bsa i  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    BsaI
    Description:

    Catalog Number:
    R0535L
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs bsa i
    Premade gRNA modules used for the assembly of two to four gRNA expression cassettes. (A) gRNA-expressing modules for both dicots and monocots. U6-29p, U6-26p, and U6-1p are three Arabidopsis U6 gene promoters; U6-29t, U6-26t, and U6-1t, corresponding Arabidopsis U6 gene terminators with downstream sequences; OsU3p and TaU3p, rice and wheat U3 promoters, respectively; OsU3t and TaU3t, rice and wheat U3 terminators with downstream sequences, respectively; gRNA-Sc, gRNA scaffold; DT1/2/3/4, dicot target-1/2/3/4; MT1/2/3/4, monocot target-1/2/3/4. The vector pCBC is the cloning vector into which the gRNA modules were inserted separately. (B) Examples of the assembly of two-gRNA expression cassettes for dicots and monocots using the gRNA modules. Note: Each PCR fragment is flanked by two <t>Bsa</t> I sites (not shown).

    https://www.bioz.com/result/bsa i/product/New England Biolabs
    Average 99 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    bsa i - by Bioz Stars, 2019-10
    99/100 stars

    Images

    1) Product Images from "A CRISPR/Cas9 toolkit for multiplex genome editing in plants"

    Article Title: A CRISPR/Cas9 toolkit for multiplex genome editing in plants

    Journal: BMC Plant Biology

    doi: 10.1186/s12870-014-0327-y

    Premade gRNA modules used for the assembly of two to four gRNA expression cassettes. (A) gRNA-expressing modules for both dicots and monocots. U6-29p, U6-26p, and U6-1p are three Arabidopsis U6 gene promoters; U6-29t, U6-26t, and U6-1t, corresponding Arabidopsis U6 gene terminators with downstream sequences; OsU3p and TaU3p, rice and wheat U3 promoters, respectively; OsU3t and TaU3t, rice and wheat U3 terminators with downstream sequences, respectively; gRNA-Sc, gRNA scaffold; DT1/2/3/4, dicot target-1/2/3/4; MT1/2/3/4, monocot target-1/2/3/4. The vector pCBC is the cloning vector into which the gRNA modules were inserted separately. (B) Examples of the assembly of two-gRNA expression cassettes for dicots and monocots using the gRNA modules. Note: Each PCR fragment is flanked by two Bsa I sites (not shown).
    Figure Legend Snippet: Premade gRNA modules used for the assembly of two to four gRNA expression cassettes. (A) gRNA-expressing modules for both dicots and monocots. U6-29p, U6-26p, and U6-1p are three Arabidopsis U6 gene promoters; U6-29t, U6-26t, and U6-1t, corresponding Arabidopsis U6 gene terminators with downstream sequences; OsU3p and TaU3p, rice and wheat U3 promoters, respectively; OsU3t and TaU3t, rice and wheat U3 terminators with downstream sequences, respectively; gRNA-Sc, gRNA scaffold; DT1/2/3/4, dicot target-1/2/3/4; MT1/2/3/4, monocot target-1/2/3/4. The vector pCBC is the cloning vector into which the gRNA modules were inserted separately. (B) Examples of the assembly of two-gRNA expression cassettes for dicots and monocots using the gRNA modules. Note: Each PCR fragment is flanked by two Bsa I sites (not shown).

    Techniques Used: Expressing, Plasmid Preparation, Clone Assay, Polymerase Chain Reaction

    Physical maps and structures of CRISPR/Cas9 binary vectors. (A) Physical maps of the backbones of pGreen and pCAMBIA from which CRISPR/Cas9 binary vectors were derived. The map of the helper plasmid required for propagation of pGreen in Agrobacterium and the mutated Bsa I site on the pCAMBIA backbone are indicated. LB/RB, left/right border of T-DNA; pSa-ori, required for replication in Agrobacterium engineered with the corresponding replication protein (pSa-repA); KmR, kanamycin resistance gene; pUC-ori, replication origin required for replication in E. coli ; pVS1-staA, pVS1-ori and pVS1-rep are the DNA elements required for replication in Agrobacterium . Only the 225-bp fragment between the LB and RB was left for comparison of the sizes of the pGreen and pCAMBIA backbones. (B, C) Physical maps of the regions between the RB and LB. The sizes of T-DNA regions and the structures of SpR-gRNA-Sc and final working gRNA are indicated. zCas9 , Zea mays codon-optimized Cas9 ; U6-26p, Arabidopsis U6 gene promoter; U6-26t, U6-26 terminator with downstream sequence; OsU3p, rice U3 promoter; OsU3t, rice U3 terminator with downstream sequence; SpR, spectinomycin resistance gene; gRNA-Sc, gRNA scaffold.
    Figure Legend Snippet: Physical maps and structures of CRISPR/Cas9 binary vectors. (A) Physical maps of the backbones of pGreen and pCAMBIA from which CRISPR/Cas9 binary vectors were derived. The map of the helper plasmid required for propagation of pGreen in Agrobacterium and the mutated Bsa I site on the pCAMBIA backbone are indicated. LB/RB, left/right border of T-DNA; pSa-ori, required for replication in Agrobacterium engineered with the corresponding replication protein (pSa-repA); KmR, kanamycin resistance gene; pUC-ori, replication origin required for replication in E. coli ; pVS1-staA, pVS1-ori and pVS1-rep are the DNA elements required for replication in Agrobacterium . Only the 225-bp fragment between the LB and RB was left for comparison of the sizes of the pGreen and pCAMBIA backbones. (B, C) Physical maps of the regions between the RB and LB. The sizes of T-DNA regions and the structures of SpR-gRNA-Sc and final working gRNA are indicated. zCas9 , Zea mays codon-optimized Cas9 ; U6-26p, Arabidopsis U6 gene promoter; U6-26t, U6-26 terminator with downstream sequence; OsU3p, rice U3 promoter; OsU3t, rice U3 terminator with downstream sequence; SpR, spectinomycin resistance gene; gRNA-Sc, gRNA scaffold.

    Techniques Used: CRISPR, Derivative Assay, Plasmid Preparation, SPR Assay, Sequencing

    2) Product Images from "A plug-and-play pathway refactoring workflow for natural product research in Escherichia coli and Saccharomyces cerevisiae"

    Article Title: A plug-and-play pathway refactoring workflow for natural product research in Escherichia coli and Saccharomyces cerevisiae

    Journal:

    doi: 10.1002/bit.26309

    Scheme of the plug-and-play pathway refactoring workflow. (A) The 1st tier Golden Gate reaction. The gene is either synthesized or PCR amplified with Bbs I cleavage sites at both ends and cloned into a helper plasmid through Bbs I catalyzed Golden Gate reaction. (B) The 2nd tier Golden Gate reaction. Helper plasmids harboring the corresponding genes are mixed with the appropriate spacer plasmids and the receiver plasmid and assembled into the final construct through Bsa I catalyzed Golden Gate reaction. All helper plasmids and spacer plasmids share the pUC19 backbone, while the receiver plasmid has either a pET28a backbone (for expression in E. coli ) or pRS416 backbone with the ampicillin resistance gene replaced by the kanamycin resistance gene (for expression in S. cerevisiae ).
    Figure Legend Snippet: Scheme of the plug-and-play pathway refactoring workflow. (A) The 1st tier Golden Gate reaction. The gene is either synthesized or PCR amplified with Bbs I cleavage sites at both ends and cloned into a helper plasmid through Bbs I catalyzed Golden Gate reaction. (B) The 2nd tier Golden Gate reaction. Helper plasmids harboring the corresponding genes are mixed with the appropriate spacer plasmids and the receiver plasmid and assembled into the final construct through Bsa I catalyzed Golden Gate reaction. All helper plasmids and spacer plasmids share the pUC19 backbone, while the receiver plasmid has either a pET28a backbone (for expression in E. coli ) or pRS416 backbone with the ampicillin resistance gene replaced by the kanamycin resistance gene (for expression in S. cerevisiae ).

    Techniques Used: Synthesized, Polymerase Chain Reaction, Amplification, Clone Assay, Plasmid Preparation, Construct, Expressing

    3) Product Images from "A novel one-step approach for the construction of yeast surface display Fab antibody libraries"

    Article Title: A novel one-step approach for the construction of yeast surface display Fab antibody libraries

    Journal: Microbial Cell Factories

    doi: 10.1186/s12934-017-0853-z

    One step generation of YSD plasmids for the construction of large combinatorial Fab immune libraries using Golden Gate Cloning. Destination plasmids (pDest), entry plasmids (pE) and PCR amplicons contain or are flanked by Bsa I recognition sites in different orientations (B: ggtctcn, B : ngagacc). A linear and distinct assembly of those DNA fragments is ensured by the design of complementary signature sequences in defined order within the three modules after Bsa I cleavage. a The two-directional (2dir) display system enables the expression of the VH-CH1-Aga2p (Aga2p-signal-sequence; SP) gene product under control of the GAL1 -promoter whereas the cLC-CLkappa (app8-signal-sequence; App8 SP) gene product is generated under control of the Gal10 -promoter. b The bicistronic display system (bicis) allows for the expression of Fab-fragment heavy and light chains under control of the GAL1 -promoter. The generation of distinct VH-CH1-Aga2p (Aga2p-signal-sequence; SP) and cLC-CLkappa (app8-signal-sequence; App8 SP) proteins is mediated by ribosomal skipping due to the T2A (2A) peptide. c Schematic illustration of Fab-fragments displayed on the surface of yeast cells. Genes are encoded by a single plasmid and expression is either conducted by two-directional promotors or by ribosomal skipping
    Figure Legend Snippet: One step generation of YSD plasmids for the construction of large combinatorial Fab immune libraries using Golden Gate Cloning. Destination plasmids (pDest), entry plasmids (pE) and PCR amplicons contain or are flanked by Bsa I recognition sites in different orientations (B: ggtctcn, B : ngagacc). A linear and distinct assembly of those DNA fragments is ensured by the design of complementary signature sequences in defined order within the three modules after Bsa I cleavage. a The two-directional (2dir) display system enables the expression of the VH-CH1-Aga2p (Aga2p-signal-sequence; SP) gene product under control of the GAL1 -promoter whereas the cLC-CLkappa (app8-signal-sequence; App8 SP) gene product is generated under control of the Gal10 -promoter. b The bicistronic display system (bicis) allows for the expression of Fab-fragment heavy and light chains under control of the GAL1 -promoter. The generation of distinct VH-CH1-Aga2p (Aga2p-signal-sequence; SP) and cLC-CLkappa (app8-signal-sequence; App8 SP) proteins is mediated by ribosomal skipping due to the T2A (2A) peptide. c Schematic illustration of Fab-fragments displayed on the surface of yeast cells. Genes are encoded by a single plasmid and expression is either conducted by two-directional promotors or by ribosomal skipping

    Techniques Used: Clone Assay, Polymerase Chain Reaction, Expressing, Sequencing, Generated, Plasmid Preparation

    4) Product Images from "Clarithromycin-Based Standard Triple Therapy Can Still Be Effective for Helicobacter pylori Eradication in Some Parts of the Korea"

    Article Title: Clarithromycin-Based Standard Triple Therapy Can Still Be Effective for Helicobacter pylori Eradication in Some Parts of the Korea

    Journal: Journal of Korean Medical Science

    doi: 10.3346/jkms.2014.29.9.1240

    Restriction fragment length polymorphism analysis of 23S rRNA amplicons: ( A ) digestion with Bsa I and ( B ) digestion with Bbs I. The A2144G mutations are observed in lanes 1 to 2, but not in lanes 3 to 5. Note that the A2143G mutation detected by digestion with Bbs I was not detected in any of the strains studied. Lanes 3 to 5 reveal the T2183C mutation, as assessed by DNA sequencing. Lane M, 100 bp DNA size markers (indicated to the left of the gels in base pairs); lane C, H. pylori ATCC 43504; lane 1 to 5, clarithromycin-resistant H. pylori strains.
    Figure Legend Snippet: Restriction fragment length polymorphism analysis of 23S rRNA amplicons: ( A ) digestion with Bsa I and ( B ) digestion with Bbs I. The A2144G mutations are observed in lanes 1 to 2, but not in lanes 3 to 5. Note that the A2143G mutation detected by digestion with Bbs I was not detected in any of the strains studied. Lanes 3 to 5 reveal the T2183C mutation, as assessed by DNA sequencing. Lane M, 100 bp DNA size markers (indicated to the left of the gels in base pairs); lane C, H. pylori ATCC 43504; lane 1 to 5, clarithromycin-resistant H. pylori strains.

    Techniques Used: Mutagenesis, DNA Sequencing

    5) Product Images from "A novel one-step approach for the construction of yeast surface display Fab antibody libraries"

    Article Title: A novel one-step approach for the construction of yeast surface display Fab antibody libraries

    Journal: Microbial Cell Factories

    doi: 10.1186/s12934-017-0853-z

    One step generation of YSD plasmids for the construction of large combinatorial Fab immune libraries using Golden Gate Cloning. Destination plasmids (pDest), entry plasmids (pE) and PCR amplicons contain or are flanked by Bsa I recognition sites in different orientations (B: ggtctcn, B : ngagacc). A linear and distinct assembly of those DNA fragments is ensured by the design of complementary signature sequences in defined order within the three modules after Bsa I cleavage. a The two-directional (2dir) display system enables the expression of the VH-CH1-Aga2p (Aga2p-signal-sequence; SP) gene product under control of the GAL1 -promoter whereas the cLC-CLkappa (app8-signal-sequence; App8 SP) gene product is generated under control of the Gal10 -promoter. b The bicistronic display system (bicis) allows for the expression of Fab-fragment heavy and light chains under control of the GAL1 -promoter. The generation of distinct VH-CH1-Aga2p (Aga2p-signal-sequence; SP) and cLC-CLkappa (app8-signal-sequence; App8 SP) proteins is mediated by ribosomal skipping due to the T2A (2A) peptide. c Schematic illustration of Fab-fragments displayed on the surface of yeast cells. Genes are encoded by a single plasmid and expression is either conducted by two-directional promotors or by ribosomal skipping
    Figure Legend Snippet: One step generation of YSD plasmids for the construction of large combinatorial Fab immune libraries using Golden Gate Cloning. Destination plasmids (pDest), entry plasmids (pE) and PCR amplicons contain or are flanked by Bsa I recognition sites in different orientations (B: ggtctcn, B : ngagacc). A linear and distinct assembly of those DNA fragments is ensured by the design of complementary signature sequences in defined order within the three modules after Bsa I cleavage. a The two-directional (2dir) display system enables the expression of the VH-CH1-Aga2p (Aga2p-signal-sequence; SP) gene product under control of the GAL1 -promoter whereas the cLC-CLkappa (app8-signal-sequence; App8 SP) gene product is generated under control of the Gal10 -promoter. b The bicistronic display system (bicis) allows for the expression of Fab-fragment heavy and light chains under control of the GAL1 -promoter. The generation of distinct VH-CH1-Aga2p (Aga2p-signal-sequence; SP) and cLC-CLkappa (app8-signal-sequence; App8 SP) proteins is mediated by ribosomal skipping due to the T2A (2A) peptide. c Schematic illustration of Fab-fragments displayed on the surface of yeast cells. Genes are encoded by a single plasmid and expression is either conducted by two-directional promotors or by ribosomal skipping

    Techniques Used: Clone Assay, Polymerase Chain Reaction, Expressing, Sequencing, Generated, Plasmid Preparation

    6) Product Images from "Targeted mutagenesis in soybean using the CRISPR-Cas9 system"

    Article Title: Targeted mutagenesis in soybean using the CRISPR-Cas9 system

    Journal: Scientific Reports

    doi: 10.1038/srep10342

    Construction of binary vectors for genome editing in soybean. Cas9 fused with a single nuclear localization signal (NLS) is expressed with a Cauliflower mosaic virus 35s (CaMV 35s) promoter. Synthetic guide RNA (sgRNA) is derived using U6 promoters. ( a ) Arabidopsis thaliana U6-26 promoter ( b ) Glycine max U6-10 promoter. Sequences containing two Bsa I sites are located between the U6 promoter and the sgRNA scaffold. These sequences can be easily replaced with a gene-specific sgRNA seed. LB: left border; RB: right border.
    Figure Legend Snippet: Construction of binary vectors for genome editing in soybean. Cas9 fused with a single nuclear localization signal (NLS) is expressed with a Cauliflower mosaic virus 35s (CaMV 35s) promoter. Synthetic guide RNA (sgRNA) is derived using U6 promoters. ( a ) Arabidopsis thaliana U6-26 promoter ( b ) Glycine max U6-10 promoter. Sequences containing two Bsa I sites are located between the U6 promoter and the sgRNA scaffold. These sequences can be easily replaced with a gene-specific sgRNA seed. LB: left border; RB: right border.

