion of the genetic alphabet
    Article Snippet: pINFs ( ) were constructed through Golden Gate assembly of pUCX2 and insert dsDNA containing a d NaM -d TPT3 pair as described previously with the following modifications. .. BsaI-HF (0.33 U/μL) and T5 exonuclease (0.16 U/μL, New England Biolabs) were then added, and the reaction was incubated at 37 °C for 1 h to remove any pUCX2 without an insert.

    Article Title: Development of a low-cost cellulase production process using Trichoderma reesei for Brazilian biorefineries
    Article Snippet: All restriction enzymes used in this study were FastDigest enzymes from Thermo Scientific, except for BsaI-HF (NEB). .. All restriction enzymes used in this study were FastDigest enzymes from Thermo Scientific, except for BsaI-HF (NEB).

    Article Title: Construction of a novel anaerobic pathway in Escherichia coli for propionate production
    Article Snippet: To construct plac-Sbm plasmid, Sbm operon was PCR amplified using the c-lac-sbm primer set. .. In a 10 μL Golden Gate reaction mixture, 100 ng of the linearized vector backbone and equimolar amounts of the other assembly pieces were blended with 0.5 μL BsaI-HF, 0.5 μL T4 ligase and 1× T4 ligase buffer (New England Biolabs, Ipswich, MA).

    End-sequence Profiling:

    Article Title: Efficient Targeted Mutagenesis in Medaka Using Custom-Designed Transcription Activator-Like Effector Nucleases
    Article Snippet: Each module containing an RVD was excised from each module plasmid (pNI, pHD, pNN, and pNG vectors) using Bsa I-HF (New England Biolabs, Ipswich, MA), and then the fragment was purified using NucleoSpin Gel and PCR Clean-up kit (MACHEREY-NAGEL, Düren, Germany). .. To generate repeat arrays, the modules were cloned into the dephosphorylated array plasmid (pFUS vectors) using Ligation high Ver.2 (Toyobo, Osaka, Japan).

    Electrophoresis:

    Article Title: Development of a low-cost cellulase production process using Trichoderma reesei for Brazilian biorefineries
    Article Snippet: All restriction enzymes used in this study were FastDigest enzymes from Thermo Scientific, except for BsaI-HF (NEB). .. The used cloning host (Escherichia coli DH5a) as well as the kits used for purifying DNA from E. coli , fungi, and agarose gels were from Zymo Research.

    Knock-In:

    Article Title: Reprograming the replisome of a semi-synthetic organism for the expansion of the genetic alphabet
    Article Snippet: BsaI-HF (0.33 U/μL) and T5 exonuclease (0.16 U/μL, New England Biolabs) were then added, and the reaction was incubated at 37 °C for 1 h to remove any pUCX2 without an insert. .. This reaction was purified using a DNA Clean & Concentrator-5 according to manufacturer recommendations except that reactions were mixed with 3 volumes of 1:1 DNA Wash:DNA Binding Buffer before binding to the silica column.

    Incubation:

    Article Title: Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides
    Article Snippet: We inoculated 5 ml LB containing kanamycin (50 µg/ml) with a single colony of E. coli transformed with the pMK-RQ vector containing the CP pseudogene and incubated overnight at 37 °C, shaking at 250 rpm. .. We applied the same procedure to get the linear 378 nt long ODN pseudogene but using ampicillin (100 µg/ml) in the 5 ml LB culture and BsaI-HF as restriction enzyme (New England Biolabs).

    Article Title: Reprograming the replisome of a semi-synthetic organism for the expansion of the genetic alphabet
    Article Snippet: For pINF assembly, pUCX2 (1 μg) and insert DNA were combined at a 1:4 molar ratio in a 80 μL reaction with ATP (1 mM), T4 DNA ligase (6.65 U/μL, New England Biolabs), BsaI-HF (0.66 U/μL, New England Biolabs), and CutSmart Buffer (1×, New England Biolabs) and subjected to the following temperature regime: [37 °C 20 min | 40 × (37 °C 5 min | 16 °C 10 min | 22 °C 5 min) | 37 °C 20 min | 50 °C 15 min | 70 °C 30 min]. .. BsaI-HF (0.33 U/μL) and T5 exonuclease (0.16 U/μL, New England Biolabs) were then added, and the reaction was incubated at 37 °C for 1 h to remove any pUCX2 without an insert. .. This reaction was purified using a DNA Clean & Concentrator-5 according to manufacturer recommendations except that reactions were mixed with 3 volumes of 1:1 DNA Wash:DNA Binding Buffer before binding to the silica column.

    Article Title: Quantitative analysis of TALE-DNA interactions suggests polarity effects
    Article Snippet: The first reaction assembled two five-repeat arrays and one seven-repeat array. .. Each cut-ligation reaction used 75 ng of appropriate plasmids with Bsa I-HF (New England Biolabs) and T4 ligase (New England Biolabs) that were incubated at 37°C for 5 h. On sequence verification, the three segments were assembled in a second cut-ligation reaction using a vector containing the last half-repeat to form a complete 17.5-repeat array (5 + 5 + 7 + 0.5 = 17.5). .. Final 17.5-repeat arrays were cloned by Stu I/Aat II digestion into pPreTALE111-42 and pPreTALE94-42 , which contained truncated N- and C-termini of the naturally occurring TALE PthXo1 in pAH103 , generated by polymerase chain reaction (PCR) using primers listed in Supplementary Table S1 .

    Article Title: MutS2 Promotes Homologous Recombination in Bacillus subtilis
    Article Snippet: The plasmid was digested with BsaI-HF (NEB) in CutSmart buffer at 37°C. .. The plasmid was digested with BsaI-HF (NEB) in CutSmart buffer at 37°C.

    Article Title: BtsCI and BseGI display sequence preference in the nucleotides flanking the recognition sequence
    Article Snippet: We prepared oligonucleotides using the monoclonal stoichiometric method (MOSIC) developed in our lab, according to a protocol described before [ ]. .. Briefly, we incubated 20 μg of pPDGF plasmid DNA containing our insert (sequence in Data A in , ThermoFischer Scientific) with BsaI-HF (New England Biolabs(NEB)) for 4h in NEB4 buffer (50mM Potassium acetate, 20mM Tris-acetate, 10mM Mg-acetate, 1mM DTT). .. After gel electrophoresis in a 0.8% agarose gel in TBE 0.5X with incorporated EtBr, we gel extracted the band using GeneJet gel extraction kit (ThermoFischer Scientific).

    TALENs:

    Article Title: Efficient Targeted Mutagenesis in Medaka Using Custom-Designed Transcription Activator-Like Effector Nucleases
    Article Snippet: Paragraph title: Design and construction of TALENs for the DJ-1 gene ... Each module containing an RVD was excised from each module plasmid (pNI, pHD, pNN, and pNG vectors) using Bsa I-HF (New England Biolabs, Ipswich, MA), and then the fragment was purified using NucleoSpin Gel and PCR Clean-up kit (MACHEREY-NAGEL, Düren, Germany).

    Activity Assay:

    Article Title: A Transcription Activator-Like Effector (TALE) Toolbox for Genome Engineering
    Article Snippet: PCR primers for TALE construction ( , Integrated DNA Technologies, custom DNA oligonucleotides) Herculase II Fusion polymerase (Agilent Technologies, cat. no. 600679) CRITICAL Standard Taq polymerase, which lacks 3′-5′ exonuclease proofreading activity, has lower fidelity and can lead to errors in the final assembled TALE. .. QIAprep Spin Miniprep Kit (Qiagen, cat. no. 27106) QIAquick 96 PCR Purification (Qiagen, cat. no. 28181) UltraPure DNase/RNase-Free Distilled Water (Invitrogen, cat. no. 10977-023) UltraPure 10X TBE Buffer (Invitrogen, cat. no. 15581-028) SeaKem LE agarose (Lonza, cat. no. 50004) 10,000x SYBR Safe DNA stain (Invitrogen, cat. no. ) Low DNA Mass Ladder (Invitrogen, cat. no. 10068-013) 1 kb Plus DNA Ladder (Invitrogen, cat. no. 10787-018) TrackIt™ Cyan/Orange Loading Buffer (Invitrogen, cat. no. 10482-028) Restriction enzymes: BsmBI ( Esp3I ) (Fermentas/ThermoScientific cat. no. ER0451) BsaI -HF (New England Biolabs, cat. no. R3535L) AfeI (New England Biolabs, cat. no. R0652S) Fermentas Tango Buffer and 10x NEBuffer 4 (included with enzymes) 100x Bovine Serum Albumin (New England Biolabs, included with Bsa I-HF) DL-Dithiothreitol (DTT) (Fermentas/ThermoScientific cat. no. R0862) T7 DNA ligase, 3,000 U/ul (Enzymatics, cat. no. L602L) CRITICAL Do not substitute the more commonly-used T4 ligase.

    Article Title: GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis
    Article Snippet: Even more importantly, the activity of the restriction endonuclease is a limiting factor for GreenGate cloning. .. We found both Bsa I-HF from NewEngland Biolabs, as well as the isoschizomer FastDigest Eco 31I from Fermentas to be highly sensitive to temperature fluctuations in a batch dependent manner.

    Expressing:

    Article Title: Fungal-type carbohydrate binding modules from the coccolithophore Emiliania huxleyi show binding affinity to cellulose and chitin
    Article Snippet: The pelB, linker, and CBM1 sequences were ordered as GeneArt Strings (ThermoFisher) and the AP segment was obtained with PCR (using KAPA HiFi DNA Polymerase from KAPA Biosystems and primers from Eurofins), all flanked with BsaI restriction sites and appropriate 4bp overlaps. .. Using the Golden Gate cloning method [ ] the pieces were combined (digest with BsaI-HF from NEB) and ligated (T4 DNA Ligase NEB) into a pET28a (+) expression vector and transformed in chemically competent TOP10 E . coli cells. .. The resulting plasmids were obtained by miniprep (NucleoSpin Plasmid from Macherey-Nagel).

    Article Title: mKast is dispensable for normal development and sexual maturation of the male European honeybee
    Article Snippet: For synthesis of the sgRNA, oligo DNAs containing sequences corresponding to the sgRNA target site and restriction enzyme recognition site were synthesized (Fasmac, Japan), and annealed oligomers were ligated into the vector pDR274 (Addgene, UK) and cut with Bsa I-HF (New England Biolabs, Japan). .. After linearization using Dra I (Takara, Japan), the sgRNA was in vitro -transcribed using the T7- Flash Transcription Kit (Epicentre, USA), purified by phenol/chloroform extraction and ethanol precipitation, and stored at −80 °C until use.

    Article Title: Quantitative analysis of TALE-DNA interactions suggests polarity effects
    Article Snippet: Each cut-ligation reaction used 75 ng of appropriate plasmids with Bsa I-HF (New England Biolabs) and T4 ligase (New England Biolabs) that were incubated at 37°C for 5 h. On sequence verification, the three segments were assembled in a second cut-ligation reaction using a vector containing the last half-repeat to form a complete 17.5-repeat array (5 + 5 + 7 + 0.5 = 17.5). .. Final 17.5-repeat arrays were cloned by Stu I/Aat II digestion into pPreTALE111-42 and pPreTALE94-42 , which contained truncated N- and C-termini of the naturally occurring TALE PthXo1 in pAH103 , generated by polymerase chain reaction (PCR) using primers listed in Supplementary Table S1 .

    Article Title: Efficient Targeted Mutagenesis in Medaka Using Custom-Designed Transcription Activator-Like Effector Nucleases
    Article Snippet: Each module containing an RVD was excised from each module plasmid (pNI, pHD, pNN, and pNG vectors) using Bsa I-HF (New England Biolabs, Ipswich, MA), and then the fragment was purified using NucleoSpin Gel and PCR Clean-up kit (MACHEREY-NAGEL, Düren, Germany). .. Both the assembled repeat arrays and a last repeat module were excised with Esp 3I (Thermo Scientific, Waltham, MA).

    Article Title: A high-efficiency CRISPR/Cas9 system for targeted mutagenesis in Cotton (Gossypium hirsutum L.)
    Article Snippet: The GhMYB25-like-sgRNA1 and GhMYB25-like-sgRNA2 expression module was assembled by direct PCR amplification using pCBC-DT1T2 template as described previously . .. And then this PCR product was purified for the Golden Gate assembly of Cas9 expression module through the Type IIS restriction endonucleases (REases) BsaI reaction (R3535L, New England Biolabs). .. The assembled CRISPR/Cas9 vector was then transformed into Agrobacterium tumefaciens (strain EHA105).

    Modification:

    Article Title: Single molecule measurements of DNA helicase activity with magnetic tweezers and t-test based step-finding analysis
    Article Snippet: 174bp DNA hairpin with a ~1.1 kb DNA handle was generated by PCR of pKZ1 using one primer containing a BsaI recognition sequence and the other primer with three digoxigenin modified bases at the 5´end. .. BbvcI (R0632L, New England Biolabs) and BsaI (R3535L, New England Biolabs) at 37° C to create two nicks at positions 1093 and 1129 and a 5′ overhang at the end of the dsDNA (20 units of each enzyme were added to the sample every 3 hours).

