brdu  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Anti Brdu Antibody
    Description:
    The Anti Bromodeoxyuridine Antibody is supplied in the same formulation as the monoclonal antibody to BrdU in the kit The antibody nuclease mixture is compatible with detection systems that incorporate fluorescently labeled antibodies and biotin streptavidin detection reagents
    Catalog Number:
    GERPN202
    Price:
    None
    Conjugate:
    unconjugated
    Category:
    Antibodies
    Source:
    mouse
    Reactivity:
    human
    Score:
    85
    Buy from Supplier


    Structured Review

    Millipore brdu
    Fear conditioning induces <t>Shh/BrdU/NeuN-positive</t> cells in the basolateral amygdala (BLA). (A) Mice were intraperitoneally injected with BrdU (300mg/kg) 2h before fear conditioning and BrdU + /Shh + /NeuN + cells were analyzed 42 days after training. (B) GFAP + /Shh + /DAPI + cells were analyzed 3 days after training. BrdU, 5-bromo-2’-deoxyuridine; GFAP, Glial fibrillary acidic protein; Shh, sonic hedgehog.
    The Anti Bromodeoxyuridine Antibody is supplied in the same formulation as the monoclonal antibody to BrdU in the kit The antibody nuclease mixture is compatible with detection systems that incorporate fluorescently labeled antibodies and biotin streptavidin detection reagents
    https://www.bioz.com/result/brdu/product/Millipore
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    brdu - by Bioz Stars, 2019-10
    99/100 stars

    Images

    1) Product Images from "Learning Induces Sonic Hedgehog Signaling in the Amygdala which Promotes Neurogenesis and Long-Term Memory Formation"

    Article Title: Learning Induces Sonic Hedgehog Signaling in the Amygdala which Promotes Neurogenesis and Long-Term Memory Formation

    Journal: International Journal of Neuropsychopharmacology

    doi: 10.1093/ijnp/pyu071

    Fear conditioning induces Shh/BrdU/NeuN-positive cells in the basolateral amygdala (BLA). (A) Mice were intraperitoneally injected with BrdU (300mg/kg) 2h before fear conditioning and BrdU + /Shh + /NeuN + cells were analyzed 42 days after training. (B) GFAP + /Shh + /DAPI + cells were analyzed 3 days after training. BrdU, 5-bromo-2’-deoxyuridine; GFAP, Glial fibrillary acidic protein; Shh, sonic hedgehog.
    Figure Legend Snippet: Fear conditioning induces Shh/BrdU/NeuN-positive cells in the basolateral amygdala (BLA). (A) Mice were intraperitoneally injected with BrdU (300mg/kg) 2h before fear conditioning and BrdU + /Shh + /NeuN + cells were analyzed 42 days after training. (B) GFAP + /Shh + /DAPI + cells were analyzed 3 days after training. BrdU, 5-bromo-2’-deoxyuridine; GFAP, Glial fibrillary acidic protein; Shh, sonic hedgehog.

    Techniques Used: Mouse Assay, Injection

    Effects of methylazoxymethanol acetate and cytosine arabinoside on freezing responses. Mice received an intraperitoneal injection of methylazoxymethanol (MAM) (7mg/kg) or vehicle once per day for 7 days. Two hours after the last injection, the mice were given 15 tone-shock pairings. (A) Mice were intraperitoneally injected with 5-bromo-2’-deoxyuridine (BrdU; 300mg/kg) 2h before fear conditioning and BrdU + /NeuN + cells were analyzed 42 days after training. (B) Quantification of BrdU + /NeuN + cells in the basolateral amygdala. * p
    Figure Legend Snippet: Effects of methylazoxymethanol acetate and cytosine arabinoside on freezing responses. Mice received an intraperitoneal injection of methylazoxymethanol (MAM) (7mg/kg) or vehicle once per day for 7 days. Two hours after the last injection, the mice were given 15 tone-shock pairings. (A) Mice were intraperitoneally injected with 5-bromo-2’-deoxyuridine (BrdU; 300mg/kg) 2h before fear conditioning and BrdU + /NeuN + cells were analyzed 42 days after training. (B) Quantification of BrdU + /NeuN + cells in the basolateral amygdala. * p

    Techniques Used: Mouse Assay, Injection

    Selective knockdown of sonic hedgehog (Shh) in mitotic neurons with small hairpin–interfering RNA (shRNA) by means of a retrovirus expression system reduces neurogenesis and impairs long-term memory formation. We generated retroviral vectors carrying either Shh -shRNA (Retro- Shh -shRNA) or scrambled shRNA. Retro- Shh -shRNA or scramble shRNA was infused bilaterally to the amygdala 10 days before fear conditioning. (A) Representative images of GFP + /Shh + /NeuN + cells in the basolateral amygdala of Retro- Shh -shRNA– or scramble-shRNA–treated mice were detected 42 days after training. (B) Mice were intraperitoneally injected with BrdU (300mg/kg) 2h before fear conditioning and BrdU + /NeuN + cells were analyzed 42 days after training. (C) Quantification of BrdU + /NeuN + cells in BLA of scramble- or Retro- Shh -shRNA–treated mice. * p
    Figure Legend Snippet: Selective knockdown of sonic hedgehog (Shh) in mitotic neurons with small hairpin–interfering RNA (shRNA) by means of a retrovirus expression system reduces neurogenesis and impairs long-term memory formation. We generated retroviral vectors carrying either Shh -shRNA (Retro- Shh -shRNA) or scrambled shRNA. Retro- Shh -shRNA or scramble shRNA was infused bilaterally to the amygdala 10 days before fear conditioning. (A) Representative images of GFP + /Shh + /NeuN + cells in the basolateral amygdala of Retro- Shh -shRNA– or scramble-shRNA–treated mice were detected 42 days after training. (B) Mice were intraperitoneally injected with BrdU (300mg/kg) 2h before fear conditioning and BrdU + /NeuN + cells were analyzed 42 days after training. (C) Quantification of BrdU + /NeuN + cells in BLA of scramble- or Retro- Shh -shRNA–treated mice. * p

    Techniques Used: shRNA, Expressing, Generated, Mouse Assay, Injection

    2) Product Images from "Atrial natriuretic peptide inhibits angiotensin II-stimulated proliferation in fetal cardiomyocytes"

    Article Title: Atrial natriuretic peptide inhibits angiotensin II-stimulated proliferation in fetal cardiomyocytes

    Journal:

    doi: 10.1113/jphysiol.2010.191098

    BrdU uptake in proliferating cultured fetal sheep cardiomyocytes
    Figure Legend Snippet: BrdU uptake in proliferating cultured fetal sheep cardiomyocytes

    Techniques Used: Cell Culture

    Inhibition of Ang II-stimulated BrdU uptake in cardiomyocytes with 8-bromo-cGMP
    Figure Legend Snippet: Inhibition of Ang II-stimulated BrdU uptake in cardiomyocytes with 8-bromo-cGMP

    Techniques Used: Inhibition

    Inhibition of Ang II-stimulated BrdU uptake in cardiomyocytes
    Figure Legend Snippet: Inhibition of Ang II-stimulated BrdU uptake in cardiomyocytes

    Techniques Used: Inhibition

    3) Product Images from "Stage-specific changes in fetal thymocyte proliferation during the CD4-8- to CD4+8+ transition in wild type, Rag1-/-, and Hoxa3,Pax1 mutant mice"

    Article Title: Stage-specific changes in fetal thymocyte proliferation during the CD4-8- to CD4+8+ transition in wild type, Rag1-/-, and Hoxa3,Pax1 mutant mice

    Journal: BMC Immunology

    doi: 10.1186/1471-2172-3-12

    Proliferation of E17.5 Hoxa3-Pax1 compound mutant thymocytes compared to wild type. Panels A-B show CD44 vs. CD25 dot plots of the gated CD3 - 4 - 8 - population from E17.5 wild type (A) and Hoxa3 +/- Pax1 -/- (B) thymus. Percentages are shown in each quadrant. C. Percentages of BrdU + cells (Mean ± SEM) in each of 4 subsets of TN cells defined by CD44 and CD25, and in DP cells. D, E. CD44 vs. CD25 dot plots of the gated CD3 - 4 - 8 - population divided into five subsets as defined by [ 12 ]. F. Percentages of BrdU + cells (Mean ± SEM) in each of 3 CD44 - TN subsets defined in panels D and E. DP values shown for comparison are the same as in C.
    Figure Legend Snippet: Proliferation of E17.5 Hoxa3-Pax1 compound mutant thymocytes compared to wild type. Panels A-B show CD44 vs. CD25 dot plots of the gated CD3 - 4 - 8 - population from E17.5 wild type (A) and Hoxa3 +/- Pax1 -/- (B) thymus. Percentages are shown in each quadrant. C. Percentages of BrdU + cells (Mean ± SEM) in each of 4 subsets of TN cells defined by CD44 and CD25, and in DP cells. D, E. CD44 vs. CD25 dot plots of the gated CD3 - 4 - 8 - population divided into five subsets as defined by [ 12 ]. F. Percentages of BrdU + cells (Mean ± SEM) in each of 3 CD44 - TN subsets defined in panels D and E. DP values shown for comparison are the same as in C.

    Techniques Used: Mutagenesis

    DNA synthesis patterns of fetal vs. adult thymocyte subsets as measured by incorporation of BrdU A. Thymocytes were gated as either CD3 - 4 - 8 - TN or CD3 + 4 + 8 + DP by cell surface marker expression and forward scatter (SP cells should be located between these two gates, and therefore excluded from analysis). B. Gate used for analysis of BrdU incorporation on gated subpopulations. Panels C-E show CD44 vs. CD25 dot plots of the gated CD3 - 4 - 8 - population from 5–6 week old adult C57BL/6 (C), E17.5 fetal C57BL/6 (D), and E17.5 fetal RAG -/- (E). Percentages are shown in each quadrant. F. Percentages of BrdU + cells (Mean ± SEM) in each subset of TN cells defined by CD44 and CD25, and in DP cells. G. Adult wild-type thymocytes were gated as CD3 - 4 - 8 - B220 - NK1.1 - . H. CD44 vs. CD25 dot plots of the gated population from (G). I. Percentage of BrdU + cells (mean ± SEM) in adult and fetal TN1 thymocytes excluding B and NK cells (H, G).
    Figure Legend Snippet: DNA synthesis patterns of fetal vs. adult thymocyte subsets as measured by incorporation of BrdU A. Thymocytes were gated as either CD3 - 4 - 8 - TN or CD3 + 4 + 8 + DP by cell surface marker expression and forward scatter (SP cells should be located between these two gates, and therefore excluded from analysis). B. Gate used for analysis of BrdU incorporation on gated subpopulations. Panels C-E show CD44 vs. CD25 dot plots of the gated CD3 - 4 - 8 - population from 5–6 week old adult C57BL/6 (C), E17.5 fetal C57BL/6 (D), and E17.5 fetal RAG -/- (E). Percentages are shown in each quadrant. F. Percentages of BrdU + cells (Mean ± SEM) in each subset of TN cells defined by CD44 and CD25, and in DP cells. G. Adult wild-type thymocytes were gated as CD3 - 4 - 8 - B220 - NK1.1 - . H. CD44 vs. CD25 dot plots of the gated population from (G). I. Percentage of BrdU + cells (mean ± SEM) in adult and fetal TN1 thymocytes excluding B and NK cells (H, G).

    Techniques Used: DNA Synthesis, Marker, Expressing, BrdU Incorporation Assay

    4) Product Images from "Direct Evidence from Single-Cell Analysis that Human ?-Defensins Block Adenovirus Uncoating To Neutralize Infection"

    Article Title: Direct Evidence from Single-Cell Analysis that Human ?-Defensins Block Adenovirus Uncoating To Neutralize Infection

    Journal:

    doi: 10.1128/JVI.02471-09

    Detection of BrdU in labeled, uncoated virus particles in infected cells. Representative images, which are stained for hexon (red), BrdU (blue), and lamin (green), are shown for unlabeled HAdV-5 wild type (WT) (A), labeled HAdV-5 WT (B), and labeled HAdV-5P137L (C) viruses. Scale bars are 10 μm. (D) Percent uncoating was determined for HAdV-5 (WT) or HAdV-5P137L (5P137L) vectors, labeled (+) or unlabeled (−) with BrdU, at 45 min postinfection in A549 cells. Data are the means and standard errors of the means of the results from three independent experiments in which ∼30 cells were evaluated for each condition. Note that the low value for the unlabeled WT virus in this assay does not indicate that the virus failed to uncoat but reflects the absence of BrdU in its genome.
    Figure Legend Snippet: Detection of BrdU in labeled, uncoated virus particles in infected cells. Representative images, which are stained for hexon (red), BrdU (blue), and lamin (green), are shown for unlabeled HAdV-5 wild type (WT) (A), labeled HAdV-5 WT (B), and labeled HAdV-5P137L (C) viruses. Scale bars are 10 μm. (D) Percent uncoating was determined for HAdV-5 (WT) or HAdV-5P137L (5P137L) vectors, labeled (+) or unlabeled (−) with BrdU, at 45 min postinfection in A549 cells. Data are the means and standard errors of the means of the results from three independent experiments in which ∼30 cells were evaluated for each condition. Note that the low value for the unlabeled WT virus in this assay does not indicate that the virus failed to uncoat but reflects the absence of BrdU in its genome.