    Techniques Used: Derivative Assay

    7) Product Images from "Transcriptional Activators of Human Genes with Programmable DNA-Specificity"

    Article Title: Transcriptional Activators of Human Genes with Programmable DNA-Specificity

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0019509

    Golden TAL Technology for assembly of TAL proteins with programmed repeat composition. (A) Single TAL repeats were cloned with flanking Bpi I sites that generate specific four base pair-overhangs (a–g). Matching sites are indicated by identical letters. A library was constructed with four different repeat types (RVD, repeat variable di-residue: NI, HD, NN, NG) for each repeat position. The repeat types have different DNA-specificities (Spec., only upper DNA-strand is shown). (B) One to six repeats are assembled in specific order into an assembly vector to generate a repeat assembly with flanking Bsa I sites. (C) TALs were directly assembled with N-terminal GFP-tag into an expression vector using fragments with matching Bsa I-generated overhangs (capital letters). Insertion of one to four repeat assemblies generated TALs with 1 to 24 repeats. The last repeat is only a half repeat as typical for TAL proteins. Please see the Text S1 and Figure S4 for details.
    Figure Legend Snippet: Golden TAL Technology for assembly of TAL proteins with programmed repeat composition. (A) Single TAL repeats were cloned with flanking Bpi I sites that generate specific four base pair-overhangs (a–g). Matching sites are indicated by identical letters. A library was constructed with four different repeat types (RVD, repeat variable di-residue: NI, HD, NN, NG) for each repeat position. The repeat types have different DNA-specificities (Spec., only upper DNA-strand is shown). (B) One to six repeats are assembled in specific order into an assembly vector to generate a repeat assembly with flanking Bsa I sites. (C) TALs were directly assembled with N-terminal GFP-tag into an expression vector using fragments with matching Bsa I-generated overhangs (capital letters). Insertion of one to four repeat assemblies generated TALs with 1 to 24 repeats. The last repeat is only a half repeat as typical for TAL proteins. Please see the Text S1 and Figure S4 for details.

    Techniques Used: Clone Assay, Construct, Plasmid Preparation, Expressing, Generated

    8) Product Images from "FusX: A Rapid One-Step Transcription Activator-Like Effector Assembly System for Genome Science"

    Article Title: FusX: A Rapid One-Step Transcription Activator-Like Effector Assembly System for Genome Science

    Journal: Human Gene Therapy

    doi: 10.1089/hum.2015.172

    Construction of the FusX1–4 libraries. (A) Component plasmids used to construct the pFusX1–4 libraries. pXX-1 and pXX-10 are single-RVD (repeat-variable diresidue) encoding plasmids from the original Golden Gate system (2.0) 16 ; pXX-M and -MM are new, single RVD modules with designated sequence and Bsa I overhangs for ligation in between pXX-1 and pXX-10 to form 3-mer intermediates in pFusX1–4 libraries. pXX-MM includes extra silent mutations and is used only to construct the pFusX3 library, providing a specific primer-binding site for sequencing of long TALE (transcription activator-like effector) domain. “XX” represents any of the four RVD modules: HD, NG, NI, NN. (B) Schematic diagram showing sequential ligation of single RVD component plasmids into the four intermediate vectors: pFusX1, pFusX2, pFusX3, pFusX4. Dotted arrows indicate ligation at compatible overhangs generated by Bsa I.
    Figure Legend Snippet: Construction of the FusX1–4 libraries. (A) Component plasmids used to construct the pFusX1–4 libraries. pXX-1 and pXX-10 are single-RVD (repeat-variable diresidue) encoding plasmids from the original Golden Gate system (2.0) 16 ; pXX-M and -MM are new, single RVD modules with designated sequence and Bsa I overhangs for ligation in between pXX-1 and pXX-10 to form 3-mer intermediates in pFusX1–4 libraries. pXX-MM includes extra silent mutations and is used only to construct the pFusX3 library, providing a specific primer-binding site for sequencing of long TALE (transcription activator-like effector) domain. “XX” represents any of the four RVD modules: HD, NG, NI, NN. (B) Schematic diagram showing sequential ligation of single RVD component plasmids into the four intermediate vectors: pFusX1, pFusX2, pFusX3, pFusX4. Dotted arrows indicate ligation at compatible overhangs generated by Bsa I.

    Techniques Used: Construct, Sequencing, Ligation, Binding Assay, Generated

    9) Product Images from "A novel one-step approach for the construction of yeast surface display Fab antibody libraries"

    Article Title: A novel one-step approach for the construction of yeast surface display Fab antibody libraries

    Journal: Microbial Cell Factories

    doi: 10.1186/s12934-017-0853-z

    One step generation of YSD plasmids for the construction of large combinatorial Fab immune libraries using Golden Gate Cloning. Destination plasmids (pDest), entry plasmids (pE) and PCR amplicons contain or are flanked by Bsa I recognition sites in different orientations (B: ggtctcn, B : ngagacc). A linear and distinct assembly of those DNA fragments is ensured by the design of complementary signature sequences in defined order within the three modules after Bsa I cleavage. a The two-directional (2dir) display system enables the expression of the VH-CH1-Aga2p (Aga2p-signal-sequence; SP) gene product under control of the GAL1 -promoter whereas the cLC-CLkappa (app8-signal-sequence; App8 SP) gene product is generated under control of the Gal10 -promoter. b The bicistronic display system (bicis) allows for the expression of Fab-fragment heavy and light chains under control of the GAL1 -promoter. The generation of distinct VH-CH1-Aga2p (Aga2p-signal-sequence; SP) and cLC-CLkappa (app8-signal-sequence; App8 SP) proteins is mediated by ribosomal skipping due to the T2A (2A) peptide. c Schematic illustration of Fab-fragments displayed on the surface of yeast cells. Genes are encoded by a single plasmid and expression is either conducted by two-directional promotors or by ribosomal skipping
    Figure Legend Snippet: One step generation of YSD plasmids for the construction of large combinatorial Fab immune libraries using Golden Gate Cloning. Destination plasmids (pDest), entry plasmids (pE) and PCR amplicons contain or are flanked by Bsa I recognition sites in different orientations (B: ggtctcn, B : ngagacc). A linear and distinct assembly of those DNA fragments is ensured by the design of complementary signature sequences in defined order within the three modules after Bsa I cleavage. a The two-directional (2dir) display system enables the expression of the VH-CH1-Aga2p (Aga2p-signal-sequence; SP) gene product under control of the GAL1 -promoter whereas the cLC-CLkappa (app8-signal-sequence; App8 SP) gene product is generated under control of the Gal10 -promoter. b The bicistronic display system (bicis) allows for the expression of Fab-fragment heavy and light chains under control of the GAL1 -promoter. The generation of distinct VH-CH1-Aga2p (Aga2p-signal-sequence; SP) and cLC-CLkappa (app8-signal-sequence; App8 SP) proteins is mediated by ribosomal skipping due to the T2A (2A) peptide. c Schematic illustration of Fab-fragments displayed on the surface of yeast cells. Genes are encoded by a single plasmid and expression is either conducted by two-directional promotors or by ribosomal skipping

    Techniques Used: Clone Assay, Polymerase Chain Reaction, Expressing, Sequencing, Generated, Plasmid Preparation

    10) Product Images from "Module-based construction of plasmids for chromosomal integration of the fission yeast Schizosaccharomyces pombe"

    Article Title: Module-based construction of plasmids for chromosomal integration of the fission yeast Schizosaccharomyces pombe

    Journal: Open Biology

    doi: 10.1098/rsob.150054

    The Golden Gate method to create integration plasmids. ( a ) A schematic of an integration plasmid. (left) An example of an integration plasmid to express a GOI in fusion with a fluorescent protein (FP) tag under a promoter. A target module comprises tar.F and tar.R regions separated by an Fse I restriction site. (right) An integration plasmid can be linearized with Fse I, and tar.F and tar.R sequences are targeted to the homologous sequences on the S. pombe chromosome, to induce homologous recombination. ( b ) A schematic for the Golden Gate reaction. (left) Examples of module elements. Modules are given either as plasmids (1, 3–6) or as PCR products (2). Modules for a promoter module (1), GOI (2), an FPtag (3), a selection marker (4), a target region (5), the vector backbone (6). a–f: cohesive ends to connect modules 1–6 in this order. (right) A reaction protocol for the Golden Gate reaction by the mixture of 1–6 and the resulting circular integration plasmid (7). Each module plasmid (1, 3–6) contains the kanamycin resistance gene (KanR), whereas the final product (integration plasmid, 7) is ampicillin resistant. ( c ) Unique property of Bsa I. (left) Eco RI, a standard restriction enzyme, cleaves its recognition site, therefore digestion and religation can be repeated. (right) By contrast, Bsa I has separate sites for recognition (GGTCTC) and digestion (NNNN; any four bases).
    Figure Legend Snippet: The Golden Gate method to create integration plasmids. ( a ) A schematic of an integration plasmid. (left) An example of an integration plasmid to express a GOI in fusion with a fluorescent protein (FP) tag under a promoter. A target module comprises tar.F and tar.R regions separated by an Fse I restriction site. (right) An integration plasmid can be linearized with Fse I, and tar.F and tar.R sequences are targeted to the homologous sequences on the S. pombe chromosome, to induce homologous recombination. ( b ) A schematic for the Golden Gate reaction. (left) Examples of module elements. Modules are given either as plasmids (1, 3–6) or as PCR products (2). Modules for a promoter module (1), GOI (2), an FPtag (3), a selection marker (4), a target region (5), the vector backbone (6). a–f: cohesive ends to connect modules 1–6 in this order. (right) A reaction protocol for the Golden Gate reaction by the mixture of 1–6 and the resulting circular integration plasmid (7). Each module plasmid (1, 3–6) contains the kanamycin resistance gene (KanR), whereas the final product (integration plasmid, 7) is ampicillin resistant. ( c ) Unique property of Bsa I. (left) Eco RI, a standard restriction enzyme, cleaves its recognition site, therefore digestion and religation can be repeated. (right) By contrast, Bsa I has separate sites for recognition (GGTCTC) and digestion (NNNN; any four bases).

    Techniques Used: Plasmid Preparation, Homologous Recombination, Polymerase Chain Reaction, Selection, Marker

    Choice of module plasmids for expression of a C-terminal tagged GOI. ( a ) Detailed illustration of an integration plasmid for expression of the GOI–GFP fusion (C-terminal GFP tag). Modules I–V are connected in the pFA6a-based vector (module VI) in that order. In this example, the adh1 promoter (selected from group I modules) drives expression of the fusion gene of the GOI (GOI (bc), II) with GFP (FPtag-C (cd), III). T adh serves as a terminator. kan (P TEF , promoter; T TEF , terminator) is a selection marker used after S. pombe transformation (module IV). Target module (V) is the sequence that is targeted to a homologous sequence in S. pombe chromosomes. Useful restriction sites are also indicated. Digestion with Not I separates the vector and other modules. JB19F and JB20R correspond to sequences commonly used in PCR-based gene targeting [ 12 ]. a–f in module names indicate the names of Bsa I cohesive ends used therein ( c ). AmpR, the ampicillin resistance gene. ( b , c ) List of module plasmids created in this study. ( b ) Modules are categorized as groups I–VI in boxes. Choose one module from each group to mix. II. The GOI (bc) is made through PCR to add cohesive ends (‘b’ and ‘c’). Group IIIa, instead of II and III, can be used to make control strains. Modules for the adh terminator and a selection marker gene can be supplied together (group IV). Alternatively, each module can be chosen separately: a terminator (group IVa) and a selection marker (group IVb). ( c ) Sequences of cohesive ends named a–g. Note that the module vector pBMod contains a Bsa I site with the cohesive end GTTA.
    Figure Legend Snippet: Choice of module plasmids for expression of a C-terminal tagged GOI. ( a ) Detailed illustration of an integration plasmid for expression of the GOI–GFP fusion (C-terminal GFP tag). Modules I–V are connected in the pFA6a-based vector (module VI) in that order. In this example, the adh1 promoter (selected from group I modules) drives expression of the fusion gene of the GOI (GOI (bc), II) with GFP (FPtag-C (cd), III). T adh serves as a terminator. kan (P TEF , promoter; T TEF , terminator) is a selection marker used after S. pombe transformation (module IV). Target module (V) is the sequence that is targeted to a homologous sequence in S. pombe chromosomes. Useful restriction sites are also indicated. Digestion with Not I separates the vector and other modules. JB19F and JB20R correspond to sequences commonly used in PCR-based gene targeting [ 12 ]. a–f in module names indicate the names of Bsa I cohesive ends used therein ( c ). AmpR, the ampicillin resistance gene. ( b , c ) List of module plasmids created in this study. ( b ) Modules are categorized as groups I–VI in boxes. Choose one module from each group to mix. II. The GOI (bc) is made through PCR to add cohesive ends (‘b’ and ‘c’). Group IIIa, instead of II and III, can be used to make control strains. Modules for the adh terminator and a selection marker gene can be supplied together (group IV). Alternatively, each module can be chosen separately: a terminator (group IVa) and a selection marker (group IVb). ( c ) Sequences of cohesive ends named a–g. Note that the module vector pBMod contains a Bsa I site with the cohesive end GTTA.

    Techniques Used: Expressing, Plasmid Preparation, Selection, Marker, Transformation Assay, Sequencing, Polymerase Chain Reaction

    11) Product Images from "New Generation of Artificial MicroRNA and Synthetic Trans-Acting Small Interfering RNA Vectors for Efficient Gene Silencing in Arabidopsis"

    Article Title: New Generation of Artificial MicroRNA and Synthetic Trans-Acting Small Interfering RNA Vectors for Efficient Gene Silencing in Arabidopsis

    Journal:

    doi: 10.1104/pp.113.234989

    s in vectors containing a modified version of AtTAS1c with a ccd B cassette flanked by two Bsa I sites (B/c vectors). A, Diagram of AtTAS1c production is initiated by miR173-guided cleavage
    Figure Legend Snippet: s in vectors containing a modified version of AtTAS1c with a ccd B cassette flanked by two Bsa I sites (B/c vectors). A, Diagram of AtTAS1c production is initiated by miR173-guided cleavage

    Techniques Used: Modification

    12) Product Images from "A novel one-step approach for the construction of yeast surface display Fab antibody libraries"

    Article Title: A novel one-step approach for the construction of yeast surface display Fab antibody libraries

    Journal: Microbial Cell Factories

    doi: 10.1186/s12934-017-0853-z

    One step generation of YSD plasmids for the construction of large combinatorial Fab immune libraries using Golden Gate Cloning. Destination plasmids (pDest), entry plasmids (pE) and PCR amplicons contain or are flanked by Bsa I recognition sites in different orientations (B: ggtctcn, B : ngagacc). A linear and distinct assembly of those DNA fragments is ensured by the design of complementary signature sequences in defined order within the three modules after Bsa I cleavage. a The two-directional (2dir) display system enables the expression of the VH-CH1-Aga2p (Aga2p-signal-sequence; SP) gene product under control of the GAL1 -promoter whereas the cLC-CLkappa (app8-signal-sequence; App8 SP) gene product is generated under control of the Gal10 -promoter. b The bicistronic display system (bicis) allows for the expression of Fab-fragment heavy and light chains under control of the GAL1 -promoter. The generation of distinct VH-CH1-Aga2p (Aga2p-signal-sequence; SP) and cLC-CLkappa (app8-signal-sequence; App8 SP) proteins is mediated by ribosomal skipping due to the T2A (2A) peptide. c Schematic illustration of Fab-fragments displayed on the surface of yeast cells. Genes are encoded by a single plasmid and expression is either conducted by two-directional promotors or by ribosomal skipping
    Figure Legend Snippet: One step generation of YSD plasmids for the construction of large combinatorial Fab immune libraries using Golden Gate Cloning. Destination plasmids (pDest), entry plasmids (pE) and PCR amplicons contain or are flanked by Bsa I recognition sites in different orientations (B: ggtctcn, B : ngagacc). A linear and distinct assembly of those DNA fragments is ensured by the design of complementary signature sequences in defined order within the three modules after Bsa I cleavage. a The two-directional (2dir) display system enables the expression of the VH-CH1-Aga2p (Aga2p-signal-sequence; SP) gene product under control of the GAL1 -promoter whereas the cLC-CLkappa (app8-signal-sequence; App8 SP) gene product is generated under control of the Gal10 -promoter. b The bicistronic display system (bicis) allows for the expression of Fab-fragment heavy and light chains under control of the GAL1 -promoter. The generation of distinct VH-CH1-Aga2p (Aga2p-signal-sequence; SP) and cLC-CLkappa (app8-signal-sequence; App8 SP) proteins is mediated by ribosomal skipping due to the T2A (2A) peptide. c Schematic illustration of Fab-fragments displayed on the surface of yeast cells. Genes are encoded by a single plasmid and expression is either conducted by two-directional promotors or by ribosomal skipping

    Techniques Used: Clone Assay, Polymerase Chain Reaction, Expressing, Sequencing, Generated, Plasmid Preparation

    Related Articles

    Clone Assay:

    Article Title: Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting
    Article Snippet: If arrays of 22–31 modules are to be assembled, the first 10 modules are cloned into pFUS_A30A, the second 10 modules into pFUS_A30B and the remaining modules into the appropriate pFUS_B plasmid, again according to the number of modules going in. .. The module and array plasmids (150 ng each) are subjected to digestion and ligation in a single 20 µl reaction containing 1 µl BsaI (10 U, New England BioLabs) and 1 µl T4 DNA Ligase (2000 U, New England BioLabs) in T4 DNA ligase buffer (New England BioLabs).

