Structured Review

Agilent technologies brilliant iii sybr green qpcr master mix
Sequence recognition by MAX/MGA is critical for recruiting PCGF6-PRC1 to its target genes. ( A ) MAX-dependent proliferation of ESCs. Schematic representation of FLAG-tagged wild type (WT) and mutant [L31V and E32D substitution (VD) and basic region deletion (Δb)] MAX proteins (left). Failure to rescue growth defects of Max -KO ESCs by either mutant MAX. Mock-transfected Max conditional KO ESCs (WT) stopped growing 4 days after doxycycline treatment (KO) (right). Stable expression of FLAG-tagged WT [KO+MAX(WT)] rescued the growth defect but VD or Δb mutants [KO+MAX(VD) and KO+MAX(Δb)] did not. ( B ) Association of mutant MAX proteins with other components of the PCGF6-PRC1 complex. Immunoprecipitation-immunoblot (IP-IB) analysis revealed the association of FLAG-tagged MAX WT, VD or Δb with HA-tagged PCGF6, RING1B and L3MBTL2. Max -KO ESCs that expressed HA-tagged PCGF6 and FLAG-tagged wild type or mutant MAX were subjected to IP with anti-FLAG antibody. Resulting precipitates (IP) and lysates (Input) were immunoblotted with antibodies against FLAG, HA, RING1B or L3MBTL2. ( C ) Binding of FLAG-tagged WT or mutant MAX to target of ChIPed DNA is depicted as a percentage of input DNA. Error bars represent standard deviation determined from at least <t>three</t> independent experiments. ( D ) Binding of HA-tagged genes in Max -KO ESCs. Local levels of FLAG-tagged WT or mutant MAX at Ddx4 or Tdrd1 promoter regions were determined by <t>ChIP-qPCR.</t> The relative amount PCGF6 to target genes in Max -KO ESCs that express WT or mutant MAX. Local levels of HA-tagged PCGF6 at Ddx4 or Tdrd1 promoter regions were determined by ChIP-qPCR. ( E ) Forced tethering of MAX to a TetO array induced activation of PCGF6-PRC1 recruitment. ChIP analysis for TetR, HA-tag (PCGF6), H2AK119ub1, H3K27me3, H3K27ac and H3 across the TetO-containing locus in ESCs revealed TetR-MAX-mediated local activation of the PCGF6-PRC1 pathway. ChIP experiments were performed at least in biological duplicate with error bars showing SEM. DOI: http://dx.doi.org/10.7554/eLife.21064.011
Brilliant Iii Sybr Green Qpcr Master Mix, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 99/100, based on 58 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/brilliant iii sybr green qpcr master mix/product/Agilent technologies
Average 99 stars, based on 58 article reviews
Price from $9.99 to $1999.99
brilliant iii sybr green qpcr master mix - by Bioz Stars, 2020-02
99/100 stars

Images

1) Product Images from "PCGF6-PRC1 suppresses premature differentiation of mouse embryonic stem cells by regulating germ cell-related genes"

Article Title: PCGF6-PRC1 suppresses premature differentiation of mouse embryonic stem cells by regulating germ cell-related genes

Journal: eLife

doi: 10.7554/eLife.21064

Sequence recognition by MAX/MGA is critical for recruiting PCGF6-PRC1 to its target genes. ( A ) MAX-dependent proliferation of ESCs. Schematic representation of FLAG-tagged wild type (WT) and mutant [L31V and E32D substitution (VD) and basic region deletion (Δb)] MAX proteins (left). Failure to rescue growth defects of Max -KO ESCs by either mutant MAX. Mock-transfected Max conditional KO ESCs (WT) stopped growing 4 days after doxycycline treatment (KO) (right). Stable expression of FLAG-tagged WT [KO+MAX(WT)] rescued the growth defect but VD or Δb mutants [KO+MAX(VD) and KO+MAX(Δb)] did not. ( B ) Association of mutant MAX proteins with other components of the PCGF6-PRC1 complex. Immunoprecipitation-immunoblot (IP-IB) analysis revealed the association of FLAG-tagged MAX WT, VD or Δb with HA-tagged PCGF6, RING1B and L3MBTL2. Max -KO ESCs that expressed HA-tagged PCGF6 and FLAG-tagged wild type or mutant MAX were subjected to IP with anti-FLAG antibody. Resulting precipitates (IP) and lysates (Input) were immunoblotted with antibodies against FLAG, HA, RING1B or L3MBTL2. ( C ) Binding of FLAG-tagged WT or mutant MAX to target of ChIPed DNA is depicted as a percentage of input DNA. Error bars represent standard deviation determined from at least three independent experiments. ( D ) Binding of HA-tagged genes in Max -KO ESCs. Local levels of FLAG-tagged WT or mutant MAX at Ddx4 or Tdrd1 promoter regions were determined by ChIP-qPCR. The relative amount PCGF6 to target genes in Max -KO ESCs that express WT or mutant MAX. Local levels of HA-tagged PCGF6 at Ddx4 or Tdrd1 promoter regions were determined by ChIP-qPCR. ( E ) Forced tethering of MAX to a TetO array induced activation of PCGF6-PRC1 recruitment. ChIP analysis for TetR, HA-tag (PCGF6), H2AK119ub1, H3K27me3, H3K27ac and H3 across the TetO-containing locus in ESCs revealed TetR-MAX-mediated local activation of the PCGF6-PRC1 pathway. ChIP experiments were performed at least in biological duplicate with error bars showing SEM. DOI: http://dx.doi.org/10.7554/eLife.21064.011
Figure Legend Snippet: Sequence recognition by MAX/MGA is critical for recruiting PCGF6-PRC1 to its target genes. ( A ) MAX-dependent proliferation of ESCs. Schematic representation of FLAG-tagged wild type (WT) and mutant [L31V and E32D substitution (VD) and basic region deletion (Δb)] MAX proteins (left). Failure to rescue growth defects of Max -KO ESCs by either mutant MAX. Mock-transfected Max conditional KO ESCs (WT) stopped growing 4 days after doxycycline treatment (KO) (right). Stable expression of FLAG-tagged WT [KO+MAX(WT)] rescued the growth defect but VD or Δb mutants [KO+MAX(VD) and KO+MAX(Δb)] did not. ( B ) Association of mutant MAX proteins with other components of the PCGF6-PRC1 complex. Immunoprecipitation-immunoblot (IP-IB) analysis revealed the association of FLAG-tagged MAX WT, VD or Δb with HA-tagged PCGF6, RING1B and L3MBTL2. Max -KO ESCs that expressed HA-tagged PCGF6 and FLAG-tagged wild type or mutant MAX were subjected to IP with anti-FLAG antibody. Resulting precipitates (IP) and lysates (Input) were immunoblotted with antibodies against FLAG, HA, RING1B or L3MBTL2. ( C ) Binding of FLAG-tagged WT or mutant MAX to target of ChIPed DNA is depicted as a percentage of input DNA. Error bars represent standard deviation determined from at least three independent experiments. ( D ) Binding of HA-tagged genes in Max -KO ESCs. Local levels of FLAG-tagged WT or mutant MAX at Ddx4 or Tdrd1 promoter regions were determined by ChIP-qPCR. The relative amount PCGF6 to target genes in Max -KO ESCs that express WT or mutant MAX. Local levels of HA-tagged PCGF6 at Ddx4 or Tdrd1 promoter regions were determined by ChIP-qPCR. ( E ) Forced tethering of MAX to a TetO array induced activation of PCGF6-PRC1 recruitment. ChIP analysis for TetR, HA-tag (PCGF6), H2AK119ub1, H3K27me3, H3K27ac and H3 across the TetO-containing locus in ESCs revealed TetR-MAX-mediated local activation of the PCGF6-PRC1 pathway. ChIP experiments were performed at least in biological duplicate with error bars showing SEM. DOI: http://dx.doi.org/10.7554/eLife.21064.011

Techniques Used: Sequencing, Mutagenesis, Transfection, Expressing, Immunoprecipitation, Binding Assay, Standard Deviation, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Activation Assay