    Techniques Used: Labeling, Infection, Staining

    Kinetics of hexon trafficking and genome exposure and translocation in infected cells. A549 cells were infected with BrdU-labeled HAdV-5 and analyzed for hexon colocalization with the nucleus (A), normalized percent uncoating (B), and BrdU colocalization with the nucleus (C) at the indicated times postinfection. Points represent the mean values from each of three independent experiments in which ∼30 cells were evaluated at each time point. Lines connect the averages of these mean values. In panel C, no value is given for the zero time point, as no uncoating occurred.
    Figure Legend Snippet: Kinetics of hexon trafficking and genome exposure and translocation in infected cells. A549 cells were infected with BrdU-labeled HAdV-5 and analyzed for hexon colocalization with the nucleus (A), normalized percent uncoating (B), and BrdU colocalization with the nucleus (C) at the indicated times postinfection. Points represent the mean values from each of three independent experiments in which ∼30 cells were evaluated at each time point. Lines connect the averages of these mean values. In panel C, no value is given for the zero time point, as no uncoating occurred.

    Techniques Used: Translocation Assay, Infection, Labeling

    5) Product Images from "DNA methyltransferase-3-dependent nonrandom template segregation in differentiating embryonic stem cells"

    Article Title: DNA methyltransferase-3-dependent nonrandom template segregation in differentiating embryonic stem cells

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.201307110

    Single- and double-labeling methods to assess nonrandom template DNA strand segregation. (a and b) Two pairs of chromosomes are represented for clarity. Newly synthesized DNA strands are shown in dashed, colored lines. After one round of cell division, all cells are labeled with BrdU for the single-labeling method (a) or CldU for the double-labeling method (b). It is only after the second division that NRTS can be observed. If cells randomly distribute their template DNA, the two resulting daughter cells will inherit BrdU (a)- or CldU (b)-labeled strands. However, if all template DNA chromosomes are segregated to one daughter cell, the other daughter cell inherits the BrdU (a)- or CldU (b)-labeled newly synthesized DNA strands (after the second round of division, all daughter cells are labeled with IdU in the double-labeling method).
    Figure Legend Snippet: Single- and double-labeling methods to assess nonrandom template DNA strand segregation. (a and b) Two pairs of chromosomes are represented for clarity. Newly synthesized DNA strands are shown in dashed, colored lines. After one round of cell division, all cells are labeled with BrdU for the single-labeling method (a) or CldU for the double-labeling method (b). It is only after the second division that NRTS can be observed. If cells randomly distribute their template DNA, the two resulting daughter cells will inherit BrdU (a)- or CldU (b)-labeled strands. However, if all template DNA chromosomes are segregated to one daughter cell, the other daughter cell inherits the BrdU (a)- or CldU (b)-labeled newly synthesized DNA strands (after the second round of division, all daughter cells are labeled with IdU in the double-labeling method).

    Techniques Used: Labeling, Synthesized, IF-cells

    High occurrence of NRTS during hESC and mESC differentiation. (a) Experimental design scheme representing how NRTS was assessed in EBs 7 d after differentiation for H9 hESCs that have a population doubling time of 24 h. The first label (BrdU for single labeling or CldU for double labeling) was added to EBs for 8 h between days 6 and 7. This was followed by a 16-h chase without any label. 24 h after addition of the first label, when cells have completed one division and started a second one, EBs were dissociated into single cells, plated at very low density, and allowed to complete the second division (in the presence of IdU for the double-labeling method). Paired cells were then fixed and stained for BrdU or CldU and IdU. (b) Theoretical predicted outcomes of the experiment described in a. (c) H9 hESC pairs that are symmetric (top) or asymmetric (bottom) for BrdU in the single-labeling method. Paired-cell assays were performed on EBs 7 d after differentiation. Representative photographs of cell pairs immunostained for BrdU are shown alongside bright-field (BF) and DAPI nuclear counterstaining images. (d) Quantification of asymmetric pairs during H9 hESC differentiation. Paired-cell assays were performed at different days after EB formation as indicated. Cell pairs were immunostained for BrdU. More than 200 pairs were analyzed per time point and the percentage of pairs showing asymmetric BrdU (i.e., NRTS) was quantified. Data represent means ± SEM ( n = 3 independent experiments). (e and f) H9 hESC (e) and R1 mESC (f) pairs that are symmetric or asymmetric for CldU in the double-labeling method. Paired-cell assays were performed on EBs 7 d after differentiation. Cell pairs were immunostained for CldU and IdU. Bright-field images and DAPI nuclear counterstaining are shown. Representative photographs of symmetric (top), asymmetric (middle), and IgG control (bottom) pairs are displayed for each cell line. (g and h) CldU (g) and IdU (h) fluorescence intensity distribution among daughter cells from R1-derived EB pairs experiment using the CldU/IdU double-labeling method. CldU intensity was normalized to IdU intensity for each cell, and IgG background was subtracted from the CldU and IdU signals. The scatter graphs show the quantification of immunofluorescence intensity of visually symmetric (with a distribution from equal to 60:40, as indicated) and visually asymmetric (with a distribution of 90:10 or greater, as indicated) pairs of cells ( n = 58 representative pairs from three to four independent experiments). (i) Quantification of the occurrence of NRTS in H9- and R1-derived EBs 7 d after differentiation and IMR-90 human fetal fibroblasts using the CldU/IdU double-labeling method. NRTS frequency was also quantified in R1-derived EBs after the first division in which the CldU label is expected to be segregated to both daughter cells. NRTS occurrence in undifferentiated R1 mESCs was assessed using the BrdU single-labeling method and quantified among Oct4 double-positive pairs. More than 100 pairs were analyzed for each cell line per experiment, and the percentage of cells showing asymmetric CldU or BrdU (i.e., NRTS) was quantified (all cells had symmetric IdU in the double-labeling method). Data represent means ± SEM ( n = 3–6 independent experiments).
    Figure Legend Snippet: High occurrence of NRTS during hESC and mESC differentiation. (a) Experimental design scheme representing how NRTS was assessed in EBs 7 d after differentiation for H9 hESCs that have a population doubling time of 24 h. The first label (BrdU for single labeling or CldU for double labeling) was added to EBs for 8 h between days 6 and 7. This was followed by a 16-h chase without any label. 24 h after addition of the first label, when cells have completed one division and started a second one, EBs were dissociated into single cells, plated at very low density, and allowed to complete the second division (in the presence of IdU for the double-labeling method). Paired cells were then fixed and stained for BrdU or CldU and IdU. (b) Theoretical predicted outcomes of the experiment described in a. (c) H9 hESC pairs that are symmetric (top) or asymmetric (bottom) for BrdU in the single-labeling method. Paired-cell assays were performed on EBs 7 d after differentiation. Representative photographs of cell pairs immunostained for BrdU are shown alongside bright-field (BF) and DAPI nuclear counterstaining images. (d) Quantification of asymmetric pairs during H9 hESC differentiation. Paired-cell assays were performed at different days after EB formation as indicated. Cell pairs were immunostained for BrdU. More than 200 pairs were analyzed per time point and the percentage of pairs showing asymmetric BrdU (i.e., NRTS) was quantified. Data represent means ± SEM ( n = 3 independent experiments). (e and f) H9 hESC (e) and R1 mESC (f) pairs that are symmetric or asymmetric for CldU in the double-labeling method. Paired-cell assays were performed on EBs 7 d after differentiation. Cell pairs were immunostained for CldU and IdU. Bright-field images and DAPI nuclear counterstaining are shown. Representative photographs of symmetric (top), asymmetric (middle), and IgG control (bottom) pairs are displayed for each cell line. (g and h) CldU (g) and IdU (h) fluorescence intensity distribution among daughter cells from R1-derived EB pairs experiment using the CldU/IdU double-labeling method. CldU intensity was normalized to IdU intensity for each cell, and IgG background was subtracted from the CldU and IdU signals. The scatter graphs show the quantification of immunofluorescence intensity of visually symmetric (with a distribution from equal to 60:40, as indicated) and visually asymmetric (with a distribution of 90:10 or greater, as indicated) pairs of cells ( n = 58 representative pairs from three to four independent experiments). (i) Quantification of the occurrence of NRTS in H9- and R1-derived EBs 7 d after differentiation and IMR-90 human fetal fibroblasts using the CldU/IdU double-labeling method. NRTS frequency was also quantified in R1-derived EBs after the first division in which the CldU label is expected to be segregated to both daughter cells. NRTS occurrence in undifferentiated R1 mESCs was assessed using the BrdU single-labeling method and quantified among Oct4 double-positive pairs. More than 100 pairs were analyzed for each cell line per experiment, and the percentage of cells showing asymmetric CldU or BrdU (i.e., NRTS) was quantified (all cells had symmetric IdU in the double-labeling method). Data represent means ± SEM ( n = 3–6 independent experiments).

    Techniques Used: Labeling, Staining, Fluorescence, Derivative Assay, Immunofluorescence

    6) Product Images from "Astrocyte Proliferation Following Stroke in the Mouse Depends on Distance from the Infarct"

    Article Title: Astrocyte Proliferation Following Stroke in the Mouse Depends on Distance from the Infarct

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0027881

    Astrocyte proliferation as a function of distance from the infarct core. BrdU labelling on day 2 or 2–6 cumulatively shows a small percentage of mature Aldh1l1 + astrocytes proliferate after MCAO within 400 µm of the ischemic core. Stereological analysis of astrocyte proliferation as a function of distance shows that Aldh1l1 + cells mainly co-express BrdU in the first 200 µm from the infarct area; the number decreases dramatically with distance. The fraction of proliferating astrocytes compared to all proliferating cells in the penumbra is low (A), and the fraction of proliferating astrocytes present falls rapidly with distance (B), and the fraction of all astrocytes present that proliferate is highest close to the core (C).
    Figure Legend Snippet: Astrocyte proliferation as a function of distance from the infarct core. BrdU labelling on day 2 or 2–6 cumulatively shows a small percentage of mature Aldh1l1 + astrocytes proliferate after MCAO within 400 µm of the ischemic core. Stereological analysis of astrocyte proliferation as a function of distance shows that Aldh1l1 + cells mainly co-express BrdU in the first 200 µm from the infarct area; the number decreases dramatically with distance. The fraction of proliferating astrocytes compared to all proliferating cells in the penumbra is low (A), and the fraction of proliferating astrocytes present falls rapidly with distance (B), and the fraction of all astrocytes present that proliferate is highest close to the core (C).

    Techniques Used:

    Cellular proliferation assessed with BrdU. (A) Low power micrographs show the edge of the core outlined by Aldh1l1 fluorescent astrocytes (green) present at the boundary visibly separating the core from the surrounding tissue on days 3 and 7 after ischemia; higher magnification of the areas indicated in the white boxes are shown below the low power images. (B) To study the proliferative response BrdU was injected 3 times/day on day 2 and animals were sacrificed on day 3 to determine the early response. A second group was injected 3 times/day from days 2–6 to analyze cumulative proliferation over the week following stroke, with animals sacrificed on day 7. (C) Panoramic views of sections immunostained for BrdU show proliferation in both penumbra (P) and ischemic core (IC), with somewhat stronger staining in penumbra on day 2, while the core showed more labelled cells on days 2–6. (D) Morphometric analysis shows the density of each cell type in the penumbra, demonstrating an increased inflammatory reaction surrounding the core. Sham animals were also analyzed for the number of each cell type on day 3 and 7, but the numbers for each cell type did not change significantly, so only the data for day 3 is shown. No MPO positive cells were detected in the sham animals. Scale Bar, 50 µm.
    Figure Legend Snippet: Cellular proliferation assessed with BrdU. (A) Low power micrographs show the edge of the core outlined by Aldh1l1 fluorescent astrocytes (green) present at the boundary visibly separating the core from the surrounding tissue on days 3 and 7 after ischemia; higher magnification of the areas indicated in the white boxes are shown below the low power images. (B) To study the proliferative response BrdU was injected 3 times/day on day 2 and animals were sacrificed on day 3 to determine the early response. A second group was injected 3 times/day from days 2–6 to analyze cumulative proliferation over the week following stroke, with animals sacrificed on day 7. (C) Panoramic views of sections immunostained for BrdU show proliferation in both penumbra (P) and ischemic core (IC), with somewhat stronger staining in penumbra on day 2, while the core showed more labelled cells on days 2–6. (D) Morphometric analysis shows the density of each cell type in the penumbra, demonstrating an increased inflammatory reaction surrounding the core. Sham animals were also analyzed for the number of each cell type on day 3 and 7, but the numbers for each cell type did not change significantly, so only the data for day 3 is shown. No MPO positive cells were detected in the sham animals. Scale Bar, 50 µm.