    Article Title: Rapid Restriction Enzyme-Free Cloning of PCR Products: A High-Throughput Method Applicable for Library Construction
    Article Snippet: Digestion of the vector with BsaI linearizes the vector, creating a 5′-GCCG-3′ overhang close to the 3′ end of the promoter and 5′-GGAG-3′ overhang close to the EcoRI site, and removes the stuffer so that the BsaI recognition sites are lost upon ligation with the insert. .. The vector for cloning was prepared by digesting 10 µg plasmid DNA in a total volume of 400 µl with 400 units of BsaI (New England Biolabs, Ipswich, MA, USA) added in four aliquots during the 4 h incubation at 50°C. .. The digested DNA was extracted with phenol: chloroform, ethanol precipitated, resuspended in 0.1X TE and then separated on 1.2% Sea Plaque GTG agarose (Lonza, Rockland, ME, USA) to purify the linearized vector from the stuffer fragment using the Qiaquick Gel Extraction kit (Qiagen, Hilden, Germany).

    Article Title: Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli
    Article Snippet: See Supplementary Table S2 for a list of all primers and oligonucleotides used in this work. .. Phosphorylated and annealed inserts were individually cloned into recipient plasmid pdCas9 ( ) at two adjacent BsaI sites in the minimal, single-spacer CRISPR array using a one-pot Golden Gate reaction with BsaI (New England BioLabs) and T7 ligase (Epicentre Biotechnologies). .. Plasmid pdCas9 was a gift from Luciano Marraffini (Addgene plasmid # 46569).

    Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli
    Article Snippet: Paragraph title: Cloning and purification of LpxB ... The lpxB coding sequence was amplified from E. coli BL21 cells with Phusion DNA polymerase (NEB) using the forward and reverse primers carrying BsaI (NEB) and XbaI (NEB) restriction sites, respectively.

    Article Title: Efficient Gene Transfer and Gene Editing in Sterlet (Acipenser ruthenus)
    Article Snippet: Plasmid DR274 (Addgene plasmid 42250) was digested using BsaI (NEB, R0535) and ligated with the paired oligos. .. Then, the ligation mix was transformed into competent E. coli cells.

    Article Title: L-SCRaMbLE as a tool for light-controlled Cre-mediated recombination in yeast
    Article Snippet: Each reaction included 1.5 µl 10x T4 DNA ligase reaction buffer (New England Biolabs), 0.15 µl 100x bovine serum albumin (New England Biolabs), 600 U T4 DNA ligase (Qiagen, Hilden, Germany), and 10 U of Bsa I (New England Biolabs) in a final volume of 15 µl . .. Plasmids pLH_Scr15 and pLH_Scr16 were constructed with the overlap-based DNA assembly methods SLiCE or TAR cloning and by using the AssemblX toolkit , , .

    Article Title: Influenza A and B Virus Intertypic Reassortment through Compatible Viral Packaging Signals
    Article Snippet: Influenza B virus ΔHA/GFP plasmid pPolI HA(228)GFP(108) was generated as previously described ( ). .. The B/Yam HA segment was amplified by RT-PCR from RNA isolated from infected MDCK cells and cloned into the human pPolI plasmid using SapI (NEB) and then digested with BglII and BsaI (NEB) to cut 228 nucleotides (nt) from the 3′ end and 108 nt from the 5′ end. .. The product from PCR amplification of GFP using primers flanked by BglII and BsaI was subcloned between these two restriction sites.

    Article Title: A plug-and-play pathway refactoring workflow for natural product research in Escherichia coli and Saccharomyces cerevisiae
    Article Snippet: The reaction condition was as follows: a 20 μL reaction system contained 2 μL 10× T4 DNA Ligase Reaction Buffer (New England Biolabs, Ipswich, MA), 0.8 μL Bsa I (New England Biolabs, Ipswich, MA), 0.2 μL T4 DNA Ligase (M0202T, New England Biolabs, Ipswich, MA), and ddH2 O to 20 μL. .. The reaction condition was as follows: a 20 μL reaction system contained 2 μL 10× T4 DNA Ligase Reaction Buffer (New England Biolabs, Ipswich, MA), 0.8 μL Bsa I (New England Biolabs, Ipswich, MA), 0.2 μL T4 DNA Ligase (M0202T, New England Biolabs, Ipswich, MA), and ddH2 O to 20 μL.

    Article Title: TRANSCRIPTION ACTIVATOR-LIKE EFFECTOR NUCLEASE-Mediated Generation and Metabolic Analysis of Camalexin-Deficient cyp71a12 cyp71a13 Double Knockout Lines
    Article Snippet: A total of 5 µL of the PCR product was used directly for digestion with Bsa I (New England Biolabs). .. The amplicon sequence contains two cleavage sites for Bsa I, one targeted by the TALEN pair, resulting in different digestion patterns of the wild-type sequence and mutated or partially mutated CYP71A12 (the wild type, 255, 253, and 157 bp; TALEN mutated, 255 and 410 bp).

    Article Title:
    Article Snippet: Paragraph title: Cloning and Mutagenesis ... The PCR products were digested with the enzyme BsaI (enzymes were from New England BioLabs) and ligated into the expression vector pASK-IBA3 (for cytoplasmic production, from IBA GmbH) or pASK-IBA2 (for periplasmic production).

    Article Title: EIN2 mediates direct regulation of histone acetylation in the ethylene response
    Article Snippet: The enzymatic activity of the Cas9 nuclease was abolished by mutation of the RuvC and HNH domains, generating the nuclease-null deactivated Cas9 (dCas9) ( ) for pRGEB31 ( pRGEB31-dCas9 ). .. All PCR amplifications were carried out using Phusion High-Fidelity DNA Polymerase (BioLabs M0530L). gRNA sequences were cloned into the BsaI (New England Biolabs) site in pRGEB31-dCas9 as previously described ( ). .. Briefly, 3-d-old etiolated seedlings treated with air or ethylene were harvested and cross-linked in 1% formaldehyde, and the chromatin was isolated.

    Amplification:

    Article Title: Human Campylobacteriosis in Italy: Emergence of Multi-Drug Resistance to Ciprofloxacin, Tetracycline, and Erythromycin
    Article Snippet: The sequences were also analyzed using BLASTN and BLASTP software at the NCBI GenBank sequence database ( ) and compared in silico to those of C. jejuni NCTC11168 strain (GenBank accession n. ), considered as the wild type reference sequences. .. The V region of 23S rRNA gene ( rrnB operon) was amplified by PCR, the amplicons, purified using the ISOLATE II PCR and Gel Kit (Bioline, London, UK) were digested with BsaI (5U) and BceAI (1U) (New England Biolabs, Beverly, UK) restriction enzymes, respectively, as previously described (Vacher et al., ). .. The fragments were separated by electrophoresis on a 2% agarose gel, with ethidium bromide, and visualized under UV light.

    Article Title: Evolutionary optimization of a modular ligase ribozyme: a small catalytic unit and a hairpin motif masking an element that could form an inactive structure
    Article Snippet: The pool-L oligonucleotides, including 5 nt of random sequence (Pool-L), was amplified by PCR using a sense primer (Fw-L) and an antisense primer (Rv-L). .. Respective PCR products were digested with BsaI (New England Biolabs, Ipswich, MA, USA).

    Article Title: Analysis of Inducible Nitric Oxide Synthase Gene Polymorphisms in Vitiligo in Han Chinese People
    Article Snippet: The primers of iNOS -1173 C →T are as follows: 5′- GACAAGAAGGAAATGAGTGGACACAGGTAGCAAAGTGTTGAGAC -3′ (MS-P2F), 5′- GCATTTTTCCATCATAAAAGTAA -3′ (MS-P3R) and 5′- GTGGTAGCAAATGTTGGAAT -3′ (MS-P4F), as previously reported .The amplified PCR products for the iNOS -954 G →C and Ex 16+14 C →T polymorphisms were 573 bp and 219 bp, respectively. .. Then we used BsaI and Tsp509I restriction enzymes (New England Biolabs, Beverly, Mass) to delineate the iNOS -954 G →C and Ex 16+14 C →T polymorphisms, respectively.

    Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli
    Article Snippet: This structure should aid in the rational and computational development of new antibiotics targeting LpxB to combat the increasing problem of antibiotic resistance. .. The lpxB coding sequence was amplified from E. coli BL21 cells with Phusion DNA polymerase (NEB) using the forward and reverse primers carrying BsaI (NEB) and XbaI (NEB) restriction sites, respectively. .. The lpxB coding sequence was inserted into pE-SUMO expression vector (LifeSensors) to attach an N-terminally His-tagged SUMO to the N-terminus of LpxB.

    Article Title: Influenza A and B Virus Intertypic Reassortment through Compatible Viral Packaging Signals
    Article Snippet: Influenza B virus ΔHA/GFP plasmid pPolI HA(228)GFP(108) was generated as previously described ( ). .. The B/Yam HA segment was amplified by RT-PCR from RNA isolated from infected MDCK cells and cloned into the human pPolI plasmid using SapI (NEB) and then digested with BglII and BsaI (NEB) to cut 228 nucleotides (nt) from the 3′ end and 108 nt from the 5′ end. .. The product from PCR amplification of GFP using primers flanked by BglII and BsaI was subcloned between these two restriction sites.

    Article Title: TRANSCRIPTION ACTIVATOR-LIKE EFFECTOR NUCLEASE-Mediated Generation and Metabolic Analysis of Camalexin-Deficient cyp71a12 cyp71a13 Double Knockout Lines
    Article Snippet: From leaves of primary transformants, genomic DNA was isolated and a sequence of 665 bp in the target region of the TALEN pair was amplified with the primer pair 5′-AAGCCGTGATTAAAGAGGTG-3′ and 5′-AAATTGTAGGATATGCTTATTTTCT-3′. .. A total of 5 µL of the PCR product was used directly for digestion with Bsa I (New England Biolabs).

    Article Title:
    Article Snippet: D00-HA was amplified from pIBA2-Int HA453 ( ). .. The PCR products were digested with the enzyme BsaI (enzymes were from New England BioLabs) and ligated into the expression vector pASK-IBA3 (for cytoplasmic production, from IBA GmbH) or pASK-IBA2 (for periplasmic production).

    Expressing:

    Article Title: Rapid Restriction Enzyme-Free Cloning of PCR Products: A High-Throughput Method Applicable for Library Construction
    Article Snippet: The expression vector pVNLEBAP1306 containing a backbone obtained from pET11a was modified by oligonucleotide-directed mutagenesis to delete a 1.32 kbp fragment between the laci and rop genes to derive the pVLExp vector backbone ( & ). .. The vector for cloning was prepared by digesting 10 µg plasmid DNA in a total volume of 400 µl with 400 units of BsaI (New England Biolabs, Ipswich, MA, USA) added in four aliquots during the 4 h incubation at 50°C.

    Article Title: Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli
    Article Snippet: Phosphorylated and annealed inserts were individually cloned into recipient plasmid pdCas9 ( ) at two adjacent BsaI sites in the minimal, single-spacer CRISPR array using a one-pot Golden Gate reaction with BsaI (New England BioLabs) and T7 ligase (Epicentre Biotechnologies). .. Phosphorylated and annealed inserts were individually cloned into recipient plasmid pdCas9 ( ) at two adjacent BsaI sites in the minimal, single-spacer CRISPR array using a one-pot Golden Gate reaction with BsaI (New England BioLabs) and T7 ligase (Epicentre Biotechnologies).

    Article Title: Influenza A and B Virus Intertypic Reassortment through Compatible Viral Packaging Signals
    Article Snippet: Chimeric influenza A/B virus constructs were generated by subcloning the entire ORF of B/Yam HA or NA into vRNA expression plasmids that contained the 3′ and 5′ NCRs and packaging signals from influenza A virus HA ( ) or NA ( ). .. The B/Yam HA segment was amplified by RT-PCR from RNA isolated from infected MDCK cells and cloned into the human pPolI plasmid using SapI (NEB) and then digested with BglII and BsaI (NEB) to cut 228 nucleotides (nt) from the 3′ end and 108 nt from the 5′ end.

    Article Title:
    Article Snippet: D00-HA was amplified from pIBA2-Int HA453 ( ). .. The PCR products were digested with the enzyme BsaI (enzymes were from New England BioLabs) and ligated into the expression vector pASK-IBA3 (for cytoplasmic production, from IBA GmbH) or pASK-IBA2 (for periplasmic production). .. The ligation mixture was transformed into chemically competent E. coli TOP10 (Invitrogen), and transformants were selected on lysogeny broth (LB) supplemented with 100 μg/ml ampicillin ( ).

    Synthesized:

    Article Title: Thermostable proteins bioprocesses: The activity of restriction endonuclease-methyltransferase from Thermus thermophilus (RM.TthHB27I) cloned in Escherichia coli is critically affected by the codon composition of the synthetic gene
    Article Snippet: SalI and BsaI REases were from New England Biolabs (Ipswich, MA, USA). .. Other reagents were from POCh S.A. (Gliwice, Poland), Sigma-Aldrich (St. Louis, MO, USA), AppliChem Inc. (St. Louis Missouri, MO, USA) or Fluka Chemie GmbH (Buchs, Switzerland).

    Article Title: Efficient Gene Transfer and Gene Editing in Sterlet (Acipenser ruthenus)
    Article Snippet: A pair of forward (F) and reverse (R) oligos was synthesized using the sequences: F, 5′-TAG GTC AGG GTG GTC ACG AGG G-3′; R, 5′-AAA CCC CTC GTG ACC ACC CTG A-3′. .. Plasmid DR274 (Addgene plasmid 42250) was digested using BsaI (NEB, R0535) and ligated with the paired oligos.

    Construct:

    Article Title: Evolutionary optimization of a modular ligase ribozyme: a small catalytic unit and a hairpin motif masking an element that could form an inactive structure
    Article Snippet: Template DNAs were constructed as follows. .. Respective PCR products were digested with BsaI (New England Biolabs, Ipswich, MA, USA).

    Article Title: Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting
    Article Snippet: Paragraph title: Protocol for assembly of custom TALEN, TAL effector or TAL effector fusion-ready constructs ... The module and array plasmids (150 ng each) are subjected to digestion and ligation in a single 20 µl reaction containing 1 µl BsaI (10 U, New England BioLabs) and 1 µl T4 DNA Ligase (2000 U, New England BioLabs) in T4 DNA ligase buffer (New England BioLabs).

    Article Title: Versatile genetic assembly system (VEGAS) to assemble pathways for expression in S. cerevisiae
    Article Snippet: 100 ng of yGG acceptor vector (pJC120 for all experiments described in this work) plus equimolar amounts of each part for assembly (LVA, PRO, CDS, TER, RVA) were combined in a Golden Gate reaction consisting of 1.5 μl 10X T4 DNA ligase reaction buffer (New England Biolabs, M0202), 0.15 μl 100X Bovine Serum Albumin (BSA, New England Biolabs), 600U T4 DNA ligase (rapid) (Enzymatics, L6030-HC-L) and 10U of BsaI (New England Biolabs, R0535) in a final volume of 15 μl. .. For ‘terminal homology VEGAS’ experiments, 5 μl of each yGG reaction was transformed into Top10 E. coli and plated on LB plates supplemented with carbenicilllin (75 μg/ml).

    Article Title: Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli
    Article Snippet: Cognate CRISPR-dCas9 repressor plasmids (containing dCas9, tracrRNA, and a single spacer CRISPR array) for each corresponding promoter variant were constructed (Figure ) using Golden Gate assembly as described before ( ). .. Phosphorylated and annealed inserts were individually cloned into recipient plasmid pdCas9 ( ) at two adjacent BsaI sites in the minimal, single-spacer CRISPR array using a one-pot Golden Gate reaction with BsaI (New England BioLabs) and T7 ligase (Epicentre Biotechnologies).

    Article Title: L-SCRaMbLE as a tool for light-controlled Cre-mediated recombination in yeast
    Article Snippet: Paragraph title: Constructs and strains ... Each reaction included 1.5 µl 10x T4 DNA ligase reaction buffer (New England Biolabs), 0.15 µl 100x bovine serum albumin (New England Biolabs), 600 U T4 DNA ligase (Qiagen, Hilden, Germany), and 10 U of Bsa I (New England Biolabs) in a final volume of 15 µl .

    Article Title: Spliceosome assembly in the absence of stable U4/U6 RNA pairing
    Article Snippet: DNA templates for all 83-nt constructs were prepared through phosphorylation and ligation of complementary, overlapping oligonucleotides (Integrated DNA Technologies) into pUC19 vector (New England Biolabs). .. A BsaI restriction site was included at the end of the template to allow for run-off transcription after digestion with BsaI enzyme (NEB).

    Article Title: Influenza A and B Virus Intertypic Reassortment through Compatible Viral Packaging Signals
    Article Snippet: Chimeric influenza A/B virus constructs were generated by subcloning the entire ORF of B/Yam HA or NA into vRNA expression plasmids that contained the 3′ and 5′ NCRs and packaging signals from influenza A virus HA ( ) or NA ( ). .. The B/Yam HA segment was amplified by RT-PCR from RNA isolated from infected MDCK cells and cloned into the human pPolI plasmid using SapI (NEB) and then digested with BglII and BsaI (NEB) to cut 228 nucleotides (nt) from the 3′ end and 108 nt from the 5′ end.