The role of MAX/MGA in recruiting PCGF6-PRC1 to its target genes. ( A ) The expression of FLAG-tagged exogenous PCGF6 in wild type (WT) and Eed -KO ESCs. Expression levels of FLAG-tagged PCGF6 and endogenous LAMIN B protein in wild type and Eed -KO ESCs mock or FLAG-PCGF6 construct transfected were tested by immunoblotting. ( B ) Local levels of FLAG at the indicated promoter regions in wild type or Eed -KO ESCs expressing FLAG-tagged PCGF6 were determined by ChIP-qPCR analysis. Underlined genes are canonical PRC1 targets. The relative amount of ChIPed DNA is depicted as a percentage of input DNA. Error bars represent standard deviation determined from at least three independent experiments. ( C ) ChIP-qPCR showing a marginal binding of canonical PRC1 (cPRC1; PCGF2) to PCGF6-bound genes with high H3K27me3 (PCGF6 +H3K27me3+/hi) and those with low H3K27me3 (PCGF6 +H3K27me3-/lo) in wild type (WT) ESCs. Eed -KO ESCs were used to confirm whether H3K27me3-dependent recruitment of cPRC1 is active at indicated gene locus. NC: negative control. ( D ) Top four de novo motif recognition hits for genes bound by PCGF6, RING1B, CBX7 (NCBI GEO accession number GSM1041373), MAX (NCBI GEO accession number GSM1171650) or MYC (NCBI GEO accession number GSM1171648) in wild type ESCs. ( E ) Expression levels of Max and Mga in untreated ESCs or those treated with control, Max siRNA or Mga siRNA revealed by RT-qPCR analysis (left). Transcription levels were normalized to a Gapdh control and are depicted as fold change relative to untreated ESCs. Error bars represent standard deviation determined from at least three independent experiments. Expression levels of FLAG-PCGF6, MAX, LAMIN B and RING1B in whole cell lysates of untreated and siRNA-treated ESCs are also shown (right). ( F ) Expression levels of the indicated genes in untreated ESCs or those treated either with control, Max siRNA or Mga siRNA. Underlined genes are canonical PRC1 targets. Expression levels were normalized to a Gapdh control and are depicted as fold change relative to mock ESCs (No treatment). Error bars represent standard deviation determined from at least three independent experiments. ( G ) Gene ontology (GO) term analysis showing that genes related to meiotic process are highly overrepresented among PCGF6+RING1B+MAX+MYC- genes. Genes were classified based on binding by PCGF6, RING1B, MAX and/or MYC and the enrichment of respective GO terms in each subset of genes was determined. The p -values for the significance of over-representation against total genes are shown along the x-axis. ( H ) Changes in local PCGF6 and MAX deposition at selected PCGF6/MAX co-bound gene that do not become de-repressed in Max -KO ESCs were determined by ChIP-qPCR using Max -KO ESCs stably expressing both an HA-tagged Pcgf6 and a Flag-tagged Max (WT or Δb) expression vectors, and are shown as described in Figure 2C . DOI: http://dx.doi.org/10.7554/eLife.21064.010
Figure Legend Snippet: The role of MAX/MGA in recruiting PCGF6-PRC1 to its target genes. ( A ) The expression of FLAG-tagged exogenous PCGF6 in wild type (WT) and Eed -KO ESCs. Expression levels of FLAG-tagged PCGF6 and endogenous LAMIN B protein in wild type and Eed -KO ESCs mock or FLAG-PCGF6 construct transfected were tested by immunoblotting. ( B ) Local levels of FLAG at the indicated promoter regions in wild type or Eed -KO ESCs expressing FLAG-tagged PCGF6 were determined by ChIP-qPCR analysis. Underlined genes are canonical PRC1 targets. The relative amount of ChIPed DNA is depicted as a percentage of input DNA. Error bars represent standard deviation determined from at least three independent experiments. ( C ) ChIP-qPCR showing a marginal binding of canonical PRC1 (cPRC1; PCGF2) to PCGF6-bound genes with high H3K27me3 (PCGF6 +H3K27me3+/hi) and those with low H3K27me3 (PCGF6 +H3K27me3-/lo) in wild type (WT) ESCs. Eed -KO ESCs were used to confirm whether H3K27me3-dependent recruitment of cPRC1 is active at indicated gene locus. NC: negative control. ( D ) Top four de novo motif recognition hits for genes bound by PCGF6, RING1B, CBX7 (NCBI GEO accession number GSM1041373), MAX (NCBI GEO accession number GSM1171650) or MYC (NCBI GEO accession number GSM1171648) in wild type ESCs. ( E ) Expression levels of Max and Mga in untreated ESCs or those treated with control, Max siRNA or Mga siRNA revealed by RT-qPCR analysis (left). Transcription levels were normalized to a Gapdh control and are depicted as fold change relative to untreated ESCs. Error bars represent standard deviation determined from at least three independent experiments. Expression levels of FLAG-PCGF6, MAX, LAMIN B and RING1B in whole cell lysates of untreated and siRNA-treated ESCs are also shown (right). ( F ) Expression levels of the indicated genes in untreated ESCs or those treated either with control, Max siRNA or Mga siRNA. Underlined genes are canonical PRC1 targets. Expression levels were normalized to a Gapdh control and are depicted as fold change relative to mock ESCs (No treatment). Error bars represent standard deviation determined from at least three independent experiments. ( G ) Gene ontology (GO) term analysis showing that genes related to meiotic process are highly overrepresented among PCGF6+RING1B+MAX+MYC- genes. Genes were classified based on binding by PCGF6, RING1B, MAX and/or MYC and the enrichment of respective GO terms in each subset of genes was determined. The p -values for the significance of over-representation against total genes are shown along the x-axis. ( H ) Changes in local PCGF6 and MAX deposition at selected PCGF6/MAX co-bound gene that do not become de-repressed in Max -KO ESCs were determined by ChIP-qPCR using Max -KO ESCs stably expressing both an HA-tagged Pcgf6 and a Flag-tagged Max (WT or Δb) expression vectors, and are shown as described in Figure 2C . DOI: http://dx.doi.org/10.7554/eLife.21064.010

Techniques Used: Expressing, Construct, Transfection, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Standard Deviation, Binding Assay, Negative Control, Quantitative RT-PCR, Stable Transfection

Related Articles

Amplification:

Article Title: Hepatic PPARγ Is Not Essential for the Rapid Development of Steatosis After Loss of Hepatic GH Signaling, in Adult Male Mice
Article Snippet: .. Resulting cDNA was amplified in a MxPro 3000P quantitative polymerase chain reaction (qPCR) system (Agilent Technologies, Inc) by quantitative real-time PCR, using Brilliant III SYBR green QPCR Master Mix (Agilent Technologies, Inc). .. Primers were selected that amplified 100- to 250-bp targets and displayed no autocomplementation or nonspecific amplifications (assessed by sequencing and melting curves). qPCR primer sequences were reported previously ( , ).

Article Title: Suppression of the activity of arbuscular mycorrhizal fungi by the soil microbiota
Article Snippet: .. Reactions were carried out with 1× Brilliant III SYBR Green QPCR Master Mix (Agilent Technologies, USA), 0.4 µM of each primer and 1 mg ml−1 bovine serum albumin under thermal cycling conditions: 95 °C for 3 min followed by 35 cycles of 95 °C for 15 s and 57 °C for 20 s. Illumina MiSeq 300 bp paired-end sequencing of the hypervariable V3-V4 regions of the 16S rRNA gene, amplified with primers Bakt_341F and Bakt_805R (from ref. [ ]) was performed on the extracted DNA by Macrogen Inc. (Seoul, Rep. of Korea). .. Sequencing of soil DNA from Expt.

Article Title: Pospiviroid Infection of Tomato Regulates the Expression of Genes Involved in Flower and Fruit Development
Article Snippet: .. The amplification reactions were performed using Brilliant® III SYBR® Green qPCR Master Mix (Agilent Technologies) on the Mx3000P Real-Time System (Stratagene, La Jolla, CA, USA). .. Each qPCR reaction contained 10 μL of 2× Brilliant® SYBR® Green III qPCR Master Mix, 1 μL of the diluted cDNA, and 2.5 pM of each gene-specific primer.

DNA Synthesis:

Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
Article Snippet: Paragraph title: RNA extraction, c DNA synthesis, and q PCR ... Briefly, total RNA was extracted with the RNeasy Plant Mini kit (Qiagen) and DNase treated (DNA‐free; Ambion). cDNA was typically synthesized from 1 μg of total RNA using random hexamers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific U.K. Ltd., Loughborough, U.K.) real‐time PCR system.

Synthesized:

Article Title: Cold-Dependent Expression and Alternative Splicing of Arabidopsis Long Non-coding RNAs
Article Snippet: Complementary DNA (cDNA) was synthesized from 2 μg of total RNA using oligo dT primers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). .. Each reaction (1:100 dilution of cDNA) was performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific-UK Ltd., Loughborough, United Kingdom) real-time PCR system.

Article Title: How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY), et al. How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY)
Article Snippet: .. Complementary DNA (cDNA) was typically synthesized from 2 μg of total RNA using oligo dT primers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system. .. The average Ct values for PP2A (At1g13320) and IPP2 (At3g02780) were used as internal control expression levels.

Article Title: Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection
Article Snippet: Real-time quantitative RT-PCR analysis Whole flies were homogenized in TRIzol reagent, followed by RNA extraction. cDNA was synthesized using MMulV Reverse Transcriptase (New England Biolab) with random hexamer primers (Integrated DNA Technologies). .. Quantitative RT-PCR analyses were performed using Brilliant III SYBR green QPCR master mix (Agilent) with gene-specific primers according to the manufacturer's protocol and with the Applied Bioscience StepOnePlus qRT-PCR machine (Life Technologies).

Article Title: Organ specificity in the plant circadian system is explained by different light inputs to the shoot and root clocks
Article Snippet: .. Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using oligo dT and SuperScript II reverse transcriptase (Invitrogen). qPCR reactions were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a Mx3000P (Agilent Technologies Ltd, Stockport, UK) or a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system. .. IRON SULFUR CLUSTER ASSEMBLY PROTEIN 1 (ISU1 , At4G22220) was used as the reference gene as its expression has been shown not to cycle over a range of conditions (Michael et al ., ).

Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
Article Snippet: .. Briefly, total RNA was extracted with the RNeasy Plant Mini kit (Qiagen) and DNase treated (DNA‐free; Ambion). cDNA was typically synthesized from 1 μg of total RNA using random hexamers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific U.K. Ltd., Loughborough, U.K.) real‐time PCR system. .. The average Ct values for PP2A (At1g13320, primers PP2A‐f2; 5′‐TAACGTGGCCAAAATGATGC‐3′ and PP2A‐r2; 5′‐GTTCTCCACAACCGCTTGGT‐3′) was used as internal control for expression levels.

Article Title: An Antiviral Role for Antimicrobial Peptides during the Arthropod Response to Alphavirus Replication
Article Snippet: Flies were homogenized in TRIzol reagent, followed by RNA extraction. cDNA was synthesized used AffinityScript QPCR cDNA synthesis kit (Agilent, Santa Clara, CA) with random hexamer primers. .. Quantitative RT-PCRs (qRT-PCRs) were prepared using Brilliant III SYBR green QPCR master mix (Agilent) with gene-specific primers according to the manufacturer's protocol and with the Applied Bioscience StepOnePlus qRT-PCR machine (Life Technologies).

Quantitative RT-PCR:

Article Title: Cold-Dependent Expression and Alternative Splicing of Arabidopsis Long Non-coding RNAs
Article Snippet: Paragraph title: Quantitative Reverse Transcription RT-PCR (RT-qPCR) ... Each reaction (1:100 dilution of cDNA) was performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific-UK Ltd., Loughborough, United Kingdom) real-time PCR system.

Article Title: How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY), et al. How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY)
Article Snippet: 2.2 RNA extraction, cDNA synthesis, RT‐PCR, and qPCR RNA extraction, cDNA synthesis, and qPCR (RT‐qPCR) were performed essentially as described previously (James et al., ; James, Syed, Bordage, et al., ). .. Complementary DNA (cDNA) was typically synthesized from 2 μg of total RNA using oligo dT primers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system.

Article Title: Embryonic Stem Cells Derived Kidney Organoids as Faithful Models to Target Programmed Nephrogenesis
Article Snippet: An RNeasy kit (Qiagen) was used according to the manufacturer’s recommendations to extract the total RNA. cDNA synthesis (First Strand cDNA Synthesis Kit, ThermoFisher) was performed using standard protocols. qRT-PCR analyses were displayed with SYBR Green (Agilent) by an CFX96 Real-Time PCR machine. .. The Brilliant III SYBR® Green QPCR Master Mix (Agilent Technologies) was used according to the manufacturer’s instructions.