    Techniques Used: Injection, Staining

    Few Aldh1l1 + astrocytes proliferate in the cortical penumbra. (A) Triple labelling reveals that most astrocytes in the cortical penumbra label for GFAP, Aldh1l1 and S100β. (B) Orthogonal view of a mature astrocyte co-expressing Aldh1l1, BrdU and GFAP in the cortical penumbra. (C) The number of Aldh1l1 + astrocytes assessed in layers II–III of the cortical penumbra does not change over the first week post-injury, or compared to sham animals. (D) Illustrative confocal micrographs show increased prominence of Aldh1l1 positive cells with cellular hypertrophy, but no change in overall number. Scale Bar, 50 µm.
    Figure Legend Snippet: Few Aldh1l1 + astrocytes proliferate in the cortical penumbra. (A) Triple labelling reveals that most astrocytes in the cortical penumbra label for GFAP, Aldh1l1 and S100β. (B) Orthogonal view of a mature astrocyte co-expressing Aldh1l1, BrdU and GFAP in the cortical penumbra. (C) The number of Aldh1l1 + astrocytes assessed in layers II–III of the cortical penumbra does not change over the first week post-injury, or compared to sham animals. (D) Illustrative confocal micrographs show increased prominence of Aldh1l1 positive cells with cellular hypertrophy, but no change in overall number. Scale Bar, 50 µm.

    Techniques Used: Expressing

    7) Product Images from "Adult Hippocampal Neurogenesis Modulation by the Membrane-Associated Progesterone Receptor Family Member Neudesin"

    Article Title: Adult Hippocampal Neurogenesis Modulation by the Membrane-Associated Progesterone Receptor Family Member Neudesin

    Journal: Frontiers in Cellular Neuroscience

    doi: 10.3389/fncel.2018.00463

    Neudesin ablation decreases proliferation selectively in the dorsal hippocampus. BrdU labeling for 24 h in the total sub-granular zone SGZ revealed that neuron-derived neurotrophic factor (NENF) ablation decreases proliferation (A) . NENF −/− mice, when compared to the respective littermate controls, did not show proliferative rate differences in the subventricular zone (SVZ; B ). When considering the SGZ divisions, dorsal (C) and ventral (D) , the effect of NENF is restricted to the dorsal pole although a slight decrease is also observed in the ventral pole of Nenf −/− males but not significant. Ki67 positive cell counts in the dorsal (E) and ventral (D) SGZ, showed a selective significant decrease in proliferation of NENF −/− mice in the dorsal area. Data presented as Mean ± SEM analyzed by two-tailed Student’s t -test. * p
    Figure Legend Snippet: Neudesin ablation decreases proliferation selectively in the dorsal hippocampus. BrdU labeling for 24 h in the total sub-granular zone SGZ revealed that neuron-derived neurotrophic factor (NENF) ablation decreases proliferation (A) . NENF −/− mice, when compared to the respective littermate controls, did not show proliferative rate differences in the subventricular zone (SVZ; B ). When considering the SGZ divisions, dorsal (C) and ventral (D) , the effect of NENF is restricted to the dorsal pole although a slight decrease is also observed in the ventral pole of Nenf −/− males but not significant. Ki67 positive cell counts in the dorsal (E) and ventral (D) SGZ, showed a selective significant decrease in proliferation of NENF −/− mice in the dorsal area. Data presented as Mean ± SEM analyzed by two-tailed Student’s t -test. * p

    Techniques Used: Labeling, Derivative Assay, Mouse Assay, Two Tailed Test

    Ablation of NENF impairs neural committed cell proliferation, survival and maturation in the adult hippocampus. Schematic representation of hippocampal neurogenesis chronology and 5-bromo-2′-Deoxyuridine (BrdU) protocol, including specific markers for cellular types (A) . NENF is not expressed in 24 h labeled BrdU neuroblasts, its expression appears later in newly born granular neurons, as seen with NENF (green) and BrdU label retaining cells (LRC) for 7 weeks (red; B ). Co-labeling of doublecortin (DCX) and BrdU in Nenf +/+ and Nenf −/− animals is represented and proliferative neuroblasts counting in the SGZ of NENF +/+ and NENF −/− showed a significant decrease in the absence of NENF (C) . BrdU followed by 7 weeks of chase period identifies adult newborn granular neurons in the dentate gyrus (DG) by co-labeling with a neuron mature marker calbindin (Calb), as represented for Nenf +/+ and Nenf −/− animals. There was a significant reduction in the percentage of BrdU positive cells that co-label Calb in NENF −/− (D) . Data presented as Mean ± SEM analyzed by two-tailed Student’s t -test * p
    Figure Legend Snippet: Ablation of NENF impairs neural committed cell proliferation, survival and maturation in the adult hippocampus. Schematic representation of hippocampal neurogenesis chronology and 5-bromo-2′-Deoxyuridine (BrdU) protocol, including specific markers for cellular types (A) . NENF is not expressed in 24 h labeled BrdU neuroblasts, its expression appears later in newly born granular neurons, as seen with NENF (green) and BrdU label retaining cells (LRC) for 7 weeks (red; B ). Co-labeling of doublecortin (DCX) and BrdU in Nenf +/+ and Nenf −/− animals is represented and proliferative neuroblasts counting in the SGZ of NENF +/+ and NENF −/− showed a significant decrease in the absence of NENF (C) . BrdU followed by 7 weeks of chase period identifies adult newborn granular neurons in the dentate gyrus (DG) by co-labeling with a neuron mature marker calbindin (Calb), as represented for Nenf +/+ and Nenf −/− animals. There was a significant reduction in the percentage of BrdU positive cells that co-label Calb in NENF −/− (D) . Data presented as Mean ± SEM analyzed by two-tailed Student’s t -test * p

    Techniques Used: Labeling, Expressing, Marker, Two Tailed Test

    8) Product Images from "A Smad Signaling Network Regulates Islet Cell Proliferation"

    Article Title: A Smad Signaling Network Regulates Islet Cell Proliferation

    Journal: Diabetes

    doi: 10.2337/db13-0432

    Expression pattern of psmad2/3, smad7, TGF-β1 ligand, and pTGFβrII in an adult pancreas. A : pSmad2/3 expression in a normal adult islet showing that most islet cells have nuclear staining. B : Expression of pSmad2/3 post-PPx, in which some cells appear to have become psmad2/3–negative. C and D : After PPx, many of the cells that have switched off (arrows) or only weakly express (arrowheads) psmad2/3 are BrdU + . E : pTGFβrII (the active form of the receptor) is present throughout the adult islet at baseline (islet outlined by dotted line). F : At 24 h post-PPx, pTGFβrII is absent in many of the islet cells (islet outlined by dotted line). G – J : Smad7 expression pattern and time course, where Smad7 is not expressed in islets baseline, but becomes rapidly upregulated in islets within 24 h of performing a PPx, and expression persists in islets even 4 weeks after surgery. K and L : Many islet cells 1 week after PPx express smad7, and these cells are insulin-negative. M : Baseline expression of TGF-β1 ligand in an unperturbed adult islet. N : Smad7 turns on in some cells within 24 h of PPx; this mantle distribution of smad7 is frequently seen, but many islets have a more diffuse distribution of smad7 expression, as in H – J . O : Smad7 expression correlates with extracellular TGF-β1 ligand accumulation in the area of the islet where smad7 is acutely upregulated. N and O are consecutive histologic sections. Scale bars, A and B : 50 μm; C – F and J – N : 10 μm; G – I : 20 μm.
    Figure Legend Snippet: Expression pattern of psmad2/3, smad7, TGF-β1 ligand, and pTGFβrII in an adult pancreas. A : pSmad2/3 expression in a normal adult islet showing that most islet cells have nuclear staining. B : Expression of pSmad2/3 post-PPx, in which some cells appear to have become psmad2/3–negative. C and D : After PPx, many of the cells that have switched off (arrows) or only weakly express (arrowheads) psmad2/3 are BrdU + . E : pTGFβrII (the active form of the receptor) is present throughout the adult islet at baseline (islet outlined by dotted line). F : At 24 h post-PPx, pTGFβrII is absent in many of the islet cells (islet outlined by dotted line). G – J : Smad7 expression pattern and time course, where Smad7 is not expressed in islets baseline, but becomes rapidly upregulated in islets within 24 h of performing a PPx, and expression persists in islets even 4 weeks after surgery. K and L : Many islet cells 1 week after PPx express smad7, and these cells are insulin-negative. M : Baseline expression of TGF-β1 ligand in an unperturbed adult islet. N : Smad7 turns on in some cells within 24 h of PPx; this mantle distribution of smad7 is frequently seen, but many islets have a more diffuse distribution of smad7 expression, as in H – J . O : Smad7 expression correlates with extracellular TGF-β1 ligand accumulation in the area of the islet where smad7 is acutely upregulated. N and O are consecutive histologic sections. Scale bars, A and B : 50 μm; C – F and J – N : 10 μm; G – I : 20 μm.

    Techniques Used: Expressing, Staining

    Islet proliferation analysis in wild-type, smad2, smad3, and TGF-β receptor mutant mice (see Fig. 5 G for quantification). A : Minimal proliferation (BrdU uptake) in a wild-type islet without pancreatectomy. B : Enhanced proliferation in a wild-type islet 1 week after PPx. C : Further enhanced islet proliferation in pdx1-cre-ERT;smad2 fx/fx pancreas 1 week after PPx. D : At baseline (without pancreatectomy), pdx1-cre-ERT;smad2 fx/fx sham islets have slightly higher proliferation compared with either wild-type sham islets ( A ) or cre- littermates (not shown). Minimal proliferation in a smad3exon2 −/− islet without pancreatectomy ( E ) compared with marked islet hyperproliferation 1 week after PPx ( F ) in smad3exon2 −/− mice. G : Enhanced proliferation in islets of PTF1a-cre;smad2 fx/fx ;smad3exon2 −/− mice (pancreatic smad2/3 double-knockout mice) 1 week after PPx. H : Enhanced proliferation in islets of double TGFβrI/TGFβrII receptor mutation (pdx1-cre-ERT;TGFβrI fx/fx ;TGFβrII fx/fx ) 1 week after pancreatectomy. I : Enhanced proliferation in islets of TGFβrII single-mutant mice (pdx1-cre-ERT;TGFβrII fx/fx ) 1 week after pancreatectomy. J : Enhanced proliferation in islets of TGFβrII single-mutant mouse with gene deletion in all pancreatic cells (PTF1a-cre;TGFβrII fx/fx ). Scale bars, A , B , and D – J : 20 μm; C : 50 μm.
    Figure Legend Snippet: Islet proliferation analysis in wild-type, smad2, smad3, and TGF-β receptor mutant mice (see Fig. 5 G for quantification). A : Minimal proliferation (BrdU uptake) in a wild-type islet without pancreatectomy. B : Enhanced proliferation in a wild-type islet 1 week after PPx. C : Further enhanced islet proliferation in pdx1-cre-ERT;smad2 fx/fx pancreas 1 week after PPx. D : At baseline (without pancreatectomy), pdx1-cre-ERT;smad2 fx/fx sham islets have slightly higher proliferation compared with either wild-type sham islets ( A ) or cre- littermates (not shown). Minimal proliferation in a smad3exon2 −/− islet without pancreatectomy ( E ) compared with marked islet hyperproliferation 1 week after PPx ( F ) in smad3exon2 −/− mice. G : Enhanced proliferation in islets of PTF1a-cre;smad2 fx/fx ;smad3exon2 −/− mice (pancreatic smad2/3 double-knockout mice) 1 week after PPx. H : Enhanced proliferation in islets of double TGFβrI/TGFβrII receptor mutation (pdx1-cre-ERT;TGFβrI fx/fx ;TGFβrII fx/fx ) 1 week after pancreatectomy. I : Enhanced proliferation in islets of TGFβrII single-mutant mice (pdx1-cre-ERT;TGFβrII fx/fx ) 1 week after pancreatectomy. J : Enhanced proliferation in islets of TGFβrII single-mutant mouse with gene deletion in all pancreatic cells (PTF1a-cre;TGFβrII fx/fx ). Scale bars, A , B , and D – J : 20 μm; C : 50 μm.