    Article Title:
    Article Snippet: The PCR products were digested with the enzyme BsaI (enzymes were from New England BioLabs) and ligated into the expression vector pASK-IBA3 (for cytoplasmic production, from IBA GmbH) or pASK-IBA2 (for periplasmic production). .. The PCR products were digested with the enzyme BsaI (enzymes were from New England BioLabs) and ligated into the expression vector pASK-IBA3 (for cytoplasmic production, from IBA GmbH) or pASK-IBA2 (for periplasmic production).

    Incubation:

    Article Title: Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting
    Article Snippet: The module and array plasmids (150 ng each) are subjected to digestion and ligation in a single 20 µl reaction containing 1 µl BsaI (10 U, New England BioLabs) and 1 µl T4 DNA Ligase (2000 U, New England BioLabs) in T4 DNA ligase buffer (New England BioLabs). .. The reaction is incubated in a thermocycler for 10 cycles of 5 min at 37°C and 10 min at 16°C, then heated to 50°C for 5 min and then 80°C for 5 min. Then, 1 µl 25 mM ATP and 1 µl Plasmid Safe DNase (10 U, Epicentre) are added.

    Article Title: Rapid Restriction Enzyme-Free Cloning of PCR Products: A High-Throughput Method Applicable for Library Construction
    Article Snippet: Digestion of the vector with BsaI linearizes the vector, creating a 5′-GCCG-3′ overhang close to the 3′ end of the promoter and 5′-GGAG-3′ overhang close to the EcoRI site, and removes the stuffer so that the BsaI recognition sites are lost upon ligation with the insert. .. The vector for cloning was prepared by digesting 10 µg plasmid DNA in a total volume of 400 µl with 400 units of BsaI (New England Biolabs, Ipswich, MA, USA) added in four aliquots during the 4 h incubation at 50°C. .. The digested DNA was extracted with phenol: chloroform, ethanol precipitated, resuspended in 0.1X TE and then separated on 1.2% Sea Plaque GTG agarose (Lonza, Rockland, ME, USA) to purify the linearized vector from the stuffer fragment using the Qiaquick Gel Extraction kit (Qiagen, Hilden, Germany).

    Article Title: Highly multiplexed genome engineering using CRISPR/Cas9 gRNA arrays
    Article Snippet: Briefly, 150 ng of each pGG-gRNA plasmid was combined with 150 ng of the appropriate pACPT vector, followed by addition of 1 uL of BsaI (New England BioLabs), 1 uL of T4 DNA Ligase and Buffer (New England BioLabs) and water to a total of 20 uL. .. Briefly, 150 ng of each pGG-gRNA plasmid was combined with 150 ng of the appropriate pACPT vector, followed by addition of 1 uL of BsaI (New England BioLabs), 1 uL of T4 DNA Ligase and Buffer (New England BioLabs) and water to a total of 20 uL.

    TALENs:

    Article Title: Efficient Gene Transfer and Gene Editing in Sterlet (Acipenser ruthenus)
    Article Snippet: Paragraph title: Preparation of TALENs mRNA, Cas9 mRNA/gRNA, and Cas9 Nuclease/Guide RNA Targeting Exogenous EGFP ... Plasmid DR274 (Addgene plasmid 42250) was digested using BsaI (NEB, R0535) and ligated with the paired oligos.

    Activity Assay:

    Article Title: EIN2 mediates direct regulation of histone acetylation in the ethylene response
    Article Snippet: The enzymatic activity of the Cas9 nuclease was abolished by mutation of the RuvC and HNH domains, generating the nuclease-null deactivated Cas9 (dCas9) ( ) for pRGEB31 ( pRGEB31-dCas9 ). .. All PCR amplifications were carried out using Phusion High-Fidelity DNA Polymerase (BioLabs M0530L). gRNA sequences were cloned into the BsaI (New England Biolabs) site in pRGEB31-dCas9 as previously described ( ).

    In Silico:

    Article Title: Human Campylobacteriosis in Italy: Emergence of Multi-Drug Resistance to Ciprofloxacin, Tetracycline, and Erythromycin
    Article Snippet: The sequences were also analyzed using BLASTN and BLASTP software at the NCBI GenBank sequence database ( ) and compared in silico to those of C. jejuni NCTC11168 strain (GenBank accession n. ), considered as the wild type reference sequences. .. The V region of 23S rRNA gene ( rrnB operon) was amplified by PCR, the amplicons, purified using the ISOLATE II PCR and Gel Kit (Bioline, London, UK) were digested with BsaI (5U) and BceAI (1U) (New England Biolabs, Beverly, UK) restriction enzymes, respectively, as previously described (Vacher et al., ).

    Mass Spectrometry:

    Article Title: Analysis of Inducible Nitric Oxide Synthase Gene Polymorphisms in Vitiligo in Han Chinese People
    Article Snippet: The primers of iNOS -1173 C →T are as follows: 5′- GACAAGAAGGAAATGAGTGGACACAGGTAGCAAAGTGTTGAGAC -3′ (MS-P2F), 5′- GCATTTTTCCATCATAAAAGTAA -3′ (MS-P3R) and 5′- GTGGTAGCAAATGTTGGAAT -3′ (MS-P4F), as previously reported .The amplified PCR products for the iNOS -954 G →C and Ex 16+14 C →T polymorphisms were 573 bp and 219 bp, respectively. .. Then we used BsaI and Tsp509I restriction enzymes (New England Biolabs, Beverly, Mass) to delineate the iNOS -954 G →C and Ex 16+14 C →T polymorphisms, respectively.

    Modification:

    Article Title: Rapid Restriction Enzyme-Free Cloning of PCR Products: A High-Throughput Method Applicable for Library Construction
    Article Snippet: The expression vector pVNLEBAP1306 containing a backbone obtained from pET11a was modified by oligonucleotide-directed mutagenesis to delete a 1.32 kbp fragment between the laci and rop genes to derive the pVLExp vector backbone ( & ). .. The vector for cloning was prepared by digesting 10 µg plasmid DNA in a total volume of 400 µl with 400 units of BsaI (New England Biolabs, Ipswich, MA, USA) added in four aliquots during the 4 h incubation at 50°C.

    Transformation Assay:

    Article Title: Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting
    Article Snippet: The module and array plasmids (150 ng each) are subjected to digestion and ligation in a single 20 µl reaction containing 1 µl BsaI (10 U, New England BioLabs) and 1 µl T4 DNA Ligase (2000 U, New England BioLabs) in T4 DNA ligase buffer (New England BioLabs). .. The module and array plasmids (150 ng each) are subjected to digestion and ligation in a single 20 µl reaction containing 1 µl BsaI (10 U, New England BioLabs) and 1 µl T4 DNA Ligase (2000 U, New England BioLabs) in T4 DNA ligase buffer (New England BioLabs).

    Article Title: Versatile genetic assembly system (VEGAS) to assemble pathways for expression in S. cerevisiae
    Article Snippet: 100 ng of yGG acceptor vector (pJC120 for all experiments described in this work) plus equimolar amounts of each part for assembly (LVA, PRO, CDS, TER, RVA) were combined in a Golden Gate reaction consisting of 1.5 μl 10X T4 DNA ligase reaction buffer (New England Biolabs, M0202), 0.15 μl 100X Bovine Serum Albumin (BSA, New England Biolabs), 600U T4 DNA ligase (rapid) (Enzymatics, L6030-HC-L) and 10U of BsaI (New England Biolabs, R0535) in a final volume of 15 μl. .. 100 ng of yGG acceptor vector (pJC120 for all experiments described in this work) plus equimolar amounts of each part for assembly (LVA, PRO, CDS, TER, RVA) were combined in a Golden Gate reaction consisting of 1.5 μl 10X T4 DNA ligase reaction buffer (New England Biolabs, M0202), 0.15 μl 100X Bovine Serum Albumin (BSA, New England Biolabs), 600U T4 DNA ligase (rapid) (Enzymatics, L6030-HC-L) and 10U of BsaI (New England Biolabs, R0535) in a final volume of 15 μl.

    Article Title: Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli
    Article Snippet: Phosphorylated and annealed inserts were individually cloned into recipient plasmid pdCas9 ( ) at two adjacent BsaI sites in the minimal, single-spacer CRISPR array using a one-pot Golden Gate reaction with BsaI (New England BioLabs) and T7 ligase (Epicentre Biotechnologies). .. After confirmation by Sanger sequencing, chemically competent BL21 Star™ (DE3) containing each of 11 promoter variants driving mCherry expression were prepared.

    Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli
    Article Snippet: The lpxB coding sequence was amplified from E. coli BL21 cells with Phusion DNA polymerase (NEB) using the forward and reverse primers carrying BsaI (NEB) and XbaI (NEB) restriction sites, respectively. .. Alternatively for co-expression and purification of two mutants of LpxB, lpxB genes were inserted into pRSF-Duet-1 (Novagen) at the EcoRI (TaKaRa) and HindIII (NEB) sites of MCS1 and at the NdeI (NEB) and KpnI (NEB) sites of MCS2, thus encoding one N-terminally His-tagged protein and one untagged protein.

    Article Title: Highly multiplexed genome engineering using CRISPR/Cas9 gRNA arrays
    Article Snippet: Briefly, 150 ng of each pGG-gRNA plasmid was combined with 150 ng of the appropriate pACPT vector, followed by addition of 1 uL of BsaI (New England BioLabs), 1 uL of T4 DNA Ligase and Buffer (New England BioLabs) and water to a total of 20 uL. .. One uL of 25 mM ATP and 1 uL of Plasmid Safe (Epicentre) were then added to the reaction and incubated for 1 hour at 37°C.

    Article Title: Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers
    Article Snippet: 3–5 ng of purified post-elution PCR product (or half of the washed beads using the direct assembly method (see Results)) was added to a 10 -µl reaction containing 1× NEBuffer 4, 1 mM ATP, 0.1 mg/ml BSA, 0.5 µl T7 ligase (Enzymatics), 0.5 µl BsaI (NEB) and 100 ng TALEN backbone plasmid. .. 3–5 ng of purified post-elution PCR product (or half of the washed beads using the direct assembly method (see Results)) was added to a 10 -µl reaction containing 1× NEBuffer 4, 1 mM ATP, 0.1 mg/ml BSA, 0.5 µl T7 ligase (Enzymatics), 0.5 µl BsaI (NEB) and 100 ng TALEN backbone plasmid.

    Countercurrent Chromatography:

    Article Title: Efficient Gene Transfer and Gene Editing in Sterlet (Acipenser ruthenus)
    Article Snippet: A pair of forward (F) and reverse (R) oligos was synthesized using the sequences: F, 5′-TAG GTC AGG GTG GTC ACG AGG G-3′; R, 5′-AAA CCC CTC GTG ACC ACC CTG A-3′. .. Plasmid DR274 (Addgene plasmid 42250) was digested using BsaI (NEB, R0535) and ligated with the paired oligos.

    Ligation:

    Article Title: Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting
    Article Snippet: If arrays of 22–31 modules are to be assembled, the first 10 modules are cloned into pFUS_A30A, the second 10 modules into pFUS_A30B and the remaining modules into the appropriate pFUS_B plasmid, again according to the number of modules going in. .. The module and array plasmids (150 ng each) are subjected to digestion and ligation in a single 20 µl reaction containing 1 µl BsaI (10 U, New England BioLabs) and 1 µl T4 DNA Ligase (2000 U, New England BioLabs) in T4 DNA ligase buffer (New England BioLabs). .. The reaction is incubated in a thermocycler for 10 cycles of 5 min at 37°C and 10 min at 16°C, then heated to 50°C for 5 min and then 80°C for 5 min. Then, 1 µl 25 mM ATP and 1 µl Plasmid Safe DNase (10 U, Epicentre) are added.

    Article Title: Rapid Restriction Enzyme-Free Cloning of PCR Products: A High-Throughput Method Applicable for Library Construction
    Article Snippet: Digestion of the vector with BsaI linearizes the vector, creating a 5′-GCCG-3′ overhang close to the 3′ end of the promoter and 5′-GGAG-3′ overhang close to the EcoRI site, and removes the stuffer so that the BsaI recognition sites are lost upon ligation with the insert. .. The vector for cloning was prepared by digesting 10 µg plasmid DNA in a total volume of 400 µl with 400 units of BsaI (New England Biolabs, Ipswich, MA, USA) added in four aliquots during the 4 h incubation at 50°C.

    Article Title: Highly multiplexed genome engineering using CRISPR/Cas9 gRNA arrays
    Article Snippet: Single pGG vectors were generated using the same oligonucleotide ligation approach described above. .. Briefly, 150 ng of each pGG-gRNA plasmid was combined with 150 ng of the appropriate pACPT vector, followed by addition of 1 uL of BsaI (New England BioLabs), 1 uL of T4 DNA Ligase and Buffer (New England BioLabs) and water to a total of 20 uL.

    Article Title: Spliceosome assembly in the absence of stable U4/U6 RNA pairing
    Article Snippet: DNA templates for all 83-nt constructs were prepared through phosphorylation and ligation of complementary, overlapping oligonucleotides (Integrated DNA Technologies) into pUC19 vector (New England Biolabs). .. A BsaI restriction site was included at the end of the template to allow for run-off transcription after digestion with BsaI enzyme (NEB).

    Infection:

    Article Title: Influenza A and B Virus Intertypic Reassortment through Compatible Viral Packaging Signals
    Article Snippet: Influenza B virus ΔHA/GFP plasmid pPolI HA(228)GFP(108) was generated as previously described ( ). .. The B/Yam HA segment was amplified by RT-PCR from RNA isolated from infected MDCK cells and cloned into the human pPolI plasmid using SapI (NEB) and then digested with BglII and BsaI (NEB) to cut 228 nucleotides (nt) from the 3′ end and 108 nt from the 5′ end. .. The product from PCR amplification of GFP using primers flanked by BglII and BsaI was subcloned between these two restriction sites.

    Hemagglutination Assay:

    Article Title: Influenza A and B Virus Intertypic Reassortment through Compatible Viral Packaging Signals
    Article Snippet: Influenza B virus ΔHA/GFP plasmid pPolI HA(228)GFP(108) was generated as previously described ( ). .. The B/Yam HA segment was amplified by RT-PCR from RNA isolated from infected MDCK cells and cloned into the human pPolI plasmid using SapI (NEB) and then digested with BglII and BsaI (NEB) to cut 228 nucleotides (nt) from the 3′ end and 108 nt from the 5′ end. .. The product from PCR amplification of GFP using primers flanked by BglII and BsaI was subcloned between these two restriction sites.

    Generated:

    Article Title: L-SCRaMbLE as a tool for light-controlled Cre-mediated recombination in yeast
    Article Snippet: Briefly, PCR amplicons spanning each of the four β-carotene transcription units (TU) were generated using overhang primers to add a loxPsym sequence to one end of each TU and Bsa I sites to both ends. .. Each reaction included 1.5 µl 10x T4 DNA ligase reaction buffer (New England Biolabs), 0.15 µl 100x bovine serum albumin (New England Biolabs), 600 U T4 DNA ligase (Qiagen, Hilden, Germany), and 10 U of Bsa I (New England Biolabs) in a final volume of 15 µl .

    Article Title: Highly multiplexed genome engineering using CRISPR/Cas9 gRNA arrays
    Article Snippet: Briefly, 150 ng of each pGG-gRNA plasmid was combined with 150 ng of the appropriate pACPT vector, followed by addition of 1 uL of BsaI (New England BioLabs), 1 uL of T4 DNA Ligase and Buffer (New England BioLabs) and water to a total of 20 uL. .. Briefly, 150 ng of each pGG-gRNA plasmid was combined with 150 ng of the appropriate pACPT vector, followed by addition of 1 uL of BsaI (New England BioLabs), 1 uL of T4 DNA Ligase and Buffer (New England BioLabs) and water to a total of 20 uL.

    Article Title: Influenza A and B Virus Intertypic Reassortment through Compatible Viral Packaging Signals
    Article Snippet: Influenza B virus ΔHA/GFP plasmid pPolI HA(228)GFP(108) was generated as previously described ( ). .. The B/Yam HA segment was amplified by RT-PCR from RNA isolated from infected MDCK cells and cloned into the human pPolI plasmid using SapI (NEB) and then digested with BglII and BsaI (NEB) to cut 228 nucleotides (nt) from the 3′ end and 108 nt from the 5′ end.

    Polymerase Chain Reaction:

    Article Title: Human Campylobacteriosis in Italy: Emergence of Multi-Drug Resistance to Ciprofloxacin, Tetracycline, and Erythromycin
    Article Snippet: The sequences were also analyzed using BLASTN and BLASTP software at the NCBI GenBank sequence database ( ) and compared in silico to those of C. jejuni NCTC11168 strain (GenBank accession n. ), considered as the wild type reference sequences. .. The V region of 23S rRNA gene ( rrnB operon) was amplified by PCR, the amplicons, purified using the ISOLATE II PCR and Gel Kit (Bioline, London, UK) were digested with BsaI (5U) and BceAI (1U) (New England Biolabs, Beverly, UK) restriction enzymes, respectively, as previously described (Vacher et al., ). .. The fragments were separated by electrophoresis on a 2% agarose gel, with ethidium bromide, and visualized under UV light.