Article Title: Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection
Article Snippet: .. Quantitative RT-PCR analyses were performed using Brilliant III SYBR green QPCR master mix (Agilent) with gene-specific primers according to the manufacturer's protocol and with the Applied Bioscience StepOnePlus qRT-PCR machine (Life Technologies). .. The expression levels were normalized to the endogenous 18S rRNA expression using the delta-delta comparative threshold method (ΔΔCT).

Article Title: Organ specificity in the plant circadian system is explained by different light inputs to the shoot and root clocks
Article Snippet: Paragraph title: RNA extraction and quantification by RT‐qPCR ... Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using oligo dT and SuperScript II reverse transcriptase (Invitrogen). qPCR reactions were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a Mx3000P (Agilent Technologies Ltd, Stockport, UK) or a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system.

Article Title: RNA immunoprecipitation identifies novel targets of DAZL in human foetal ovary
Article Snippet: Paragraph title: RNA extraction, cDNA synthesis and quantitative RT-PCR ... Each reaction was performed in a final volume of 10 µl, with 1× Brilliant III SYBR Green qPCR Master Mix (Agilent, Santa Clara, CA, USA), 20 pmol of each primer and 2 µl of diluted cDNA.

Article Title: An Antiviral Role for Antimicrobial Peptides during the Arthropod Response to Alphavirus Replication
Article Snippet: .. Quantitative RT-PCRs (qRT-PCRs) were prepared using Brilliant III SYBR green QPCR master mix (Agilent) with gene-specific primers according to the manufacturer's protocol and with the Applied Bioscience StepOnePlus qRT-PCR machine (Life Technologies). .. The expression levels were normalized to the 18S rRNA expression using the delta delta comparative threshold method (ΔΔ CT ).

Real-time Polymerase Chain Reaction:

Article Title: PCGF6-PRC1 suppresses premature differentiation of mouse embryonic stem cells by regulating germ cell-related genes
Article Snippet: .. Real-time qPCR was performed using the Brilliant III SYBR Green QPCR Master Mix (Agilent). .. For H2AK119u1-ChIP using E6C5 (Millipore #05–678), pre-cleared chromatin from 2–3 × 106 cells was incubated with 40 ul of E6C5 antibody (Millipore #05–678) (overnight, 4°C), and 30 ul of original Protein A dynabead slurry (Invitrogen) was incubated with 3 ug (=3 ul) of rabbit anti-mouse IgM antibody (Millipore #12–488) (overnight, 4°C).

Article Title: Hepatic PPARγ Is Not Essential for the Rapid Development of Steatosis After Loss of Hepatic GH Signaling, in Adult Male Mice
Article Snippet: .. Resulting cDNA was amplified in a MxPro 3000P quantitative polymerase chain reaction (qPCR) system (Agilent Technologies, Inc) by quantitative real-time PCR, using Brilliant III SYBR green QPCR Master Mix (Agilent Technologies, Inc). .. Primers were selected that amplified 100- to 250-bp targets and displayed no autocomplementation or nonspecific amplifications (assessed by sequencing and melting curves). qPCR primer sequences were reported previously ( , ).

Article Title: Cold-Dependent Expression and Alternative Splicing of Arabidopsis Long Non-coding RNAs
Article Snippet: .. Each reaction (1:100 dilution of cDNA) was performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific-UK Ltd., Loughborough, United Kingdom) real-time PCR system. .. The average Ct values for IPP2 (AT3G02780) were used as internal control expression levels.

Article Title: How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY), et al. How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY)
Article Snippet: .. Complementary DNA (cDNA) was typically synthesized from 2 μg of total RNA using oligo dT primers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system. .. The average Ct values for PP2A (At1g13320) and IPP2 (At3g02780) were used as internal control expression levels.

Article Title: Embryonic Stem Cells Derived Kidney Organoids as Faithful Models to Target Programmed Nephrogenesis
Article Snippet: .. The Brilliant III SYBR® Green QPCR Master Mix (Agilent Technologies) was used according to the manufacturer’s instructions. ..

Article Title: Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection
Article Snippet: .. Quantitative RT-PCR analyses were performed using Brilliant III SYBR green QPCR master mix (Agilent) with gene-specific primers according to the manufacturer's protocol and with the Applied Bioscience StepOnePlus qRT-PCR machine (Life Technologies). .. The expression levels were normalized to the endogenous 18S rRNA expression using the delta-delta comparative threshold method (ΔΔCT).

Article Title: Organ specificity in the plant circadian system is explained by different light inputs to the shoot and root clocks
Article Snippet: .. Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using oligo dT and SuperScript II reverse transcriptase (Invitrogen). qPCR reactions were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a Mx3000P (Agilent Technologies Ltd, Stockport, UK) or a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system. .. IRON SULFUR CLUSTER ASSEMBLY PROTEIN 1 (ISU1 , At4G22220) was used as the reference gene as its expression has been shown not to cycle over a range of conditions (Michael et al ., ).

Article Title: 1,25-Dihydroxyvitamin D inhibits glutamine metabolism in Harvey-ras transformed MCF10A human breast epithelial cell
Article Snippet: .. Real-time quantitative PCR was performed using the Brilliant III SYBR Green QPCR Master Mix (Agilent, Santa Clara, CA). .. The mRNA abundances of enzymes involved in glutamine metabolism were determined from the threshold cycle (Ct) value.

Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
Article Snippet: .. Briefly, total RNA was extracted with the RNeasy Plant Mini kit (Qiagen) and DNase treated (DNA‐free; Ambion). cDNA was typically synthesized from 1 μg of total RNA using random hexamers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific U.K. Ltd., Loughborough, U.K.) real‐time PCR system. .. The average Ct values for PP2A (At1g13320, primers PP2A‐f2; 5′‐TAACGTGGCCAAAATGATGC‐3′ and PP2A‐r2; 5′‐GTTCTCCACAACCGCTTGGT‐3′) was used as internal control for expression levels.

Article Title: RNA immunoprecipitation identifies novel targets of DAZL in human foetal ovary
Article Snippet: .. Each reaction was performed in a final volume of 10 µl, with 1× Brilliant III SYBR Green qPCR Master Mix (Agilent, Santa Clara, CA, USA), 20 pmol of each primer and 2 µl of diluted cDNA. ..

Article Title: Inhibition of pyruvate carboxylase by 1α,25-dihydroxyvitamin D promotes oxidative stress in early breast cancer progression
Article Snippet: .. Brilliant III SYBR Green QPCR Master Mix (Agilent, Santa Clara, CA) was used for real-time quantitative PCR. .. The mRNA expression was normalized to 18S expression using the 2(−delta CT) equation and results were expressed as arbitrary units.

Article Title: Suppression of the activity of arbuscular mycorrhizal fungi by the soil microbiota
Article Snippet: .. Reactions were carried out with 1× Brilliant III SYBR Green QPCR Master Mix (Agilent Technologies, USA), 0.4 µM of each primer and 1 mg ml−1 bovine serum albumin under thermal cycling conditions: 95 °C for 3 min followed by 35 cycles of 95 °C for 15 s and 57 °C for 20 s. Illumina MiSeq 300 bp paired-end sequencing of the hypervariable V3-V4 regions of the 16S rRNA gene, amplified with primers Bakt_341F and Bakt_805R (from ref. [ ]) was performed on the extracted DNA by Macrogen Inc. (Seoul, Rep. of Korea). .. Sequencing of soil DNA from Expt.

Article Title: An Antiviral Role for Antimicrobial Peptides during the Arthropod Response to Alphavirus Replication
Article Snippet: .. Quantitative RT-PCRs (qRT-PCRs) were prepared using Brilliant III SYBR green QPCR master mix (Agilent) with gene-specific primers according to the manufacturer's protocol and with the Applied Bioscience StepOnePlus qRT-PCR machine (Life Technologies). .. The expression levels were normalized to the 18S rRNA expression using the delta delta comparative threshold method (ΔΔ CT ).

Article Title: Pospiviroid Infection of Tomato Regulates the Expression of Genes Involved in Flower and Fruit Development
Article Snippet: .. The amplification reactions were performed using Brilliant® III SYBR® Green qPCR Master Mix (Agilent Technologies) on the Mx3000P Real-Time System (Stratagene, La Jolla, CA, USA). .. Each qPCR reaction contained 10 μL of 2× Brilliant® SYBR® Green III qPCR Master Mix, 1 μL of the diluted cDNA, and 2.5 pM of each gene-specific primer.

Incubation:

Article Title: PCGF6-PRC1 suppresses premature differentiation of mouse embryonic stem cells by regulating germ cell-related genes
Article Snippet: Real-time qPCR was performed using the Brilliant III SYBR Green QPCR Master Mix (Agilent). .. For H2AK119u1-ChIP using E6C5 (Millipore #05–678), pre-cleared chromatin from 2–3 × 106 cells was incubated with 40 ul of E6C5 antibody (Millipore #05–678) (overnight, 4°C), and 30 ul of original Protein A dynabead slurry (Invitrogen) was incubated with 3 ug (=3 ul) of rabbit anti-mouse IgM antibody (Millipore #12–488) (overnight, 4°C).

Luciferase:

Article Title: RNA immunoprecipitation identifies novel targets of DAZL in human foetal ovary
Article Snippet: Cytoplasmic RNA from luciferase-transfected HEK293T cells was extracted with the Cytoplasmic and Nuclear RNA Purification Kit (Norgen-Biotek, Ontario, Canada) according to manufacturer's instructions. .. Each reaction was performed in a final volume of 10 µl, with 1× Brilliant III SYBR Green qPCR Master Mix (Agilent, Santa Clara, CA, USA), 20 pmol of each primer and 2 µl of diluted cDNA.

Expressing:

Article Title: Hepatic PPARγ Is Not Essential for the Rapid Development of Steatosis After Loss of Hepatic GH Signaling, in Adult Male Mice
Article Snippet: Paragraph title: Hepatic gene expression analysis ... Resulting cDNA was amplified in a MxPro 3000P quantitative polymerase chain reaction (qPCR) system (Agilent Technologies, Inc) by quantitative real-time PCR, using Brilliant III SYBR green QPCR Master Mix (Agilent Technologies, Inc).

Article Title: Cold-Dependent Expression and Alternative Splicing of Arabidopsis Long Non-coding RNAs
Article Snippet: Each reaction (1:100 dilution of cDNA) was performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific-UK Ltd., Loughborough, United Kingdom) real-time PCR system. .. The average Ct values for IPP2 (AT3G02780) were used as internal control expression levels.