    Techniques Used: Mutagenesis, Mouse Assay, Double Knockout

    9) Product Images from "An Important Role of the SDF-1/CXCR4 Axis in Chronic Skin Inflammation"

    Article Title: An Important Role of the SDF-1/CXCR4 Axis in Chronic Skin Inflammation

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0093665

    Inhibition of CXCR4 reduces inflammatory cell infiltration into the skin and normalizes epidermal architecture. (A–B) H E stains of ear skin sections at day 21 showed that AMD3100 treatment reduced edema formation, epidermal thickening and inflammatory cell infiltration. (C–D) CXCR4 inhibition reduced the number of intraepidermal BrdU + proliferating cells in the inflamed ear skin. (E–H) The hyperproliferation-associated keratin 6 and loricrin, a marker of terminal epidermal differentiation, were less broadly expressed in the epidermis of AMD3100-treated mice than in PBS-treated mice. (I–L) Immunofluorescence staining of the two macrophage markers F4/80 and CD68 revealed a significant reduction in the percentage of area covered by macrophages in AMD3100-treated mice compared to PBS treatment. (M–N) Inhibition of CXCR4 decreased the number of intraepidermal CD8 + T-cells in the inflamed ear skin. One ear half is shown. (O–P) Computer-assesed quantification of epidermal thickness (O), number of intraepidermal BrdU + cells (P), the percentage of covered area by F4/80 (Q) and CD68 (R) postitive macrophages and the number of intraepidermal CD8 + cells (S). Scale bars represent 100 μm. Data represent mean ±SD. * P
    Figure Legend Snippet: Inhibition of CXCR4 reduces inflammatory cell infiltration into the skin and normalizes epidermal architecture. (A–B) H E stains of ear skin sections at day 21 showed that AMD3100 treatment reduced edema formation, epidermal thickening and inflammatory cell infiltration. (C–D) CXCR4 inhibition reduced the number of intraepidermal BrdU + proliferating cells in the inflamed ear skin. (E–H) The hyperproliferation-associated keratin 6 and loricrin, a marker of terminal epidermal differentiation, were less broadly expressed in the epidermis of AMD3100-treated mice than in PBS-treated mice. (I–L) Immunofluorescence staining of the two macrophage markers F4/80 and CD68 revealed a significant reduction in the percentage of area covered by macrophages in AMD3100-treated mice compared to PBS treatment. (M–N) Inhibition of CXCR4 decreased the number of intraepidermal CD8 + T-cells in the inflamed ear skin. One ear half is shown. (O–P) Computer-assesed quantification of epidermal thickness (O), number of intraepidermal BrdU + cells (P), the percentage of covered area by F4/80 (Q) and CD68 (R) postitive macrophages and the number of intraepidermal CD8 + cells (S). Scale bars represent 100 μm. Data represent mean ±SD. * P

    Techniques Used: Inhibition, Marker, Mouse Assay, Immunofluorescence, Staining

    Inhibition of CXCR4 reduces imiquimod-induced skin inflammation. (A, B) Real-time RT-PCR analysis of extracts of IMQ-inflamed ear skin (8 consecutive days) and non-inflamed skin (n = 5 per group). The expression of CXCR4 and SDF-1 was significantly upregulated in IMQ-treated ear skin compared to uninflamed skin. (C–E) Immunofluorescence stains of ear skin for CXCR4 revealed a significantly increased CXCR4 + tissue area in IMQ-treated mice as compared with uninflamed skin. (F) Mice (n = 5 per group) received AMD3100 or PBS injections every 12 hours. 12 hours after the first injection, IMQ was applied topically, followed by daily applications for 8 days. (G) Treatment with AMD3100 (△) significantly reduced ear swelling as compared with PBS-treated controls (□). (H–J) H E stains of ear skin sections showed that AMD3100 treatment (I) significantly reduced epidermal thickening compared to PBS-treated mice (H). Scale bar represents 100 μm. (K) CXCR4 inhibition significantly reduced the number of intraepidermal BrdU + proliferating cells in the inflamed ear skin, as compared with control mice. Data represent mean±SD. * P
    Figure Legend Snippet: Inhibition of CXCR4 reduces imiquimod-induced skin inflammation. (A, B) Real-time RT-PCR analysis of extracts of IMQ-inflamed ear skin (8 consecutive days) and non-inflamed skin (n = 5 per group). The expression of CXCR4 and SDF-1 was significantly upregulated in IMQ-treated ear skin compared to uninflamed skin. (C–E) Immunofluorescence stains of ear skin for CXCR4 revealed a significantly increased CXCR4 + tissue area in IMQ-treated mice as compared with uninflamed skin. (F) Mice (n = 5 per group) received AMD3100 or PBS injections every 12 hours. 12 hours after the first injection, IMQ was applied topically, followed by daily applications for 8 days. (G) Treatment with AMD3100 (△) significantly reduced ear swelling as compared with PBS-treated controls (□). (H–J) H E stains of ear skin sections showed that AMD3100 treatment (I) significantly reduced epidermal thickening compared to PBS-treated mice (H). Scale bar represents 100 μm. (K) CXCR4 inhibition significantly reduced the number of intraepidermal BrdU + proliferating cells in the inflamed ear skin, as compared with control mice. Data represent mean±SD. * P

    Techniques Used: Inhibition, Quantitative RT-PCR, Expressing, Immunofluorescence, Mouse Assay, Injection

    10) Product Images from "Analysis of the In Vivo Turnover of CD4+ T-Cell Subsets in Chronically SIV-Infected Sooty Mangabeys"

    Article Title: Analysis of the In Vivo Turnover of CD4+ T-Cell Subsets in Chronically SIV-Infected Sooty Mangabeys

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0156352

    Ki67 and BrdU Expression Among Bulk Peripheral Blood Lymphocytes. The mean (±SEM) percent Ki67+ (A+B) and percent BrdU+ (C+D) of peripheral blood CD4+ (A+C) and CD8+ (B+D) T-cells were assessed longitudinally by flow cytometry in both uninfected (black squares) and infected (red circles) animals. p = NS between infected and uninfected controls at all timepoints for all populations (Mann-Whitney U). Shaded area represents BrdU administration period. Data points are shown only for animals above which 100 events were collected for the parent population.
    Figure Legend Snippet: Ki67 and BrdU Expression Among Bulk Peripheral Blood Lymphocytes. The mean (±SEM) percent Ki67+ (A+B) and percent BrdU+ (C+D) of peripheral blood CD4+ (A+C) and CD8+ (B+D) T-cells were assessed longitudinally by flow cytometry in both uninfected (black squares) and infected (red circles) animals. p = NS between infected and uninfected controls at all timepoints for all populations (Mann-Whitney U). Shaded area represents BrdU administration period. Data points are shown only for animals above which 100 events were collected for the parent population.

    Techniques Used: Expressing, Flow Cytometry, Cytometry, Infection, MANN-WHITNEY

    BrdU and Ki67 Expression By CD4+ and CD8+ T-cell Subsets. A-B. (±SEM) percent BrdU expression was assessed longitudinally by flow cytometry among CD4+ (A) and CD8+ (B) T N , T CM , T TM , T EM , and CCR5+ TM in uninfected (left) and SIV-infected (right) animals. C. Mean (±SEM) longitudinal Ki67 expression of CD4+ T N , T CM , T TM , T EM , and CCR5+ TM in uninfected (left) and SIV-infected (right) animals. p = NS between infected and uninfected controls at all timepoints for all populations (Mann-Whitney U). Shaded area represents BrdU administration period. Data points are shown only for animals above which 100 events were collected for the parent population.
    Figure Legend Snippet: BrdU and Ki67 Expression By CD4+ and CD8+ T-cell Subsets. A-B. (±SEM) percent BrdU expression was assessed longitudinally by flow cytometry among CD4+ (A) and CD8+ (B) T N , T CM , T TM , T EM , and CCR5+ TM in uninfected (left) and SIV-infected (right) animals. C. Mean (±SEM) longitudinal Ki67 expression of CD4+ T N , T CM , T TM , T EM , and CCR5+ TM in uninfected (left) and SIV-infected (right) animals. p = NS between infected and uninfected controls at all timepoints for all populations (Mann-Whitney U). Shaded area represents BrdU administration period. Data points are shown only for animals above which 100 events were collected for the parent population.

    Techniques Used: Expressing, Flow Cytometry, Cytometry, Electron Microscopy, Infection, MANN-WHITNEY

    11) Product Images from "Targeting Androgen Receptor/Src Complex Impairs the Aggressive Phenotype of Human Fibrosarcoma Cells"

    Article Title: Targeting Androgen Receptor/Src Complex Impairs the Aggressive Phenotype of Human Fibrosarcoma Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0076899

    Casodex inhibits the EGF-triggered DNA synthesis in human fibrosarcoma HT1080 cells and reduces the growth of HT1080 xenografts. Human fibrosarcoma HT1080 cells were used. In A , quiescent cells on coverslips were left un-stimulated or stimulated for 18 h with the indicated compounds. EGF (Roche) was used at 100 ng/ml; the synthetic androgen R1881 and DHT (both from Sigma) were used at 10 nM; Casodex (Sigma) was used at 10 μM. After in vivo pulse with BrdU (100 μM; Sigma), BrdU incorporation was analyzed by IF and expressed as % of total nuclei. Several independent experiments were performed in duplicate and the results were derived from at least 400 scored cells for each coverslip. Mean and SEM are shown. n represents the number of experiments. (**) p value
    Figure Legend Snippet: Casodex inhibits the EGF-triggered DNA synthesis in human fibrosarcoma HT1080 cells and reduces the growth of HT1080 xenografts. Human fibrosarcoma HT1080 cells were used. In A , quiescent cells on coverslips were left un-stimulated or stimulated for 18 h with the indicated compounds. EGF (Roche) was used at 100 ng/ml; the synthetic androgen R1881 and DHT (both from Sigma) were used at 10 nM; Casodex (Sigma) was used at 10 μM. After in vivo pulse with BrdU (100 μM; Sigma), BrdU incorporation was analyzed by IF and expressed as % of total nuclei. Several independent experiments were performed in duplicate and the results were derived from at least 400 scored cells for each coverslip. Mean and SEM are shown. n represents the number of experiments. (**) p value

    Techniques Used: DNA Synthesis, In Vivo, BrdU Incorporation Assay, Derivative Assay

    Inhibition by the S1 peptide of AR/Src complex, Src activation and DNA synthesis triggered by EGF in HT1080 cells. Quiescent HT1080 cells were used. Cells were left un-stimulated or stimulated for 10 min with EGF (at 100 ng/ml) in the absence or presence of S1 or Ss peptide (both at 1 nM). Casodex (at 10 μM) was used for comparison with the S1 peptide. Upper section in A , Western blot of HT1080 cell lysates with anti-EGFR antibody. Tubulin (tubulin) was revealed by immunoblot, as a loading control. Lower section in A , lysates were immune-precipitated with anti-EGFR Ab and proteins in immune complexes were detected using antibodies against the indicated proteins. In B , lysates were immune-precipitated with the anti-Src MAb and Src activity in immune complexes was assayed using acidified enolase, as a substrate. In C , cells on coverslips were left untreated or treated for 18 h with the indicated compounds. After in vivo pulse with BrdU (100 μM), BrdU incorporation was analyzed by IF and expressed as % of total nuclei. Several independent experiments were performed in duplicate and the results were obtained from at least 500 scored cells for each coverslip. Mean and SEM are shown. n represents the number of experiments. (*) p value
    Figure Legend Snippet: Inhibition by the S1 peptide of AR/Src complex, Src activation and DNA synthesis triggered by EGF in HT1080 cells. Quiescent HT1080 cells were used. Cells were left un-stimulated or stimulated for 10 min with EGF (at 100 ng/ml) in the absence or presence of S1 or Ss peptide (both at 1 nM). Casodex (at 10 μM) was used for comparison with the S1 peptide. Upper section in A , Western blot of HT1080 cell lysates with anti-EGFR antibody. Tubulin (tubulin) was revealed by immunoblot, as a loading control. Lower section in A , lysates were immune-precipitated with anti-EGFR Ab and proteins in immune complexes were detected using antibodies against the indicated proteins. In B , lysates were immune-precipitated with the anti-Src MAb and Src activity in immune complexes was assayed using acidified enolase, as a substrate. In C , cells on coverslips were left untreated or treated for 18 h with the indicated compounds. After in vivo pulse with BrdU (100 μM), BrdU incorporation was analyzed by IF and expressed as % of total nuclei. Several independent experiments were performed in duplicate and the results were obtained from at least 500 scored cells for each coverslip. Mean and SEM are shown. n represents the number of experiments. (*) p value