    Transformation Assay:

    Article Title: Fungal-type carbohydrate binding modules from the coccolithophore Emiliania huxleyi show binding affinity to cellulose and chitin
    Article Snippet: The pelB, linker, and CBM1 sequences were ordered as GeneArt Strings (ThermoFisher) and the AP segment was obtained with PCR (using KAPA HiFi DNA Polymerase from KAPA Biosystems and primers from Eurofins), all flanked with BsaI restriction sites and appropriate 4bp overlaps. .. Using the Golden Gate cloning method [ ] the pieces were combined (digest with BsaI-HF from NEB) and ligated (T4 DNA Ligase NEB) into a pET28a (+) expression vector and transformed in chemically competent TOP10 E . coli cells. .. The resulting plasmids were obtained by miniprep (NucleoSpin Plasmid from Macherey-Nagel).

    Article Title: YeastFab: the design and construction of standard biological parts for metabolic engineering in Saccharomyces cerevisiae
    Article Snippet: 1.5 μl PCR fragments and 15 ng reporter plasmids were mixed together with 3 U of BsaI-HF (NEB), 0.5 U of T4 DNA ligase (Thermo Scientific) in 1× T4 ligase Buffer (Thermo Scientific). .. The plasmid DNA from positive colony PCR candidates was isolated and sequenced.

    Article Title: Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides
    Article Snippet: We inoculated 5 ml LB containing kanamycin (50 µg/ml) with a single colony of E. coli transformed with the pMK-RQ vector containing the CP pseudogene and incubated overnight at 37 °C, shaking at 250 rpm. .. We applied the same procedure to get the linear 378 nt long ODN pseudogene but using ampicillin (100 µg/ml) in the 5 ml LB culture and BsaI-HF as restriction enzyme (New England Biolabs).

    Article Title: interleukin-11 induces and maintains progenitors of different cell lineages during Xenopus tadpole tail regeneration
    Article Snippet: In brief, DR274 plasmid was digested with Bsa I-HF (New England Biolabs, MA), annealed with oligonucleotide, and they were ligated. .. Some of the gRNA template plasmids were assembled using a PCR-amplified DR274 fragment, an oligonucleotide, and an In-Fusion HD Cloning Kit (TaKaRa).

    Article Title: Development of a low-cost cellulase production process using Trichoderma reesei for Brazilian biorefineries
    Article Snippet: All restriction enzymes used in this study were FastDigest enzymes from Thermo Scientific, except for BsaI-HF (NEB). .. Sequencing of plasmids was performed by Helixxa Ltda. using an Applied Biosystems 3500 capillary electrophoresis system.

    Ligation:

    Article Title: MutS2 Promotes Homologous Recombination in Bacillus subtilis
    Article Snippet: First, the spacer was incorporated into the CRISPR array via restriction digestion and ligation cloning. .. The plasmid was digested with BsaI-HF (NEB) in CutSmart buffer at 37°C.

    Genomic Sequencing:

    Article Title: A high-efficiency CRISPR/Cas9 system for targeted mutagenesis in Cotton (Gossypium hirsutum L.)
    Article Snippet: Through comparing previously reported gene information and searching the NIBC cotton database, two sgRNAs, GhMYB25-like-sgRNA1 and GhMYB25-like-sgRNA2, which from GhMYB25-like A and GhMYB25-like D genomic sequences encoded by allotetraploid cotton A subgenome and the D subgenome respectively , were designed for the assembly of sgRNA-expression module. .. And then this PCR product was purified for the Golden Gate assembly of Cas9 expression module through the Type IIS restriction endonucleases (REases) BsaI reaction (R3535L, New England Biolabs).

    Cell Culture:

    Article Title: Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides
    Article Snippet: We isolated the plasmid DNA from the saturated cell culture by a plasmid mini-prep kit (Omega Bio-Tek), and digested the pMK-RQ vector containing the CP (20 ng/µl) by BsmBI (0.25 U/µl), New England Biolabs), in 1× NEB2 buffer reaction at 55 °C for 2 h, followed by heat inactivation at 80 °C for 20 minutes. .. We applied the same procedure to get the linear 378 nt long ODN pseudogene but using ampicillin (100 µg/ml) in the 5 ml LB culture and BsaI-HF as restriction enzyme (New England Biolabs).

    Generated:

    Article Title: Single molecule measurements of DNA helicase activity with magnetic tweezers and t-test based step-finding analysis
    Article Snippet: 174bp DNA hairpin with a ~1.1 kb DNA handle was generated by PCR of pKZ1 using one primer containing a BsaI recognition sequence and the other primer with three digoxigenin modified bases at the 5´end. .. BbvcI (R0632L, New England Biolabs) and BsaI (R3535L, New England Biolabs) at 37° C to create two nicks at positions 1093 and 1129 and a 5′ overhang at the end of the dsDNA (20 units of each enzyme were added to the sample every 3 hours).

    Article Title: Shuttling along DNA and directed processing of D-loops by RecQ helicase support quality control of homologous recombination
    Article Snippet: For hairpin DNA substrate, a 174-bp DNA hairpin with a ∼1.0-kb DNA handle was generated first by PCR of pKZ1 plasmid between positions 4550 and 368 using forward primer (position 368) containing a BsaI restriction enzyme digestion site and reverse primer (position 4550) 5′-labeled with digoxigenin. pKZ1 was made by ligating a 44-bp dsDNA segment containing two BbvCI restriction sites separated by 37 nt into pET28b plasmid at the BamHI restriction site. .. PCR product was digested with restriction enzymes Nt.BbvCI (New England Biolabs) and BsaI-HF (New England Biolabs) for 16 h at 37 °C to create two nicks at positions 1093 and 1129, near the middle of the DNA template and the 5′ overhang at the end of dsDNA, respectively.

    Article Title: CRISPR/Cas9 Editing of the Bacillus subtilis Genome
    Article Snippet: Prepare pPB41 digested with the restriction endonuclease Bsa I ( ) Assemble 50 μl restriction digest reaction: 1x Cutsmart buffer (NEB), 2 μl Bsa I-HF (20,000 U/ml; NEB), and 5 μg pPB41. .. Incubate reaction at 37 °C in an incubator for 3 to 6 h. Add 1 μl of calf intestinal phosphatase (CIP; 10,000 U/ml; NEB), and incubate at 37 °C for 1 h. Perform 1% agarose gel electrophoresis in 1x TAE buffer (see Recipes), followed by gel extraction of the digested plasmid.

    Article Title: Multiplex target capture with double-stranded DNA probes
    Article Snippet: We generated 5,619 individual PCRs of approximately 350 bp in order to target all protein-coding sequences and flanking intronic regions of 524 genes (target size range < 100 to 541 bp). .. The purified PCR products are simultaneously digested for 1 hour at 37°C using MlyI and BsaI-HF (NEB, Ipswich, MA, USA), only leaving the target sequences at each probe end, respectively.

    Article Title: GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis
    Article Snippet: On the upside, once the supermodules are generated, they can be re-used just like ordinary modules at the same high efficiency. .. We found both Bsa I-HF from NewEngland Biolabs, as well as the isoschizomer FastDigest Eco 31I from Fermentas to be highly sensitive to temperature fluctuations in a batch dependent manner.

    Gel Extraction:

    Article Title: Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides
    Article Snippet: We loaded the digestion products on a 1% agarose gel containing ethidium bromide (1 µg/ml, Sigma Aldrich), and purified the linear pseudogene (329 base pairs) by gel extraction (kit from Omega bio-tek) and eluted in 30 µl 10mM Tris-HCl (pH 8.5). .. We applied the same procedure to get the linear 378 nt long ODN pseudogene but using ampicillin (100 µg/ml) in the 5 ml LB culture and BsaI-HF as restriction enzyme (New England Biolabs).

    Article Title: A Transcription Activator-Like Effector (TALE) Toolbox for Genome Engineering
    Article Snippet: 5x Herculase II reaction buffer (Agilent Technologies, included with polymerase) Taq-B polymerase (Enzymatics, cat. no. P725L) 10x Taq-B buffer (Enzymatics, included with polymerase) 25 mM (each) dNTP solution mix (Enzymatics, cat. no. N205L) MinElute Gel Extraction Kit (Qiagen, cat. no. 28606) CRITICAL MinElute columns should be stored at 4°C until use. .. QIAprep Spin Miniprep Kit (Qiagen, cat. no. 27106) QIAquick 96 PCR Purification (Qiagen, cat. no. 28181) UltraPure DNase/RNase-Free Distilled Water (Invitrogen, cat. no. 10977-023) UltraPure 10X TBE Buffer (Invitrogen, cat. no. 15581-028) SeaKem LE agarose (Lonza, cat. no. 50004) 10,000x SYBR Safe DNA stain (Invitrogen, cat. no. ) Low DNA Mass Ladder (Invitrogen, cat. no. 10068-013) 1 kb Plus DNA Ladder (Invitrogen, cat. no. 10787-018) TrackIt™ Cyan/Orange Loading Buffer (Invitrogen, cat. no. 10482-028) Restriction enzymes: BsmBI ( Esp3I ) (Fermentas/ThermoScientific cat. no. ER0451) BsaI -HF (New England Biolabs, cat. no. R3535L) AfeI (New England Biolabs, cat. no. R0652S) Fermentas Tango Buffer and 10x NEBuffer 4 (included with enzymes) 100x Bovine Serum Albumin (New England Biolabs, included with Bsa I-HF) DL-Dithiothreitol (DTT) (Fermentas/ThermoScientific cat. no. R0862) T7 DNA ligase, 3,000 U/ul (Enzymatics, cat. no. L602L) CRITICAL Do not substitute the more commonly-used T4 ligase.

    Sequencing:

    Article Title: Fungal-type carbohydrate binding modules from the coccolithophore Emiliania huxleyi show binding affinity to cellulose and chitin
    Article Snippet: Using the Golden Gate cloning method [ ] the pieces were combined (digest with BsaI-HF from NEB) and ligated (T4 DNA Ligase NEB) into a pET28a (+) expression vector and transformed in chemically competent TOP10 E . coli cells. .. The resulting plasmids were obtained by miniprep (NucleoSpin Plasmid from Macherey-Nagel).

    Article Title: Single molecule measurements of DNA helicase activity with magnetic tweezers and t-test based step-finding analysis
    Article Snippet: BbvcI (R0632L, New England Biolabs) and BsaI (R3535L, New England Biolabs) at 37° C to create two nicks at positions 1093 and 1129 and a 5′ overhang at the end of the dsDNA (20 units of each enzyme were added to the sample every 3 hours). .. BbvcI (R0632L, New England Biolabs) and BsaI (R3535L, New England Biolabs) at 37° C to create two nicks at positions 1093 and 1129 and a 5′ overhang at the end of the dsDNA (20 units of each enzyme were added to the sample every 3 hours).

    Article Title: Quantitative analysis of TALE-DNA interactions suggests polarity effects
    Article Snippet: The first reaction assembled two five-repeat arrays and one seven-repeat array. .. Each cut-ligation reaction used 75 ng of appropriate plasmids with Bsa I-HF (New England Biolabs) and T4 ligase (New England Biolabs) that were incubated at 37°C for 5 h. On sequence verification, the three segments were assembled in a second cut-ligation reaction using a vector containing the last half-repeat to form a complete 17.5-repeat array (5 + 5 + 7 + 0.5 = 17.5). .. Final 17.5-repeat arrays were cloned by Stu I/Aat II digestion into pPreTALE111-42 and pPreTALE94-42 , which contained truncated N- and C-termini of the naturally occurring TALE PthXo1 in pAH103 , generated by polymerase chain reaction (PCR) using primers listed in Supplementary Table S1 .

    Article Title: Development of a low-cost cellulase production process using Trichoderma reesei for Brazilian biorefineries
    Article Snippet: All restriction enzymes used in this study were FastDigest enzymes from Thermo Scientific, except for BsaI-HF (NEB). .. The used cloning host (Escherichia coli DH5a) as well as the kits used for purifying DNA from E. coli , fungi, and agarose gels were from Zymo Research.

    Article Title: Efficient Targeted Mutagenesis in Medaka Using Custom-Designed Transcription Activator-Like Effector Nucleases
    Article Snippet: The genomic sequence of the DJ-1 locus was identified from the Ensembl medaka genome browser ( ). .. Each module containing an RVD was excised from each module plasmid (pNI, pHD, pNN, and pNG vectors) using Bsa I-HF (New England Biolabs, Ipswich, MA), and then the fragment was purified using NucleoSpin Gel and PCR Clean-up kit (MACHEREY-NAGEL, Düren, Germany).

    Article Title: BtsCI and BseGI display sequence preference in the nucleotides flanking the recognition sequence
    Article Snippet: We prepared oligonucleotides using the monoclonal stoichiometric method (MOSIC) developed in our lab, according to a protocol described before [ ]. .. Briefly, we incubated 20 μg of pPDGF plasmid DNA containing our insert (sequence in Data A in , ThermoFischer Scientific) with BsaI-HF (New England Biolabs(NEB)) for 4h in NEB4 buffer (50mM Potassium acetate, 20mM Tris-acetate, 10mM Mg-acetate, 1mM DTT). .. After gel electrophoresis in a 0.8% agarose gel in TBE 0.5X with incorporated EtBr, we gel extracted the band using GeneJet gel extraction kit (ThermoFischer Scientific).