Article Title: How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY), et al. How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY)
Article Snippet: Complementary DNA (cDNA) was typically synthesized from 2 μg of total RNA using oligo dT primers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system. .. The average Ct values for PP2A (At1g13320) and IPP2 (At3g02780) were used as internal control expression levels.

Article Title: Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection
Article Snippet: Quantitative RT-PCR analyses were performed using Brilliant III SYBR green QPCR master mix (Agilent) with gene-specific primers according to the manufacturer's protocol and with the Applied Bioscience StepOnePlus qRT-PCR machine (Life Technologies). .. The expression levels were normalized to the endogenous 18S rRNA expression using the delta-delta comparative threshold method (ΔΔCT).

Article Title: Organ specificity in the plant circadian system is explained by different light inputs to the shoot and root clocks
Article Snippet: Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using oligo dT and SuperScript II reverse transcriptase (Invitrogen). qPCR reactions were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a Mx3000P (Agilent Technologies Ltd, Stockport, UK) or a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system. .. IRON SULFUR CLUSTER ASSEMBLY PROTEIN 1 (ISU1 , At4G22220) was used as the reference gene as its expression has been shown not to cycle over a range of conditions (Michael et al ., ).

Article Title: 1,25-Dihydroxyvitamin D inhibits glutamine metabolism in Harvey-ras transformed MCF10A human breast epithelial cell
Article Snippet: Real-time quantitative PCR was performed using the Brilliant III SYBR Green QPCR Master Mix (Agilent, Santa Clara, CA). .. The mRNA expression was normalized to 18S expression and results were expressed as arbitrary units.

Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
Article Snippet: Briefly, total RNA was extracted with the RNeasy Plant Mini kit (Qiagen) and DNase treated (DNA‐free; Ambion). cDNA was typically synthesized from 1 μg of total RNA using random hexamers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific U.K. Ltd., Loughborough, U.K.) real‐time PCR system. .. The average Ct values for PP2A (At1g13320, primers PP2A‐f2; 5′‐TAACGTGGCCAAAATGATGC‐3′ and PP2A‐r2; 5′‐GTTCTCCACAACCGCTTGGT‐3′) was used as internal control for expression levels.

Article Title: RNA immunoprecipitation identifies novel targets of DAZL in human foetal ovary
Article Snippet: Each reaction was performed in a final volume of 10 µl, with 1× Brilliant III SYBR Green qPCR Master Mix (Agilent, Santa Clara, CA, USA), 20 pmol of each primer and 2 µl of diluted cDNA. .. For expression analyses in human foetal ovary, target genes were normalised to the geometric mean expression of B2M (Beta-2 microglobulin) and RPL32 (ribosomal protein L32).

Article Title: Inhibition of pyruvate carboxylase by 1α,25-dihydroxyvitamin D promotes oxidative stress in early breast cancer progression
Article Snippet: Brilliant III SYBR Green QPCR Master Mix (Agilent, Santa Clara, CA) was used for real-time quantitative PCR. .. The mRNA expression was normalized to 18S expression using the 2(−delta CT) equation and results were expressed as arbitrary units.

Article Title: An Antiviral Role for Antimicrobial Peptides during the Arthropod Response to Alphavirus Replication
Article Snippet: Quantitative RT-PCRs (qRT-PCRs) were prepared using Brilliant III SYBR green QPCR master mix (Agilent) with gene-specific primers according to the manufacturer's protocol and with the Applied Bioscience StepOnePlus qRT-PCR machine (Life Technologies). .. The expression levels were normalized to the 18S rRNA expression using the delta delta comparative threshold method (ΔΔ CT ).

Article Title: Pospiviroid Infection of Tomato Regulates the Expression of Genes Involved in Flower and Fruit Development
Article Snippet: Gene expression profiles were analyzed by qPCR with gene-specific primers designed using the Primer3 online software [ , ], or published primers ( ). .. The amplification reactions were performed using Brilliant® III SYBR® Green qPCR Master Mix (Agilent Technologies) on the Mx3000P Real-Time System (Stratagene, La Jolla, CA, USA).

Gas Chromatography:

Article Title: Suppression of the activity of arbuscular mycorrhizal fungi by the soil microbiota
Article Snippet: Samples were analysed by gas chromatography mass spectromety using aVarian CP482fitted with a 50 m CPSIL8CB column (Ø 0.25 mm, film thickness 0.25 µm), after injection of 3 µL using a temperature programme of 50 °C for 1.89 min, 20 °C min−1 to 160 °C, hold for 5 min, 5 °C min−1 to 270 °C, hold for 0 min, 50 °C min−1 to 325 °C, hold for 3 min. .. Reactions were carried out with 1× Brilliant III SYBR Green QPCR Master Mix (Agilent Technologies, USA), 0.4 µM of each primer and 1 mg ml−1 bovine serum albumin under thermal cycling conditions: 95 °C for 3 min followed by 35 cycles of 95 °C for 15 s and 57 °C for 20 s. Illumina MiSeq 300 bp paired-end sequencing of the hypervariable V3-V4 regions of the 16S rRNA gene, amplified with primers Bakt_341F and Bakt_805R (from ref. [ ]) was performed on the extracted DNA by Macrogen Inc. (Seoul, Rep. of Korea).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Cold-Dependent Expression and Alternative Splicing of Arabidopsis Long Non-coding RNAs
Article Snippet: Paragraph title: Quantitative Reverse Transcription RT-PCR (RT-qPCR) ... Each reaction (1:100 dilution of cDNA) was performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific-UK Ltd., Loughborough, United Kingdom) real-time PCR system.

Article Title: How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY), et al. How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY)
Article Snippet: Paragraph title: RNA extraction, cDNA synthesis, RT‐PCR, and qPCR ... Complementary DNA (cDNA) was typically synthesized from 2 μg of total RNA using oligo dT primers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system.

Article Title: Embryonic Stem Cells Derived Kidney Organoids as Faithful Models to Target Programmed Nephrogenesis
Article Snippet: Paragraph title: RT-PCR ... The Brilliant III SYBR® Green QPCR Master Mix (Agilent Technologies) was used according to the manufacturer’s instructions.

Sequencing:

Article Title: Hepatic PPARγ Is Not Essential for the Rapid Development of Steatosis After Loss of Hepatic GH Signaling, in Adult Male Mice
Article Snippet: Resulting cDNA was amplified in a MxPro 3000P quantitative polymerase chain reaction (qPCR) system (Agilent Technologies, Inc) by quantitative real-time PCR, using Brilliant III SYBR green QPCR Master Mix (Agilent Technologies, Inc). .. Primers were selected that amplified 100- to 250-bp targets and displayed no autocomplementation or nonspecific amplifications (assessed by sequencing and melting curves). qPCR primer sequences were reported previously ( , ).

Article Title: Cold-Dependent Expression and Alternative Splicing of Arabidopsis Long Non-coding RNAs
Article Snippet: Each reaction (1:100 dilution of cDNA) was performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific-UK Ltd., Loughborough, United Kingdom) real-time PCR system. .. Primers TAS1a-ex1-fwd 5′-CTAAGCGGCTAAGCCTGACGTCA-3′ and TAS1a-ex2-ex1-rev 5′-CACCCATTACAAG CC TTTCTATCAGACAAGAC-3′ targeted spliced TAS1a transcripts where the latter primer bridged the spliced intron (between exonic nucleotides underlined in the primer sequence).

Article Title: RNA immunoprecipitation identifies novel targets of DAZL in human foetal ovary
Article Snippet: Each reaction was performed in a final volume of 10 µl, with 1× Brilliant III SYBR Green qPCR Master Mix (Agilent, Santa Clara, CA, USA), 20 pmol of each primer and 2 µl of diluted cDNA. .. For Luciferase expression, the Renilla sequence which was located on the same construct was used for normalisation.

Article Title: Suppression of the activity of arbuscular mycorrhizal fungi by the soil microbiota
Article Snippet: .. Reactions were carried out with 1× Brilliant III SYBR Green QPCR Master Mix (Agilent Technologies, USA), 0.4 µM of each primer and 1 mg ml−1 bovine serum albumin under thermal cycling conditions: 95 °C for 3 min followed by 35 cycles of 95 °C for 15 s and 57 °C for 20 s. Illumina MiSeq 300 bp paired-end sequencing of the hypervariable V3-V4 regions of the 16S rRNA gene, amplified with primers Bakt_341F and Bakt_805R (from ref. [ ]) was performed on the extracted DNA by Macrogen Inc. (Seoul, Rep. of Korea). .. Sequencing of soil DNA from Expt.

Sonication:

Article Title: PCGF6-PRC1 suppresses premature differentiation of mouse embryonic stem cells by regulating germ cell-related genes
Article Snippet: Sonication was performed using a Covaris focused-ultrasonicator (Covaris, Woburn, MA) to produce fragments of approximately 0.5–1 kb. .. Real-time qPCR was performed using the Brilliant III SYBR Green QPCR Master Mix (Agilent).

Injection:

Article Title: Suppression of the activity of arbuscular mycorrhizal fungi by the soil microbiota
Article Snippet: Samples were analysed by gas chromatography mass spectromety using aVarian CP482fitted with a 50 m CPSIL8CB column (Ø 0.25 mm, film thickness 0.25 µm), after injection of 3 µL using a temperature programme of 50 °C for 1.89 min, 20 °C min−1 to 160 °C, hold for 5 min, 5 °C min−1 to 270 °C, hold for 0 min, 50 °C min−1 to 325 °C, hold for 3 min. .. Reactions were carried out with 1× Brilliant III SYBR Green QPCR Master Mix (Agilent Technologies, USA), 0.4 µM of each primer and 1 mg ml−1 bovine serum albumin under thermal cycling conditions: 95 °C for 3 min followed by 35 cycles of 95 °C for 15 s and 57 °C for 20 s. Illumina MiSeq 300 bp paired-end sequencing of the hypervariable V3-V4 regions of the 16S rRNA gene, amplified with primers Bakt_341F and Bakt_805R (from ref. [ ]) was performed on the extracted DNA by Macrogen Inc. (Seoul, Rep. of Korea).