    Techniques Used: Inhibition, Activation Assay, DNA Synthesis, Western Blot, Activity Assay, In Vivo, BrdU Incorporation Assay

    12) Product Images from "Epigenetic stress responses induce muscle stem cell aging by Hoxa9 developmental signals"

    Article Title: Epigenetic stress responses induce muscle stem cell aging by Hoxa9 developmental signals

    Journal: Nature

    doi: 10.1038/nature20603

    Overexpression of Hox genes inhibits SC function a , Expression of Hoxa9 in SCs transduced with Hoxa9 cDNA or EGFP as control. b–c , FACS-isolated SCs from young adult mice were transduced with a lentivirus either containing both EGFP and Hoxa9 cDNA or only EGFP. Infected (EGFP + ) cells were isolated after 3 days. (b) Frequency of myogenic colonies from single cell-sorted SCs. (c) Quantification of cell number based on Alamar Blue assay of bulk cultures. d , Frequency of myogenic colonies of SCs overexpressing the indicated Hox genes. e+g , TUNEL (e) or BrdU (g) staining of SCs overexpressing Hoxa9 or EGFP. Infected (EGFP+) cells were isolated 3d after transduction and analyzed 3d later. Nuclei were counterstained with DAPI (blue). Arrowheads mark TUNEL or BrdU positive cells. f+h , Quantification of apoptosis (f) or proliferation (h) based on TUNEL or BrdU staining as in e or g. i , qRT-PCR based expression analysis of various cell-cycle and senescence markers in SCs overexpressing Hoxa9 compared to EGFP-infected controls, day 5 after infection. j , SA-ß-Galactosidase staining of SCs overexpressing Hoxa9 or EGFP at day 5 after infection. Arrowheads mark SA-ß-Gal positive cells. k , Quantification of senescence per field of view (FOV) based on SA-ß-Gal staining in j. l , Heat map displaying log2 fold changes of expression of selected genes from microarray analysis in Fig. 5a . m–o , qRT-PCR validation of differentially expressed genes annotated to Wnt- (m), TGFß- (n) and JAK/STAT pathways (o) as in l. p , Identification of Hoxa9 binding sites by anti-HA ChIP of primary myoblasts overexpressing HA-tagged Hoxa9 cDNA or EGFP as control. Shown is the qRT-PCR for 1 or 2 putative Hoxa9 binding sites at the indicated loci. Hoxa9 binding sites at target genes were identified as described in Methods and are listed in Supplementary Table 1 . A two-sided block bootstrap test on the difference of the percentage of bound DNA for all binding sites being equal to 0 was performed to test the hypothesis of a generally increased binding Hoxa9. q–s , SCs were infected with lentiviruses expressing Hoxa9 , Wnt3a , BMP4 , STAT3 cDNAs or EGFP. qRT-PCR analysis of expression of the indicated target genes at 5 days after infection: Axin2 (q), BMP4 (r) and STAT3 (s). Scale bars = 20 μm for e, g, 50 μm for j. Comparisons by two-sided student’s t-test (a–d, f, h, k, q–s) or two-way ANOVA (i, m–o). n=4 mice for a; n=3 mice for b; n=7 mice for c; n=3 mice for d; n=4 mice for f, h, k; n=3 mice (p15, p21), n=6 mice (p16), n=4 mice (all others) for i; n=4 pools of 3 mice for l; n=4 mice for m–o; n=3 biological replicates for p; n=3 mice (Wnt3a, BMP4, STAT3), n=4 mice (EGFP, Hoxa9) for q–s.
    Figure Legend Snippet: Overexpression of Hox genes inhibits SC function a , Expression of Hoxa9 in SCs transduced with Hoxa9 cDNA or EGFP as control. b–c , FACS-isolated SCs from young adult mice were transduced with a lentivirus either containing both EGFP and Hoxa9 cDNA or only EGFP. Infected (EGFP + ) cells were isolated after 3 days. (b) Frequency of myogenic colonies from single cell-sorted SCs. (c) Quantification of cell number based on Alamar Blue assay of bulk cultures. d , Frequency of myogenic colonies of SCs overexpressing the indicated Hox genes. e+g , TUNEL (e) or BrdU (g) staining of SCs overexpressing Hoxa9 or EGFP. Infected (EGFP+) cells were isolated 3d after transduction and analyzed 3d later. Nuclei were counterstained with DAPI (blue). Arrowheads mark TUNEL or BrdU positive cells. f+h , Quantification of apoptosis (f) or proliferation (h) based on TUNEL or BrdU staining as in e or g. i , qRT-PCR based expression analysis of various cell-cycle and senescence markers in SCs overexpressing Hoxa9 compared to EGFP-infected controls, day 5 after infection. j , SA-ß-Galactosidase staining of SCs overexpressing Hoxa9 or EGFP at day 5 after infection. Arrowheads mark SA-ß-Gal positive cells. k , Quantification of senescence per field of view (FOV) based on SA-ß-Gal staining in j. l , Heat map displaying log2 fold changes of expression of selected genes from microarray analysis in Fig. 5a . m–o , qRT-PCR validation of differentially expressed genes annotated to Wnt- (m), TGFß- (n) and JAK/STAT pathways (o) as in l. p , Identification of Hoxa9 binding sites by anti-HA ChIP of primary myoblasts overexpressing HA-tagged Hoxa9 cDNA or EGFP as control. Shown is the qRT-PCR for 1 or 2 putative Hoxa9 binding sites at the indicated loci. Hoxa9 binding sites at target genes were identified as described in Methods and are listed in Supplementary Table 1 . A two-sided block bootstrap test on the difference of the percentage of bound DNA for all binding sites being equal to 0 was performed to test the hypothesis of a generally increased binding Hoxa9. q–s , SCs were infected with lentiviruses expressing Hoxa9 , Wnt3a , BMP4 , STAT3 cDNAs or EGFP. qRT-PCR analysis of expression of the indicated target genes at 5 days after infection: Axin2 (q), BMP4 (r) and STAT3 (s). Scale bars = 20 μm for e, g, 50 μm for j. Comparisons by two-sided student’s t-test (a–d, f, h, k, q–s) or two-way ANOVA (i, m–o). n=4 mice for a; n=3 mice for b; n=7 mice for c; n=3 mice for d; n=4 mice for f, h, k; n=3 mice (p15, p21), n=6 mice (p16), n=4 mice (all others) for i; n=4 pools of 3 mice for l; n=4 mice for m–o; n=3 biological replicates for p; n=3 mice (Wnt3a, BMP4, STAT3), n=4 mice (EGFP, Hoxa9) for q–s.

    Techniques Used: Over Expression, Expressing, Transduction, FACS, Isolation, Mouse Assay, Infection, Alamar Blue Assay, TUNEL Assay, Staining, BrdU Staining, Quantitative RT-PCR, Microarray, Binding Assay, Hemagglutination Assay, Chromatin Immunoprecipitation, Blocking Assay

    Functional decline in aged SCs a , SCs from young adult and aged mice were sorted as single cells. After 5d, the frequency of myogenic colonies was assessed. The presence of at least 2 cells was considered as colony. b , Equal numbers of FACS-isolated SCs from young adult and aged mice were cultured for 4d and Alamar Blue assay was performed. c , TUNEL staining of SCs isolated from young adult or aged mice after 4d of culture. Nuclei were counterstained with DAPI (blue). d , Quantification of apoptosis based on TUNEL staining in c. e , BrdU staining of SCs isolated from young adult or aged mice after 4d of culture. Nuclei were counterstained with DAPI (blue). f , Quantification of proliferation based on BrdU staining in e. g , IF staining for Pax7 and MyoD on myofibers isolated from young adult and aged mice after 72h in culture. Nuclei were counterstained with DAPI (blue). h–j , Quantification of the number of SC-derived clusters with at least 3 adjacent cells (h), average number of all Pax7 + cells (i), or proportion of Pax7 + /MyoD − cells (j) within clusters as in g. Scale bars = 20 μm for c, g; 50 μm for e. Comparisons by two-sided student’s t-test. n=8 mice (young), n=10 mice (aged) for a; n=7 mice (young), n=5 mice (aged) for b; n=3 mice for d; n=4 mice for f; n=4 mice (aged) for j, n=5 mice (all others) for h–j.
    Figure Legend Snippet: Functional decline in aged SCs a , SCs from young adult and aged mice were sorted as single cells. After 5d, the frequency of myogenic colonies was assessed. The presence of at least 2 cells was considered as colony. b , Equal numbers of FACS-isolated SCs from young adult and aged mice were cultured for 4d and Alamar Blue assay was performed. c , TUNEL staining of SCs isolated from young adult or aged mice after 4d of culture. Nuclei were counterstained with DAPI (blue). d , Quantification of apoptosis based on TUNEL staining in c. e , BrdU staining of SCs isolated from young adult or aged mice after 4d of culture. Nuclei were counterstained with DAPI (blue). f , Quantification of proliferation based on BrdU staining in e. g , IF staining for Pax7 and MyoD on myofibers isolated from young adult and aged mice after 72h in culture. Nuclei were counterstained with DAPI (blue). h–j , Quantification of the number of SC-derived clusters with at least 3 adjacent cells (h), average number of all Pax7 + cells (i), or proportion of Pax7 + /MyoD − cells (j) within clusters as in g. Scale bars = 20 μm for c, g; 50 μm for e. Comparisons by two-sided student’s t-test. n=8 mice (young), n=10 mice (aged) for a; n=7 mice (young), n=5 mice (aged) for b; n=3 mice for d; n=4 mice for f; n=4 mice (aged) for j, n=5 mice (all others) for h–j.

    Techniques Used: Functional Assay, Mouse Assay, FACS, Isolation, Cell Culture, Alamar Blue Assay, TUNEL Assay, Staining, BrdU Staining, Derivative Assay

    13) Product Images from "A Majority of Human Melanoma Cell Lines Exhibits an S Phase-Specific Defect in Excision of UV-Induced DNA Photoproducts"

    Article Title: A Majority of Human Melanoma Cell Lines Exhibits an S Phase-Specific Defect in Excision of UV-Induced DNA Photoproducts

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0085294

    Cell cycle-specific CPD excision in melanoma cell lines. Cells were irradiated with 10/m 2 UVC and then labeled with BrdU for 1 h (except for the 0 h time point, where BrdU labeling was performed for 30 min prior to UV). At the indicated times post-UV, cells were stained with anti-CPD (FITC), PI, and anti-BrdU (Alexa-647) and analyzed by flow cytometry. A ) Bivariate plots of WM35 showing the distribution of BrdU-positive cells at different times post-UV. The S' population indicated with an arrow at 24 h post-UV have traversed mitosis after increasing their DNA content and are excluded from the analysis. The extent of CPD removal is compared for cells in S phase at the time of irradiation (designated S), vs. cells in G1 at the time of irradiation which includes a minor proportion of cells that were initially in G2 and have migrated into the G1 compartment during the post-UV incubation period (designated G1/G2) (see text for details). B ) Graphical representation of CPD excision in WM35 (top), WM3248 (middle), and XPA control skin fibroblasts (bottom). * and **, two-tailed paired t-test comparing CPD excision during S-phase vs G1/G2; p
    Figure Legend Snippet: Cell cycle-specific CPD excision in melanoma cell lines. Cells were irradiated with 10/m 2 UVC and then labeled with BrdU for 1 h (except for the 0 h time point, where BrdU labeling was performed for 30 min prior to UV). At the indicated times post-UV, cells were stained with anti-CPD (FITC), PI, and anti-BrdU (Alexa-647) and analyzed by flow cytometry. A ) Bivariate plots of WM35 showing the distribution of BrdU-positive cells at different times post-UV. The S' population indicated with an arrow at 24 h post-UV have traversed mitosis after increasing their DNA content and are excluded from the analysis. The extent of CPD removal is compared for cells in S phase at the time of irradiation (designated S), vs. cells in G1 at the time of irradiation which includes a minor proportion of cells that were initially in G2 and have migrated into the G1 compartment during the post-UV incubation period (designated G1/G2) (see text for details). B ) Graphical representation of CPD excision in WM35 (top), WM3248 (middle), and XPA control skin fibroblasts (bottom). * and **, two-tailed paired t-test comparing CPD excision during S-phase vs G1/G2; p

    Techniques Used: Irradiation, Labeling, Staining, Flow Cytometry, Cytometry, Incubation, Two Tailed Test

    Cell cycle progression in melanoma cells post-UVC. Cells were irradiated with UVC or mock-irradiated and then pulse-labeled with BrdU to mark cells in S-phase at the time of irradiation. Cultures were harvested immediately (0 h) or further incubated for 6 h. Cells were stained with PI and anti-BrdU (Alexa-647), and analyzed by flow cytometry. A ) SPR-proficient WM35. BrdU+ and BrdU- populations were gated as shown in the bivariate dot plots (top panels). Histograms represent DNA content of BrdU+ and BrdU- cells under each condition (lower panels). B ) Same as A, but for SPR-deficient WM3248. Similar data for all other melanoma cell lines used in this study are presented in Figure S1 .
    Figure Legend Snippet: Cell cycle progression in melanoma cells post-UVC. Cells were irradiated with UVC or mock-irradiated and then pulse-labeled with BrdU to mark cells in S-phase at the time of irradiation. Cultures were harvested immediately (0 h) or further incubated for 6 h. Cells were stained with PI and anti-BrdU (Alexa-647), and analyzed by flow cytometry. A ) SPR-proficient WM35. BrdU+ and BrdU- populations were gated as shown in the bivariate dot plots (top panels). Histograms represent DNA content of BrdU+ and BrdU- cells under each condition (lower panels). B ) Same as A, but for SPR-deficient WM3248. Similar data for all other melanoma cell lines used in this study are presented in Figure S1 .