    Binding Assay:

    Article Title: Single molecule measurements of DNA helicase activity with magnetic tweezers and t-test based step-finding analysis
    Article Snippet: BbvcI (R0632L, New England Biolabs) and BsaI (R3535L, New England Biolabs) at 37° C to create two nicks at positions 1093 and 1129 and a 5′ overhang at the end of the dsDNA (20 units of each enzyme were added to the sample every 3 hours). .. The digested products were purified using a PCR purification kit (11732668001, Roche).

    Article Title: BtsCI and BseGI display sequence preference in the nucleotides flanking the recognition sequence
    Article Snippet: Briefly, we incubated 20 μg of pPDGF plasmid DNA containing our insert (sequence in Data A in , ThermoFischer Scientific) with BsaI-HF (New England Biolabs(NEB)) for 4h in NEB4 buffer (50mM Potassium acetate, 20mM Tris-acetate, 10mM Mg-acetate, 1mM DTT). .. Briefly, we incubated 20 μg of pPDGF plasmid DNA containing our insert (sequence in Data A in , ThermoFischer Scientific) with BsaI-HF (New England Biolabs(NEB)) for 4h in NEB4 buffer (50mM Potassium acetate, 20mM Tris-acetate, 10mM Mg-acetate, 1mM DTT).

    Molecular Cloning:

    Article Title: Development of a low-cost cellulase production process using Trichoderma reesei for Brazilian biorefineries
    Article Snippet: Paragraph title: Molecular cloning ... All restriction enzymes used in this study were FastDigest enzymes from Thermo Scientific, except for BsaI-HF (NEB).

    Mutagenesis:

    Article Title: A high-efficiency CRISPR/Cas9 system for targeted mutagenesis in Cotton (Gossypium hirsutum L.)
    Article Snippet: To strict evaluate the efficacy and specificity of the CRISPR/Cas9 vectors, the sgRNAs design basically need to meet three standards: firstly, these sgRNAs target sites can be used to test the genome mutation efficacy on both G. hirsutum cotton A subgenome and D subgenome; secondly, several single-nucleotide polymorphism and double-nucleotide polymorphism near these two sgRNAs target sites can be used for distinguishing the identity of GhMYB25-like genes; thirdly, there are two highly similar sequences (have 1–3 mismatched nucleotides) with the designed sgRNAs can be used to estimate the off-target effect. .. And then this PCR product was purified for the Golden Gate assembly of Cas9 expression module through the Type IIS restriction endonucleases (REases) BsaI reaction (R3535L, New England Biolabs).

    Isolation:

    Article Title: YeastFab: the design and construction of standard biological parts for metabolic engineering in Saccharomyces cerevisiae
    Article Snippet: 1.5 μl PCR fragments and 15 ng reporter plasmids were mixed together with 3 U of BsaI-HF (NEB), 0.5 U of T4 DNA ligase (Thermo Scientific) in 1× T4 ligase Buffer (Thermo Scientific). .. The oligos YGO199 (GCGTATATATACCAATCTAAGTCT) and YGO200 (GTCAATTTACCGTAAGTAGCATC) were used as primers to set up colony PCR after transformation.

    Article Title: Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides
    Article Snippet: We isolated the plasmid DNA from the saturated cell culture by a plasmid mini-prep kit (Omega Bio-Tek), and digested the pMK-RQ vector containing the CP (20 ng/µl) by BsmBI (0.25 U/µl), New England Biolabs), in 1× NEB2 buffer reaction at 55 °C for 2 h, followed by heat inactivation at 80 °C for 20 minutes. .. We applied the same procedure to get the linear 378 nt long ODN pseudogene but using ampicillin (100 µg/ml) in the 5 ml LB culture and BsaI-HF as restriction enzyme (New England Biolabs).

    Subcloning:

    Article Title: Quantitative analysis of TALE-DNA interactions suggests polarity effects
    Article Snippet: Each cut-ligation reaction used 75 ng of appropriate plasmids with Bsa I-HF (New England Biolabs) and T4 ligase (New England Biolabs) that were incubated at 37°C for 5 h. On sequence verification, the three segments were assembled in a second cut-ligation reaction using a vector containing the last half-repeat to form a complete 17.5-repeat array (5 + 5 + 7 + 0.5 = 17.5). .. Final 17.5-repeat arrays were cloned by Stu I/Aat II digestion into pPreTALE111-42 and pPreTALE94-42 , which contained truncated N- and C-termini of the naturally occurring TALE PthXo1 in pAH103 , generated by polymerase chain reaction (PCR) using primers listed in Supplementary Table S1 .

    Labeling:

    Article Title: Single molecule measurements of DNA helicase activity with magnetic tweezers and t-test based step-finding analysis
    Article Snippet: BbvcI (R0632L, New England Biolabs) and BsaI (R3535L, New England Biolabs) at 37° C to create two nicks at positions 1093 and 1129 and a 5′ overhang at the end of the dsDNA (20 units of each enzyme were added to the sample every 3 hours). .. The digested products were purified using a PCR purification kit (11732668001, Roche).

    Purification:

    Article Title: Fungal-type carbohydrate binding modules from the coccolithophore Emiliania huxleyi show binding affinity to cellulose and chitin
    Article Snippet: The CBM1 constructs were designed to have a carrier protein fused to the CBM1 domain by a flexible linker, in addition to the N-terminal pelB signal peptide and a 6His purification tag on the C-terminus. .. Using the Golden Gate cloning method [ ] the pieces were combined (digest with BsaI-HF from NEB) and ligated (T4 DNA Ligase NEB) into a pET28a (+) expression vector and transformed in chemically competent TOP10 E . coli cells.

    Article Title: Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides
    Article Snippet: We loaded the digestion products on a 1% agarose gel containing ethidium bromide (1 µg/ml, Sigma Aldrich), and purified the linear pseudogene (329 base pairs) by gel extraction (kit from Omega bio-tek) and eluted in 30 µl 10mM Tris-HCl (pH 8.5). .. We applied the same procedure to get the linear 378 nt long ODN pseudogene but using ampicillin (100 µg/ml) in the 5 ml LB culture and BsaI-HF as restriction enzyme (New England Biolabs).

    Article Title: Single molecule measurements of DNA helicase activity with magnetic tweezers and t-test based step-finding analysis
    Article Snippet: The PCR product was purified using a PCR purification kit (28104, Qiagen). .. BbvcI (R0632L, New England Biolabs) and BsaI (R3535L, New England Biolabs) at 37° C to create two nicks at positions 1093 and 1129 and a 5′ overhang at the end of the dsDNA (20 units of each enzyme were added to the sample every 3 hours).

    Article Title: interleukin-11 induces and maintains progenitors of different cell lineages during Xenopus tadpole tail regeneration
    Article Snippet: In brief, DR274 plasmid was digested with Bsa I-HF (New England Biolabs, MA), annealed with oligonucleotide, and they were ligated. .. In brief, DR274 plasmid was digested with Bsa I-HF (New England Biolabs, MA), annealed with oligonucleotide, and they were ligated.

    Article Title: mKast is dispensable for normal development and sexual maturation of the male European honeybee
    Article Snippet: For synthesis of the sgRNA, oligo DNAs containing sequences corresponding to the sgRNA target site and restriction enzyme recognition site were synthesized (Fasmac, Japan), and annealed oligomers were ligated into the vector pDR274 (Addgene, UK) and cut with Bsa I-HF (New England Biolabs, Japan). .. For synthesis of the sgRNA, oligo DNAs containing sequences corresponding to the sgRNA target site and restriction enzyme recognition site were synthesized (Fasmac, Japan), and annealed oligomers were ligated into the vector pDR274 (Addgene, UK) and cut with Bsa I-HF (New England Biolabs, Japan).

    Article Title: Reprograming the replisome of a semi-synthetic organism for the expansion of the genetic alphabet
    Article Snippet: The resulting UBP containing dsDNA was purified using a DNA Clean & Concentrator-5 (Zymo Research) according to manufacturer recommendations. .. BsaI-HF (0.33 U/μL) and T5 exonuclease (0.16 U/μL, New England Biolabs) were then added, and the reaction was incubated at 37 °C for 1 h to remove any pUCX2 without an insert.

    Article Title: A Transcription Activator-Like Effector (TALE) Toolbox for Genome Engineering
    Article Snippet: 5x Herculase II reaction buffer (Agilent Technologies, included with polymerase) Taq-B polymerase (Enzymatics, cat. no. P725L) 10x Taq-B buffer (Enzymatics, included with polymerase) 25 mM (each) dNTP solution mix (Enzymatics, cat. no. N205L) MinElute Gel Extraction Kit (Qiagen, cat. no. 28606) CRITICAL MinElute columns should be stored at 4°C until use. .. QIAprep Spin Miniprep Kit (Qiagen, cat. no. 27106) QIAquick 96 PCR Purification (Qiagen, cat. no. 28181) UltraPure DNase/RNase-Free Distilled Water (Invitrogen, cat. no. 10977-023) UltraPure 10X TBE Buffer (Invitrogen, cat. no. 15581-028) SeaKem LE agarose (Lonza, cat. no. 50004) 10,000x SYBR Safe DNA stain (Invitrogen, cat. no. ) Low DNA Mass Ladder (Invitrogen, cat. no. 10068-013) 1 kb Plus DNA Ladder (Invitrogen, cat. no. 10787-018) TrackIt™ Cyan/Orange Loading Buffer (Invitrogen, cat. no. 10482-028) Restriction enzymes: BsmBI ( Esp3I ) (Fermentas/ThermoScientific cat. no. ER0451) BsaI -HF (New England Biolabs, cat. no. R3535L) AfeI (New England Biolabs, cat. no. R0652S) Fermentas Tango Buffer and 10x NEBuffer 4 (included with enzymes) 100x Bovine Serum Albumin (New England Biolabs, included with Bsa I-HF) DL-Dithiothreitol (DTT) (Fermentas/ThermoScientific cat. no. R0862) T7 DNA ligase, 3,000 U/ul (Enzymatics, cat. no. L602L) CRITICAL Do not substitute the more commonly-used T4 ligase. .. T7 ligase has 1000-fold higher activity on sticky ends than blunt ends and higher overall activity than commercially available concentrated T4 ligases.

    Article Title: Multiplex target capture with double-stranded DNA probes
    Article Snippet: All 5,619 PCR products were pooled in a single tube and purified through QIAquick columns (Qiagen, Valencia, CA, US). .. The purified PCR products are simultaneously digested for 1 hour at 37°C using MlyI and BsaI-HF (NEB, Ipswich, MA, USA), only leaving the target sequences at each probe end, respectively. .. Following QIAquick purification, the pool of cLPPs is ready for multiplex target capture.

    Article Title: Smart DNA Fabrication Using Sound Waves
    Article Snippet: The PCR product was purified using a PureLink PCR purification kit (Life Technologies) and diluted to 20 ng/µl. .. The Golden Gate master mix was made of 35 µL T4 ligase (2000 U/µl, New England Biolabs, NEB), 35 µL BsaI-HF (NEB), 52.5 µL 10× T4 buffer (NEB), and 25 µL 200× BSA (NEB).

    Article Title: Efficient Targeted Mutagenesis in Medaka Using Custom-Designed Transcription Activator-Like Effector Nucleases
    Article Snippet: TAL repeats were assembled by the Golden Gate assembly method ( ) with slight modifications ( ). .. Each module containing an RVD was excised from each module plasmid (pNI, pHD, pNN, and pNG vectors) using Bsa I-HF (New England Biolabs, Ipswich, MA), and then the fragment was purified using NucleoSpin Gel and PCR Clean-up kit (MACHEREY-NAGEL, Düren, Germany). .. To generate repeat arrays, the modules were cloned into the dephosphorylated array plasmid (pFUS vectors) using Ligation high Ver.2 (Toyobo, Osaka, Japan).

    Article Title: A high-efficiency CRISPR/Cas9 system for targeted mutagenesis in Cotton (Gossypium hirsutum L.)
    Article Snippet: The GhMYB25-like-sgRNA1 and GhMYB25-like-sgRNA2 expression module was assembled by direct PCR amplification using pCBC-DT1T2 template as described previously . .. And then this PCR product was purified for the Golden Gate assembly of Cas9 expression module through the Type IIS restriction endonucleases (REases) BsaI reaction (R3535L, New England Biolabs). .. The assembled CRISPR/Cas9 vector was then transformed into Agrobacterium tumefaciens (strain EHA105).

    Polymerase Chain Reaction:

    Article Title: Fungal-type carbohydrate binding modules from the coccolithophore Emiliania huxleyi show binding affinity to cellulose and chitin
    Article Snippet: The pelB, linker, and CBM1 sequences were ordered as GeneArt Strings (ThermoFisher) and the AP segment was obtained with PCR (using KAPA HiFi DNA Polymerase from KAPA Biosystems and primers from Eurofins), all flanked with BsaI restriction sites and appropriate 4bp overlaps. .. Using the Golden Gate cloning method [ ] the pieces were combined (digest with BsaI-HF from NEB) and ligated (T4 DNA Ligase NEB) into a pET28a (+) expression vector and transformed in chemically competent TOP10 E . coli cells.