Isolation:

Article Title: PCGF6-PRC1 suppresses premature differentiation of mouse embryonic stem cells by regulating germ cell-related genes
Article Snippet: Antibody bound proteins were isolated on protein A/G magnetic Dynabeads (Invitrogen), washed extensively, eluted, cross-links were reversed, and then the samples were sequentially treated with RNase and proteinase K before being purified using phenol-chloroform extraction. .. Real-time qPCR was performed using the Brilliant III SYBR Green QPCR Master Mix (Agilent).

Article Title: 1,25-Dihydroxyvitamin D inhibits glutamine metabolism in Harvey-ras transformed MCF10A human breast epithelial cell
Article Snippet: Paragraph title: 2.9. RNA isolation and analysis ... Real-time quantitative PCR was performed using the Brilliant III SYBR Green QPCR Master Mix (Agilent, Santa Clara, CA).

Article Title: Inhibition of pyruvate carboxylase by 1α,25-dihydroxyvitamin D promotes oxidative stress in early breast cancer progression
Article Snippet: Paragraph title: RNA isolation and analysis ... Brilliant III SYBR Green QPCR Master Mix (Agilent, Santa Clara, CA) was used for real-time quantitative PCR.

Article Title: Suppression of the activity of arbuscular mycorrhizal fungi by the soil microbiota
Article Snippet: Each DNA sample contained pooled DNA isolated from two subsamples of 0.5 g soil from each HC. .. Reactions were carried out with 1× Brilliant III SYBR Green QPCR Master Mix (Agilent Technologies, USA), 0.4 µM of each primer and 1 mg ml−1 bovine serum albumin under thermal cycling conditions: 95 °C for 3 min followed by 35 cycles of 95 °C for 15 s and 57 °C for 20 s. Illumina MiSeq 300 bp paired-end sequencing of the hypervariable V3-V4 regions of the 16S rRNA gene, amplified with primers Bakt_341F and Bakt_805R (from ref. [ ]) was performed on the extracted DNA by Macrogen Inc. (Seoul, Rep. of Korea).

Purification:

Article Title: PCGF6-PRC1 suppresses premature differentiation of mouse embryonic stem cells by regulating germ cell-related genes
Article Snippet: Antibody bound proteins were isolated on protein A/G magnetic Dynabeads (Invitrogen), washed extensively, eluted, cross-links were reversed, and then the samples were sequentially treated with RNase and proteinase K before being purified using phenol-chloroform extraction. .. Real-time qPCR was performed using the Brilliant III SYBR Green QPCR Master Mix (Agilent).

Article Title: RNA immunoprecipitation identifies novel targets of DAZL in human foetal ovary
Article Snippet: Cytoplasmic RNA from luciferase-transfected HEK293T cells was extracted with the Cytoplasmic and Nuclear RNA Purification Kit (Norgen-Biotek, Ontario, Canada) according to manufacturer's instructions. .. Each reaction was performed in a final volume of 10 µl, with 1× Brilliant III SYBR Green qPCR Master Mix (Agilent, Santa Clara, CA, USA), 20 pmol of each primer and 2 µl of diluted cDNA.

Polymerase Chain Reaction:

Article Title: Hepatic PPARγ Is Not Essential for the Rapid Development of Steatosis After Loss of Hepatic GH Signaling, in Adult Male Mice
Article Snippet: Resulting cDNA was amplified in a MxPro 3000P quantitative polymerase chain reaction (qPCR) system (Agilent Technologies, Inc) by quantitative real-time PCR, using Brilliant III SYBR green QPCR Master Mix (Agilent Technologies, Inc). .. An internal standard curve using dilutions of the gene-specific PCR products (106 -101 copies of starting DNA template) were run in the same PCR plate to estimate efficiency of the PCR reaction and linearity of the standard curve.

Article Title: Organ specificity in the plant circadian system is explained by different light inputs to the shoot and root clocks
Article Snippet: Absence of genomic DNA contamination was confirmed by PCR with ACTIN2 gene primers. .. Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using oligo dT and SuperScript II reverse transcriptase (Invitrogen). qPCR reactions were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a Mx3000P (Agilent Technologies Ltd, Stockport, UK) or a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system.

Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
Article Snippet: Paragraph title: RNA extraction, c DNA synthesis, and q PCR ... Briefly, total RNA was extracted with the RNeasy Plant Mini kit (Qiagen) and DNase treated (DNA‐free; Ambion). cDNA was typically synthesized from 1 μg of total RNA using random hexamers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific U.K. Ltd., Loughborough, U.K.) real‐time PCR system.

Article Title: RNA immunoprecipitation identifies novel targets of DAZL in human foetal ovary
Article Snippet: Primer pair efficiencies were calculated with the LinReg PCR applet ( ). .. Each reaction was performed in a final volume of 10 µl, with 1× Brilliant III SYBR Green qPCR Master Mix (Agilent, Santa Clara, CA, USA), 20 pmol of each primer and 2 µl of diluted cDNA.

Article Title: Pospiviroid Infection of Tomato Regulates the Expression of Genes Involved in Flower and Fruit Development
Article Snippet: The amplification reactions were performed using Brilliant® III SYBR® Green qPCR Master Mix (Agilent Technologies) on the Mx3000P Real-Time System (Stratagene, La Jolla, CA, USA). .. Thermal conditions used for the qPCR reactions were: 95 °C for 10 min, followed by 40 cycles of 95 °C, 30 s, 55 °C, for 1 min, and 72 °C for 30 s. Specificity of the amplifications was confirmed by the single peak of dissociation curves of the PCR products.

Construct:

Article Title: RNA immunoprecipitation identifies novel targets of DAZL in human foetal ovary
Article Snippet: Each reaction was performed in a final volume of 10 µl, with 1× Brilliant III SYBR Green qPCR Master Mix (Agilent, Santa Clara, CA, USA), 20 pmol of each primer and 2 µl of diluted cDNA. .. For Luciferase expression, the Renilla sequence which was located on the same construct was used for normalisation.

Chromatin Immunoprecipitation:

Article Title: PCGF6-PRC1 suppresses premature differentiation of mouse embryonic stem cells by regulating germ cell-related genes
Article Snippet: Paragraph title: ChIP-qPCR analysis ... Real-time qPCR was performed using the Brilliant III SYBR Green QPCR Master Mix (Agilent).

Software:

Article Title: Suppression of the activity of arbuscular mycorrhizal fungi by the soil microbiota
Article Snippet: Reactions were carried out with 1× Brilliant III SYBR Green QPCR Master Mix (Agilent Technologies, USA), 0.4 µM of each primer and 1 mg ml−1 bovine serum albumin under thermal cycling conditions: 95 °C for 3 min followed by 35 cycles of 95 °C for 15 s and 57 °C for 20 s. Illumina MiSeq 300 bp paired-end sequencing of the hypervariable V3-V4 regions of the 16S rRNA gene, amplified with primers Bakt_341F and Bakt_805R (from ref. [ ]) was performed on the extracted DNA by Macrogen Inc. (Seoul, Rep. of Korea). .. Sequencing data were analysed using the CLC Genomics Workbench with the Microbial Genomics Module (Qiagen) using the software’s default settings.

Article Title: Pospiviroid Infection of Tomato Regulates the Expression of Genes Involved in Flower and Fruit Development
Article Snippet: Gene expression profiles were analyzed by qPCR with gene-specific primers designed using the Primer3 online software [ , ], or published primers ( ). .. The amplification reactions were performed using Brilliant® III SYBR® Green qPCR Master Mix (Agilent Technologies) on the Mx3000P Real-Time System (Stratagene, La Jolla, CA, USA).

SYBR Green Assay:

Article Title: PCGF6-PRC1 suppresses premature differentiation of mouse embryonic stem cells by regulating germ cell-related genes
Article Snippet: .. Real-time qPCR was performed using the Brilliant III SYBR Green QPCR Master Mix (Agilent). .. For H2AK119u1-ChIP using E6C5 (Millipore #05–678), pre-cleared chromatin from 2–3 × 106 cells was incubated with 40 ul of E6C5 antibody (Millipore #05–678) (overnight, 4°C), and 30 ul of original Protein A dynabead slurry (Invitrogen) was incubated with 3 ug (=3 ul) of rabbit anti-mouse IgM antibody (Millipore #12–488) (overnight, 4°C).

Article Title: Hepatic PPARγ Is Not Essential for the Rapid Development of Steatosis After Loss of Hepatic GH Signaling, in Adult Male Mice
Article Snippet: .. Resulting cDNA was amplified in a MxPro 3000P quantitative polymerase chain reaction (qPCR) system (Agilent Technologies, Inc) by quantitative real-time PCR, using Brilliant III SYBR green QPCR Master Mix (Agilent Technologies, Inc). .. Primers were selected that amplified 100- to 250-bp targets and displayed no autocomplementation or nonspecific amplifications (assessed by sequencing and melting curves). qPCR primer sequences were reported previously ( , ).

Article Title: Cold-Dependent Expression and Alternative Splicing of Arabidopsis Long Non-coding RNAs
Article Snippet: .. Each reaction (1:100 dilution of cDNA) was performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific-UK Ltd., Loughborough, United Kingdom) real-time PCR system. .. The average Ct values for IPP2 (AT3G02780) were used as internal control expression levels.

Article Title: How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY), et al. How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY)
Article Snippet: .. Complementary DNA (cDNA) was typically synthesized from 2 μg of total RNA using oligo dT primers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system. .. The average Ct values for PP2A (At1g13320) and IPP2 (At3g02780) were used as internal control expression levels.

Article Title: Embryonic Stem Cells Derived Kidney Organoids as Faithful Models to Target Programmed Nephrogenesis
Article Snippet: .. The Brilliant III SYBR® Green QPCR Master Mix (Agilent Technologies) was used according to the manufacturer’s instructions. ..

Article Title: Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection
Article Snippet: .. Quantitative RT-PCR analyses were performed using Brilliant III SYBR green QPCR master mix (Agilent) with gene-specific primers according to the manufacturer's protocol and with the Applied Bioscience StepOnePlus qRT-PCR machine (Life Technologies). .. The expression levels were normalized to the endogenous 18S rRNA expression using the delta-delta comparative threshold method (ΔΔCT).

Article Title: Organ specificity in the plant circadian system is explained by different light inputs to the shoot and root clocks
Article Snippet: .. Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using oligo dT and SuperScript II reverse transcriptase (Invitrogen). qPCR reactions were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a Mx3000P (Agilent Technologies Ltd, Stockport, UK) or a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system. .. IRON SULFUR CLUSTER ASSEMBLY PROTEIN 1 (ISU1 , At4G22220) was used as the reference gene as its expression has been shown not to cycle over a range of conditions (Michael et al ., ).