    Techniques Used: Irradiation, Labeling, Incubation, Staining, Flow Cytometry, Cytometry, SPR Assay

    14) Product Images from "Migration of cytotoxic lymphocytes in cell cycle permits local MHC I-dependent control of division at sites of viral infection"

    Article Title: Migration of cytotoxic lymphocytes in cell cycle permits local MHC I-dependent control of division at sites of viral infection

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20101295

    Virus-specific CTLs in cell cycle are activated effector cells. To determine whether the CD8 + T cells undergoing cell division in the CNS were naive or activated effectors, the CNS, liver (LIV), blood (BL), cervical LNs, and spleen (SPL) of mice seeded with Thy1.1 + P14 cells were harvested 15 min after i.p. BrdU administration on day 6 after LCMV infection. (A) Representative flow cytometric plots of CD44 versus CD62L for Thy1.1 + P14 cells. Note the absence of naive P14 cells (identified as CD62L + CD44 − ) in the tissues of infected animals. (B) Quantification of CD44 expression on P14 cells at all stages of cell cycle. Data are plotted as mean ± SD and are representative of n = 14 mice per group collected over four independent experiments. (C) Representative flow cytometric plots of granzyme B or isotype control staining versus CD8 for Thy1.1 + P14 cells. (D) Granzyme B expression was quantified in P14 cells at all stages of cell cycle. Data are plotted as mean ± SD and are representative of n = 19 mice per group acquired from five independent experiments.
    Figure Legend Snippet: Virus-specific CTLs in cell cycle are activated effector cells. To determine whether the CD8 + T cells undergoing cell division in the CNS were naive or activated effectors, the CNS, liver (LIV), blood (BL), cervical LNs, and spleen (SPL) of mice seeded with Thy1.1 + P14 cells were harvested 15 min after i.p. BrdU administration on day 6 after LCMV infection. (A) Representative flow cytometric plots of CD44 versus CD62L for Thy1.1 + P14 cells. Note the absence of naive P14 cells (identified as CD62L + CD44 − ) in the tissues of infected animals. (B) Quantification of CD44 expression on P14 cells at all stages of cell cycle. Data are plotted as mean ± SD and are representative of n = 14 mice per group collected over four independent experiments. (C) Representative flow cytometric plots of granzyme B or isotype control staining versus CD8 for Thy1.1 + P14 cells. (D) Granzyme B expression was quantified in P14 cells at all stages of cell cycle. Data are plotted as mean ± SD and are representative of n = 19 mice per group acquired from five independent experiments.

    Techniques Used: Mouse Assay, Infection, Flow Cytometry, Expressing, Staining

    MHC I but not CD80/CD86 expression influences the ability of virus-specific CTL to enter cell cycle in the CNS. (A and B) 3.0 × 10 7 CD8 + T cells isolated from the spleens of day-6 mice seeded with Thy1.1 + P14 cells were transferred i.v. into day-6 LCMV-infected WT or H-2D b−/− recipients. Approximately 2–3 × 10 6 of the transferred cells were CD8 + Thy1.1 + P14 cells. 90 min after adoptive transfer, recipient mice received 2 mg BrdU i.p. and were harvested 15 min later. (A) Representative dot plots of BrdU versus 7AAD staining shown for CD8 + Thy1.1 + P14 cells that infiltrated the CNS of recipient mice. (B) The percentage of CD8 + Thy1.1 + P14 cells in G0-G1, S, and G2-M is shown for WT or H2D b−/− mice. Data are shown as mean ± SD for a single experiment and are representative of n = 14 mice per group collected over four independent experiments. The asterisk denotes statistical significance (P ≤ 0.006, Student’s t test). (C) To block CD80 and CD86, WT B6 mice seeded with Thy1.1 + P14 cells were injected i.p. on days 4 and 5 after LCMV infection with 200 µg CTLA-4-Fc (red) or PBS (black). The percentage of CNS Thy1.1 + P14 cells (mean ± SD for a single experiment) in the denoted stages of cell cycle was analyzed at day 6 after infection. Data are representative of n = 22–24 mice per group acquired over six independent experiments.
    Figure Legend Snippet: MHC I but not CD80/CD86 expression influences the ability of virus-specific CTL to enter cell cycle in the CNS. (A and B) 3.0 × 10 7 CD8 + T cells isolated from the spleens of day-6 mice seeded with Thy1.1 + P14 cells were transferred i.v. into day-6 LCMV-infected WT or H-2D b−/− recipients. Approximately 2–3 × 10 6 of the transferred cells were CD8 + Thy1.1 + P14 cells. 90 min after adoptive transfer, recipient mice received 2 mg BrdU i.p. and were harvested 15 min later. (A) Representative dot plots of BrdU versus 7AAD staining shown for CD8 + Thy1.1 + P14 cells that infiltrated the CNS of recipient mice. (B) The percentage of CD8 + Thy1.1 + P14 cells in G0-G1, S, and G2-M is shown for WT or H2D b−/− mice. Data are shown as mean ± SD for a single experiment and are representative of n = 14 mice per group collected over four independent experiments. The asterisk denotes statistical significance (P ≤ 0.006, Student’s t test). (C) To block CD80 and CD86, WT B6 mice seeded with Thy1.1 + P14 cells were injected i.p. on days 4 and 5 after LCMV infection with 200 µg CTLA-4-Fc (red) or PBS (black). The percentage of CNS Thy1.1 + P14 cells (mean ± SD for a single experiment) in the denoted stages of cell cycle was analyzed at day 6 after infection. Data are representative of n = 22–24 mice per group acquired over six independent experiments.

    Techniques Used: Expressing, CTL Assay, Isolation, Mouse Assay, Infection, Adoptive Transfer Assay, Staining, Blocking Assay, Injection, Flow Cytometry

    Peptide–MHC I interactions influence the division program of virus-specific CTL. (A) Representative flow cytometric plots depict the non–T cell component of CNS mononuclear cells in mock versus day-6 LCMV-infected mice. Plots are gated on Thy1.2-negative cells. The schematic plot on the far left shows the relative position of 1, microglia; 2, neutrophils; and 3, macrophages/monocytes/DCs. To further delineate macrophages/monocytes and DCs, the cells in region 3 were subdivided into CD11c − CD45.2 hi CD11b + (macrophages/monocytes) and CD11c + CD45.2 hi CD11b + (DCs) as shown in the far right plot. Data are representative of n = 16–24 mice per group accumulated over four to six experiments. (B) Representative histograms show the expression of MHC class I (K b D b ), MHC class II (I-A/I-E), CD80, and CD86 (red) relative to isotype controls (blue) on microglia (Thy1.2 − CD45.2 lo CD11b + ), macrophages/monocytes (Thy1.2 − CD45.2 hi CD11b + CD11c − ), and DCs (Thy1.2 − CD45.2 hi CD11b + CD11c + ) at day 6 after infection. Data are representative of n = 16 mice collected in three separate experiments. (C) Sorted effector virus-specific CTL pooled from four mice were stimulated at a 2:1 ratio with sorted GP33 peptide-pulsed CNS APCs isolated from day 6–infected animals ( n = 20). BrdU was added to the in vitro culture for the last 30 min of the 90-min incubation. Representative BrdU versus 7AAD staining of CD8 + Thy1.1 + P14 cells incubated alone or with CNS APCs is shown. These data are representative of four separate experiments. (D) Normalized percentages of T cells in various stages of cell cycle are shown. Data were normalized from four independent experiments. (*, P
    Figure Legend Snippet: Peptide–MHC I interactions influence the division program of virus-specific CTL. (A) Representative flow cytometric plots depict the non–T cell component of CNS mononuclear cells in mock versus day-6 LCMV-infected mice. Plots are gated on Thy1.2-negative cells. The schematic plot on the far left shows the relative position of 1, microglia; 2, neutrophils; and 3, macrophages/monocytes/DCs. To further delineate macrophages/monocytes and DCs, the cells in region 3 were subdivided into CD11c − CD45.2 hi CD11b + (macrophages/monocytes) and CD11c + CD45.2 hi CD11b + (DCs) as shown in the far right plot. Data are representative of n = 16–24 mice per group accumulated over four to six experiments. (B) Representative histograms show the expression of MHC class I (K b D b ), MHC class II (I-A/I-E), CD80, and CD86 (red) relative to isotype controls (blue) on microglia (Thy1.2 − CD45.2 lo CD11b + ), macrophages/monocytes (Thy1.2 − CD45.2 hi CD11b + CD11c − ), and DCs (Thy1.2 − CD45.2 hi CD11b + CD11c + ) at day 6 after infection. Data are representative of n = 16 mice collected in three separate experiments. (C) Sorted effector virus-specific CTL pooled from four mice were stimulated at a 2:1 ratio with sorted GP33 peptide-pulsed CNS APCs isolated from day 6–infected animals ( n = 20). BrdU was added to the in vitro culture for the last 30 min of the 90-min incubation. Representative BrdU versus 7AAD staining of CD8 + Thy1.1 + P14 cells incubated alone or with CNS APCs is shown. These data are representative of four separate experiments. (D) Normalized percentages of T cells in various stages of cell cycle are shown. Data were normalized from four independent experiments. (*, P

    Techniques Used: CTL Assay, Flow Cytometry, Infection, Mouse Assay, Expressing, Isolation, In Vitro, Incubation, Staining

    Virus-specific CTLs divide in lymphoid and nonlymphoid sites. To determine the cell cycle stage of virus-specific CTL, blood (BL), CNS, liver (LIV), cervical LNs, and spleen (SPL) of mice seeded with Thy1.1 + P14 cells were harvested 15 min after i.p. BrdU administration on day 6 after LCMV infection. (A) Representative flow cytometric plots of BrdU versus 7AAD are shown for Thy1.1 + P14 cells extracted from tissues of infected mice. (B–E) The ratio of Thy1.1 + P14 cells found in G0-G1, S, or G2-M stages of cell cycle in the CNS (B), liver (C), LN (D), or spleen (E) relative to the blood was calculated for individual mice ( n = 16–24 mice per group). Data were compiled from six independent experiments. The red line is set at a ratio of 1 and indicates no difference relative to the blood. The ratio of cells in S or G2-M compared with G0-G1 was significantly different in all tissues examined (P
    Figure Legend Snippet: Virus-specific CTLs divide in lymphoid and nonlymphoid sites. To determine the cell cycle stage of virus-specific CTL, blood (BL), CNS, liver (LIV), cervical LNs, and spleen (SPL) of mice seeded with Thy1.1 + P14 cells were harvested 15 min after i.p. BrdU administration on day 6 after LCMV infection. (A) Representative flow cytometric plots of BrdU versus 7AAD are shown for Thy1.1 + P14 cells extracted from tissues of infected mice. (B–E) The ratio of Thy1.1 + P14 cells found in G0-G1, S, or G2-M stages of cell cycle in the CNS (B), liver (C), LN (D), or spleen (E) relative to the blood was calculated for individual mice ( n = 16–24 mice per group). Data were compiled from six independent experiments. The red line is set at a ratio of 1 and indicates no difference relative to the blood. The ratio of cells in S or G2-M compared with G0-G1 was significantly different in all tissues examined (P

    Techniques Used: CTL Assay, Mouse Assay, Infection, Flow Cytometry

    15) Product Images from "Cytotoxic T cells induce proliferation of chronic myeloid leukemia stem cells by secreting interferon-?"

    Article Title: Cytotoxic T cells induce proliferation of chronic myeloid leukemia stem cells by secreting interferon-?