    Article Title: YeastFab: the design and construction of standard biological parts for metabolic engineering in Saccharomyces cerevisiae
    Article Snippet: The method used was similar to that for part assembly. .. 1.5 μl PCR fragments and 15 ng reporter plasmids were mixed together with 3 U of BsaI-HF (NEB), 0.5 U of T4 DNA ligase (Thermo Scientific) in 1× T4 ligase Buffer (Thermo Scientific). .. The oligos YGO199 (GCGTATATATACCAATCTAAGTCT) and YGO200 (GTCAATTTACCGTAAGTAGCATC) were used as primers to set up colony PCR after transformation.

    Article Title: Single molecule measurements of DNA helicase activity with magnetic tweezers and t-test based step-finding analysis
    Article Snippet: BbvcI (R0632L, New England Biolabs) and BsaI (R3535L, New England Biolabs) at 37° C to create two nicks at positions 1093 and 1129 and a 5′ overhang at the end of the dsDNA (20 units of each enzyme were added to the sample every 3 hours). .. BbvcI (R0632L, New England Biolabs) and BsaI (R3535L, New England Biolabs) at 37° C to create two nicks at positions 1093 and 1129 and a 5′ overhang at the end of the dsDNA (20 units of each enzyme were added to the sample every 3 hours).

    Article Title: interleukin-11 induces and maintains progenitors of different cell lineages during Xenopus tadpole tail regeneration
    Article Snippet: In brief, DR274 plasmid was digested with Bsa I-HF (New England Biolabs, MA), annealed with oligonucleotide, and they were ligated. .. Some of the gRNA template plasmids were assembled using a PCR-amplified DR274 fragment, an oligonucleotide, and an In-Fusion HD Cloning Kit (TaKaRa).

    Article Title: Shuttling along DNA and directed processing of D-loops by RecQ helicase support quality control of homologous recombination
    Article Snippet: For hairpin DNA substrate, a 174-bp DNA hairpin with a ∼1.0-kb DNA handle was generated first by PCR of pKZ1 plasmid between positions 4550 and 368 using forward primer (position 368) containing a BsaI restriction enzyme digestion site and reverse primer (position 4550) 5′-labeled with digoxigenin. pKZ1 was made by ligating a 44-bp dsDNA segment containing two BbvCI restriction sites separated by 37 nt into pET28b plasmid at the BamHI restriction site. .. PCR product was digested with restriction enzymes Nt.BbvCI (New England Biolabs) and BsaI-HF (New England Biolabs) for 16 h at 37 °C to create two nicks at positions 1093 and 1129, near the middle of the DNA template and the 5′ overhang at the end of dsDNA, respectively. .. After digestion, the 37-nt oligonucleotide was removed by heating the DNA to 80 °C for 20 min and cooling down gradually to 4 °C in the presence of excess complementary 37-nt oligonucleotide, thus producing a 37-nt ssDNA region.

    Article Title: CRISPR/Cas9 Editing of the Bacillus subtilis Genome
    Article Snippet: Prepare pPB41 digested with the restriction endonuclease Bsa I ( ) Assemble 50 μl restriction digest reaction: 1x Cutsmart buffer (NEB), 2 μl Bsa I-HF (20,000 U/ml; NEB), and 5 μg pPB41. .. All steps of the procedure are identical for pPB105, except for E. coli clones are selected using LB agar plates containing 100 μg/ml ampicillin or 20 μg/ml chloramphenicol (chloramphenicol selection works but colonies grow slower), and B. subtilis transformants are selected using LB agar plates containing 5 μg/ml chloramphenicol.

    Article Title: Reprograming the replisome of a semi-synthetic organism for the expansion of the genetic alphabet
    Article Snippet: UBP containing dsDNA was produced with a 50-μL PCR with chemically synthesized UBP containing oligonucleotides (0.025 ng/μL), primers introducing BsaI sites and vector homology (1 μM, ), d TPT3 TP (100 μM), d NaM TP (100 μM), dNTPs (200 μM), MgSO4 (1.2 mM), One Taq DNA Polymerase (0.025 U/μL), and One Taq Standard Reaction Buffer (1×, New England Biolabs). .. BsaI-HF (0.33 U/μL) and T5 exonuclease (0.16 U/μL, New England Biolabs) were then added, and the reaction was incubated at 37 °C for 1 h to remove any pUCX2 without an insert.

    Article Title: A Transcription Activator-Like Effector (TALE) Toolbox for Genome Engineering
    Article Snippet: 5x Herculase II reaction buffer (Agilent Technologies, included with polymerase) Taq-B polymerase (Enzymatics, cat. no. P725L) 10x Taq-B buffer (Enzymatics, included with polymerase) 25 mM (each) dNTP solution mix (Enzymatics, cat. no. N205L) MinElute Gel Extraction Kit (Qiagen, cat. no. 28606) CRITICAL MinElute columns should be stored at 4°C until use. .. QIAprep Spin Miniprep Kit (Qiagen, cat. no. 27106) QIAquick 96 PCR Purification (Qiagen, cat. no. 28181) UltraPure DNase/RNase-Free Distilled Water (Invitrogen, cat. no. 10977-023) UltraPure 10X TBE Buffer (Invitrogen, cat. no. 15581-028) SeaKem LE agarose (Lonza, cat. no. 50004) 10,000x SYBR Safe DNA stain (Invitrogen, cat. no. ) Low DNA Mass Ladder (Invitrogen, cat. no. 10068-013) 1 kb Plus DNA Ladder (Invitrogen, cat. no. 10787-018) TrackIt™ Cyan/Orange Loading Buffer (Invitrogen, cat. no. 10482-028) Restriction enzymes: BsmBI ( Esp3I ) (Fermentas/ThermoScientific cat. no. ER0451) BsaI -HF (New England Biolabs, cat. no. R3535L) AfeI (New England Biolabs, cat. no. R0652S) Fermentas Tango Buffer and 10x NEBuffer 4 (included with enzymes) 100x Bovine Serum Albumin (New England Biolabs, included with Bsa I-HF) DL-Dithiothreitol (DTT) (Fermentas/ThermoScientific cat. no. R0862) T7 DNA ligase, 3,000 U/ul (Enzymatics, cat. no. L602L) CRITICAL Do not substitute the more commonly-used T4 ligase. .. T7 ligase has 1000-fold higher activity on sticky ends than blunt ends and higher overall activity than commercially available concentrated T4 ligases.

    Article Title: Multiplex target capture with double-stranded DNA probes
    Article Snippet: All 5,619 PCR products were pooled in a single tube and purified through QIAquick columns (Qiagen, Valencia, CA, US). .. The purified PCR products are simultaneously digested for 1 hour at 37°C using MlyI and BsaI-HF (NEB, Ipswich, MA, USA), only leaving the target sequences at each probe end, respectively. .. Following QIAquick purification, the pool of cLPPs is ready for multiplex target capture.

    Article Title: Smart DNA Fabrication Using Sound Waves
    Article Snippet: The PCR product was purified using a PureLink PCR purification kit (Life Technologies) and diluted to 20 ng/µl. .. The Golden Gate master mix was made of 35 µL T4 ligase (2000 U/µl, New England Biolabs, NEB), 35 µL BsaI-HF (NEB), 52.5 µL 10× T4 buffer (NEB), and 25 µL 200× BSA (NEB).

    Article Title: Construction of a novel anaerobic pathway in Escherichia coli for propionate production
    Article Snippet: Double terminator DNA fragment was PCR amplified using the c-lac-dbl term primer set. .. In a 10 μL Golden Gate reaction mixture, 100 ng of the linearized vector backbone and equimolar amounts of the other assembly pieces were blended with 0.5 μL BsaI-HF, 0.5 μL T4 ligase and 1× T4 ligase buffer (New England Biolabs, Ipswich, MA).

    Article Title: Efficient Targeted Mutagenesis in Medaka Using Custom-Designed Transcription Activator-Like Effector Nucleases
    Article Snippet: TAL repeats were assembled by the Golden Gate assembly method ( ) with slight modifications ( ). .. Each module containing an RVD was excised from each module plasmid (pNI, pHD, pNN, and pNG vectors) using Bsa I-HF (New England Biolabs, Ipswich, MA), and then the fragment was purified using NucleoSpin Gel and PCR Clean-up kit (MACHEREY-NAGEL, Düren, Germany). .. To generate repeat arrays, the modules were cloned into the dephosphorylated array plasmid (pFUS vectors) using Ligation high Ver.2 (Toyobo, Osaka, Japan).

    Article Title: A high-efficiency CRISPR/Cas9 system for targeted mutagenesis in Cotton (Gossypium hirsutum L.)
    Article Snippet: The GhMYB25-like-sgRNA1 and GhMYB25-like-sgRNA2 expression module was assembled by direct PCR amplification using pCBC-DT1T2 template as described previously . .. And then this PCR product was purified for the Golden Gate assembly of Cas9 expression module through the Type IIS restriction endonucleases (REases) BsaI reaction (R3535L, New England Biolabs). .. The assembled CRISPR/Cas9 vector was then transformed into Agrobacterium tumefaciens (strain EHA105).

    CRISPR:

    Article Title: MutS2 Promotes Homologous Recombination in Bacillus subtilis
    Article Snippet: Paragraph title: CRISPR/Cas9 editing plasmid construction. ... The plasmid was digested with BsaI-HF (NEB) in CutSmart buffer at 37°C.

    Article Title: A high-efficiency CRISPR/Cas9 system for targeted mutagenesis in Cotton (Gossypium hirsutum L.)
    Article Snippet: Paragraph title: sgRNAs Design and Golden Gate Assembly of CRISPR/Cas9 System ... And then this PCR product was purified for the Golden Gate assembly of Cas9 expression module through the Type IIS restriction endonucleases (REases) BsaI reaction (R3535L, New England Biolabs).

    Plasmid Preparation:

    Article Title: Fungal-type carbohydrate binding modules from the coccolithophore Emiliania huxleyi show binding affinity to cellulose and chitin
    Article Snippet: The pelB, linker, and CBM1 sequences were ordered as GeneArt Strings (ThermoFisher) and the AP segment was obtained with PCR (using KAPA HiFi DNA Polymerase from KAPA Biosystems and primers from Eurofins), all flanked with BsaI restriction sites and appropriate 4bp overlaps. .. Using the Golden Gate cloning method [ ] the pieces were combined (digest with BsaI-HF from NEB) and ligated (T4 DNA Ligase NEB) into a pET28a (+) expression vector and transformed in chemically competent TOP10 E . coli cells. .. The resulting plasmids were obtained by miniprep (NucleoSpin Plasmid from Macherey-Nagel).

    Article Title: YeastFab: the design and construction of standard biological parts for metabolic engineering in Saccharomyces cerevisiae
    Article Snippet: Paragraph title: Reporter plasmid construction ... 1.5 μl PCR fragments and 15 ng reporter plasmids were mixed together with 3 U of BsaI-HF (NEB), 0.5 U of T4 DNA ligase (Thermo Scientific) in 1× T4 ligase Buffer (Thermo Scientific).

    Article Title: Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides
    Article Snippet: We isolated the plasmid DNA from the saturated cell culture by a plasmid mini-prep kit (Omega Bio-Tek), and digested the pMK-RQ vector containing the CP (20 ng/µl) by BsmBI (0.25 U/µl), New England Biolabs), in 1× NEB2 buffer reaction at 55 °C for 2 h, followed by heat inactivation at 80 °C for 20 minutes. .. We applied the same procedure to get the linear 378 nt long ODN pseudogene but using ampicillin (100 µg/ml) in the 5 ml LB culture and BsaI-HF as restriction enzyme (New England Biolabs).

    Article Title: interleukin-11 induces and maintains progenitors of different cell lineages during Xenopus tadpole tail regeneration
    Article Snippet: gRNAs and cas9 mRNA were designed and synthesised essentially as described previously with minor modifications. .. In brief, DR274 plasmid was digested with Bsa I-HF (New England Biolabs, MA), annealed with oligonucleotide, and they were ligated. .. Some of the gRNA template plasmids were assembled using a PCR-amplified DR274 fragment, an oligonucleotide, and an In-Fusion HD Cloning Kit (TaKaRa).

    Article Title: mKast is dispensable for normal development and sexual maturation of the male European honeybee
    Article Snippet: RNA synthesis of sgRNA and Cas9 mRNA were conducted as described previously . .. For synthesis of the sgRNA, oligo DNAs containing sequences corresponding to the sgRNA target site and restriction enzyme recognition site were synthesized (Fasmac, Japan), and annealed oligomers were ligated into the vector pDR274 (Addgene, UK) and cut with Bsa I-HF (New England Biolabs, Japan). .. After linearization using Dra I (Takara, Japan), the sgRNA was in vitro -transcribed using the T7- Flash Transcription Kit (Epicentre, USA), purified by phenol/chloroform extraction and ethanol precipitation, and stored at −80 °C until use.