Article Title: 1,25-Dihydroxyvitamin D inhibits glutamine metabolism in Harvey-ras transformed MCF10A human breast epithelial cell
Article Snippet: .. Real-time quantitative PCR was performed using the Brilliant III SYBR Green QPCR Master Mix (Agilent, Santa Clara, CA). .. The mRNA abundances of enzymes involved in glutamine metabolism were determined from the threshold cycle (Ct) value.

Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
Article Snippet: .. Briefly, total RNA was extracted with the RNeasy Plant Mini kit (Qiagen) and DNase treated (DNA‐free; Ambion). cDNA was typically synthesized from 1 μg of total RNA using random hexamers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific U.K. Ltd., Loughborough, U.K.) real‐time PCR system. .. The average Ct values for PP2A (At1g13320, primers PP2A‐f2; 5′‐TAACGTGGCCAAAATGATGC‐3′ and PP2A‐r2; 5′‐GTTCTCCACAACCGCTTGGT‐3′) was used as internal control for expression levels.

Article Title: RNA immunoprecipitation identifies novel targets of DAZL in human foetal ovary
Article Snippet: .. Each reaction was performed in a final volume of 10 µl, with 1× Brilliant III SYBR Green qPCR Master Mix (Agilent, Santa Clara, CA, USA), 20 pmol of each primer and 2 µl of diluted cDNA. ..

Article Title: Inhibition of pyruvate carboxylase by 1α,25-dihydroxyvitamin D promotes oxidative stress in early breast cancer progression
Article Snippet: .. Brilliant III SYBR Green QPCR Master Mix (Agilent, Santa Clara, CA) was used for real-time quantitative PCR. .. The mRNA expression was normalized to 18S expression using the 2(−delta CT) equation and results were expressed as arbitrary units.

Article Title: Suppression of the activity of arbuscular mycorrhizal fungi by the soil microbiota
Article Snippet: .. Reactions were carried out with 1× Brilliant III SYBR Green QPCR Master Mix (Agilent Technologies, USA), 0.4 µM of each primer and 1 mg ml−1 bovine serum albumin under thermal cycling conditions: 95 °C for 3 min followed by 35 cycles of 95 °C for 15 s and 57 °C for 20 s. Illumina MiSeq 300 bp paired-end sequencing of the hypervariable V3-V4 regions of the 16S rRNA gene, amplified with primers Bakt_341F and Bakt_805R (from ref. [ ]) was performed on the extracted DNA by Macrogen Inc. (Seoul, Rep. of Korea). .. Sequencing of soil DNA from Expt.

Article Title: An Antiviral Role for Antimicrobial Peptides during the Arthropod Response to Alphavirus Replication
Article Snippet: .. Quantitative RT-PCRs (qRT-PCRs) were prepared using Brilliant III SYBR green QPCR master mix (Agilent) with gene-specific primers according to the manufacturer's protocol and with the Applied Bioscience StepOnePlus qRT-PCR machine (Life Technologies). .. The expression levels were normalized to the 18S rRNA expression using the delta delta comparative threshold method (ΔΔ CT ).

Article Title: Pospiviroid Infection of Tomato Regulates the Expression of Genes Involved in Flower and Fruit Development
Article Snippet: .. The amplification reactions were performed using Brilliant® III SYBR® Green qPCR Master Mix (Agilent Technologies) on the Mx3000P Real-Time System (Stratagene, La Jolla, CA, USA). .. Each qPCR reaction contained 10 μL of 2× Brilliant® SYBR® Green III qPCR Master Mix, 1 μL of the diluted cDNA, and 2.5 pM of each gene-specific primer.

RNA Extraction:

Article Title: How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY), et al. How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY)
Article Snippet: Paragraph title: RNA extraction, cDNA synthesis, RT‐PCR, and qPCR ... Complementary DNA (cDNA) was typically synthesized from 2 μg of total RNA using oligo dT primers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system.

Article Title: Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection
Article Snippet: Real-time quantitative RT-PCR analysis Whole flies were homogenized in TRIzol reagent, followed by RNA extraction. cDNA was synthesized using MMulV Reverse Transcriptase (New England Biolab) with random hexamer primers (Integrated DNA Technologies). .. Quantitative RT-PCR analyses were performed using Brilliant III SYBR green QPCR master mix (Agilent) with gene-specific primers according to the manufacturer's protocol and with the Applied Bioscience StepOnePlus qRT-PCR machine (Life Technologies).

Article Title: Organ specificity in the plant circadian system is explained by different light inputs to the shoot and root clocks
Article Snippet: Paragraph title: RNA extraction and quantification by RT‐qPCR ... Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using oligo dT and SuperScript II reverse transcriptase (Invitrogen). qPCR reactions were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a Mx3000P (Agilent Technologies Ltd, Stockport, UK) or a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system.

Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
Article Snippet: Paragraph title: RNA extraction, c DNA synthesis, and q PCR ... Briefly, total RNA was extracted with the RNeasy Plant Mini kit (Qiagen) and DNase treated (DNA‐free; Ambion). cDNA was typically synthesized from 1 μg of total RNA using random hexamers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific U.K. Ltd., Loughborough, U.K.) real‐time PCR system.

Article Title: RNA immunoprecipitation identifies novel targets of DAZL in human foetal ovary
Article Snippet: Paragraph title: RNA extraction, cDNA synthesis and quantitative RT-PCR ... Each reaction was performed in a final volume of 10 µl, with 1× Brilliant III SYBR Green qPCR Master Mix (Agilent, Santa Clara, CA, USA), 20 pmol of each primer and 2 µl of diluted cDNA.

Article Title: An Antiviral Role for Antimicrobial Peptides during the Arthropod Response to Alphavirus Replication
Article Snippet: Flies were homogenized in TRIzol reagent, followed by RNA extraction. cDNA was synthesized used AffinityScript QPCR cDNA synthesis kit (Agilent, Santa Clara, CA) with random hexamer primers. .. Quantitative RT-PCRs (qRT-PCRs) were prepared using Brilliant III SYBR green QPCR master mix (Agilent) with gene-specific primers according to the manufacturer's protocol and with the Applied Bioscience StepOnePlus qRT-PCR machine (Life Technologies).

Random Hexamer Labeling:

Article Title: Hepatic PPARγ Is Not Essential for the Rapid Development of Steatosis After Loss of Hepatic GH Signaling, in Adult Male Mice
Article Snippet: Random hexamer primers were used to retrotranscribe 100 ng/μL of DNA-free RNA into cDNA (RevertAid First Strand cDNA Synthesis kit; Thermo Fisher Scientific). .. Resulting cDNA was amplified in a MxPro 3000P quantitative polymerase chain reaction (qPCR) system (Agilent Technologies, Inc) by quantitative real-time PCR, using Brilliant III SYBR green QPCR Master Mix (Agilent Technologies, Inc).

Article Title: Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection
Article Snippet: Real-time quantitative RT-PCR analysis Whole flies were homogenized in TRIzol reagent, followed by RNA extraction. cDNA was synthesized using MMulV Reverse Transcriptase (New England Biolab) with random hexamer primers (Integrated DNA Technologies). .. Quantitative RT-PCR analyses were performed using Brilliant III SYBR green QPCR master mix (Agilent) with gene-specific primers according to the manufacturer's protocol and with the Applied Bioscience StepOnePlus qRT-PCR machine (Life Technologies).

Article Title: An Antiviral Role for Antimicrobial Peptides during the Arthropod Response to Alphavirus Replication
Article Snippet: Flies were homogenized in TRIzol reagent, followed by RNA extraction. cDNA was synthesized used AffinityScript QPCR cDNA synthesis kit (Agilent, Santa Clara, CA) with random hexamer primers. .. Quantitative RT-PCRs (qRT-PCRs) were prepared using Brilliant III SYBR green QPCR master mix (Agilent) with gene-specific primers according to the manufacturer's protocol and with the Applied Bioscience StepOnePlus qRT-PCR machine (Life Technologies).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Agilent technologies brilliant iii ultra fast sybr green qpcr master mix
    Gene expression levels measured by <t>qPCR.</t> (A) ABA transport and biosynthesis genes expression levels. (B) Genes that respond to drought. The expression levels are relative to the normalizer gene (Pre-mRNA splicing PRP18 -interacting factor) that was identified from the in silico expression analysis. Bars represent the standard deviation of <t>three</t> replicates.
    Brilliant Iii Ultra Fast Sybr Green Qpcr Master Mix, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 99/100, based on 133 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/brilliant iii ultra fast sybr green qpcr master mix/product/Agilent technologies
    Average 99 stars, based on 133 article reviews
    Price from $9.99 to $1999.99
    brilliant iii ultra fast sybr green qpcr master mix - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    89
    Agilent technologies qrt pcr reaction mix
    The T49E substitution affects interferon β (IFNβ) antagonistic properties of NS1. A, B. IFNβ mRNA expression in A549 cells infected with recombinant PR8 viruses containing wt NS1 or NS1 with different mutations (MOI = 5) was measured by <t>qRT‐PCR.</t> Values represent n ‐fold expression of mock‐infected cells and are displayed as mean ± SD of three independently repeated experiments. One‐way ANOVA followed by Dunnett's multiple comparisons test using T49 or T215 as controls was used for statistical analysis of each time point separately (** p ≤ 0.01). C, D. Phosphorylation of NS1 T49 suppresses IFNβ promoter activity. A549 cells were transfected with pcDNA3 plasmids containing different NS1 genes and with luciferase reporter gene plasmids harbouring the IFN promotor or the IRF‐3 domain only. After 24 h, cells were stimulated with vRNA or cellular RNA and luciferase activity in cell lysates was measured after 6 h. Results represent means ± SD of three independently repeated experiments. Luciferase activity of empty vector transfected, cellular RNA stimulated cells was taken as unity. Statistical significance of vRNA stimulated cells was analysed by one‐way ANOVA followed by Dunnett's multiple comparisons test using T49 as control (** p ≤ 0.01, *** p ≤ 0.001). E. Multi‐cycle replication kinetics of recombinant PR8 viruses with wt NS1 or NS1 with different mutations in Vero cells infected at a MOI of 0.01. Results represent means ± SD of three independently repeated experiments. F. Viral replication in lungs of C57Bl/6 and C57Bl/6 Ifnar1 –/– mice. Mice were infected with 10 3 PFU of PR8/NS1‐T49 or PR8/NS1‐T49E and lung virus titers were determined after 3 days. PFU/ml of lung homogenate are presented. Statistical analysis was performed using the Mann‐Whitney U test (** p ≤ 0.01).
    Qrt Pcr Reaction Mix, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr reaction mix/product/Agilent technologies
    Average 89 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    qrt pcr reaction mix - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    Image Search Results


    Gene expression levels measured by qPCR. (A) ABA transport and biosynthesis genes expression levels. (B) Genes that respond to drought. The expression levels are relative to the normalizer gene (Pre-mRNA splicing PRP18 -interacting factor) that was identified from the in silico expression analysis. Bars represent the standard deviation of three replicates.