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20121229

    IFN-γ increases proliferation and colony formation of primary CD34 + stem/progenitor cells from CML patients . (A) Expression of IFN-γ receptor α chain (IFN-γRα) on CD34 + stem/progenitor cells from newly diagnosed CML patients. One representative plot of four is shown. (B–E) 10 4 FACS-sorted CD34 + cells from the peripheral blood or BM were cultured in the presence or absence of rh-IFN-γ for 7 d in sextuplicates. At day 7 of culture, BrdU incorporation (B), cell numbers (C), apoptosis (D), and necrosis (E) were assessed in duplicates or triplicates. (F) 2 × 10 3 FACS-sorted CD34 + cells were cultured in methylcellulose in triplicates and colony-forming capacity was determined after 14 d. Data are displayed as mean ± SEM. Statistics: Student’s t test. **, P
    Figure Legend Snippet: IFN-γ increases proliferation and colony formation of primary CD34 + stem/progenitor cells from CML patients . (A) Expression of IFN-γ receptor α chain (IFN-γRα) on CD34 + stem/progenitor cells from newly diagnosed CML patients. One representative plot of four is shown. (B–E) 10 4 FACS-sorted CD34 + cells from the peripheral blood or BM were cultured in the presence or absence of rh-IFN-γ for 7 d in sextuplicates. At day 7 of culture, BrdU incorporation (B), cell numbers (C), apoptosis (D), and necrosis (E) were assessed in duplicates or triplicates. (F) 2 × 10 3 FACS-sorted CD34 + cells were cultured in methylcellulose in triplicates and colony-forming capacity was determined after 14 d. Data are displayed as mean ± SEM. Statistics: Student’s t test. **, P

    Techniques Used: Expressing, FACS, Cell Culture, BrdU Incorporation Assay

    IFN-γ enhances the proliferation of early LSCs and leukemia progenitor cells in vivo . (A) Gating strategy to identify early LSCs and leukemia progenitor cells in the BM of CML mice. (B–N) BL/6 CML mice were treated with either vehicle (VEH, n = 7) or 2.5 × 10 5 U of rm-IFN-γ ( n = 5) i.p. twice daily on two consecutive days (days 17 and 18 after primary transplantation). On the same days, mice also received BrdU (0.8 mg/ml in drinking water and 1 mg i.p./day). 1 d later, lin − BCR/ABL-GFP + BM cells were analyzed for LSCs and leukemia progenitor cells. (B) Long-term LSCs (c-kit hi CD135 − CD48 − CD150 + ). (C) Short-term LSCs (c-kit hi CD135 − CD48 - CD150 − ). (D) Leukemia MPP1s (c-kit hi CD135 − CD48 + CD150 + ). (E) Leukemia MPP2s (c-kit hi CD135 − CD48 + CD150 − ). (F) Leukemia LMPPs (c-kit hi CD135 + CD150 − ). (G) Numbers, (H) proliferation, and (I-J) viability of c-kit hi leukemia progenitor cells. Numbers (K) and proliferation (L) of leukemia CMPs (c-kit hi CD127 − CD34 + FcγR − ). Numbers (M) and proliferation (N) of leukemia GMPs (c-kit hi CD127 − CD34 + FcγR + ). Data are displayed as mean ± SEM. Statistics: (B–N) Student’s t test. *, P
    Figure Legend Snippet: IFN-γ enhances the proliferation of early LSCs and leukemia progenitor cells in vivo . (A) Gating strategy to identify early LSCs and leukemia progenitor cells in the BM of CML mice. (B–N) BL/6 CML mice were treated with either vehicle (VEH, n = 7) or 2.5 × 10 5 U of rm-IFN-γ ( n = 5) i.p. twice daily on two consecutive days (days 17 and 18 after primary transplantation). On the same days, mice also received BrdU (0.8 mg/ml in drinking water and 1 mg i.p./day). 1 d later, lin − BCR/ABL-GFP + BM cells were analyzed for LSCs and leukemia progenitor cells. (B) Long-term LSCs (c-kit hi CD135 − CD48 − CD150 + ). (C) Short-term LSCs (c-kit hi CD135 − CD48 - CD150 − ). (D) Leukemia MPP1s (c-kit hi CD135 − CD48 + CD150 + ). (E) Leukemia MPP2s (c-kit hi CD135 − CD48 + CD150 − ). (F) Leukemia LMPPs (c-kit hi CD135 + CD150 − ). (G) Numbers, (H) proliferation, and (I-J) viability of c-kit hi leukemia progenitor cells. Numbers (K) and proliferation (L) of leukemia CMPs (c-kit hi CD127 − CD34 + FcγR − ). Numbers (M) and proliferation (N) of leukemia GMPs (c-kit hi CD127 − CD34 + FcγR + ). Data are displayed as mean ± SEM. Statistics: (B–N) Student’s t test. *, P

    Techniques Used: In Vivo, Mouse Assay, Transplantation Assay

    16) Product Images from "Enriched environment and physical activity reduce microglia and influence the fate of NG2 cells in the amygdala of adult mice"

    Article Title: Enriched environment and physical activity reduce microglia and influence the fate of NG2 cells in the amygdala of adult mice

    Journal: Cell and Tissue Research

    doi: 10.1007/s00441-011-1200-z

    Regulation of cell proliferation and differentiation in the adult amygdala by environmental enrichment ( ENR ) and physical activity ( RUN ). a Consistent with previous findings, RUN and ENR increased the number of BrdU-positive cells in the dentate gyrus relative to controls ( CTR ). b In the amygdala, ENR and RUN did not change the number of BrdU-positive cells at 1 day ( 1 d ) after BrdU as compared with CTR. At 4 weeks ( 4 w ), however, significantly fewer BrdU-positive cells were counted in ENR and RUN than in CTR. c The number of BrdU-positive cells expressing NG2 did not significantly differ between experimental groups. d , e A marked reduction, however, in the number of BrdU/S100β-positive cells ( d ) and BrdU/Iba1-positive cells (new microglia; e ) was noted at 4 weeks after BrdU. f The number of newborn oligodendrocytes (CNPase-positive) was not measurably affected by ENR and RUN. g , h The apparent loss of BrdU/S100β cells in ENR and RUN was caused by an increase in the number ( g ) and proportion ( h ) of BrdU/NG2 cells that did not express S100β ( error bars SEM). * P
    Figure Legend Snippet: Regulation of cell proliferation and differentiation in the adult amygdala by environmental enrichment ( ENR ) and physical activity ( RUN ). a Consistent with previous findings, RUN and ENR increased the number of BrdU-positive cells in the dentate gyrus relative to controls ( CTR ). b In the amygdala, ENR and RUN did not change the number of BrdU-positive cells at 1 day ( 1 d ) after BrdU as compared with CTR. At 4 weeks ( 4 w ), however, significantly fewer BrdU-positive cells were counted in ENR and RUN than in CTR. c The number of BrdU-positive cells expressing NG2 did not significantly differ between experimental groups. d , e A marked reduction, however, in the number of BrdU/S100β-positive cells ( d ) and BrdU/Iba1-positive cells (new microglia; e ) was noted at 4 weeks after BrdU. f The number of newborn oligodendrocytes (CNPase-positive) was not measurably affected by ENR and RUN. g , h The apparent loss of BrdU/S100β cells in ENR and RUN was caused by an increase in the number ( g ) and proportion ( h ) of BrdU/NG2 cells that did not express S100β ( error bars SEM). * P

    Techniques Used: Activity Assay, Expressing

    Environmental enrichment ( ENR )/physical activity ( RUN ) regulate the number of BrdU/NG2-positive S100β-negative cells in layers II/III of the visual cortex ( CTR control). a At 4 weeks after BrdU, a significant increase is found in the number of BrdU/NG2-positive S100β-negaitve cells in layers II/III of visual cortex of RUN and a trend toward an increase in ENR. b Proportion of BrdU/NG2-positive cells negative for S100β in visual cortex layers II/III at 4 weeks after BrdU ( error bars SEM). * P
    Figure Legend Snippet: Environmental enrichment ( ENR )/physical activity ( RUN ) regulate the number of BrdU/NG2-positive S100β-negative cells in layers II/III of the visual cortex ( CTR control). a At 4 weeks after BrdU, a significant increase is found in the number of BrdU/NG2-positive S100β-negaitve cells in layers II/III of visual cortex of RUN and a trend toward an increase in ENR. b Proportion of BrdU/NG2-positive cells negative for S100β in visual cortex layers II/III at 4 weeks after BrdU ( error bars SEM). * P

    Techniques Used: Activity Assay

    17) Product Images from "The Snail Transcription Factor Regulates the Numbers of Neural Precursor Cells and Newborn Neurons throughout Mammalian Life"

    Article Title: The Snail Transcription Factor Regulates the Numbers of Neural Precursor Cells and Newborn Neurons throughout Mammalian Life

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0104767

    Genetic ablation of Snail perturbs the proliferation of adult forebrain neural precursor cells and the number of adult-born olfactory neurons. (A-D) Adult Snail fl/fl mice that were positive (Cre+ve) or negative (Cre-ve) for the nestin-cre transgene were injected with BrdU and coronal sections through the SVZ were analyzed one day later. (A) Fluorescence micrographs of sections through the SVZ that were immunostained for BrdU (green). Arrows denote BrdU-positive cells in the SVZ and rostral migratory stream. LV indicates the lateral ventricle. Scale bar 100 µm. (B) Quantification of sections as in A for the total relative number of BrdU-positive cells in the SVZ, as determined by counting all positive cells in 10 sections spanning the lateral ventricle (see experimental methods for details). (***p
    Figure Legend Snippet: Genetic ablation of Snail perturbs the proliferation of adult forebrain neural precursor cells and the number of adult-born olfactory neurons. (A-D) Adult Snail fl/fl mice that were positive (Cre+ve) or negative (Cre-ve) for the nestin-cre transgene were injected with BrdU and coronal sections through the SVZ were analyzed one day later. (A) Fluorescence micrographs of sections through the SVZ that were immunostained for BrdU (green). Arrows denote BrdU-positive cells in the SVZ and rostral migratory stream. LV indicates the lateral ventricle. Scale bar 100 µm. (B) Quantification of sections as in A for the total relative number of BrdU-positive cells in the SVZ, as determined by counting all positive cells in 10 sections spanning the lateral ventricle (see experimental methods for details). (***p

    Techniques Used: Mouse Assay, Injection, Fluorescence

    Postnatal deficits in cortical neurons in Snail fl/fl ;nestin-cre mice. Snail fl/fl mice that were positive (Cre+ve) or negative (Cre-ve) for the nestin-cre transgene were labelled with BrdU at E13 and their cortices were analyzed at P7. (A) Confocal micrographs of coronal sections through the SVZ and layer VI immunostained for BrdU (red) and Tbr1 (green; merges are shown on the right). The boxed areas are shown at higher magnification in the insets. Arrows denote double-labelled cells. Scale bar, 20 µm. (B) Quantification of sections as in A for the proportion of BrdU-positive cells that are also positive for Tbr1 (B) and their relative location within layers V and VI (C). (**p
    Figure Legend Snippet: Postnatal deficits in cortical neurons in Snail fl/fl ;nestin-cre mice. Snail fl/fl mice that were positive (Cre+ve) or negative (Cre-ve) for the nestin-cre transgene were labelled with BrdU at E13 and their cortices were analyzed at P7. (A) Confocal micrographs of coronal sections through the SVZ and layer VI immunostained for BrdU (red) and Tbr1 (green; merges are shown on the right). The boxed areas are shown at higher magnification in the insets. Arrows denote double-labelled cells. Scale bar, 20 µm. (B) Quantification of sections as in A for the proportion of BrdU-positive cells that are also positive for Tbr1 (B) and their relative location within layers V and VI (C). (**p

    Techniques Used: Mouse Assay

    Genetic ablation of Snail perturbs the proliferation of adult dentate gyrus neural precursor cells and the number of adult-born hippocampal neurons. (A–D) Adult Snail fl/fl mice that were positive (Cre+ve) or negative (Cre-ve) for the nestin-cre transgene were injected with BrdU and coronal sections through the hippocampal dentate gyrus were analyzed one day later. (A) Fluorescence micrographs of sections through the dentate gyrus subgranular zone (SGZ) immunostained for BrdU (green) and Sox2 (red; right panels show the merged images). Arrows denote double labeled cells and the hatched white line the border of the SGZ and the hilus. Scale bar 50 µm. (B–D) Quantification of sections as in A for the total relative numbers of BrdU-positive cells (B), Sox2-positive cells (C) and BrdU-positive, Sox2-positive double-labelled cells (D) in the SGZ as determined by counting all positive cells in 10 sections spanning the dentate gyrus. (*p
    Figure Legend Snippet: Genetic ablation of Snail perturbs the proliferation of adult dentate gyrus neural precursor cells and the number of adult-born hippocampal neurons. (A–D) Adult Snail fl/fl mice that were positive (Cre+ve) or negative (Cre-ve) for the nestin-cre transgene were injected with BrdU and coronal sections through the hippocampal dentate gyrus were analyzed one day later. (A) Fluorescence micrographs of sections through the dentate gyrus subgranular zone (SGZ) immunostained for BrdU (green) and Sox2 (red; right panels show the merged images). Arrows denote double labeled cells and the hatched white line the border of the SGZ and the hilus. Scale bar 50 µm. (B–D) Quantification of sections as in A for the total relative numbers of BrdU-positive cells (B), Sox2-positive cells (C) and BrdU-positive, Sox2-positive double-labelled cells (D) in the SGZ as determined by counting all positive cells in 10 sections spanning the dentate gyrus. (*p