    Article Title: Shuttling along DNA and directed processing of D-loops by RecQ helicase support quality control of homologous recombination
    Article Snippet: For hairpin DNA substrate, a 174-bp DNA hairpin with a ∼1.0-kb DNA handle was generated first by PCR of pKZ1 plasmid between positions 4550 and 368 using forward primer (position 368) containing a BsaI restriction enzyme digestion site and reverse primer (position 4550) 5′-labeled with digoxigenin. pKZ1 was made by ligating a 44-bp dsDNA segment containing two BbvCI restriction sites separated by 37 nt into pET28b plasmid at the BamHI restriction site. .. PCR product was digested with restriction enzymes Nt.BbvCI (New England Biolabs) and BsaI-HF (New England Biolabs) for 16 h at 37 °C to create two nicks at positions 1093 and 1129, near the middle of the DNA template and the 5′ overhang at the end of dsDNA, respectively.

    Article Title: CRISPR/Cas9 Editing of the Bacillus subtilis Genome
    Article Snippet: Paragraph title: A. Construction of plasmid containing spacer used to target the B. subtilis genome ... Prepare pPB41 digested with the restriction endonuclease Bsa I ( ) Assemble 50 μl restriction digest reaction: 1x Cutsmart buffer (NEB), 2 μl Bsa I-HF (20,000 U/ml; NEB), and 5 μg pPB41.

    Article Title: Reprograming the replisome of a semi-synthetic organism for the expansion of the genetic alphabet
    Article Snippet: UBP containing dsDNA was produced with a 50-μL PCR with chemically synthesized UBP containing oligonucleotides (0.025 ng/μL), primers introducing BsaI sites and vector homology (1 μM, ), d TPT3 TP (100 μM), d NaM TP (100 μM), dNTPs (200 μM), MgSO4 (1.2 mM), One Taq DNA Polymerase (0.025 U/μL), and One Taq Standard Reaction Buffer (1×, New England Biolabs). .. BsaI-HF (0.33 U/μL) and T5 exonuclease (0.16 U/μL, New England Biolabs) were then added, and the reaction was incubated at 37 °C for 1 h to remove any pUCX2 without an insert.

    Article Title: A Transcription Activator-Like Effector (TALE) Toolbox for Genome Engineering
    Article Snippet: See Supplementary Data 1 for plasmid sequences. .. QIAprep Spin Miniprep Kit (Qiagen, cat. no. 27106) QIAquick 96 PCR Purification (Qiagen, cat. no. 28181) UltraPure DNase/RNase-Free Distilled Water (Invitrogen, cat. no. 10977-023) UltraPure 10X TBE Buffer (Invitrogen, cat. no. 15581-028) SeaKem LE agarose (Lonza, cat. no. 50004) 10,000x SYBR Safe DNA stain (Invitrogen, cat. no. ) Low DNA Mass Ladder (Invitrogen, cat. no. 10068-013) 1 kb Plus DNA Ladder (Invitrogen, cat. no. 10787-018) TrackIt™ Cyan/Orange Loading Buffer (Invitrogen, cat. no. 10482-028) Restriction enzymes: BsmBI ( Esp3I ) (Fermentas/ThermoScientific cat. no. ER0451) BsaI -HF (New England Biolabs, cat. no. R3535L) AfeI (New England Biolabs, cat. no. R0652S) Fermentas Tango Buffer and 10x NEBuffer 4 (included with enzymes) 100x Bovine Serum Albumin (New England Biolabs, included with Bsa I-HF) DL-Dithiothreitol (DTT) (Fermentas/ThermoScientific cat. no. R0862) T7 DNA ligase, 3,000 U/ul (Enzymatics, cat. no. L602L) CRITICAL Do not substitute the more commonly-used T4 ligase.

    Article Title: Quantitative analysis of TALE-DNA interactions suggests polarity effects
    Article Snippet: The first reaction assembled two five-repeat arrays and one seven-repeat array. .. Each cut-ligation reaction used 75 ng of appropriate plasmids with Bsa I-HF (New England Biolabs) and T4 ligase (New England Biolabs) that were incubated at 37°C for 5 h. On sequence verification, the three segments were assembled in a second cut-ligation reaction using a vector containing the last half-repeat to form a complete 17.5-repeat array (5 + 5 + 7 + 0.5 = 17.5). .. Final 17.5-repeat arrays were cloned by Stu I/Aat II digestion into pPreTALE111-42 and pPreTALE94-42 , which contained truncated N- and C-termini of the naturally occurring TALE PthXo1 in pAH103 , generated by polymerase chain reaction (PCR) using primers listed in Supplementary Table S1 .

    Article Title: Smart DNA Fabrication Using Sound Waves
    Article Snippet: Bacteria carrying the residual RFP plasmid will give a bright red pigment, which would facilitate the visual identification of correct assembled clones (white colonies; see ). .. The Golden Gate master mix was made of 35 µL T4 ligase (2000 U/µl, New England Biolabs, NEB), 35 µL BsaI-HF (NEB), 52.5 µL 10× T4 buffer (NEB), and 25 µL 200× BSA (NEB).

    Article Title: Construction of a novel anaerobic pathway in Escherichia coli for propionate production
    Article Snippet: Plasmid backbone of pET28a and DNA fragments were assembled with Golden Gate Assembly [ ]. .. In a 10 μL Golden Gate reaction mixture, 100 ng of the linearized vector backbone and equimolar amounts of the other assembly pieces were blended with 0.5 μL BsaI-HF, 0.5 μL T4 ligase and 1× T4 ligase buffer (New England Biolabs, Ipswich, MA). .. The reaction was carried out in a thermocycler using the following program: 37 °C for 3 min, 16 °C for 4 min, repeat 1–2 for 25 cycles, 50 °C for 5 min, 80 °C for 5 min, and 4 °C hold.

    Article Title: Efficient Targeted Mutagenesis in Medaka Using Custom-Designed Transcription Activator-Like Effector Nucleases
    Article Snippet: TAL repeats were assembled by the Golden Gate assembly method ( ) with slight modifications ( ). .. Each module containing an RVD was excised from each module plasmid (pNI, pHD, pNN, and pNG vectors) using Bsa I-HF (New England Biolabs, Ipswich, MA), and then the fragment was purified using NucleoSpin Gel and PCR Clean-up kit (MACHEREY-NAGEL, Düren, Germany). .. To generate repeat arrays, the modules were cloned into the dephosphorylated array plasmid (pFUS vectors) using Ligation high Ver.2 (Toyobo, Osaka, Japan).

    Article Title: MutS2 Promotes Homologous Recombination in Bacillus subtilis
    Article Snippet: First, the spacer was incorporated into the CRISPR array via restriction digestion and ligation cloning. .. The plasmid was digested with BsaI-HF (NEB) in CutSmart buffer at 37°C. .. First the oligonucleotides, ordered with the correct overhangs , were annealed by mixing the oligonucleotides at 10 μM each in 1× annealing buffer (10 mM Tris-Cl, pH 7.5, 100 mM NaCl, and 0.1 mM EDTA).

    Article Title: GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis
    Article Snippet: We have identified plasmid DNA quality and quantity to be an important determinant of GreenGate efficiency with a DNA concentration of at least 100 ng/µl after column preparation being a minimum requirement. .. We found both Bsa I-HF from NewEngland Biolabs, as well as the isoschizomer FastDigest Eco 31I from Fermentas to be highly sensitive to temperature fluctuations in a batch dependent manner.

    Article Title: BtsCI and BseGI display sequence preference in the nucleotides flanking the recognition sequence
    Article Snippet: We prepared oligonucleotides using the monoclonal stoichiometric method (MOSIC) developed in our lab, according to a protocol described before [ ]. .. Briefly, we incubated 20 μg of pPDGF plasmid DNA containing our insert (sequence in Data A in , ThermoFischer Scientific) with BsaI-HF (New England Biolabs(NEB)) for 4h in NEB4 buffer (50mM Potassium acetate, 20mM Tris-acetate, 10mM Mg-acetate, 1mM DTT). .. After gel electrophoresis in a 0.8% agarose gel in TBE 0.5X with incorporated EtBr, we gel extracted the band using GeneJet gel extraction kit (ThermoFischer Scientific).

    Selection:

    Article Title: YeastFab: the design and construction of standard biological parts for metabolic engineering in Saccharomyces cerevisiae
    Article Snippet: Similar to the part accepting vectors, the reporter plasmid was re-engineered to contain a bacterial expressed RFP gene for colony selection just upstream of the YFP ORF, which could be released with BsaI, leaving overhangs compatible with promoter parts. .. 1.5 μl PCR fragments and 15 ng reporter plasmids were mixed together with 3 U of BsaI-HF (NEB), 0.5 U of T4 DNA ligase (Thermo Scientific) in 1× T4 ligase Buffer (Thermo Scientific).

    Article Title: CRISPR/Cas9 Editing of the Bacillus subtilis Genome
    Article Snippet: Prepare pPB41 digested with the restriction endonuclease Bsa I ( ) Assemble 50 μl restriction digest reaction: 1x Cutsmart buffer (NEB), 2 μl Bsa I-HF (20,000 U/ml; NEB), and 5 μg pPB41. .. Notes: The plasmid pPB41 is typically used, but we also generated a derivative, pPB105, wherein the spectinomycin resistance cassette was replaced with a chloramphenicol resistance cassette (see ).

    Agarose Gel Electrophoresis:

    Article Title: Fungal-type carbohydrate binding modules from the coccolithophore Emiliania huxleyi show binding affinity to cellulose and chitin
    Article Snippet: Using the Golden Gate cloning method [ ] the pieces were combined (digest with BsaI-HF from NEB) and ligated (T4 DNA Ligase NEB) into a pET28a (+) expression vector and transformed in chemically competent TOP10 E . coli cells. .. The resulting plasmids were obtained by miniprep (NucleoSpin Plasmid from Macherey-Nagel).

    Article Title: Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides
    Article Snippet: We loaded the digestion products on a 1% agarose gel containing ethidium bromide (1 µg/ml, Sigma Aldrich), and purified the linear pseudogene (329 base pairs) by gel extraction (kit from Omega bio-tek) and eluted in 30 µl 10mM Tris-HCl (pH 8.5). .. We applied the same procedure to get the linear 378 nt long ODN pseudogene but using ampicillin (100 µg/ml) in the 5 ml LB culture and BsaI-HF as restriction enzyme (New England Biolabs).

    Article Title: CRISPR/Cas9 Editing of the Bacillus subtilis Genome
    Article Snippet: Prepare pPB41 digested with the restriction endonuclease Bsa I ( ) Assemble 50 μl restriction digest reaction: 1x Cutsmart buffer (NEB), 2 μl Bsa I-HF (20,000 U/ml; NEB), and 5 μg pPB41. .. All steps of the procedure are identical for pPB105, except for E. coli clones are selected using LB agar plates containing 100 μg/ml ampicillin or 20 μg/ml chloramphenicol (chloramphenicol selection works but colonies grow slower), and B. subtilis transformants are selected using LB agar plates containing 5 μg/ml chloramphenicol.

    In Vitro:

    Article Title: Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides
    Article Snippet: Paragraph title: Pseudogene in vitro amplification ... We applied the same procedure to get the linear 378 nt long ODN pseudogene but using ampicillin (100 µg/ml) in the 5 ml LB culture and BsaI-HF as restriction enzyme (New England Biolabs).

    Article Title: interleukin-11 induces and maintains progenitors of different cell lineages during Xenopus tadpole tail regeneration
    Article Snippet: In brief, DR274 plasmid was digested with Bsa I-HF (New England Biolabs, MA), annealed with oligonucleotide, and they were ligated. .. In brief, DR274 plasmid was digested with Bsa I-HF (New England Biolabs, MA), annealed with oligonucleotide, and they were ligated.

    Article Title: mKast is dispensable for normal development and sexual maturation of the male European honeybee
    Article Snippet: For synthesis of the sgRNA, oligo DNAs containing sequences corresponding to the sgRNA target site and restriction enzyme recognition site were synthesized (Fasmac, Japan), and annealed oligomers were ligated into the vector pDR274 (Addgene, UK) and cut with Bsa I-HF (New England Biolabs, Japan). .. After linearization using Dra I (Takara, Japan), the sgRNA was in vitro -transcribed using the T7- Flash Transcription Kit (Epicentre, USA), purified by phenol/chloroform extraction and ethanol precipitation, and stored at −80 °C until use.

    Produced:

    Article Title: Reprograming the replisome of a semi-synthetic organism for the expansion of the genetic alphabet
    Article Snippet: UBP containing dsDNA was produced with a 50-μL PCR with chemically synthesized UBP containing oligonucleotides (0.025 ng/μL), primers introducing BsaI sites and vector homology (1 μM, ), d TPT3 TP (100 μM), d NaM TP (100 μM), dNTPs (200 μM), MgSO4 (1.2 mM), One Taq DNA Polymerase (0.025 U/μL), and One Taq Standard Reaction Buffer (1×, New England Biolabs). .. BsaI-HF (0.33 U/μL) and T5 exonuclease (0.16 U/μL, New England Biolabs) were then added, and the reaction was incubated at 37 °C for 1 h to remove any pUCX2 without an insert.

    Concentration Assay:

    Article Title: GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis
    Article Snippet: We have identified plasmid DNA quality and quantity to be an important determinant of GreenGate efficiency with a DNA concentration of at least 100 ng/µl after column preparation being a minimum requirement. .. We found both Bsa I-HF from NewEngland Biolabs, as well as the isoschizomer FastDigest Eco 31I from Fermentas to be highly sensitive to temperature fluctuations in a batch dependent manner.