    Journal: Frontiers in Plant Science

    Article Title: Transcriptional Responses of Chilean Quinoa (Chenopodium quinoa Willd.) Under Water Deficit Conditions Uncovers ABA-Independent Expression Patterns

    doi: 10.3389/fpls.2017.00216

    Figure Lengend Snippet: Gene expression levels measured by qPCR. (A) ABA transport and biosynthesis genes expression levels. (B) Genes that respond to drought. The expression levels are relative to the normalizer gene (Pre-mRNA splicing PRP18 -interacting factor) that was identified from the in silico expression analysis. Bars represent the standard deviation of three replicates.

    Article Snippet: Gene-specific primers were designed to span the selected genes using Primer3 software ( http://frodo.wi.mit.edu/primer3/ ). qPCR was carried out on 1 μL diluted cDNA by triplicate using the MaxPro3000P Stratagene Sequence Detection System, Brilliant III Ultra Fast SYBR Green QPCR master mix (Agilent) and primers at a final concentration between 250 and 450 nM.

    Techniques: Expressing, Real-time Polymerase Chain Reaction, In Silico, Standard Deviation

    Effect of MYC and MAX on BCR and BCR/ABL1 expression in K562 cell line. MYC ( a,c ) and MAX ( b,c ) over-expression in K562 cells stably transfected with MAX, MYC, or pcDNA3 empty vector (Empty) or MYC/MAX (MYC::MAX), as evidenced by RTq-PCR ( a,b ) and Western Blot from total lysates ( c ). RT-qPCR ( d,e ) and Western Blot ( f ) show BCR and BCR/ABL1 expression levels in K562 transfectants. Actin was used as loading control. The RTq-PCR data shown in ( d,e ) represent the means ± SD (standard deviation) of three independent experiments. Data are represented as mRNA fold change compared to the Empty sample

    Journal: Molecular Cancer

    Article Title: BCR/ABL1 and BCR are under the transcriptional control of the MYC oncogene

    doi: 10.1186/s12943-015-0407-0

    Figure Lengend Snippet: Effect of MYC and MAX on BCR and BCR/ABL1 expression in K562 cell line. MYC ( a,c ) and MAX ( b,c ) over-expression in K562 cells stably transfected with MAX, MYC, or pcDNA3 empty vector (Empty) or MYC/MAX (MYC::MAX), as evidenced by RTq-PCR ( a,b ) and Western Blot from total lysates ( c ). RT-qPCR ( d,e ) and Western Blot ( f ) show BCR and BCR/ABL1 expression levels in K562 transfectants. Actin was used as loading control. The RTq-PCR data shown in ( d,e ) represent the means ± SD (standard deviation) of three independent experiments. Data are represented as mRNA fold change compared to the Empty sample

    Article Snippet: RT-qPCR was performed using TaqMan® Brilliant II QPCR Master Mix (Agilent technologies, Santa Clara, CA, USA) for TaqMan assays or with Brilliant III Ultra-fast SYBR Green QPCR Master Mix (Agilent technologies) for SYBR Green assays on a Stratagene-MX3005P (Agilent technologies) under standard conditions.

    Techniques: Expressing, Over Expression, Stable Transfection, Transfection, Plasmid Preparation, Polymerase Chain Reaction, Western Blot, Quantitative RT-PCR, Standard Deviation

    PBS1-4 are critical for BCR promoter regulation. 293 cells were infected with lentiviruses expressing scrambled shRNA (negative control: shNC) or MYC shRNA (shMYC). ( a , b ) RT-qPCR and Western Blot analyses assessing MYC expression levels. ( c ) Luciferase assay on 293 infected cells. The four MYC/MAX binding sites are numbered in the figure (1-4). The graph shows the relative luciferase values as assessed after normalization with Renilla Luciferase signal. Values reported in the graph represent the average of three separate experiments. *** = p

    Journal: Molecular Cancer

    Article Title: BCR/ABL1 and BCR are under the transcriptional control of the MYC oncogene

    doi: 10.1186/s12943-015-0407-0

    Figure Lengend Snippet: PBS1-4 are critical for BCR promoter regulation. 293 cells were infected with lentiviruses expressing scrambled shRNA (negative control: shNC) or MYC shRNA (shMYC). ( a , b ) RT-qPCR and Western Blot analyses assessing MYC expression levels. ( c ) Luciferase assay on 293 infected cells. The four MYC/MAX binding sites are numbered in the figure (1-4). The graph shows the relative luciferase values as assessed after normalization with Renilla Luciferase signal. Values reported in the graph represent the average of three separate experiments. *** = p

    Article Snippet: RT-qPCR was performed using TaqMan® Brilliant II QPCR Master Mix (Agilent technologies, Santa Clara, CA, USA) for TaqMan assays or with Brilliant III Ultra-fast SYBR Green QPCR Master Mix (Agilent technologies) for SYBR Green assays on a Stratagene-MX3005P (Agilent technologies) under standard conditions.

    Techniques: Infection, Expressing, shRNA, Negative Control, Quantitative RT-PCR, Western Blot, Luciferase, Binding Assay

    vtRNA levels in response to expression of EBV-encoded latency III proteins. ( a ) Northern blot analysis was used to assess the effects of overexpressing EBV-encoded proteins on the vtRNA1-1 levels in different BL2 cell lines. The 5S rRNA serves as internal loading control. (−) indicate untreated BL2 cells, whereas EVC indicates the empty vector control. EBV strain B95.8 was used as positive infection control (+ EBV). The mean and standard deviation of three different experiments are shown beneath the blot, whereas the vtRNA1-1 expression levels in untreated BL2 cells (−) was taken as 1.0. See also Supplementary Fig. 2 . (b) Real-time qPCR was used to quantify vtRNA1-1 levels in the untreated BL2 control (−) or in BL2 cells overexpressing latency stage III proteins. Real-time qPCR data shown are the mean values from three individual assays; TBP served as housekeeping gene. ‘Fold induction' was calculated using the comparative Δct method where BL2 served as calibrator. (c) Schematic representation of LMP1 domain organization. The different signalling pathways controlled by the signalling modules CTAR1 and CTAR2 are indicated. ( d) Real-time qPCR to investigate the effect of LMP1 mutants (M_CTAR 1 and M_CTAR 2 carry detrimental amino-acid substitutions or a deletion in CTAR domains 1 or 2, respectively) on the vtRNA1-1 level in BL2 cells. Data shown are the mean values and standard deviations of three independent assays. ( e) In the presence of an NF-κB inhibitor (inh.), northern blot analysis showed no LMP1-dependent upregulation of vtRNA1-1. 5.8 S rRNA serves as internal loading control. (f ) ChIP efficiencies using an NF-κB p65 antibody were monitored using qPCR on vtRNA1-1 and vtRNA1-2 promoter regions from BL2 cells carrying the empty vector (evc), expressing LMP1 (+LMP1), or from EBV-infected BL2 cells. Data shown are mean values and standard deviations from three individual assays. Significant differences relative to the mock control (no antibody) were determined using the two-tailed unpaired Student's t -test (*** P

    Journal: Nature Communications

    Article Title: Expression of the vault RNA protects cells from undergoing apoptosis

    doi: 10.1038/ncomms8030

    Figure Lengend Snippet: vtRNA levels in response to expression of EBV-encoded latency III proteins. ( a ) Northern blot analysis was used to assess the effects of overexpressing EBV-encoded proteins on the vtRNA1-1 levels in different BL2 cell lines. The 5S rRNA serves as internal loading control. (−) indicate untreated BL2 cells, whereas EVC indicates the empty vector control. EBV strain B95.8 was used as positive infection control (+ EBV). The mean and standard deviation of three different experiments are shown beneath the blot, whereas the vtRNA1-1 expression levels in untreated BL2 cells (−) was taken as 1.0. See also Supplementary Fig. 2 . (b) Real-time qPCR was used to quantify vtRNA1-1 levels in the untreated BL2 control (−) or in BL2 cells overexpressing latency stage III proteins. Real-time qPCR data shown are the mean values from three individual assays; TBP served as housekeeping gene. ‘Fold induction' was calculated using the comparative Δct method where BL2 served as calibrator. (c) Schematic representation of LMP1 domain organization. The different signalling pathways controlled by the signalling modules CTAR1 and CTAR2 are indicated. ( d) Real-time qPCR to investigate the effect of LMP1 mutants (M_CTAR 1 and M_CTAR 2 carry detrimental amino-acid substitutions or a deletion in CTAR domains 1 or 2, respectively) on the vtRNA1-1 level in BL2 cells. Data shown are the mean values and standard deviations of three independent assays. ( e) In the presence of an NF-κB inhibitor (inh.), northern blot analysis showed no LMP1-dependent upregulation of vtRNA1-1. 5.8 S rRNA serves as internal loading control. (f ) ChIP efficiencies using an NF-κB p65 antibody were monitored using qPCR on vtRNA1-1 and vtRNA1-2 promoter regions from BL2 cells carrying the empty vector (evc), expressing LMP1 (+LMP1), or from EBV-infected BL2 cells. Data shown are mean values and standard deviations from three individual assays. Significant differences relative to the mock control (no antibody) were determined using the two-tailed unpaired Student's t -test (*** P

    Article Snippet: Quantitative real-time PCR (3 min 95 °C, 40 cycles each 10 s 95 °C and 15 s 50 °C) was performed with Brilliant III ultra-fast SYBR Green qPCR master mix (Agilent Technologies) to amplify a distinct region of the vtRNA1-1 promoter and of the vtRNA1-2 promoter region.