    Article Title: Evolutionary optimization of a modular ligase ribozyme: a small catalytic unit and a hairpin motif masking an element that could form an inactive structure
    Article Snippet: The pool-L oligonucleotides, including 5 nt of random sequence (Pool-L), was amplified by PCR using a sense primer (Fw-L) and an antisense primer (Rv-L). .. Respective PCR products were digested with BsaI (New England Biolabs, Ipswich, MA, USA). .. The PCR R fragments were ligated with the L fragments using T4 DNA ligase (Takara).

    Article Title: Analysis of Inducible Nitric Oxide Synthase Gene Polymorphisms in Vitiligo in Han Chinese People
    Article Snippet: The primers of iNOS -1173 C →T are as follows: 5′- GACAAGAAGGAAATGAGTGGACACAGGTAGCAAAGTGTTGAGAC -3′ (MS-P2F), 5′- GCATTTTTCCATCATAAAAGTAA -3′ (MS-P3R) and 5′- GTGGTAGCAAATGTTGGAAT -3′ (MS-P4F), as previously reported .The amplified PCR products for the iNOS -954 G →C and Ex 16+14 C →T polymorphisms were 573 bp and 219 bp, respectively. .. Then we used BsaI and Tsp509I restriction enzymes (New England Biolabs, Beverly, Mass) to delineate the iNOS -954 G →C and Ex 16+14 C →T polymorphisms, respectively.

    Article Title: Macrolide Resistance in Treponema pallidum Correlates With 23S rDNA Mutations in Recently Isolated Clinical Strains
    Article Snippet: 23S rDNA mutations were confirmed using the published restriction fragment length polymorphism methods previously described., Briefly, an initial 23S rDNA polymerase chain reaction (PCR) product specific to T. pallidum genomic DNA served as template for a nested PCR. .. For restriction enzyme digestion, the A2058G mutation was detected with MboII (New England Biolabs, Ipswich, Mass) and the A2059G mutation with BsaI (NEB).

    Article Title: Efficient Gene Transfer and Gene Editing in Sterlet (Acipenser ruthenus)
    Article Snippet: Plasmid DR274 (Addgene plasmid 42250) was digested using BsaI (NEB, R0535) and ligated with the paired oligos. .. Then, the ligation mix was transformed into competent E. coli cells.

    Article Title: L-SCRaMbLE as a tool for light-controlled Cre-mediated recombination in yeast
    Article Snippet: To carry out type IIS restriction enzyme-based Golden Gate reactions, 100 ng of Golden Gate acceptor vector plus equimolar amounts of PCR-amplified DNA fragments were mixed together for one-pot digestion-ligation reaction. .. Each reaction included 1.5 µl 10x T4 DNA ligase reaction buffer (New England Biolabs), 0.15 µl 100x bovine serum albumin (New England Biolabs), 600 U T4 DNA ligase (Qiagen, Hilden, Germany), and 10 U of Bsa I (New England Biolabs) in a final volume of 15 µl .

    Article Title: TRANSCRIPTION ACTIVATOR-LIKE EFFECTOR NUCLEASE-Mediated Generation and Metabolic Analysis of Camalexin-Deficient cyp71a12 cyp71a13 Double Knockout Lines
    Article Snippet: From leaves of primary transformants, genomic DNA was isolated and a sequence of 665 bp in the target region of the TALEN pair was amplified with the primer pair 5′-AAGCCGTGATTAAAGAGGTG-3′ and 5′-AAATTGTAGGATATGCTTATTTTCT-3′. .. A total of 5 µL of the PCR product was used directly for digestion with Bsa I (New England Biolabs). .. The amplicon sequence contains two cleavage sites for Bsa I, one targeted by the TALEN pair, resulting in different digestion patterns of the wild-type sequence and mutated or partially mutated CYP71A12 (the wild type, 255, 253, and 157 bp; TALEN mutated, 255 and 410 bp).

    Article Title:
    Article Snippet: D00-HA was amplified from pIBA2-Int HA453 ( ). .. The PCR products were digested with the enzyme BsaI (enzymes were from New England BioLabs) and ligated into the expression vector pASK-IBA3 (for cytoplasmic production, from IBA GmbH) or pASK-IBA2 (for periplasmic production). .. The ligation mixture was transformed into chemically competent E. coli TOP10 (Invitrogen), and transformants were selected on lysogeny broth (LB) supplemented with 100 μg/ml ampicillin ( ).

    Article Title: EIN2 mediates direct regulation of histone acetylation in the ethylene response
    Article Snippet: The enzymatic activity of the Cas9 nuclease was abolished by mutation of the RuvC and HNH domains, generating the nuclease-null deactivated Cas9 (dCas9) ( ) for pRGEB31 ( pRGEB31-dCas9 ). .. All PCR amplifications were carried out using Phusion High-Fidelity DNA Polymerase (BioLabs M0530L). gRNA sequences were cloned into the BsaI (New England Biolabs) site in pRGEB31-dCas9 as previously described ( ). .. Briefly, 3-d-old etiolated seedlings treated with air or ethylene were harvested and cross-linked in 1% formaldehyde, and the chromatin was isolated.

    Article Title: Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers
    Article Snippet: Ligated TALE domains were assembled into a nuclease-carrying backbone vector using the Golden-Gate method ( ) as applied by ( ). .. 3–5 ng of purified post-elution PCR product (or half of the washed beads using the direct assembly method (see Results)) was added to a 10 -µl reaction containing 1× NEBuffer 4, 1 mM ATP, 0.1 mg/ml BSA, 0.5 µl T7 ligase (Enzymatics), 0.5 µl BsaI (NEB) and 100 ng TALEN backbone plasmid. .. This plasmid is based on the nuclease plasmid of ( ) but modified using PCR and isothermal assembly ( ) to remove the C-terminal 0.5 TALE repeat.

    DNA Sequencing:

    Article Title: Thermostable proteins bioprocesses: The activity of restriction endonuclease-methyltransferase from Thermus thermophilus (RM.TthHB27I) cloned in Escherichia coli is critically affected by the codon composition of the synthetic gene
    Article Snippet: SalI and BsaI REases were from New England Biolabs (Ipswich, MA, USA). .. Other reagents were from POCh S.A. (Gliwice, Poland), Sigma-Aldrich (St. Louis, MO, USA), AppliChem Inc. (St. Louis Missouri, MO, USA) or Fluka Chemie GmbH (Buchs, Switzerland).

    Sequencing:

    Article Title: Human Campylobacteriosis in Italy: Emergence of Multi-Drug Resistance to Ciprofloxacin, Tetracycline, and Erythromycin
    Article Snippet: The sequences were also analyzed using BLASTN and BLASTP software at the NCBI GenBank sequence database ( ) and compared in silico to those of C. jejuni NCTC11168 strain (GenBank accession n. ), considered as the wild type reference sequences. .. The V region of 23S rRNA gene ( rrnB operon) was amplified by PCR, the amplicons, purified using the ISOLATE II PCR and Gel Kit (Bioline, London, UK) were digested with BsaI (5U) and BceAI (1U) (New England Biolabs, Beverly, UK) restriction enzymes, respectively, as previously described (Vacher et al., ).

    Article Title: Evolutionary optimization of a modular ligase ribozyme: a small catalytic unit and a hairpin motif masking an element that could form an inactive structure
    Article Snippet: The pool-L oligonucleotides, including 5 nt of random sequence (Pool-L), was amplified by PCR using a sense primer (Fw-L) and an antisense primer (Rv-L). .. Respective PCR products were digested with BsaI (New England Biolabs, Ipswich, MA, USA).

    Article Title: Rapid Restriction Enzyme-Free Cloning of PCR Products: A High-Throughput Method Applicable for Library Construction
    Article Snippet: The NdeI site harboring the initiation codon (CAT ATG ) was followed by a sequence encoding an N-terminal tag (Tag1), NheI site, 5′ inverted BsaI site, 1.8 kbp stuffer, 3′ BsaI site followed by a Bsu36I restriction site, the sequence encoding a C-terminal tag (Tag2) and the stop codon (TAA). .. The vector for cloning was prepared by digesting 10 µg plasmid DNA in a total volume of 400 µl with 400 units of BsaI (New England Biolabs, Ipswich, MA, USA) added in four aliquots during the 4 h incubation at 50°C.

    Article Title: Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli
    Article Snippet: Two 35 bp complementary and slightly offset oligonucleotides (IDT) containing the spacer sequence for dCas9 targeting were phosphorylated with PNK (NEB) and annealed (37°C for 30 min, 98°C for 5 min, ramp down to 25°C over 15 min) to build inserts for each repressor variant. .. Phosphorylated and annealed inserts were individually cloned into recipient plasmid pdCas9 ( ) at two adjacent BsaI sites in the minimal, single-spacer CRISPR array using a one-pot Golden Gate reaction with BsaI (New England BioLabs) and T7 ligase (Epicentre Biotechnologies).

    Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli
    Article Snippet: This structure should aid in the rational and computational development of new antibiotics targeting LpxB to combat the increasing problem of antibiotic resistance. .. The lpxB coding sequence was amplified from E. coli BL21 cells with Phusion DNA polymerase (NEB) using the forward and reverse primers carrying BsaI (NEB) and XbaI (NEB) restriction sites, respectively. .. The lpxB coding sequence was inserted into pE-SUMO expression vector (LifeSensors) to attach an N-terminally His-tagged SUMO to the N-terminus of LpxB.

    Article Title: Efficient Gene Transfer and Gene Editing in Sterlet (Acipenser ruthenus)
    Article Snippet: The target site sequence of Cas9 on EGFP was GGT CAG GGT GGT CAC GAG GG (Supplementary Figure ). .. Plasmid DR274 (Addgene plasmid 42250) was digested using BsaI (NEB, R0535) and ligated with the paired oligos.

    Article Title: L-SCRaMbLE as a tool for light-controlled Cre-mediated recombination in yeast
    Article Snippet: Briefly, PCR amplicons spanning each of the four β-carotene transcription units (TU) were generated using overhang primers to add a loxPsym sequence to one end of each TU and Bsa I sites to both ends. .. Each reaction included 1.5 µl 10x T4 DNA ligase reaction buffer (New England Biolabs), 0.15 µl 100x bovine serum albumin (New England Biolabs), 600 U T4 DNA ligase (Qiagen, Hilden, Germany), and 10 U of Bsa I (New England Biolabs) in a final volume of 15 µl .

    Article Title: Highly multiplexed genome engineering using CRISPR/Cas9 gRNA arrays
    Article Snippet: Briefly, 150 ng of each pGG-gRNA plasmid was combined with 150 ng of the appropriate pACPT vector, followed by addition of 1 uL of BsaI (New England BioLabs), 1 uL of T4 DNA Ligase and Buffer (New England BioLabs) and water to a total of 20 uL. .. Assembled plasmids were then transformed into TOP10 bacteria (Thermo Fisher Scientific) and plated on spectinomycin selection plates with X-gal and mini-preps performed on white colonies using the GeneJET Plasmid Miniprep Kit (Life Technologies).

    Article Title: Spliceosome assembly in the absence of stable U4/U6 RNA pairing
    Article Snippet: A BsaI restriction site was included at the end of the template to allow for run-off transcription after digestion with BsaI enzyme (NEB). .. RNA was transcribed in vitro using purified His6 -tagged T7 RNA polymerase ( ) in 40 mM TrisCl [pH 8.0], 1 mM spermidine, 0.01% Triton X-100, and 38 mM MgCl2 .

    Article Title: Influenza A and B Virus Intertypic Reassortment through Compatible Viral Packaging Signals
    Article Snippet: The B/Yam HA segment was amplified by RT-PCR from RNA isolated from infected MDCK cells and cloned into the human pPolI plasmid using SapI (NEB) and then digested with BglII and BsaI (NEB) to cut 228 nucleotides (nt) from the 3′ end and 108 nt from the 5′ end. .. The product from PCR amplification of GFP using primers flanked by BglII and BsaI was subcloned between these two restriction sites.

    Article Title: TRANSCRIPTION ACTIVATOR-LIKE EFFECTOR NUCLEASE-Mediated Generation and Metabolic Analysis of Camalexin-Deficient cyp71a12 cyp71a13 Double Knockout Lines
    Article Snippet: From leaves of primary transformants, genomic DNA was isolated and a sequence of 665 bp in the target region of the TALEN pair was amplified with the primer pair 5′-AAGCCGTGATTAAAGAGGTG-3′ and 5′-AAATTGTAGGATATGCTTATTTTCT-3′. .. A total of 5 µL of the PCR product was used directly for digestion with Bsa I (New England Biolabs).

    Article Title:
    Article Snippet: To clone the D00 domain, the DNA sequence coding for the D00 domain was amplified from wt EPEC E2348/69 intimin ( ) using PCR with Q5 polymerase (New England BioLabs). .. The PCR products were digested with the enzyme BsaI (enzymes were from New England BioLabs) and ligated into the expression vector pASK-IBA3 (for cytoplasmic production, from IBA GmbH) or pASK-IBA2 (for periplasmic production).

    Molecular Weight:

    Article Title: Thermostable proteins bioprocesses: The activity of restriction endonuclease-methyltransferase from Thermus thermophilus (RM.TthHB27I) cloned in Escherichia coli is critically affected by the codon composition of the synthetic gene
    Article Snippet: DNA isolation kits (DNA Cleanup Micro Kit, GeneJet Plasmid Miniprep Kit and GeneJET Gel Extraction), DNA size markers (100 bp Plus DNA Ladder, GeneRuler 1 kb DNA Ladder), protein molecular weight standards (PageRuler™ Unstained Broad Range Protein Ladder and Pierce™ Unstained Protein Molecular Weight Marker) were from Thermo Fisher Scientific/Fermentas (Vilnius, Lithuania). .. SalI and BsaI REases were from New England Biolabs (Ipswich, MA, USA).

    DNA Extraction:

    Article Title: Thermostable proteins bioprocesses: The activity of restriction endonuclease-methyltransferase from Thermus thermophilus (RM.TthHB27I) cloned in Escherichia coli is critically affected by the codon composition of the synthetic gene
    Article Snippet: DNA isolation kits (DNA Cleanup Micro Kit, GeneJet Plasmid Miniprep Kit and GeneJET Gel Extraction), DNA size markers (100 bp Plus DNA Ladder, GeneRuler 1 kb DNA Ladder), protein molecular weight standards (PageRuler™ Unstained Broad Range Protein Ladder and Pierce™ Unstained Protein Molecular Weight Marker) were from Thermo Fisher Scientific/Fermentas (Vilnius, Lithuania). .. SalI and BsaI REases were from New England Biolabs (Ipswich, MA, USA).

    Marker:

    Article Title: Thermostable proteins bioprocesses: The activity of restriction endonuclease-methyltransferase from Thermus thermophilus (RM.TthHB27I) cloned in Escherichia coli is critically affected by the codon composition of the synthetic gene
    Article Snippet: DNA isolation kits (DNA Cleanup Micro Kit, GeneJet Plasmid Miniprep Kit and GeneJET Gel Extraction), DNA size markers (100 bp Plus DNA Ladder, GeneRuler 1 kb DNA Ladder), protein molecular weight standards (PageRuler™ Unstained Broad Range Protein Ladder and Pierce™ Unstained Protein Molecular Weight Marker) were from Thermo Fisher Scientific/Fermentas (Vilnius, Lithuania). .. SalI and BsaI REases were from New England Biolabs (Ipswich, MA, USA).

    Mutagenesis:

    Article Title: Human Campylobacteriosis in Italy: Emergence of Multi-Drug Resistance to Ciprofloxacin, Tetracycline, and Erythromycin
    Article Snippet: The V region of 23S rRNA gene ( rrnB operon) was amplified by PCR, the amplicons, purified using the ISOLATE II PCR and Gel Kit (Bioline, London, UK) were digested with BsaI (5U) and BceAI (1U) (New England Biolabs, Beverly, UK) restriction enzymes, respectively, as previously described (Vacher et al., ). .. The fragments were separated by electrophoresis on a 2% agarose gel, with ethidium bromide, and visualized under UV light.

    Article Title: Rapid Restriction Enzyme-Free Cloning of PCR Products: A High-Throughput Method Applicable for Library Construction
    Article Snippet: The expression vector pVNLEBAP1306 containing a backbone obtained from pET11a was modified by oligonucleotide-directed mutagenesis to delete a 1.32 kbp fragment between the laci and rop genes to derive the pVLExp vector backbone ( & ). .. The vector for cloning was prepared by digesting 10 µg plasmid DNA in a total volume of 400 µl with 400 units of BsaI (New England Biolabs, Ipswich, MA, USA) added in four aliquots during the 4 h incubation at 50°C.

    Article Title: Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli
    Article Snippet: Phosphorylated and annealed inserts were individually cloned into recipient plasmid pdCas9 ( ) at two adjacent BsaI sites in the minimal, single-spacer CRISPR array using a one-pot Golden Gate reaction with BsaI (New England BioLabs) and T7 ligase (Epicentre Biotechnologies). .. After confirmation by Sanger sequencing, chemically competent BL21 Star™ (DE3) containing each of 11 promoter variants driving mCherry expression were prepared.