    Article Title: BtsCI and BseGI display sequence preference in the nucleotides flanking the recognition sequence
    Article Snippet: Briefly, we incubated 20 μg of pPDGF plasmid DNA containing our insert (sequence in Data A in , ThermoFischer Scientific) with BsaI-HF (New England Biolabs(NEB)) for 4h in NEB4 buffer (50mM Potassium acetate, 20mM Tris-acetate, 10mM Mg-acetate, 1mM DTT). .. Briefly, we incubated 20 μg of pPDGF plasmid DNA containing our insert (sequence in Data A in , ThermoFischer Scientific) with BsaI-HF (New England Biolabs(NEB)) for 4h in NEB4 buffer (50mM Potassium acetate, 20mM Tris-acetate, 10mM Mg-acetate, 1mM DTT).

    Marker:

    Article Title: Smart DNA Fabrication Using Sound Waves
    Article Snippet: This plasmid carries a KanR selectable marker, along with a RFP cassette flanked by a pair of outward-facing BsaI sites. .. The Golden Gate master mix was made of 35 µL T4 ligase (2000 U/µl, New England Biolabs, NEB), 35 µL BsaI-HF (NEB), 52.5 µL 10× T4 buffer (NEB), and 25 µL 200× BSA (NEB).

    Staining:

    Article Title: A Transcription Activator-Like Effector (TALE) Toolbox for Genome Engineering
    Article Snippet: 5x Herculase II reaction buffer (Agilent Technologies, included with polymerase) Taq-B polymerase (Enzymatics, cat. no. P725L) 10x Taq-B buffer (Enzymatics, included with polymerase) 25 mM (each) dNTP solution mix (Enzymatics, cat. no. N205L) MinElute Gel Extraction Kit (Qiagen, cat. no. 28606) CRITICAL MinElute columns should be stored at 4°C until use. .. QIAprep Spin Miniprep Kit (Qiagen, cat. no. 27106) QIAquick 96 PCR Purification (Qiagen, cat. no. 28181) UltraPure DNase/RNase-Free Distilled Water (Invitrogen, cat. no. 10977-023) UltraPure 10X TBE Buffer (Invitrogen, cat. no. 15581-028) SeaKem LE agarose (Lonza, cat. no. 50004) 10,000x SYBR Safe DNA stain (Invitrogen, cat. no. ) Low DNA Mass Ladder (Invitrogen, cat. no. 10068-013) 1 kb Plus DNA Ladder (Invitrogen, cat. no. 10787-018) TrackIt™ Cyan/Orange Loading Buffer (Invitrogen, cat. no. 10482-028) Restriction enzymes: BsmBI ( Esp3I ) (Fermentas/ThermoScientific cat. no. ER0451) BsaI -HF (New England Biolabs, cat. no. R3535L) AfeI (New England Biolabs, cat. no. R0652S) Fermentas Tango Buffer and 10x NEBuffer 4 (included with enzymes) 100x Bovine Serum Albumin (New England Biolabs, included with Bsa I-HF) DL-Dithiothreitol (DTT) (Fermentas/ThermoScientific cat. no. R0862) T7 DNA ligase, 3,000 U/ul (Enzymatics, cat. no. L602L) CRITICAL Do not substitute the more commonly-used T4 ligase. .. T7 ligase has 1000-fold higher activity on sticky ends than blunt ends and higher overall activity than commercially available concentrated T4 ligases.

    Variant Assay:

    Article Title: Quantitative analysis of TALE-DNA interactions suggests polarity effects
    Article Snippet: Each cut-ligation reaction used 75 ng of appropriate plasmids with Bsa I-HF (New England Biolabs) and T4 ligase (New England Biolabs) that were incubated at 37°C for 5 h. On sequence verification, the three segments were assembled in a second cut-ligation reaction using a vector containing the last half-repeat to form a complete 17.5-repeat array (5 + 5 + 7 + 0.5 = 17.5). .. Each cut-ligation reaction used 75 ng of appropriate plasmids with Bsa I-HF (New England Biolabs) and T4 ligase (New England Biolabs) that were incubated at 37°C for 5 h. On sequence verification, the three segments were assembled in a second cut-ligation reaction using a vector containing the last half-repeat to form a complete 17.5-repeat array (5 + 5 + 7 + 0.5 = 17.5).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars

  • 99
    New England Biolabs bsai
    Identification of suitable methylases for methylation-switching. ( A ) Initial screening of functional methylases for selective blocking of overlapping methylation/restriction sites. The diagrams show the design of overlapping sites for screening of methylase activity. The table shows the screening result using methylases expressed in vivo from an F-ori based low copy number vector. Restriction enzyme recognition sites are boxed in solid lines. The adhesive ends generated by the restriction enzyme are shown by solid lines. Methylase recognition sites are boxed in dashed lines, and methylated bases are in bold font. All the listed methylases modify N6-adenine, except M.SacI and M.AspJHL3I, which modify C5-cytosine and N4-cytosine respectively. ( B ) Experimental designs to test blocking of methylation-switchable type IIS restriction enzyme sites by in vivo methylation. For each methylase/restriction enzyme combination tested, the test plasmid contains a head-to-head potentially methylation-switchable restriction site and a non-methylatable restriction site. Restriction digestion of test plasmid prepared from a normal E. coli strain would result in cutting at both sites and the release of a 600 bp fragment from the 4.3 kb vector backbone. Restriction digestion of test plasmid prepared from a strain expressing the switch methylase would result in a single 4.9 kb band, due to blocking of the methylation-switchable restriction sites by in vivo methylation. The restriction sites of the test plasmids for each restriction enzyme are shown, with the restriction site boxed in solid line, the methylase recognition site boxed in dashed line, and the methylated bases in bold. The head-to-head arrangement of overlapping methylation/restriction site allows the same assay to be used to detect any residual single strand nicking activity of the restriction enzyme towards the methylated restriction site. ( C ) Agarose gel electrophoresis analysis of the test plasmids for each methylation-switchable restriction site after preparation of the plasmids in a normal strain (–) or in a strain expressing the appropriate DNA methylase (+) and digested with the corresponding type IIS restriction enzymes. The combinations tested were <t>BsaI</t> with <t>M.Osp807II</t> methylase using test plasmid pMOP_BsaINC, BpiI with M2.NmeMC58II methylase using test plasmid pMOP_BpiINC, and LguI with M.XmnI methylase using test plasmid pMOP_LguINC. Test conditions were 60 fmol test plasmid digested using 5 U BsaI or BpiI, or 2.5 U LguI in 10 μl reactions at 37°C for 1 h. The results show that in vivo methylation by each of the methylases successfully blocked the restriction site for the corresponding type IIS restriction enzyme when the methylase recognition site overlapped the restriction enzyme site. The data shown represents results from three independent experiments.
    Bsai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 37 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsai/product/New England Biolabs
    Average 99 stars, based on 37 article reviews
    Price from $9.99 to $1999.99
    bsai - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Identification of suitable methylases for methylation-switching. ( A ) Initial screening of functional methylases for selective blocking of overlapping methylation/restriction sites. The diagrams show the design of overlapping sites for screening of methylase activity. The table shows the screening result using methylases expressed in vivo from an F-ori based low copy number vector. Restriction enzyme recognition sites are boxed in solid lines. The adhesive ends generated by the restriction enzyme are shown by solid lines. Methylase recognition sites are boxed in dashed lines, and methylated bases are in bold font. All the listed methylases modify N6-adenine, except M.SacI and M.AspJHL3I, which modify C5-cytosine and N4-cytosine respectively. ( B ) Experimental designs to test blocking of methylation-switchable type IIS restriction enzyme sites by in vivo methylation. For each methylase/restriction enzyme combination tested, the test plasmid contains a head-to-head potentially methylation-switchable restriction site and a non-methylatable restriction site. Restriction digestion of test plasmid prepared from a normal E. coli strain would result in cutting at both sites and the release of a 600 bp fragment from the 4.3 kb vector backbone. Restriction digestion of test plasmid prepared from a strain expressing the switch methylase would result in a single 4.9 kb band, due to blocking of the methylation-switchable restriction sites by in vivo methylation. The restriction sites of the test plasmids for each restriction enzyme are shown, with the restriction site boxed in solid line, the methylase recognition site boxed in dashed line, and the methylated bases in bold. The head-to-head arrangement of overlapping methylation/restriction site allows the same assay to be used to detect any residual single strand nicking activity of the restriction enzyme towards the methylated restriction site. ( C ) Agarose gel electrophoresis analysis of the test plasmids for each methylation-switchable restriction site after preparation of the plasmids in a normal strain (–) or in a strain expressing the appropriate DNA methylase (+) and digested with the corresponding type IIS restriction enzymes. The combinations tested were BsaI with M.Osp807II methylase using test plasmid pMOP_BsaINC, BpiI with M2.NmeMC58II methylase using test plasmid pMOP_BpiINC, and LguI with M.XmnI methylase using test plasmid pMOP_LguINC. Test conditions were 60 fmol test plasmid digested using 5 U BsaI or BpiI, or 2.5 U LguI in 10 μl reactions at 37°C for 1 h. The results show that in vivo methylation by each of the methylases successfully blocked the restriction site for the corresponding type IIS restriction enzyme when the methylase recognition site overlapped the restriction enzyme site. The data shown represents results from three independent experiments.

    Journal: Nucleic Acids Research

    Article Title: MetClo: methylase-assisted hierarchical DNA assembly using a single type IIS restriction enzyme

    doi: 10.1093/nar/gky596

    Figure Lengend Snippet: Identification of suitable methylases for methylation-switching. ( A ) Initial screening of functional methylases for selective blocking of overlapping methylation/restriction sites. The diagrams show the design of overlapping sites for screening of methylase activity. The table shows the screening result using methylases expressed in vivo from an F-ori based low copy number vector. Restriction enzyme recognition sites are boxed in solid lines. The adhesive ends generated by the restriction enzyme are shown by solid lines. Methylase recognition sites are boxed in dashed lines, and methylated bases are in bold font. All the listed methylases modify N6-adenine, except M.SacI and M.AspJHL3I, which modify C5-cytosine and N4-cytosine respectively. ( B ) Experimental designs to test blocking of methylation-switchable type IIS restriction enzyme sites by in vivo methylation. For each methylase/restriction enzyme combination tested, the test plasmid contains a head-to-head potentially methylation-switchable restriction site and a non-methylatable restriction site. Restriction digestion of test plasmid prepared from a normal E. coli strain would result in cutting at both sites and the release of a 600 bp fragment from the 4.3 kb vector backbone. Restriction digestion of test plasmid prepared from a strain expressing the switch methylase would result in a single 4.9 kb band, due to blocking of the methylation-switchable restriction sites by in vivo methylation. The restriction sites of the test plasmids for each restriction enzyme are shown, with the restriction site boxed in solid line, the methylase recognition site boxed in dashed line, and the methylated bases in bold. The head-to-head arrangement of overlapping methylation/restriction site allows the same assay to be used to detect any residual single strand nicking activity of the restriction enzyme towards the methylated restriction site. ( C ) Agarose gel electrophoresis analysis of the test plasmids for each methylation-switchable restriction site after preparation of the plasmids in a normal strain (–) or in a strain expressing the appropriate DNA methylase (+) and digested with the corresponding type IIS restriction enzymes. The combinations tested were BsaI with M.Osp807II methylase using test plasmid pMOP_BsaINC, BpiI with M2.NmeMC58II methylase using test plasmid pMOP_BpiINC, and LguI with M.XmnI methylase using test plasmid pMOP_LguINC. Test conditions were 60 fmol test plasmid digested using 5 U BsaI or BpiI, or 2.5 U LguI in 10 μl reactions at 37°C for 1 h. The results show that in vivo methylation by each of the methylases successfully blocked the restriction site for the corresponding type IIS restriction enzyme when the methylase recognition site overlapped the restriction enzyme site. The data shown represents results from three independent experiments.

    Article Snippet: In stage one, the fragments were assembled, seven per group, using 15 fmol of each donor plasmid prepared from DH10B cells, 15 fmol assembly vector prepared from DH10B-M.Osp807II cells, 1000 U T4 ligase (NEB), and 5 U BsaI (NEB) in 20 μl 1× T4 ligase buffer (NEB).

    Techniques: Methylation, Functional Assay, Blocking Assay, Activity Assay, In Vivo, Low Copy Number, Plasmid Preparation, Generated, Expressing, Agarose Gel Electrophoresis

    BsaI-M.Osp807II based MetClo system. The donor plasmids contain DNA fragments to be assembled (Fragments A–D) flanked by BsaI sites that generate compatible adhesive ends (schematically labelled aaaa-eeee). The BsaI sites overlap with the M.Osp807II methylase recognition sequence. Donor plasmids were prepared from a normal strain that does not express the M.Osp807II switch methylase. As a result, the BsaI sites are not methylated and so the insert DNA fragments can be released by BsaI digestion. The recipient assembly vector contains a LacZα selection marker flanked by head-to-head BsaI sites. The outer pair of BsaI sites closer to the vector backbone overlap with an M.Osp807II methylation sequence and so are methylation-switchable, whereas the inner pair of BsaI sites are not. Preparation of the assembly vector in the M.Osp807II switch methylase-expressing DH10B strain results in selective blocking of the outer pair of BsaI sites. The LacZα fragment can be released by BsaI through cutting at inner pair of BsaI sites. Following a one-pot reaction using BsaI and T4 DNA ligase, ligation among compatible adhesive ends results in ordered assembly of DNA fragments into the assembly vector backbone. The assembled fragment in the assembled plasmid is flanked by methylated BsaI sites, which are not cut by BsaI. Following transformation into a normal strain that does not express the M.Osp807II switch methylase, methylation of the flanking restriction sites is lost, and the assembled fragment can be released by BsaI for the next stage assembly.