    Techniques: Expressing, Northern Blot, Plasmid Preparation, Infection, Standard Deviation, Real-time Polymerase Chain Reaction, Chromatin Immunoprecipitation, Two Tailed Test

    The T49E substitution affects interferon β (IFNβ) antagonistic properties of NS1. A, B. IFNβ mRNA expression in A549 cells infected with recombinant PR8 viruses containing wt NS1 or NS1 with different mutations (MOI = 5) was measured by qRT‐PCR. Values represent n ‐fold expression of mock‐infected cells and are displayed as mean ± SD of three independently repeated experiments. One‐way ANOVA followed by Dunnett's multiple comparisons test using T49 or T215 as controls was used for statistical analysis of each time point separately (** p ≤ 0.01). C, D. Phosphorylation of NS1 T49 suppresses IFNβ promoter activity. A549 cells were transfected with pcDNA3 plasmids containing different NS1 genes and with luciferase reporter gene plasmids harbouring the IFN promotor or the IRF‐3 domain only. After 24 h, cells were stimulated with vRNA or cellular RNA and luciferase activity in cell lysates was measured after 6 h. Results represent means ± SD of three independently repeated experiments. Luciferase activity of empty vector transfected, cellular RNA stimulated cells was taken as unity. Statistical significance of vRNA stimulated cells was analysed by one‐way ANOVA followed by Dunnett's multiple comparisons test using T49 as control (** p ≤ 0.01, *** p ≤ 0.001). E. Multi‐cycle replication kinetics of recombinant PR8 viruses with wt NS1 or NS1 with different mutations in Vero cells infected at a MOI of 0.01. Results represent means ± SD of three independently repeated experiments. F. Viral replication in lungs of C57Bl/6 and C57Bl/6 Ifnar1 –/– mice. Mice were infected with 10 3 PFU of PR8/NS1‐T49 or PR8/NS1‐T49E and lung virus titers were determined after 3 days. PFU/ml of lung homogenate are presented. Statistical analysis was performed using the Mann‐Whitney U test (** p ≤ 0.01).

    Journal: Cellular Microbiology

    Article Title: Phosphorylation of influenza A virus NS1 protein at threonine 49 suppresses its interferon antagonistic activity) Phosphorylation of influenza A virus NS1 protein at threonine 49 suppresses its interferon antagonistic activity

    doi: 10.1111/cmi.12559

    Figure Lengend Snippet: The T49E substitution affects interferon β (IFNβ) antagonistic properties of NS1. A, B. IFNβ mRNA expression in A549 cells infected with recombinant PR8 viruses containing wt NS1 or NS1 with different mutations (MOI = 5) was measured by qRT‐PCR. Values represent n ‐fold expression of mock‐infected cells and are displayed as mean ± SD of three independently repeated experiments. One‐way ANOVA followed by Dunnett's multiple comparisons test using T49 or T215 as controls was used for statistical analysis of each time point separately (** p ≤ 0.01). C, D. Phosphorylation of NS1 T49 suppresses IFNβ promoter activity. A549 cells were transfected with pcDNA3 plasmids containing different NS1 genes and with luciferase reporter gene plasmids harbouring the IFN promotor or the IRF‐3 domain only. After 24 h, cells were stimulated with vRNA or cellular RNA and luciferase activity in cell lysates was measured after 6 h. Results represent means ± SD of three independently repeated experiments. Luciferase activity of empty vector transfected, cellular RNA stimulated cells was taken as unity. Statistical significance of vRNA stimulated cells was analysed by one‐way ANOVA followed by Dunnett's multiple comparisons test using T49 as control (** p ≤ 0.01, *** p ≤ 0.001). E. Multi‐cycle replication kinetics of recombinant PR8 viruses with wt NS1 or NS1 with different mutations in Vero cells infected at a MOI of 0.01. Results represent means ± SD of three independently repeated experiments. F. Viral replication in lungs of C57Bl/6 and C57Bl/6 Ifnar1 –/– mice. Mice were infected with 10 3 PFU of PR8/NS1‐T49 or PR8/NS1‐T49E and lung virus titers were determined after 3 days. PFU/ml of lung homogenate are presented. Statistical analysis was performed using the Mann‐Whitney U test (** p ≤ 0.01).

    Article Snippet: The qRT‐PCR reaction mix (Brilliant III SYBR Green QPCR Master Mix) was purchased from Agilent Technologies.

    Techniques: Expressing, Infection, Recombinant, Quantitative RT-PCR, Activity Assay, Transfection, Luciferase, Plasmid Preparation, Mouse Assay, MANN-WHITNEY

    Phosphorylation of NS1 T49 leads to reduced vRNA, RIG‐I and TRIM25 binding as well as structural destabilization of the RBD. A. A549 cells were transfected with pcDNA3 plasmids containing wt NS1 or NS1 with indicated mutations or were mock transfected. Cell lysates were subjected to immunoprecipitations 24 h p.i. using mouse anti‐NS1 antibody. Washed beads were incubated with vRNA and RNA bound to immunocomplexes was extracted. The relative amount of viral NS1 mRNA was determined by qRT‐PCR as described previously (Habjan et al ., 2008 ). Data represents mean ± SD of two independently repeated experiments. B. Comparative binding scores of RNA to RBD T49E, T49A and T49 as calculated using random forest model from the RNA–protein interaction prediction (RPISeq) tool (Muppirala et al ., 2011 ). The RNA sequence was obtained from Protein Data Bank (PDB) ID 2ZKO (Cheng et al ., 2009 ). C. Structural simulation on 2ZKO structure employing DUET (Pires et al ., 2014b ) was predicted as destabilizing (−0.17 Kcal/mol) resulting in an unfavourable RNA binding ability. The figure shows the stereo‐chemical effect of E49 compared with T49. The RNA helix is shown in yellow, while the two monomers of the NS1 dimer are shown in green and blue. NS1 residues T49 and E49 are shown in red and purple respectively. Molecular graphic simulation was performed using Bioblender (Andrei et al ., 2012 ). D. For analysis of NS1‐RIG‐I interaction, HEK293 cells transiently expressing FLAG‐tagged RIG‐I and the indicated NS1 proteins were subjected to crosslinking with DSP after 48 h, followed by quenching with glycine. Control cells were mock transfected. FLAG‐tagged RIG‐I was immunoprecipitated with anti‐FLAG M2 antibody. Detection of FLAG‐tagged RIG‐I and co‐precipitated NS1 protein was performed by Western blotting. Detection of FLAG‐tagged RIG‐I and NS1 in the cell lysates before immunoprecipitation served as ‘input control’ ensuring comparable expression levels. E. For analysis of NS1‐TRIM25 interaction HEK293 cells were infected with PR8/NS1‐T49, PR8/NS1‐T49A or PR8/NS1‐T49E (MOI of 1, 5 or 10 respectively) or were mock infected (control).Eighteen h p.i. cells were lysed and lysates subjected to immunoprecipitation with mouse anti‐TRIM25 antibody. TRIM25 and the co‐precipitated NS1 were detected by Western blotting using mouse anti‐TRIM25 antibody or mouse anti‐NS1 antibody. Detection of TRIM25 and NS1 in the cell lysates before immunoprecipitation served as ‘input control’ ensuring comparable expression levels.

    Journal: Cellular Microbiology

    Article Title: Phosphorylation of influenza A virus NS1 protein at threonine 49 suppresses its interferon antagonistic activity) Phosphorylation of influenza A virus NS1 protein at threonine 49 suppresses its interferon antagonistic activity

    doi: 10.1111/cmi.12559

    Figure Lengend Snippet: Phosphorylation of NS1 T49 leads to reduced vRNA, RIG‐I and TRIM25 binding as well as structural destabilization of the RBD. A. A549 cells were transfected with pcDNA3 plasmids containing wt NS1 or NS1 with indicated mutations or were mock transfected. Cell lysates were subjected to immunoprecipitations 24 h p.i. using mouse anti‐NS1 antibody. Washed beads were incubated with vRNA and RNA bound to immunocomplexes was extracted. The relative amount of viral NS1 mRNA was determined by qRT‐PCR as described previously (Habjan et al ., 2008 ). Data represents mean ± SD of two independently repeated experiments. B. Comparative binding scores of RNA to RBD T49E, T49A and T49 as calculated using random forest model from the RNA–protein interaction prediction (RPISeq) tool (Muppirala et al ., 2011 ). The RNA sequence was obtained from Protein Data Bank (PDB) ID 2ZKO (Cheng et al ., 2009 ). C. Structural simulation on 2ZKO structure employing DUET (Pires et al ., 2014b ) was predicted as destabilizing (−0.17 Kcal/mol) resulting in an unfavourable RNA binding ability. The figure shows the stereo‐chemical effect of E49 compared with T49. The RNA helix is shown in yellow, while the two monomers of the NS1 dimer are shown in green and blue. NS1 residues T49 and E49 are shown in red and purple respectively. Molecular graphic simulation was performed using Bioblender (Andrei et al ., 2012 ). D. For analysis of NS1‐RIG‐I interaction, HEK293 cells transiently expressing FLAG‐tagged RIG‐I and the indicated NS1 proteins were subjected to crosslinking with DSP after 48 h, followed by quenching with glycine. Control cells were mock transfected. FLAG‐tagged RIG‐I was immunoprecipitated with anti‐FLAG M2 antibody. Detection of FLAG‐tagged RIG‐I and co‐precipitated NS1 protein was performed by Western blotting. Detection of FLAG‐tagged RIG‐I and NS1 in the cell lysates before immunoprecipitation served as ‘input control’ ensuring comparable expression levels. E. For analysis of NS1‐TRIM25 interaction HEK293 cells were infected with PR8/NS1‐T49, PR8/NS1‐T49A or PR8/NS1‐T49E (MOI of 1, 5 or 10 respectively) or were mock infected (control).Eighteen h p.i. cells were lysed and lysates subjected to immunoprecipitation with mouse anti‐TRIM25 antibody. TRIM25 and the co‐precipitated NS1 were detected by Western blotting using mouse anti‐TRIM25 antibody or mouse anti‐NS1 antibody. Detection of TRIM25 and NS1 in the cell lysates before immunoprecipitation served as ‘input control’ ensuring comparable expression levels.

    Article Snippet: The qRT‐PCR reaction mix (Brilliant III SYBR Green QPCR Master Mix) was purchased from Agilent Technologies.

    Techniques: Binding Assay, Transfection, Incubation, Quantitative RT-PCR, Sequencing, RNA Binding Assay, Expressing, Immunoprecipitation, Western Blot, Infection