    Article Title: Macrolide Resistance in Treponema pallidum Correlates With 23S rDNA Mutations in Recently Isolated Clinical Strains
    Article Snippet: 23S rDNA mutations were confirmed using the published restriction fragment length polymorphism methods previously described., Briefly, an initial 23S rDNA polymerase chain reaction (PCR) product specific to T. pallidum genomic DNA served as template for a nested PCR. .. For restriction enzyme digestion, the A2058G mutation was detected with MboII (New England Biolabs, Ipswich, Mass) and the A2059G mutation with BsaI (NEB). .. Wild type amplicons were not cut by either enzyme.

    Article Title: Influenza A and B Virus Intertypic Reassortment through Compatible Viral Packaging Signals
    Article Snippet: The B/Yam HA segment was amplified by RT-PCR from RNA isolated from infected MDCK cells and cloned into the human pPolI plasmid using SapI (NEB) and then digested with BglII and BsaI (NEB) to cut 228 nucleotides (nt) from the 3′ end and 108 nt from the 5′ end. .. The product from PCR amplification of GFP using primers flanked by BglII and BsaI was subcloned between these two restriction sites.

    Article Title: TRANSCRIPTION ACTIVATOR-LIKE EFFECTOR NUCLEASE-Mediated Generation and Metabolic Analysis of Camalexin-Deficient cyp71a12 cyp71a13 Double Knockout Lines
    Article Snippet: Paragraph title: Screening for Mutation Events ... A total of 5 µL of the PCR product was used directly for digestion with Bsa I (New England Biolabs).

    Article Title:
    Article Snippet: Paragraph title: Cloning and Mutagenesis ... The PCR products were digested with the enzyme BsaI (enzymes were from New England BioLabs) and ligated into the expression vector pASK-IBA3 (for cytoplasmic production, from IBA GmbH) or pASK-IBA2 (for periplasmic production).

    Article Title: EIN2 mediates direct regulation of histone acetylation in the ethylene response
    Article Snippet: The enzymatic activity of the Cas9 nuclease was abolished by mutation of the RuvC and HNH domains, generating the nuclease-null deactivated Cas9 (dCas9) ( ) for pRGEB31 ( pRGEB31-dCas9 ). .. All PCR amplifications were carried out using Phusion High-Fidelity DNA Polymerase (BioLabs M0530L). gRNA sequences were cloned into the BsaI (New England Biolabs) site in pRGEB31-dCas9 as previously described ( ).

    Isolation:

    Article Title: Influenza A and B Virus Intertypic Reassortment through Compatible Viral Packaging Signals
    Article Snippet: Influenza B virus ΔHA/GFP plasmid pPolI HA(228)GFP(108) was generated as previously described ( ). .. The B/Yam HA segment was amplified by RT-PCR from RNA isolated from infected MDCK cells and cloned into the human pPolI plasmid using SapI (NEB) and then digested with BglII and BsaI (NEB) to cut 228 nucleotides (nt) from the 3′ end and 108 nt from the 5′ end. .. The product from PCR amplification of GFP using primers flanked by BglII and BsaI was subcloned between these two restriction sites.

    Article Title: A plug-and-play pathway refactoring workflow for natural product research in Escherichia coli and Saccharomyces cerevisiae
    Article Snippet: The reaction condition was as follows: a 20 μL reaction system contained 2 μL 10× T4 DNA Ligase Reaction Buffer (New England Biolabs, Ipswich, MA), 0.8 μL Bsa I (New England Biolabs, Ipswich, MA), 0.2 μL T4 DNA Ligase (M0202T, New England Biolabs, Ipswich, MA), and ddH2 O to 20 μL. .. The reaction condition was as follows: a 20 μL reaction system contained 2 μL 10× T4 DNA Ligase Reaction Buffer (New England Biolabs, Ipswich, MA), 0.8 μL Bsa I (New England Biolabs, Ipswich, MA), 0.2 μL T4 DNA Ligase (M0202T, New England Biolabs, Ipswich, MA), and ddH2 O to 20 μL.

    Article Title: TRANSCRIPTION ACTIVATOR-LIKE EFFECTOR NUCLEASE-Mediated Generation and Metabolic Analysis of Camalexin-Deficient cyp71a12 cyp71a13 Double Knockout Lines
    Article Snippet: From leaves of primary transformants, genomic DNA was isolated and a sequence of 665 bp in the target region of the TALEN pair was amplified with the primer pair 5′-AAGCCGTGATTAAAGAGGTG-3′ and 5′-AAATTGTAGGATATGCTTATTTTCT-3′. .. A total of 5 µL of the PCR product was used directly for digestion with Bsa I (New England Biolabs).

    Subcloning:

    Article Title: Influenza A and B Virus Intertypic Reassortment through Compatible Viral Packaging Signals
    Article Snippet: Chimeric influenza A/B virus constructs were generated by subcloning the entire ORF of B/Yam HA or NA into vRNA expression plasmids that contained the 3′ and 5′ NCRs and packaging signals from influenza A virus HA ( ) or NA ( ). .. The B/Yam HA segment was amplified by RT-PCR from RNA isolated from infected MDCK cells and cloned into the human pPolI plasmid using SapI (NEB) and then digested with BglII and BsaI (NEB) to cut 228 nucleotides (nt) from the 3′ end and 108 nt from the 5′ end.

    Luciferase:

    Article Title: Influenza A and B Virus Intertypic Reassortment through Compatible Viral Packaging Signals
    Article Snippet: Minigenome (MG) plasmids containing GFP or firefly luciferase (FFluc) flanked by the 3′ and 5′ NCRs of the influenza B virus HA segment (IBV MG) were cloned into the human pPolI plasmid using SapI (NEB), as previously described for the IAV MG plasmid ( , ). .. The B/Yam HA segment was amplified by RT-PCR from RNA isolated from infected MDCK cells and cloned into the human pPolI plasmid using SapI (NEB) and then digested with BglII and BsaI (NEB) to cut 228 nucleotides (nt) from the 3′ end and 108 nt from the 5′ end.

    Labeling:

    Article Title: Spliceosome assembly in the absence of stable U4/U6 RNA pairing
    Article Snippet: A BsaI restriction site was included at the end of the template to allow for run-off transcription after digestion with BsaI enzyme (NEB). .. Nucleoside triphosphate concentrations were adjusted stoichiometrically to the RNA sequence with the lowest concentration at 5 mM.

    Purification:

    Article Title: Human Campylobacteriosis in Italy: Emergence of Multi-Drug Resistance to Ciprofloxacin, Tetracycline, and Erythromycin
    Article Snippet: The sequences were also analyzed using BLASTN and BLASTP software at the NCBI GenBank sequence database ( ) and compared in silico to those of C. jejuni NCTC11168 strain (GenBank accession n. ), considered as the wild type reference sequences. .. The V region of 23S rRNA gene ( rrnB operon) was amplified by PCR, the amplicons, purified using the ISOLATE II PCR and Gel Kit (Bioline, London, UK) were digested with BsaI (5U) and BceAI (1U) (New England Biolabs, Beverly, UK) restriction enzymes, respectively, as previously described (Vacher et al., ). .. The fragments were separated by electrophoresis on a 2% agarose gel, with ethidium bromide, and visualized under UV light.

    Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli
    Article Snippet: Paragraph title: Cloning and purification of LpxB ... The lpxB coding sequence was amplified from E. coli BL21 cells with Phusion DNA polymerase (NEB) using the forward and reverse primers carrying BsaI (NEB) and XbaI (NEB) restriction sites, respectively.

    Article Title: Spliceosome assembly in the absence of stable U4/U6 RNA pairing
    Article Snippet: A BsaI restriction site was included at the end of the template to allow for run-off transcription after digestion with BsaI enzyme (NEB). .. A BsaI restriction site was included at the end of the template to allow for run-off transcription after digestion with BsaI enzyme (NEB).

    Article Title: Influenza A and B Virus Intertypic Reassortment through Compatible Viral Packaging Signals
    Article Snippet: The B/Yam HA segment was amplified by RT-PCR from RNA isolated from infected MDCK cells and cloned into the human pPolI plasmid using SapI (NEB) and then digested with BglII and BsaI (NEB) to cut 228 nucleotides (nt) from the 3′ end and 108 nt from the 5′ end. .. This mutation introduced the primer twice (on the 3′ end) immediately upstream of the GFP ORF.

    Article Title:
    Article Snippet: The PCR products were digested with the enzyme BsaI (enzymes were from New England BioLabs) and ligated into the expression vector pASK-IBA3 (for cytoplasmic production, from IBA GmbH) or pASK-IBA2 (for periplasmic production). .. Positive clones were screened for by colony PCR and the correctness of the constructs was verified by sequencing.

    Article Title: Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers
    Article Snippet: Ligated TALE domains were assembled into a nuclease-carrying backbone vector using the Golden-Gate method ( ) as applied by ( ). .. 3–5 ng of purified post-elution PCR product (or half of the washed beads using the direct assembly method (see Results)) was added to a 10 -µl reaction containing 1× NEBuffer 4, 1 mM ATP, 0.1 mg/ml BSA, 0.5 µl T7 ligase (Enzymatics), 0.5 µl BsaI (NEB) and 100 ng TALEN backbone plasmid. .. This plasmid is based on the nuclease plasmid of ( ) but modified using PCR and isothermal assembly ( ) to remove the C-terminal 0.5 TALE repeat.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Influenza A and B Virus Intertypic Reassortment through Compatible Viral Packaging Signals
    Article Snippet: Influenza B virus ΔHA/GFP plasmid pPolI HA(228)GFP(108) was generated as previously described ( ). .. The B/Yam HA segment was amplified by RT-PCR from RNA isolated from infected MDCK cells and cloned into the human pPolI plasmid using SapI (NEB) and then digested with BglII and BsaI (NEB) to cut 228 nucleotides (nt) from the 3′ end and 108 nt from the 5′ end. .. The product from PCR amplification of GFP using primers flanked by BglII and BsaI was subcloned between these two restriction sites.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Spliceosome assembly in the absence of stable U4/U6 RNA pairing
    Article Snippet: A BsaI restriction site was included at the end of the template to allow for run-off transcription after digestion with BsaI enzyme (NEB). .. 13 C–15 N labeled samples were prepared in the same manner as the unlabeled RNA using 13 C–15 N labeled nucleotides (Cambridge Isotope Laboratories) and 5 mM GMP.

    CRISPR:

    Article Title: Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli
    Article Snippet: See Supplementary Table S2 for a list of all primers and oligonucleotides used in this work. .. Phosphorylated and annealed inserts were individually cloned into recipient plasmid pdCas9 ( ) at two adjacent BsaI sites in the minimal, single-spacer CRISPR array using a one-pot Golden Gate reaction with BsaI (New England BioLabs) and T7 ligase (Epicentre Biotechnologies). .. Plasmid pdCas9 was a gift from Luciano Marraffini (Addgene plasmid # 46569).

    Nested PCR:

    Article Title: Macrolide Resistance in Treponema pallidum Correlates With 23S rDNA Mutations in Recently Isolated Clinical Strains
    Article Snippet: 23S rDNA mutations were confirmed using the published restriction fragment length polymorphism methods previously described., Briefly, an initial 23S rDNA polymerase chain reaction (PCR) product specific to T. pallidum genomic DNA served as template for a nested PCR. .. For restriction enzyme digestion, the A2058G mutation was detected with MboII (New England Biolabs, Ipswich, Mass) and the A2059G mutation with BsaI (NEB).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Rapid Restriction Enzyme-Free Cloning of PCR Products: A High-Throughput Method Applicable for Library Construction
    Article Snippet: The NdeI site harboring the initiation codon (CAT ATG ) was followed by a sequence encoding an N-terminal tag (Tag1), NheI site, 5′ inverted BsaI site, 1.8 kbp stuffer, 3′ BsaI site followed by a Bsu36I restriction site, the sequence encoding a C-terminal tag (Tag2) and the stop codon (TAA). .. The vector for cloning was prepared by digesting 10 µg plasmid DNA in a total volume of 400 µl with 400 units of BsaI (New England Biolabs, Ipswich, MA, USA) added in four aliquots during the 4 h incubation at 50°C.

    Plasmid Preparation:

    Article Title: Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting
    Article Snippet: If arrays of 22–31 modules are to be assembled, the first 10 modules are cloned into pFUS_A30A, the second 10 modules into pFUS_A30B and the remaining modules into the appropriate pFUS_B plasmid, again according to the number of modules going in. .. The module and array plasmids (150 ng each) are subjected to digestion and ligation in a single 20 µl reaction containing 1 µl BsaI (10 U, New England BioLabs) and 1 µl T4 DNA Ligase (2000 U, New England BioLabs) in T4 DNA ligase buffer (New England BioLabs).

    Article Title: Rapid Restriction Enzyme-Free Cloning of PCR Products: A High-Throughput Method Applicable for Library Construction
    Article Snippet: Digestion of the vector with BsaI linearizes the vector, creating a 5′-GCCG-3′ overhang close to the 3′ end of the promoter and 5′-GGAG-3′ overhang close to the EcoRI site, and removes the stuffer so that the BsaI recognition sites are lost upon ligation with the insert. .. The vector for cloning was prepared by digesting 10 µg plasmid DNA in a total volume of 400 µl with 400 units of BsaI (New England Biolabs, Ipswich, MA, USA) added in four aliquots during the 4 h incubation at 50°C. .. The digested DNA was extracted with phenol: chloroform, ethanol precipitated, resuspended in 0.1X TE and then separated on 1.2% Sea Plaque GTG agarose (Lonza, Rockland, ME, USA) to purify the linearized vector from the stuffer fragment using the Qiaquick Gel Extraction kit (Qiagen, Hilden, Germany).

    Article Title: Versatile genetic assembly system (VEGAS) to assemble pathways for expression in S. cerevisiae
    Article Snippet: All parts and their corresponding sequence files are available upon request. .. 100 ng of yGG acceptor vector (pJC120 for all experiments described in this work) plus equimolar amounts of each part for assembly (LVA, PRO, CDS, TER, RVA) were combined in a Golden Gate reaction consisting of 1.5 μl 10X T4 DNA ligase reaction buffer (New England Biolabs, M0202), 0.15 μl 100X Bovine Serum Albumin (BSA, New England Biolabs), 600U T4 DNA ligase (rapid) (Enzymatics, L6030-HC-L) and 10U of BsaI (New England Biolabs, R0535) in a final volume of 15 μl. .. One-pot digestion-ligation assembly was carried out in a thermocycler by performing 25 cycles of [37°C 3 min, 16°C 4 min], followed by 50°C 5 min, and 80°C 5 min. We have also described several modifications to improve the efficiency of yGG ( ).

    Article Title: Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli
    Article Snippet: See Supplementary Table S2 for a list of all primers and oligonucleotides used in this work. .. Phosphorylated and annealed inserts were individually cloned into recipient plasmid pdCas9 ( ) at two adjacent BsaI sites in the minimal, single-spacer CRISPR array using a one-pot Golden Gate reaction with BsaI (New England BioLabs) and T7 ligase (Epicentre Biotechnologies). .. Plasmid pdCas9 was a gift from Luciano Marraffini (Addgene plasmid # 46569).

    Article Title: Thermostable proteins bioprocesses: The activity of restriction endonuclease-methyltransferase from Thermus thermophilus (RM.TthHB27I) cloned in Escherichia coli is critically affected by the codon composition of the synthetic gene
    Article Snippet: DNA isolation kits (DNA Cleanup Micro Kit, GeneJet Plasmid Miniprep Kit and GeneJET Gel Extraction), DNA size markers (100 bp Plus DNA Ladder, GeneRuler 1 kb DNA Ladder), protein molecular weight standards (PageRuler™ Unstained Broad Range Protein Ladder and Pierce™ Unstained Protein Molecular Weight Marker) were from Thermo Fisher Scientific/Fermentas (Vilnius, Lithuania). .. SalI and BsaI REases were from New England Biolabs (Ipswich, MA, USA).

    Article Title: Efficient Gene Transfer and Gene Editing in Sterlet (Acipenser ruthenus)
    Article Snippet: Oligos were mixed at a final concentration of 10 mM each and heated at 95°C for 5 min, followed by a slow cooling to 37°C. .. Plasmid DR274 (Addgene plasmid 42250) was digested using BsaI (NEB, R0535) and ligated with the paired oligos. .. Then, the ligation mix was transformed into competent E. coli cells.

    Article Title: L-SCRaMbLE as a tool for light-controlled Cre-mediated recombination in yeast
    Article Snippet: To carry out type IIS restriction enzyme-based Golden Gate reactions, 100 ng of Golden Gate acceptor vector plus equimolar amounts of PCR-amplified DNA fragments were mixed together for one-pot digestion-ligation reaction. .. Each reaction included 1.5 µl 10x T4 DNA ligase reaction buffer (New England Biolabs), 0.15 µl 100x bovine serum albumin (New England Biolabs), 600 U T4 DNA ligase (Qiagen, Hilden, Germany), and 10 U of Bsa I (New England Biolabs) in a final volume of 15 µl .

    Article Title: Highly multiplexed genome engineering using CRISPR/Cas9 gRNA arrays
    Article Snippet: Arrays were then generated using golden gate assembly. .. Briefly, 150 ng of each pGG-gRNA plasmid was combined with 150 ng of the appropriate pACPT vector, followed by addition of 1 uL of BsaI (New England BioLabs), 1 uL of T4 DNA Ligase and Buffer (New England BioLabs) and water to a total of 20 uL. .. Golden gate assembly was then carried out using the following thermocycling protocol: ( 37°C 5 minutes, 16°C 10 minutes) x10, 50°C 5 minutes, 80°C for 5 minutes and then cooled to 4°C.