    Journal: Nucleic Acids Research

    Article Title: MetClo: methylase-assisted hierarchical DNA assembly using a single type IIS restriction enzyme

    doi: 10.1093/nar/gky596

    Figure Lengend Snippet: BsaI-M.Osp807II based MetClo system. The donor plasmids contain DNA fragments to be assembled (Fragments A–D) flanked by BsaI sites that generate compatible adhesive ends (schematically labelled aaaa-eeee). The BsaI sites overlap with the M.Osp807II methylase recognition sequence. Donor plasmids were prepared from a normal strain that does not express the M.Osp807II switch methylase. As a result, the BsaI sites are not methylated and so the insert DNA fragments can be released by BsaI digestion. The recipient assembly vector contains a LacZα selection marker flanked by head-to-head BsaI sites. The outer pair of BsaI sites closer to the vector backbone overlap with an M.Osp807II methylation sequence and so are methylation-switchable, whereas the inner pair of BsaI sites are not. Preparation of the assembly vector in the M.Osp807II switch methylase-expressing DH10B strain results in selective blocking of the outer pair of BsaI sites. The LacZα fragment can be released by BsaI through cutting at inner pair of BsaI sites. Following a one-pot reaction using BsaI and T4 DNA ligase, ligation among compatible adhesive ends results in ordered assembly of DNA fragments into the assembly vector backbone. The assembled fragment in the assembled plasmid is flanked by methylated BsaI sites, which are not cut by BsaI. Following transformation into a normal strain that does not express the M.Osp807II switch methylase, methylation of the flanking restriction sites is lost, and the assembled fragment can be released by BsaI for the next stage assembly.

    Article Snippet: In stage one, the fragments were assembled, seven per group, using 15 fmol of each donor plasmid prepared from DH10B cells, 15 fmol assembly vector prepared from DH10B-M.Osp807II cells, 1000 U T4 ligase (NEB), and 5 U BsaI (NEB) in 20 μl 1× T4 ligase buffer (NEB).

    Techniques: Sequencing, Methylation, Plasmid Preparation, Selection, Marker, Expressing, Blocking Assay, Ligation, Transformation Assay

    Design of a standard MetClo vector set. Three types of adaptor sequences were designed for the standard MetClo vector set. The vectors contain two head-to-head BsaI sites (boxed) flanking the negative selection marker LacZα. The pair of unmethylated BsaI sites closest to the negative selection marker can be used to release LacZα and generates adhesive ends ‘p’ and ‘q’. This allows any fragments that start with adhesive end ‘p’ and end with adhesive end ‘q’ to be cloned into any of the three types of adaptor sequences (types ‘Start’, ‘Middle’, ‘End’). The outer pair of BsaI sites closest to the vector backbone overlap with the M.Osp807II recognition sequence and are both methylated at the adenine bases highlighted in bold when the vector is prepared in M.Osp807II-expressing E. coli strain. A DNA fragment assembled into these vectors, following transformation into a normal E. coli strain which lacks this switch methylase activity, can be released from the assembled plasmid using BsaI, which can now recognize this unmethylated BsaI site. The released fragment will carry different adhesive ends depending on the type of the vector used. Assembly into a type ‘Start’ vector will generate a fragment flanked by adaptors ‘p-a’; assembly into a type ‘Middle’ vector will generate a fragment flanked by ‘a-b’, ‘b-c’, ‘c-d’ or ‘d-e’; assembly into a type ‘End’ vector will generate a fragment flanked by ‘a-q’, ‘b-q’, ‘c-q’, ‘d-q’ or ‘e-q’. The design of these LacZα selection cassettes flanked by unique adaptors are represented in the figure by the letter codes for the outside adaptor sequences.

    Journal: Nucleic Acids Research

    Article Title: MetClo: methylase-assisted hierarchical DNA assembly using a single type IIS restriction enzyme

    doi: 10.1093/nar/gky596

    Figure Lengend Snippet: Design of a standard MetClo vector set. Three types of adaptor sequences were designed for the standard MetClo vector set. The vectors contain two head-to-head BsaI sites (boxed) flanking the negative selection marker LacZα. The pair of unmethylated BsaI sites closest to the negative selection marker can be used to release LacZα and generates adhesive ends ‘p’ and ‘q’. This allows any fragments that start with adhesive end ‘p’ and end with adhesive end ‘q’ to be cloned into any of the three types of adaptor sequences (types ‘Start’, ‘Middle’, ‘End’). The outer pair of BsaI sites closest to the vector backbone overlap with the M.Osp807II recognition sequence and are both methylated at the adenine bases highlighted in bold when the vector is prepared in M.Osp807II-expressing E. coli strain. A DNA fragment assembled into these vectors, following transformation into a normal E. coli strain which lacks this switch methylase activity, can be released from the assembled plasmid using BsaI, which can now recognize this unmethylated BsaI site. The released fragment will carry different adhesive ends depending on the type of the vector used. Assembly into a type ‘Start’ vector will generate a fragment flanked by adaptors ‘p-a’; assembly into a type ‘Middle’ vector will generate a fragment flanked by ‘a-b’, ‘b-c’, ‘c-d’ or ‘d-e’; assembly into a type ‘End’ vector will generate a fragment flanked by ‘a-q’, ‘b-q’, ‘c-q’, ‘d-q’ or ‘e-q’. The design of these LacZα selection cassettes flanked by unique adaptors are represented in the figure by the letter codes for the outside adaptor sequences.

    Article Snippet: In stage one, the fragments were assembled, seven per group, using 15 fmol of each donor plasmid prepared from DH10B cells, 15 fmol assembly vector prepared from DH10B-M.Osp807II cells, 1000 U T4 ligase (NEB), and 5 U BsaI (NEB) in 20 μl 1× T4 ligase buffer (NEB).

    Techniques: Plasmid Preparation, Selection, Marker, Clone Assay, Sequencing, Methylation, Expressing, Transformation Assay, Activity Assay

    Characterization of poly(A) tract stability in pEVL. ( a ) Stability of the encoded poly(A) tracts following overnight induction of pEVL for template preparation. BFP-pEVL-200 through 500 were grown overnight with induction at 30 °C and then maxiprepped. Each maxiprepped sample was digested with BsiWI and BsaI to release the poly(A) tail fragment from the rest of the plasmid. The tail length was determined by gel electrophoresis with comparison to a known molecular weight s tandard. ( b ) Shortening of poly(A) tracts upon cloning into standard circular or linear plasmid cloning vectors at 30 °C. BFP followed by poly(A) tract inserts of 70, 172, and 325 base pairs bounded by restriction enzyme sites DraIII and SwaI were generated via restriction enzyme digest from the linear plasmid cloning vectors pEVL-100, pEVL-200, and pEVL-300. The inserts were ligated into the circular cloning vector pWNY or subcloned into pEVL and transformed via electroporation. Transformed bacteria were grown with ampicillin (pWNY) or kanamycin (pEVL) selection at 30 °C. Individual colonies were amplified by PCR using primers flanking the poly(A) tract, and the length of the poly(A) tract was determined based on the resulting band size as in Figure 1 . Typically, a band was obtained at the expected size, or a smaller size, reflecting shortening of the poly(A) tract during transformation. Colonies were scored for whether the poly(A) tract fragment was approximately of the expected size (open circle), or was substantially shortened (closed circle). ( c ) Stability of encoded poly(A) tracts under extended propagation conditions. To test the stability of the poly(A) tail under stringent propagation conditions, pEVL 100 through 500 were grown for 2 weeks at 30 °C and 37 °C with reseeding into fresh media at a 1:1000 dilution every 24 hours. At days 0, 6, and 13, each sample was similarly reseeded into induction media and grown overnight before being miniprepped. Parallel analysis was performed with the circular vectors described in ( b ), in which the poly(A) tract fragment was sub-cloned into a circular vector (pWNY). As these are already high-copy plasmids, no inducing agent was added to the cultures. For the circular vectors, samples were miniprepped daily for 7 days. For both pEVL and the circular vectors, the tail length of the induced minipreps was determined by gel elctrophoresis as described above. The expected tail band size for each construct is indicated with an arrow.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: pEVL: A Linear Plasmid for Generating mRNA IVT Templates With Extended Encoded Poly(A) Sequences

    doi: 10.1038/mtna.2016.21

    Figure Lengend Snippet: Characterization of poly(A) tract stability in pEVL. ( a ) Stability of the encoded poly(A) tracts following overnight induction of pEVL for template preparation. BFP-pEVL-200 through 500 were grown overnight with induction at 30 °C and then maxiprepped. Each maxiprepped sample was digested with BsiWI and BsaI to release the poly(A) tail fragment from the rest of the plasmid. The tail length was determined by gel electrophoresis with comparison to a known molecular weight s tandard. ( b ) Shortening of poly(A) tracts upon cloning into standard circular or linear plasmid cloning vectors at 30 °C. BFP followed by poly(A) tract inserts of 70, 172, and 325 base pairs bounded by restriction enzyme sites DraIII and SwaI were generated via restriction enzyme digest from the linear plasmid cloning vectors pEVL-100, pEVL-200, and pEVL-300. The inserts were ligated into the circular cloning vector pWNY or subcloned into pEVL and transformed via electroporation. Transformed bacteria were grown with ampicillin (pWNY) or kanamycin (pEVL) selection at 30 °C. Individual colonies were amplified by PCR using primers flanking the poly(A) tract, and the length of the poly(A) tract was determined based on the resulting band size as in Figure 1 . Typically, a band was obtained at the expected size, or a smaller size, reflecting shortening of the poly(A) tract during transformation. Colonies were scored for whether the poly(A) tract fragment was approximately of the expected size (open circle), or was substantially shortened (closed circle). ( c ) Stability of encoded poly(A) tracts under extended propagation conditions. To test the stability of the poly(A) tail under stringent propagation conditions, pEVL 100 through 500 were grown for 2 weeks at 30 °C and 37 °C with reseeding into fresh media at a 1:1000 dilution every 24 hours. At days 0, 6, and 13, each sample was similarly reseeded into induction media and grown overnight before being miniprepped. Parallel analysis was performed with the circular vectors described in ( b ), in which the poly(A) tract fragment was sub-cloned into a circular vector (pWNY). As these are already high-copy plasmids, no inducing agent was added to the cultures. For the circular vectors, samples were miniprepped daily for 7 days. For both pEVL and the circular vectors, the tail length of the induced minipreps was determined by gel elctrophoresis as described above. The expected tail band size for each construct is indicated with an arrow.

    Article Snippet: BFP, TALENs, and Cas9 pEVL constructs were digested with BsaI (NEB or Thermo Scientific) to create a template with a terminal poly(A) tail.

    Techniques: Plasmid Preparation, Nucleic Acid Electrophoresis, Molecular Weight, Clone Assay, Generated, Transformation Assay, Electroporation, Selection, Amplification, Polymerase Chain Reaction, Construct

    Generation and characterization of mRNA from pEVL-encoded templates . ( a ) IVT mRNA encoding blue fluorescent protein (mTagBFP2) generated from pWNY with enzymatic tailing and pEVL-100 through pEVL-500. BFP-pEVL-100 to 500 were digested with XbaI and BsaI, and pWNY with ScaI and BsiWI, to generate template for IVT. IVT was carried out with antireverse cap analog capping, and for pWNY, enzymatic tailing with EPAP. After purification, 200 ng of each transcript was imaged via gel electrophoresis on the FlashGel system. Typically, pEVL produces a single band of defined length, whereas pWNY with enzymatic tailing produces transcripts of a more heterogenous length. ( b ) Relative potency of mRNA encoding BFP generated from a circular plasmid vector with enzymatic polyadenylation or from pEVL-300 and representative flow plots. 1 μg of IVT mRNA from the indicated template was electroporated into prestimulated primary human T cells. After a 24-hour cold shock at 30 ° C, the cells were analyzed each day for 5 days by flow cytometry for the percentage of cells expressing BFP as well as the mean fluorescence intensity (MFI) of the BFP in BFP+ cells. Flow plots are shown as side scatter (SSC) versus BFP. ( c ) Relative potency of mRNA encoding BFP generated from pEVL-100 through pEVL-500 and representative flow plots. Equimolar amounts of IVT mRNA from BFP-pEVL-100 to 500 were electroporated into prestimulated primary human T cells. After an initial 24-hour cold shock at 30 ° C, the cells were grown at 37 °C for 6 more days. Every 24 hours after electroporation, the percentage of cells expressing BFP and the BFI MFI of the BFP+ cells was analyzed by flow cytometry. Flow plots are shown as side scatter (SSC) versus BFP. BFP, blue fluorescent protein; IVT, in vitro transcribed; pEVL, p(Extended Variable Length).

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: pEVL: A Linear Plasmid for Generating mRNA IVT Templates With Extended Encoded Poly(A) Sequences

    doi: 10.1038/mtna.2016.21

    Figure Lengend Snippet: Generation and characterization of mRNA from pEVL-encoded templates . ( a ) IVT mRNA encoding blue fluorescent protein (mTagBFP2) generated from pWNY with enzymatic tailing and pEVL-100 through pEVL-500. BFP-pEVL-100 to 500 were digested with XbaI and BsaI, and pWNY with ScaI and BsiWI, to generate template for IVT. IVT was carried out with antireverse cap analog capping, and for pWNY, enzymatic tailing with EPAP. After purification, 200 ng of each transcript was imaged via gel electrophoresis on the FlashGel system. Typically, pEVL produces a single band of defined length, whereas pWNY with enzymatic tailing produces transcripts of a more heterogenous length. ( b ) Relative potency of mRNA encoding BFP generated from a circular plasmid vector with enzymatic polyadenylation or from pEVL-300 and representative flow plots. 1 μg of IVT mRNA from the indicated template was electroporated into prestimulated primary human T cells. After a 24-hour cold shock at 30 ° C, the cells were analyzed each day for 5 days by flow cytometry for the percentage of cells expressing BFP as well as the mean fluorescence intensity (MFI) of the BFP in BFP+ cells. Flow plots are shown as side scatter (SSC) versus BFP. ( c ) Relative potency of mRNA encoding BFP generated from pEVL-100 through pEVL-500 and representative flow plots. Equimolar amounts of IVT mRNA from BFP-pEVL-100 to 500 were electroporated into prestimulated primary human T cells. After an initial 24-hour cold shock at 30 ° C, the cells were grown at 37 °C for 6 more days. Every 24 hours after electroporation, the percentage of cells expressing BFP and the BFI MFI of the BFP+ cells was analyzed by flow cytometry. Flow plots are shown as side scatter (SSC) versus BFP. BFP, blue fluorescent protein; IVT, in vitro transcribed; pEVL, p(Extended Variable Length).

    Article Snippet: BFP, TALENs, and Cas9 pEVL constructs were digested with BsaI (NEB or Thermo Scientific) to create a template with a terminal poly(A) tail.

    Techniques: Generated, Purification, Nucleic Acid Electrophoresis, Plasmid Preparation, Flow Cytometry, Cytometry, Expressing, Fluorescence, Electroporation, In Vitro

    Generation of pEVL: a linear plasmid vector for generation of mRNA with extended encoded poly(A) tracts. ( a ) Schematic of pJazz and conversion to pEVL. The plasmids are shown with orange arrows denoting genes, red circles with T's denoting transcriptional terminators, open circles denoting terminal hairpin loops, yellow blocks denoting BsaI sites, and green blocks denoting the poly(A) tail. ( b ) Schematic of pEVL and method used for generation of extended poly(A) tracts in pEVL.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: pEVL: A Linear Plasmid for Generating mRNA IVT Templates With Extended Encoded Poly(A) Sequences

    doi: 10.1038/mtna.2016.21

    Figure Lengend Snippet: Generation of pEVL: a linear plasmid vector for generation of mRNA with extended encoded poly(A) tracts. ( a ) Schematic of pJazz and conversion to pEVL. The plasmids are shown with orange arrows denoting genes, red circles with T's denoting transcriptional terminators, open circles denoting terminal hairpin loops, yellow blocks denoting BsaI sites, and green blocks denoting the poly(A) tail. ( b ) Schematic of pEVL and method used for generation of extended poly(A) tracts in pEVL.

    Article Snippet: BFP, TALENs, and Cas9 pEVL constructs were digested with BsaI (NEB or Thermo Scientific) to create a template with a terminal poly(A) tail.

    Techniques: Plasmid Preparation

    Incorporation of double and single BrdU residues by Bst exo - DNA Polymerase into the 466 bp hybrid molecule . Incorporation reactions using BrdUTP alone or in combination with dTTP were carried out with Bst exo - DNA Polymerase. Lanes M, Perfect 100 bp Ladder (selected bands marked). Enzyme purity and reaction steps controls: lane 1, uncut 437 bp PCR fragment amplified from pGCN1 plasmid; lane 2, uncut 480 bp PCR fragment amplified from pGCN2 plasmid; lane 3, BsaI-cut 437 bp fragment; lane 4, BsaI-cut 480 bp fragment; lane 5, BsaI restriction fragment I (191 bp) filled in with BrdUTP isolated from agarose gel; lane 6, BsaI restriction fragment III (270 bp) filled in with BrdUTP isolated from agarose gel; lane 7, BsaI-cut 437 bp fragment, purified and back-ligated; lane 8, BsaI-cut 437 bp fragment, purified, incubated with Bst exo- DNA Pol without dNTPs and back-ligated. Incorporation reaction: lane 9, fragment I (191 bp) filled in with dTTP, ligated to BrdU-labeled fragment III (270 bp); lane 10, fragment I (191 bp) filled in with BrdUTP, ligated to BrdU-labeled fragment III (270 bp). I, III BsaI restriction fragments numbered as in Figure 1.

    Journal: BMC Biochemistry

    Article Title: Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence

    doi: 10.1186/1471-2091-12-47

    Figure Lengend Snippet: Incorporation of double and single BrdU residues by Bst exo - DNA Polymerase into the 466 bp hybrid molecule . Incorporation reactions using BrdUTP alone or in combination with dTTP were carried out with Bst exo - DNA Polymerase. Lanes M, Perfect 100 bp Ladder (selected bands marked). Enzyme purity and reaction steps controls: lane 1, uncut 437 bp PCR fragment amplified from pGCN1 plasmid; lane 2, uncut 480 bp PCR fragment amplified from pGCN2 plasmid; lane 3, BsaI-cut 437 bp fragment; lane 4, BsaI-cut 480 bp fragment; lane 5, BsaI restriction fragment I (191 bp) filled in with BrdUTP isolated from agarose gel; lane 6, BsaI restriction fragment III (270 bp) filled in with BrdUTP isolated from agarose gel; lane 7, BsaI-cut 437 bp fragment, purified and back-ligated; lane 8, BsaI-cut 437 bp fragment, purified, incubated with Bst exo- DNA Pol without dNTPs and back-ligated. Incorporation reaction: lane 9, fragment I (191 bp) filled in with dTTP, ligated to BrdU-labeled fragment III (270 bp); lane 10, fragment I (191 bp) filled in with BrdUTP, ligated to BrdU-labeled fragment III (270 bp). I, III BsaI restriction fragments numbered as in Figure 1.

    Article Snippet: Bst DNA Polymerase large fragment exo-, pUC19 DNA, BsaI, NcoI and BspHI, T4 DNA ligase REase were from New England Biolabs (Ipswich, MA, USA).

    Techniques: Polymerase Chain Reaction, Amplification, Plasmid Preparation, Isolation, Agarose Gel Electrophoresis, Purification, Incubation, Labeling

    Assessment of various DNA polymerases for their ability to incorporate BrdU . Complete and incomplete specific incorporation reactions (Figure 1) were carried out with 5 DNA Polymerases: Bst exo - (thermophilic), T4 (mesophilic), Taq (thermophilic), OptiTaq (thermophilic blend) and Pfu (hyperthermophilic) in the presence of BrdUTP. Lanes M, Perfect 100 bp Ladder; lane 1, PCR 1 fragment (379 bp); lane 2, BsaI-cleaved PCR 1 fragment; lane 3, PCR 2 fragment (625 bp); lane 4, BsaI-cleaved PCR 2 fragment; lane 5, BsaI restriction fragments: I (363 bp) and III (609 bp). Lanes 6-18 reactions with specified DNA Polymerases: lane 6, restriction fragments: I and III, T4; lane 7, restriction fragments: I and III, Bst exo - ; lane 8, restriction fragments: I and III, Bst exo - , T4 DNA Ligase; lane 9, restriction fragments: I and III, T4; lane 10, restriction fragments: I and III, T4, T4 DNA Ligase; lane 11, restriction fragments: I and III, Taq; lane 12, restriction fragments: I and III, Taq, T4 DNA Ligase; lane 13, restriction fragments: I and III, OptiTaq; lane 14, restriction fragments: I and III, OptiTaq, T4 DNA Ligase; lane 15, restriction fragments: I and III, Tfl; lane 16, restriction fragments: I and III, Tfl, T4 DNA Ligase; lane 17, restriction fragments: I and III, Pfu; lane 18, restriction fragments: I and III, Pfu, T4 DNA Ligase. I, III BsaI restriction fragments numbered as in Figure 1.

    Journal: BMC Biochemistry

    Article Title: Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence

    doi: 10.1186/1471-2091-12-47

    Figure Lengend Snippet: Assessment of various DNA polymerases for their ability to incorporate BrdU . Complete and incomplete specific incorporation reactions (Figure 1) were carried out with 5 DNA Polymerases: Bst exo - (thermophilic), T4 (mesophilic), Taq (thermophilic), OptiTaq (thermophilic blend) and Pfu (hyperthermophilic) in the presence of BrdUTP. Lanes M, Perfect 100 bp Ladder; lane 1, PCR 1 fragment (379 bp); lane 2, BsaI-cleaved PCR 1 fragment; lane 3, PCR 2 fragment (625 bp); lane 4, BsaI-cleaved PCR 2 fragment; lane 5, BsaI restriction fragments: I (363 bp) and III (609 bp). Lanes 6-18 reactions with specified DNA Polymerases: lane 6, restriction fragments: I and III, T4; lane 7, restriction fragments: I and III, Bst exo - ; lane 8, restriction fragments: I and III, Bst exo - , T4 DNA Ligase; lane 9, restriction fragments: I and III, T4; lane 10, restriction fragments: I and III, T4, T4 DNA Ligase; lane 11, restriction fragments: I and III, Taq; lane 12, restriction fragments: I and III, Taq, T4 DNA Ligase; lane 13, restriction fragments: I and III, OptiTaq; lane 14, restriction fragments: I and III, OptiTaq, T4 DNA Ligase; lane 15, restriction fragments: I and III, Tfl; lane 16, restriction fragments: I and III, Tfl, T4 DNA Ligase; lane 17, restriction fragments: I and III, Pfu; lane 18, restriction fragments: I and III, Pfu, T4 DNA Ligase. I, III BsaI restriction fragments numbered as in Figure 1.

    Article Snippet: Bst DNA Polymerase large fragment exo-, pUC19 DNA, BsaI, NcoI and BspHI, T4 DNA ligase REase were from New England Biolabs (Ipswich, MA, USA).

    Techniques: Polymerase Chain Reaction

    Incorporation of double and single BrdU residues by Bst exo - DNA Polymerase into the 441 bp hybrid molecule . Incorporation reactions using BrdUTP alone or in combination with dTTP were carried out with Bst exo - DNA Polymerase. Lanes M, Perfect 100 bp Ladder (selected bands marked); lane 1, 260 bp BsaI-cleaved PCR (restriction fragment I); lane 2, 208 bp BsaI-cleaved PCR (restriction fragment III); lane 3, BrdUTP-filled restriction fragments I and III, T4 DNA ligase; lane 4, BrdUTP-filled restriction fragments I and III; lane 5, dTTP-filled restriction fragment I and BrdUTP-filled restriction fragment III, T4 DNA ligase; lane 6, dTTP-filled restriction fragment I and BrdU-filled restriction fragment III. Lanes 7-9, controls of enzymes functional purity: lane 7, control PCR fragment with internal BsaI site; lane 8, BsaI-cleaved control PCR fragment; lane 9, BsaI-cleaved control PCR fragment after addition of T4 DNA Ligase; lane M, Perfect 100 bp Ladder. I, III BsaI restriction fragments numbered as in Figure 1.

    Journal: BMC Biochemistry

    Article Title: Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence

    doi: 10.1186/1471-2091-12-47

    Figure Lengend Snippet: Incorporation of double and single BrdU residues by Bst exo - DNA Polymerase into the 441 bp hybrid molecule . Incorporation reactions using BrdUTP alone or in combination with dTTP were carried out with Bst exo - DNA Polymerase. Lanes M, Perfect 100 bp Ladder (selected bands marked); lane 1, 260 bp BsaI-cleaved PCR (restriction fragment I); lane 2, 208 bp BsaI-cleaved PCR (restriction fragment III); lane 3, BrdUTP-filled restriction fragments I and III, T4 DNA ligase; lane 4, BrdUTP-filled restriction fragments I and III; lane 5, dTTP-filled restriction fragment I and BrdUTP-filled restriction fragment III, T4 DNA ligase; lane 6, dTTP-filled restriction fragment I and BrdU-filled restriction fragment III. Lanes 7-9, controls of enzymes functional purity: lane 7, control PCR fragment with internal BsaI site; lane 8, BsaI-cleaved control PCR fragment; lane 9, BsaI-cleaved control PCR fragment after addition of T4 DNA Ligase; lane M, Perfect 100 bp Ladder. I, III BsaI restriction fragments numbered as in Figure 1.

    Article Snippet: Bst DNA Polymerase large fragment exo-, pUC19 DNA, BsaI, NcoI and BspHI, T4 DNA ligase REase were from New England Biolabs (Ipswich, MA, USA).

    Techniques: Polymerase Chain Reaction, Functional Assay