    Article Title: Spliceosome assembly in the absence of stable U4/U6 RNA pairing
    Article Snippet: DNA templates for all 83-nt constructs were prepared through phosphorylation and ligation of complementary, overlapping oligonucleotides (Integrated DNA Technologies) into pUC19 vector (New England Biolabs). .. A BsaI restriction site was included at the end of the template to allow for run-off transcription after digestion with BsaI enzyme (NEB).

    Article Title: Influenza A and B Virus Intertypic Reassortment through Compatible Viral Packaging Signals
    Article Snippet: Influenza B virus ΔHA/GFP plasmid pPolI HA(228)GFP(108) was generated as previously described ( ). .. The B/Yam HA segment was amplified by RT-PCR from RNA isolated from infected MDCK cells and cloned into the human pPolI plasmid using SapI (NEB) and then digested with BglII and BsaI (NEB) to cut 228 nucleotides (nt) from the 3′ end and 108 nt from the 5′ end. .. The product from PCR amplification of GFP using primers flanked by BglII and BsaI was subcloned between these two restriction sites.

    Article Title: A plug-and-play pathway refactoring workflow for natural product research in Escherichia coli and Saccharomyces cerevisiae
    Article Snippet: The reaction condition was as follows: a 20 μL reaction system contained 2 μL 10× T4 DNA Ligase Reaction Buffer (New England Biolabs, Ipswich, MA), 0.8 μL Bsa I (New England Biolabs, Ipswich, MA), 0.2 μL T4 DNA Ligase (M0202T, New England Biolabs, Ipswich, MA), and ddH2 O to 20 μL. .. The reaction condition was as follows: a 20 μL reaction system contained 2 μL 10× T4 DNA Ligase Reaction Buffer (New England Biolabs, Ipswich, MA), 0.8 μL Bsa I (New England Biolabs, Ipswich, MA), 0.2 μL T4 DNA Ligase (M0202T, New England Biolabs, Ipswich, MA), and ddH2 O to 20 μL.

    Article Title:
    Article Snippet: D00-HA was amplified from pIBA2-Int HA453 ( ). .. The PCR products were digested with the enzyme BsaI (enzymes were from New England BioLabs) and ligated into the expression vector pASK-IBA3 (for cytoplasmic production, from IBA GmbH) or pASK-IBA2 (for periplasmic production). .. The ligation mixture was transformed into chemically competent E. coli TOP10 (Invitrogen), and transformants were selected on lysogeny broth (LB) supplemented with 100 μg/ml ampicillin ( ).

    Article Title: EIN2 mediates direct regulation of histone acetylation in the ethylene response
    Article Snippet: Paragraph title: Plasmid Construction. ... All PCR amplifications were carried out using Phusion High-Fidelity DNA Polymerase (BioLabs M0530L). gRNA sequences were cloned into the BsaI (New England Biolabs) site in pRGEB31-dCas9 as previously described ( ).

    Article Title: Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers
    Article Snippet: Ligated TALE domains were assembled into a nuclease-carrying backbone vector using the Golden-Gate method ( ) as applied by ( ). .. 3–5 ng of purified post-elution PCR product (or half of the washed beads using the direct assembly method (see Results)) was added to a 10 -µl reaction containing 1× NEBuffer 4, 1 mM ATP, 0.1 mg/ml BSA, 0.5 µl T7 ligase (Enzymatics), 0.5 µl BsaI (NEB) and 100 ng TALEN backbone plasmid. .. This plasmid is based on the nuclease plasmid of ( ) but modified using PCR and isothermal assembly ( ) to remove the C-terminal 0.5 TALE repeat.

    Software:

    Article Title: Human Campylobacteriosis in Italy: Emergence of Multi-Drug Resistance to Ciprofloxacin, Tetracycline, and Erythromycin
    Article Snippet: The sequences were also analyzed using BLASTN and BLASTP software at the NCBI GenBank sequence database ( ) and compared in silico to those of C. jejuni NCTC11168 strain (GenBank accession n. ), considered as the wild type reference sequences. .. The V region of 23S rRNA gene ( rrnB operon) was amplified by PCR, the amplicons, purified using the ISOLATE II PCR and Gel Kit (Bioline, London, UK) were digested with BsaI (5U) and BceAI (1U) (New England Biolabs, Beverly, UK) restriction enzymes, respectively, as previously described (Vacher et al., ).

    Selection:

    Article Title: Evolutionary optimization of a modular ligase ribozyme: a small catalytic unit and a hairpin motif masking an element that could form an inactive structure
    Article Snippet: Respective PCR products were digested with BsaI (New England Biolabs, Ipswich, MA, USA). .. The resulting ligated DNAs were used as templates for in vitro transcription with T7 RNA polymerase under standard reaction conditions except the nucleotide composition consisted of 1 mM GTP, UTP and CTP, 0.1 mM ATP and 50 mM β-NADH (Sigma, St Louis, MO, USA).

    Article Title: Highly multiplexed genome engineering using CRISPR/Cas9 gRNA arrays
    Article Snippet: Briefly, 150 ng of each pGG-gRNA plasmid was combined with 150 ng of the appropriate pACPT vector, followed by addition of 1 uL of BsaI (New England BioLabs), 1 uL of T4 DNA Ligase and Buffer (New England BioLabs) and water to a total of 20 uL. .. One uL of 25 mM ATP and 1 uL of Plasmid Safe (Epicentre) were then added to the reaction and incubated for 1 hour at 37°C.

    Sample Prep:

    Article Title: Spliceosome assembly in the absence of stable U4/U6 RNA pairing
    Article Snippet: Paragraph title: NMR sample preparation ... A BsaI restriction site was included at the end of the template to allow for run-off transcription after digestion with BsaI enzyme (NEB).

    In Vitro:

    Article Title: Evolutionary optimization of a modular ligase ribozyme: a small catalytic unit and a hairpin motif masking an element that could form an inactive structure
    Article Snippet: Respective PCR products were digested with BsaI (New England Biolabs, Ipswich, MA, USA). .. Respective PCR products were digested with BsaI (New England Biolabs, Ipswich, MA, USA).

    Article Title: Efficient Gene Transfer and Gene Editing in Sterlet (Acipenser ruthenus)
    Article Snippet: Plasmid DR274 (Addgene plasmid 42250) was digested using BsaI (NEB, R0535) and ligated with the paired oligos. .. Plasmid DR274 (Addgene plasmid 42250) was digested using BsaI (NEB, R0535) and ligated with the paired oligos.

    Nuclear Magnetic Resonance:

    Article Title: Spliceosome assembly in the absence of stable U4/U6 RNA pairing
    Article Snippet: Paragraph title: NMR sample preparation ... A BsaI restriction site was included at the end of the template to allow for run-off transcription after digestion with BsaI enzyme (NEB).

    Produced:

    Article Title: Human Campylobacteriosis in Italy: Emergence of Multi-Drug Resistance to Ciprofloxacin, Tetracycline, and Erythromycin
    Article Snippet: The V region of 23S rRNA gene ( rrnB operon) was amplified by PCR, the amplicons, purified using the ISOLATE II PCR and Gel Kit (Bioline, London, UK) were digested with BsaI (5U) and BceAI (1U) (New England Biolabs, Beverly, UK) restriction enzymes, respectively, as previously described (Vacher et al., ). .. The results were interpreted as follows: Digestion by BsaI of the 316-bp amplicon containing the A2075G mutation led to two subproducts of 201 and 115 bp in contrast to the uncut wild type and A2074C amplicons.

    Concentration Assay:

    Article Title: Analysis of Inducible Nitric Oxide Synthase Gene Polymorphisms in Vitiligo in Han Chinese People
    Article Snippet: DNA purity and concentration were determined by spectrophotometric measurement of absorbance at 260 and 280 nm. .. Then we used BsaI and Tsp509I restriction enzymes (New England Biolabs, Beverly, Mass) to delineate the iNOS -954 G →C and Ex 16+14 C →T polymorphisms, respectively.

    Article Title: Efficient Gene Transfer and Gene Editing in Sterlet (Acipenser ruthenus)
    Article Snippet: Oligos were mixed at a final concentration of 10 mM each and heated at 95°C for 5 min, followed by a slow cooling to 37°C. .. Plasmid DR274 (Addgene plasmid 42250) was digested using BsaI (NEB, R0535) and ligated with the paired oligos.

    Article Title: Spliceosome assembly in the absence of stable U4/U6 RNA pairing
    Article Snippet: A BsaI restriction site was included at the end of the template to allow for run-off transcription after digestion with BsaI enzyme (NEB). .. RNA was transcribed in vitro using purified His6 -tagged T7 RNA polymerase ( ) in 40 mM TrisCl [pH 8.0], 1 mM spermidine, 0.01% Triton X-100, and 38 mM MgCl2 .

    DNA Purification:

    Article Title: Human Campylobacteriosis in Italy: Emergence of Multi-Drug Resistance to Ciprofloxacin, Tetracycline, and Erythromycin
    Article Snippet: The amplicons were purified using the Wizard PCR Preps DNA purification system (Promega, Madison, WI, USA) and fully sequenced by fluorescent dye-labeled deoxyribonucletide method with an ABI 3730 automatic DNA sequencer (Perkin-Elmer, Foster City, CA). .. The V region of 23S rRNA gene ( rrnB operon) was amplified by PCR, the amplicons, purified using the ISOLATE II PCR and Gel Kit (Bioline, London, UK) were digested with BsaI (5U) and BceAI (1U) (New England Biolabs, Beverly, UK) restriction enzymes, respectively, as previously described (Vacher et al., ).

    CTG Assay:

    Article Title: Efficient Gene Transfer and Gene Editing in Sterlet (Acipenser ruthenus)
    Article Snippet: A pair of forward (F) and reverse (R) oligos was synthesized using the sequences: F, 5′-TAG GTC AGG GTG GTC ACG AGG G-3′; R, 5′-AAA CCC CTC GTG ACC ACC CTG A-3′. .. Plasmid DR274 (Addgene plasmid 42250) was digested using BsaI (NEB, R0535) and ligated with the paired oligos.

    Gel Extraction:

    Article Title: Thermostable proteins bioprocesses: The activity of restriction endonuclease-methyltransferase from Thermus thermophilus (RM.TthHB27I) cloned in Escherichia coli is critically affected by the codon composition of the synthetic gene
    Article Snippet: DNA isolation kits (DNA Cleanup Micro Kit, GeneJet Plasmid Miniprep Kit and GeneJET Gel Extraction), DNA size markers (100 bp Plus DNA Ladder, GeneRuler 1 kb DNA Ladder), protein molecular weight standards (PageRuler™ Unstained Broad Range Protein Ladder and Pierce™ Unstained Protein Molecular Weight Marker) were from Thermo Fisher Scientific/Fermentas (Vilnius, Lithuania). .. SalI and BsaI REases were from New England Biolabs (Ipswich, MA, USA).

    Variant Assay:

    Article Title: Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli
    Article Snippet: Two 35 bp complementary and slightly offset oligonucleotides (IDT) containing the spacer sequence for dCas9 targeting were phosphorylated with PNK (NEB) and annealed (37°C for 30 min, 98°C for 5 min, ramp down to 25°C over 15 min) to build inserts for each repressor variant. .. Phosphorylated and annealed inserts were individually cloned into recipient plasmid pdCas9 ( ) at two adjacent BsaI sites in the minimal, single-spacer CRISPR array using a one-pot Golden Gate reaction with BsaI (New England BioLabs) and T7 ligase (Epicentre Biotechnologies).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars

  • 84
    New England Biolabs bsa i bsa i hf
    Golden Gate assembly of the expression plasmid in a single reaction. Six donor plasmids and one acceptor plasmid were combined to form each expression plasmid by directional cloning in a restriction-ligation step using the endonuclease <t>Bsa</t> I and T4 DNA ligase. The overhangs produced by Bsa I are colored
    Bsa I Bsa I Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsa i bsa i hf/product/New England Biolabs
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bsa i bsa i hf - by Bioz Stars, 2019-10
    84/100 stars
      Buy from Supplier

    99
    New England Biolabs bsa i hf
    Golden Gate assembly of the expression plasmid in a single reaction. Six donor plasmids and one acceptor plasmid were combined to form each expression plasmid by directional cloning in a restriction-ligation step using the endonuclease <t>Bsa</t> I and T4 DNA ligase. The overhangs produced by Bsa I are colored
    Bsa I Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsa i hf/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    bsa i hf - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Golden Gate assembly of the expression plasmid in a single reaction. Six donor plasmids and one acceptor plasmid were combined to form each expression plasmid by directional cloning in a restriction-ligation step using the endonuclease Bsa I and T4 DNA ligase. The overhangs produced by Bsa I are colored

    Journal: Microbial Cell Factories

    Article Title: A high-throughput expression screening platform to optimize the production of antimicrobial peptides

    doi: 10.1186/s12934-017-0637-5

    Figure Lengend Snippet: Golden Gate assembly of the expression plasmid in a single reaction. Six donor plasmids and one acceptor plasmid were combined to form each expression plasmid by directional cloning in a restriction-ligation step using the endonuclease Bsa I and T4 DNA ligase. The overhangs produced by Bsa I are colored

    Article Snippet: Each Golden Gate cloning reaction required 100 ng of the acceptor plasmid (pJ915-lacZ), 100 ng of each donor plasmid, 2.5 U Bsa I/Bsa I-HF and 300 U T4 DNA ligase (NEB, 2000 U/µL) in a reaction mixture of 15 µL in 1× T4 DNA ligation buffer (NEB).

    Techniques: Expressing, Plasmid Preparation, Clone Assay, Ligation, Produced

    Basic plasmid library for E. coli . The plasmid library consists of 13 donor plasmids, resulting in 27 different expression plasmids. Three promoters (T7/ lac , T5/ lac and araBAD ) were combined with a His 6 tag and either GST or Trx as a fusion partner (or no fusion partner). A thrombin cleavage site was also included in the constructs with a fusion partner. The library includes three AMP genes encoding IMPI, BR021 or the L. sericata antifungal peptide (AFP). The T7 transcriptional terminator was present in all constructs. The chosen Bsa I overhangs are shown above the elements

    Journal: Microbial Cell Factories

    Article Title: A high-throughput expression screening platform to optimize the production of antimicrobial peptides

    doi: 10.1186/s12934-017-0637-5

    Figure Lengend Snippet: Basic plasmid library for E. coli . The plasmid library consists of 13 donor plasmids, resulting in 27 different expression plasmids. Three promoters (T7/ lac , T5/ lac and araBAD ) were combined with a His 6 tag and either GST or Trx as a fusion partner (or no fusion partner). A thrombin cleavage site was also included in the constructs with a fusion partner. The library includes three AMP genes encoding IMPI, BR021 or the L. sericata antifungal peptide (AFP). The T7 transcriptional terminator was present in all constructs. The chosen Bsa I overhangs are shown above the elements

    Article Snippet: Each Golden Gate cloning reaction required 100 ng of the acceptor plasmid (pJ915-lacZ), 100 ng of each donor plasmid, 2.5 U Bsa I/Bsa I-HF and 300 U T4 DNA ligase (NEB, 2000 U/µL) in a reaction mixture of 15 µL in 1× T4 DNA ligation buffer (NEB).

    Techniques: Plasmid Preparation, Expressing, Construct

    Cloning efficiencies for the Golden Gate assembly of different E. coli expression plasmids. Each dot represents one cloning procedure with an individual expression plasmid. There were no significant differences in the cloning efficiencies of the different promoters ( a ), fusion partners ( b ) or proteins ( c ). d Shows the cloning efficiencies for an expression plasmid where two consecutive plasmid features were left out, here the fusion partner and the protease cleavage site. In this case, Golden Gate cloning using two short dummy fragments was compared to a workaround strategy in which one of the neighboring plasmid feature sequences (here for the His 6 tag) carries a Bsa I overhang directly complementary to the plasmid feature “protein of interest” so that no short dummy fragments are needed. As a comparison, the cloning efficiencies for the assembly of the other 18 expression plasmids, which carry all six classes of plasmid features, are also shown

    Journal: Microbial Cell Factories

    Article Title: A high-throughput expression screening platform to optimize the production of antimicrobial peptides

    doi: 10.1186/s12934-017-0637-5

    Figure Lengend Snippet: Cloning efficiencies for the Golden Gate assembly of different E. coli expression plasmids. Each dot represents one cloning procedure with an individual expression plasmid. There were no significant differences in the cloning efficiencies of the different promoters ( a ), fusion partners ( b ) or proteins ( c ). d Shows the cloning efficiencies for an expression plasmid where two consecutive plasmid features were left out, here the fusion partner and the protease cleavage site. In this case, Golden Gate cloning using two short dummy fragments was compared to a workaround strategy in which one of the neighboring plasmid feature sequences (here for the His 6 tag) carries a Bsa I overhang directly complementary to the plasmid feature “protein of interest” so that no short dummy fragments are needed. As a comparison, the cloning efficiencies for the assembly of the other 18 expression plasmids, which carry all six classes of plasmid features, are also shown

    Article Snippet: Each Golden Gate cloning reaction required 100 ng of the acceptor plasmid (pJ915-lacZ), 100 ng of each donor plasmid, 2.5 U Bsa I/Bsa I-HF and 300 U T4 DNA ligase (NEB, 2000 U/µL) in a reaction mixture of 15 µL in 1× T4 DNA ligation buffer (NEB).

    Techniques: Clone Assay, Expressing, Plasmid Preparation

    Golden Gate assembly of the expression plasmid in a single reaction. Six donor plasmids and one acceptor plasmid were combined to form each expression plasmid by directional cloning in a restriction-ligation step using the endonuclease Bsa I and T4 DNA ligase. The overhangs produced by Bsa I are colored

    Journal: Microbial Cell Factories

    Article Title: A high-throughput expression screening platform to optimize the production of antimicrobial peptides

    doi: 10.1186/s12934-017-0637-5

    Figure Lengend Snippet: Golden Gate assembly of the expression plasmid in a single reaction. Six donor plasmids and one acceptor plasmid were combined to form each expression plasmid by directional cloning in a restriction-ligation step using the endonuclease Bsa I and T4 DNA ligase. The overhangs produced by Bsa I are colored

    Article Snippet: The better performance of the wild-type enzyme may be caused by its full activity at 50 °C during the final restriction step, in contrast to the depleted activity of Bsa I-HF (NEB, personal communication).

    Techniques: Expressing, Plasmid Preparation, Clone Assay, Ligation, Produced

    Basic plasmid library for E. coli . The plasmid library consists of 13 donor plasmids, resulting in 27 different expression plasmids. Three promoters (T7/ lac , T5/ lac and araBAD ) were combined with a His 6 tag and either GST or Trx as a fusion partner (or no fusion partner). A thrombin cleavage site was also included in the constructs with a fusion partner. The library includes three AMP genes encoding IMPI, BR021 or the L. sericata antifungal peptide (AFP). The T7 transcriptional terminator was present in all constructs. The chosen Bsa I overhangs are shown above the elements

    Journal: Microbial Cell Factories

    Article Title: A high-throughput expression screening platform to optimize the production of antimicrobial peptides

    doi: 10.1186/s12934-017-0637-5

    Figure Lengend Snippet: Basic plasmid library for E. coli . The plasmid library consists of 13 donor plasmids, resulting in 27 different expression plasmids. Three promoters (T7/ lac , T5/ lac and araBAD ) were combined with a His 6 tag and either GST or Trx as a fusion partner (or no fusion partner). A thrombin cleavage site was also included in the constructs with a fusion partner. The library includes three AMP genes encoding IMPI, BR021 or the L. sericata antifungal peptide (AFP). The T7 transcriptional terminator was present in all constructs. The chosen Bsa I overhangs are shown above the elements

    Article Snippet: The better performance of the wild-type enzyme may be caused by its full activity at 50 °C during the final restriction step, in contrast to the depleted activity of Bsa I-HF (NEB, personal communication).

    Techniques: Plasmid Preparation, Expressing, Construct

    Cloning efficiencies for the Golden Gate assembly of different E. coli expression plasmids. Each dot represents one cloning procedure with an individual expression plasmid. There were no significant differences in the cloning efficiencies of the different promoters ( a ), fusion partners ( b ) or proteins ( c ). d Shows the cloning efficiencies for an expression plasmid where two consecutive plasmid features were left out, here the fusion partner and the protease cleavage site. In this case, Golden Gate cloning using two short dummy fragments was compared to a workaround strategy in which one of the neighboring plasmid feature sequences (here for the His 6 tag) carries a Bsa I overhang directly complementary to the plasmid feature “protein of interest” so that no short dummy fragments are needed. As a comparison, the cloning efficiencies for the assembly of the other 18 expression plasmids, which carry all six classes of plasmid features, are also shown

    Journal: Microbial Cell Factories

    Article Title: A high-throughput expression screening platform to optimize the production of antimicrobial peptides

    doi: 10.1186/s12934-017-0637-5

    Figure Lengend Snippet: Cloning efficiencies for the Golden Gate assembly of different E. coli expression plasmids. Each dot represents one cloning procedure with an individual expression plasmid. There were no significant differences in the cloning efficiencies of the different promoters ( a ), fusion partners ( b ) or proteins ( c ). d Shows the cloning efficiencies for an expression plasmid where two consecutive plasmid features were left out, here the fusion partner and the protease cleavage site. In this case, Golden Gate cloning using two short dummy fragments was compared to a workaround strategy in which one of the neighboring plasmid feature sequences (here for the His 6 tag) carries a Bsa I overhang directly complementary to the plasmid feature “protein of interest” so that no short dummy fragments are needed. As a comparison, the cloning efficiencies for the assembly of the other 18 expression plasmids, which carry all six classes of plasmid features, are also shown

    Article Snippet: The better performance of the wild-type enzyme may be caused by its full activity at 50 °C during the final restriction step, in contrast to the depleted activity of Bsa I-HF (NEB, personal communication).

    Techniques: Clone Assay, Expressing, Plasmid Preparation

    GreenGate vector design and layout. A) The GreenGate cloning system uses six different types of pUC19 based entry vectors into which the individual elements are inserted and a pGreen-IIS based destination vector. Magenta scissors represent Bsa I recognition sites. In each GreenGate reaction, six modules are ligated between the left border (LB) and the right border (RB) sequences of the destination vector yielding a ready-to-use plant transformation vector with expression unit and resistance cassette. These six modules encompass a plant promoter, an N-terminal tag, a coding sequence (i.e. the gene of interest), a C-terminal tag, a plant terminator and a plant resistance cassette for selection of transgenic plants. The modules can only be ligated in the pre-defined order. B) The orderly assembly is enabled by a set of seven different overhangs. Each module is flanked at its 5′-end by the same overhang as the 3′-end of its preceding neighbor. The individual overhangs all differ from each other by at least two out of the four nucleotides. The underlined nucleotides define coding triplets to which all other coding elements have to be in frame. C) Empty entry vector. The multiple cloning site of pUC19 has been replaced by two Bsa I recognition sites (magenta scissors), the respective overhangs for each module type and a counter-selectable ccdB gene. DNA fragments can be cloned via the specific overhangs, via the Bam HI and Kpn I sites or via A-overhangs after Xcm I digestion. Plac = lac promoter, SP6 = SP6 promoter, caR = chloramphenicol acetyltransferase gene, T7 = T7 promoter, lacZ = lacZα coding sequence, ampR = beta-lactamase gene, ori = origin of replication. D) Empty destination vector. A counter-selectable ccdB -cassette has been inserted between the LB and RB sequences of pGreen-IIS, flanked by Bsa I sites, with overhangs A and G. promoter = bacterial promoter. The pSa origin of replication ( ori A. tum. ) requires the presence of the helper plasmid pSOUP in agrobacteria.

    Journal: PLoS ONE

    Article Title: GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis

    doi: 10.1371/journal.pone.0083043

    Figure Lengend Snippet: GreenGate vector design and layout. A) The GreenGate cloning system uses six different types of pUC19 based entry vectors into which the individual elements are inserted and a pGreen-IIS based destination vector. Magenta scissors represent Bsa I recognition sites. In each GreenGate reaction, six modules are ligated between the left border (LB) and the right border (RB) sequences of the destination vector yielding a ready-to-use plant transformation vector with expression unit and resistance cassette. These six modules encompass a plant promoter, an N-terminal tag, a coding sequence (i.e. the gene of interest), a C-terminal tag, a plant terminator and a plant resistance cassette for selection of transgenic plants. The modules can only be ligated in the pre-defined order. B) The orderly assembly is enabled by a set of seven different overhangs. Each module is flanked at its 5′-end by the same overhang as the 3′-end of its preceding neighbor. The individual overhangs all differ from each other by at least two out of the four nucleotides. The underlined nucleotides define coding triplets to which all other coding elements have to be in frame. C) Empty entry vector. The multiple cloning site of pUC19 has been replaced by two Bsa I recognition sites (magenta scissors), the respective overhangs for each module type and a counter-selectable ccdB gene. DNA fragments can be cloned via the specific overhangs, via the Bam HI and Kpn I sites or via A-overhangs after Xcm I digestion. Plac = lac promoter, SP6 = SP6 promoter, caR = chloramphenicol acetyltransferase gene, T7 = T7 promoter, lacZ = lacZα coding sequence, ampR = beta-lactamase gene, ori = origin of replication. D) Empty destination vector. A counter-selectable ccdB -cassette has been inserted between the LB and RB sequences of pGreen-IIS, flanked by Bsa I sites, with overhangs A and G. promoter = bacterial promoter. The pSa origin of replication ( ori A. tum. ) requires the presence of the helper plasmid pSOUP in agrobacteria.

    Article Snippet: We found both Bsa I-HF from NewEngland Biolabs, as well as the isoschizomer FastDigest Eco 31I from Fermentas to be highly sensitive to temperature fluctuations in a batch dependent manner.

    Techniques: Plasmid Preparation, Clone Assay, Transformation Assay, Expressing, Sequencing, Selection, Transgenic Assay

    Multiple expression cassettes on a single T-DNA. A) The first strategy uses one additional overhang (“H” = TAGG), two adapter modules and two intermediate vectors. In a first step, two expression cassettes (“supermodules”) are assembled in parallel in two different intermediate vectors (pGGM000 and pGGN000). The Bsa I sites in the intermediate vectors are retained in the supermodule. In the second step, these two supermodules are then transferred into a destination vector via a normal GreenGate reaction. The overhang types are given in capital letters. p1/2 = promoter, n1/2 = N-terminal tag, cds1/2 = coding sequence, c1/2 = C-terminal tag, t1/2 = terminator, r1 = plant resistance, ad.1 = FH-adapter module, ad.2 = HA-adapter module. B) Fluorescence microscopy images show Nicotiana benthamiana leaves infiltrated with a construct harboring two expression cassettes on one T-DNA created via this method. The images were taken 72 hours after infiltration and 24 hours after ethanol induction (picture on the right). The first transcriptional unit drives constitutive expression of the ALCR transcription factor ( pUBQ10:B-dummy-ALCR-D-dummy:tRBCS ; pMAS:sulfR:t35S ), the second one ( pALCA:Ω-element-GFP-NLS-D-dummy:tRBCS ) of nuclear localized GFP in presence of ethanol-bound ALCR protein. C) Only one additional element is required for the second strategy. Instead of a plant resistance cassette module, the FH-adapter module from strategy #1 and an oligo duplex (orange) with unpaired H and G overhangs are used in the GreenGate reaction. The oligo duplex contains internal Bsa I sites that would result in A and G overhangs after digestion. However, digestion is blocked by methylation of the cytosine residues in the Bsa I recognition sites, since Bsa I is sensitive to methylation. After transformation of the resulting construct into bacteria, the methylation is lost during replication because no dcm site is present. Thus, after re-isolation from bacteria, the plasmid, already containing one expression cassette, can function as an empty GreenGate destination vector, releasing A and G overhangs after digestion by Bsa I and removal of the Bsa I recognition sites from the vector backbone. This process can in principle be re-iterated infinitely. The construct is finalized by using a standard plant resistance module in the last step. D) N. benthamiana leaves infiltrated with a destination vector (pTL019) carrying three transcriptional units assembled by this method. The fluorescence signal from all three individual expression cassettes, i.e. nuclear localized BFP (left), ER-localized GFP (second from left) and nuclear localized mCherry (third from left), is visible in all transformed cells. Merge shown on the right.

    Journal: PLoS ONE

    Article Title: GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis

    doi: 10.1371/journal.pone.0083043

    Figure Lengend Snippet: Multiple expression cassettes on a single T-DNA. A) The first strategy uses one additional overhang (“H” = TAGG), two adapter modules and two intermediate vectors. In a first step, two expression cassettes (“supermodules”) are assembled in parallel in two different intermediate vectors (pGGM000 and pGGN000). The Bsa I sites in the intermediate vectors are retained in the supermodule. In the second step, these two supermodules are then transferred into a destination vector via a normal GreenGate reaction. The overhang types are given in capital letters. p1/2 = promoter, n1/2 = N-terminal tag, cds1/2 = coding sequence, c1/2 = C-terminal tag, t1/2 = terminator, r1 = plant resistance, ad.1 = FH-adapter module, ad.2 = HA-adapter module. B) Fluorescence microscopy images show Nicotiana benthamiana leaves infiltrated with a construct harboring two expression cassettes on one T-DNA created via this method. The images were taken 72 hours after infiltration and 24 hours after ethanol induction (picture on the right). The first transcriptional unit drives constitutive expression of the ALCR transcription factor ( pUBQ10:B-dummy-ALCR-D-dummy:tRBCS ; pMAS:sulfR:t35S ), the second one ( pALCA:Ω-element-GFP-NLS-D-dummy:tRBCS ) of nuclear localized GFP in presence of ethanol-bound ALCR protein. C) Only one additional element is required for the second strategy. Instead of a plant resistance cassette module, the FH-adapter module from strategy #1 and an oligo duplex (orange) with unpaired H and G overhangs are used in the GreenGate reaction. The oligo duplex contains internal Bsa I sites that would result in A and G overhangs after digestion. However, digestion is blocked by methylation of the cytosine residues in the Bsa I recognition sites, since Bsa I is sensitive to methylation. After transformation of the resulting construct into bacteria, the methylation is lost during replication because no dcm site is present. Thus, after re-isolation from bacteria, the plasmid, already containing one expression cassette, can function as an empty GreenGate destination vector, releasing A and G overhangs after digestion by Bsa I and removal of the Bsa I recognition sites from the vector backbone. This process can in principle be re-iterated infinitely. The construct is finalized by using a standard plant resistance module in the last step. D) N. benthamiana leaves infiltrated with a destination vector (pTL019) carrying three transcriptional units assembled by this method. The fluorescence signal from all three individual expression cassettes, i.e. nuclear localized BFP (left), ER-localized GFP (second from left) and nuclear localized mCherry (third from left), is visible in all transformed cells. Merge shown on the right.

    Article Snippet: We found both Bsa I-HF from NewEngland Biolabs, as well as the isoschizomer FastDigest Eco 31I from Fermentas to be highly sensitive to temperature fluctuations in a batch dependent manner.

    Techniques: Expressing, Plasmid Preparation, Sequencing, Hemagglutination Assay, Fluorescence, Microscopy, Construct, Methylation, Transformation Assay, Isolation

    The Golden Gate principle. A) Type IIS restriction endonucleases, such as Bsa I, have a distinct, non-palindromic recognition site (red) and asymmetrically cut at a precisely defined distance regardless of the local sequence (green). Bsa I for instance creates a four base 5′-overhang starting from the second nucleotide downstream of the recognition site. B) A Golden Gate style cloning system requires two types of components, a destination vector and entry vectors containing the modules to be assembled. Each vector carries two recognition sites for the type IIS endonuclease (red) flanking the counter-selective marker on the destination vector and the modules on the entry vectors, respectively. Destination and entry vectors confer different markers for bacterial selection. The sequences in purple, blue and green represent the cutting sites. C) The orientation and position of the recognition sites is such that after digestion they remain with the backbone of the entry vectors, but are excised from the destination vector along with the counter-selectable marker ( ccdB ). D) The single stranded overhangs generated by the endonuclease can anneal to complementary sequences and be covalently linked by T4 DNA ligase. During the Golden Gate reaction in the presence of endonuclease and ligase the desired final product, but also the original vectors or a plethora of side-products (one of them shown at the bottom) can be created. However, only the desired final product is resistant to further endonucleolytic cleavage, whereas all other molecules will be cut again and again and thus will disappear from the reaction over time.

    Journal: PLoS ONE

    Article Title: GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis

    doi: 10.1371/journal.pone.0083043

    Figure Lengend Snippet: The Golden Gate principle. A) Type IIS restriction endonucleases, such as Bsa I, have a distinct, non-palindromic recognition site (red) and asymmetrically cut at a precisely defined distance regardless of the local sequence (green). Bsa I for instance creates a four base 5′-overhang starting from the second nucleotide downstream of the recognition site. B) A Golden Gate style cloning system requires two types of components, a destination vector and entry vectors containing the modules to be assembled. Each vector carries two recognition sites for the type IIS endonuclease (red) flanking the counter-selective marker on the destination vector and the modules on the entry vectors, respectively. Destination and entry vectors confer different markers for bacterial selection. The sequences in purple, blue and green represent the cutting sites. C) The orientation and position of the recognition sites is such that after digestion they remain with the backbone of the entry vectors, but are excised from the destination vector along with the counter-selectable marker ( ccdB ). D) The single stranded overhangs generated by the endonuclease can anneal to complementary sequences and be covalently linked by T4 DNA ligase. During the Golden Gate reaction in the presence of endonuclease and ligase the desired final product, but also the original vectors or a plethora of side-products (one of them shown at the bottom) can be created. However, only the desired final product is resistant to further endonucleolytic cleavage, whereas all other molecules will be cut again and again and thus will disappear from the reaction over time.

    Article Snippet: We found both Bsa I-HF from NewEngland Biolabs, as well as the isoschizomer FastDigest Eco 31I from Fermentas to be highly sensitive to temperature fluctuations in a batch dependent manner.

    Techniques: Sequencing, Clone Assay, Plasmid Preparation, Marker, Selection, Generated