    Techniques Used: Mouse Assay, Injection, Fluorescence, Labeling

    Perturbations in postnatal cortical precursors in Snail fl/fl ;nestin-cre mice. (A) PCR analysis of genomic DNA isolated from the cortex of P7 Snail fl/fl mice that were positive (Cre+ve) or negative (Cre-ve) for the nestin-cre transgene showing the 480 nucleotide product from the intact floxed allele in the top panel, and the 492 nucleotide product generated from the floxed allele after Cre-mediated recombination (bottom panel). The top panel also shows genomic DNA from an adult Snail fl/fl mouse as a positive control. (B–F) Snail fl/fl mice that were positive (Cre+ve) or negative (Cre-ve) for the nestin-cre transgene were labelled with BrdU at E13 and their cortices were analyzed at P7. (B) Fluorescence micrographs of coronal cortical sections immunostained for BrdU (red). The dotted white lines demarcate the different cortical layers and the subventricular zone (SVZ), which comprises the precursor region in the postnatal cortex. Scale bar, 20 µm. (C) Quantification of sections similar to those in B for the relative location of BrdU-positive cells. (*p
    Figure Legend Snippet: Perturbations in postnatal cortical precursors in Snail fl/fl ;nestin-cre mice. (A) PCR analysis of genomic DNA isolated from the cortex of P7 Snail fl/fl mice that were positive (Cre+ve) or negative (Cre-ve) for the nestin-cre transgene showing the 480 nucleotide product from the intact floxed allele in the top panel, and the 492 nucleotide product generated from the floxed allele after Cre-mediated recombination (bottom panel). The top panel also shows genomic DNA from an adult Snail fl/fl mouse as a positive control. (B–F) Snail fl/fl mice that were positive (Cre+ve) or negative (Cre-ve) for the nestin-cre transgene were labelled with BrdU at E13 and their cortices were analyzed at P7. (B) Fluorescence micrographs of coronal cortical sections immunostained for BrdU (red). The dotted white lines demarcate the different cortical layers and the subventricular zone (SVZ), which comprises the precursor region in the postnatal cortex. Scale bar, 20 µm. (C) Quantification of sections similar to those in B for the relative location of BrdU-positive cells. (*p

    Techniques Used: Mouse Assay, Polymerase Chain Reaction, Isolation, Generated, Positive Control, Fluorescence

    18) Product Images from "IKK?/NF-?B Disrupts Adult Hypothalamic Neural Stem Cells to Mediate Neurodegenerative Mechanism of Dietary Obesity and Pre-Diabetes"

    Article Title: IKK?/NF-?B Disrupts Adult Hypothalamic Neural Stem Cells to Mediate Neurodegenerative Mechanism of Dietary Obesity and Pre-Diabetes

    Journal: Nature cell biology

    doi: 10.1038/ncb2562

    Mouse model of htNSCs-specific IKKβ activation and metabolic phenotypes. C57BL/6 mice (3-month-old, chow-fed males) bilaterally received intra-MBH injections of P Sox2 - CA IKKβ vs. P Sox2 -control lentiviruses. All mice were maintained under normal chow feeding throughout experiments. ( a,b ) Schematic of lentiviral vector that expressed CA IKKβ under the control of Sox2 promoter (P Sox2 - CA IKKβ). The same vector with the removal of CA IKKβ was used as the matched control (P Sox2 -control). ( b ) Hypothalamic sections were prepared from mice at 2 weeks post injection and co-immunostained for Sox2 (green) and IκBα (red). ( c–e ) Mice with P Sox2 - CA IKKβ vs. P Sox2 -control received a single-day icv injection of Brdu. Brains were fixed at Day 1, 7 or 14 post Brdu injection. Brain sections across the ARC were processed with Brdu staining or co-immunostaining with NeuN or S100B, and analyzed for total Brdu-labeled cells ( c ) and Brdu-labeled cells positive for NeuN ( d ) or S100B ( e ). ( f–h ) Brain sections across the ARC were prepared from mice at ~3 months (3 M) post lentiviral injection, subjected to Sox2 and POMC immunostaining, and counted for Sox2-positive cells ( f ), POMC neurons ( g ) and NPY neurons ( h ) in serial ARC sections. ( i–l ) Data show glucose tolerance ( i ) and fasting insulin levels ( j ) of mice at 3 M post lentiviral injection, and food intake ( k ) and body weight ( l ) of mice at 10 months (10 M) post lentiviral injections. Baseline body weight levels of mice prior to lentiviral injections were also included in ( l ). GTT: glucose tolerance test. * P
    Figure Legend Snippet: Mouse model of htNSCs-specific IKKβ activation and metabolic phenotypes. C57BL/6 mice (3-month-old, chow-fed males) bilaterally received intra-MBH injections of P Sox2 - CA IKKβ vs. P Sox2 -control lentiviruses. All mice were maintained under normal chow feeding throughout experiments. ( a,b ) Schematic of lentiviral vector that expressed CA IKKβ under the control of Sox2 promoter (P Sox2 - CA IKKβ). The same vector with the removal of CA IKKβ was used as the matched control (P Sox2 -control). ( b ) Hypothalamic sections were prepared from mice at 2 weeks post injection and co-immunostained for Sox2 (green) and IκBα (red). ( c–e ) Mice with P Sox2 - CA IKKβ vs. P Sox2 -control received a single-day icv injection of Brdu. Brains were fixed at Day 1, 7 or 14 post Brdu injection. Brain sections across the ARC were processed with Brdu staining or co-immunostaining with NeuN or S100B, and analyzed for total Brdu-labeled cells ( c ) and Brdu-labeled cells positive for NeuN ( d ) or S100B ( e ). ( f–h ) Brain sections across the ARC were prepared from mice at ~3 months (3 M) post lentiviral injection, subjected to Sox2 and POMC immunostaining, and counted for Sox2-positive cells ( f ), POMC neurons ( g ) and NPY neurons ( h ) in serial ARC sections. ( i–l ) Data show glucose tolerance ( i ) and fasting insulin levels ( j ) of mice at 3 M post lentiviral injection, and food intake ( k ) and body weight ( l ) of mice at 10 months (10 M) post lentiviral injections. Baseline body weight levels of mice prior to lentiviral injections were also included in ( l ). GTT: glucose tolerance test. * P

    Techniques Used: Activation Assay, Mouse Assay, Plasmid Preparation, Injection, BrdU Staining, Immunostaining, Labeling

    Brdu tracking of adult htNSCs-mediated neurogenesis in mice. ( a ) C57BL/6 mice (chow-fed males, 4 months old) received a single-day icv injection of Brdu. Brains were fixed at Day 1 vs. 7 and sectioned for Brdu staining. Total numbers of Brdu-labeled cells in serial ARC sections were counted. ( b–i ) C57BL/6 mice (chow-fed males, 4 months old) received daily icv injections of Brdu consecutively for 7 days. Brains were fixed at Day 10 vs. 30 and then sectioned for Brdu staining ( b ) or co-immunostaining with indicated markers ( c–i ). ( b ) Total numbers of Brdu-labeled cells in serial ARC sections were counted. ( e–i ) Total numbers of Brdu-labeled cells co-immunostained with NeuN ( e ), POMC ( f ), NPY ( g ), S100B ( h ), and RIP ( i ) in serial ARC sections were counted. ** P
    Figure Legend Snippet: Brdu tracking of adult htNSCs-mediated neurogenesis in mice. ( a ) C57BL/6 mice (chow-fed males, 4 months old) received a single-day icv injection of Brdu. Brains were fixed at Day 1 vs. 7 and sectioned for Brdu staining. Total numbers of Brdu-labeled cells in serial ARC sections were counted. ( b–i ) C57BL/6 mice (chow-fed males, 4 months old) received daily icv injections of Brdu consecutively for 7 days. Brains were fixed at Day 10 vs. 30 and then sectioned for Brdu staining ( b ) or co-immunostaining with indicated markers ( c–i ). ( b ) Total numbers of Brdu-labeled cells in serial ARC sections were counted. ( e–i ) Total numbers of Brdu-labeled cells co-immunostained with NeuN ( e ), POMC ( f ), NPY ( g ), S100B ( h ), and RIP ( i ) in serial ARC sections were counted. ** P

    Techniques Used: Mouse Assay, Injection, BrdU Staining, Labeling, Immunostaining

    19) Product Images from "Ensa controls S-phase length by modulating Treslin levels"

    Article Title: Ensa controls S-phase length by modulating Treslin levels

    Journal: Nature Communications

    doi: 10.1038/s41467-017-00339-4

    The knockout of Greatwall, the upstream kinase of Ensa, also results in partial S-phase accumulation. a Control or MEF Gwl(Lox/Lox) cells were serum-starved for 3 days, infected for 5 h with GFP or GFP-Cre-expressing adenoviruses as indicated, stimulated to re-enter the cell cycle with fresh serum-supplemented media and recovered for western blot with the indicated antibodies. b FACS analysis 48 h after infection in control MEFs infected with GFP-Cre adenoviruses. c Gwl Lox/Lox MEFs infected with control GFP adenovirus. d Gwl Lox/Lox MEFs infected with GFP-Cre adenovirus. e MEF Gwl Lox/Lox cells were serum-starved for 3 days and subsequently infected with GFP-expressing adenovirus. Five hours later, cells were supplemented with fresh medium containing aphidicolin for 24 h. S-phase synchronised cells were then released and recovered at 5 and 14 h for FACS analysis. f As for e , except that GFP-Cre-expressing adenoviruses was used. g S-phase synchronised cells infected with GFP (control) and GFP-Cre (Gwl knockout) adenoviruses as in e and f were released and a pulse of 30 min of BrdU at the indicated time points was performed. Cells were then fixed and immunostained with anti-BrdU antibodies. The number of S-phase cells in control and Gwl knockout cells were counted at each time point, compared and represented as a bar graph of the mean value of three different samples ± standard deviation. A cell number between 175 and 565 were counted for each time point
    Figure Legend Snippet: The knockout of Greatwall, the upstream kinase of Ensa, also results in partial S-phase accumulation. a Control or MEF Gwl(Lox/Lox) cells were serum-starved for 3 days, infected for 5 h with GFP or GFP-Cre-expressing adenoviruses as indicated, stimulated to re-enter the cell cycle with fresh serum-supplemented media and recovered for western blot with the indicated antibodies. b FACS analysis 48 h after infection in control MEFs infected with GFP-Cre adenoviruses. c Gwl Lox/Lox MEFs infected with control GFP adenovirus. d Gwl Lox/Lox MEFs infected with GFP-Cre adenovirus. e MEF Gwl Lox/Lox cells were serum-starved for 3 days and subsequently infected with GFP-expressing adenovirus. Five hours later, cells were supplemented with fresh medium containing aphidicolin for 24 h. S-phase synchronised cells were then released and recovered at 5 and 14 h for FACS analysis. f As for e , except that GFP-Cre-expressing adenoviruses was used. g S-phase synchronised cells infected with GFP (control) and GFP-Cre (Gwl knockout) adenoviruses as in e and f were released and a pulse of 30 min of BrdU at the indicated time points was performed. Cells were then fixed and immunostained with anti-BrdU antibodies. The number of S-phase cells in control and Gwl knockout cells were counted at each time point, compared and represented as a bar graph of the mean value of three different samples ± standard deviation. A cell number between 175 and 565 were counted for each time point

    Techniques Used: Knock-Out, Infection, Expressing, Western Blot, FACS, Standard Deviation

    Ensa KD strongly delays cells in S phase. a HeLa cells were treated with scramble siRNA (siSC) or Ensa siRNA#1 (siEnsa1) or #2 (siEnsa2) for 48 h. a Ensa levels and, as a loading control, β-tubulin(βTub) were checked in these cells by immunoblot. b Ensa-GFP was overexpressed in control cells (parental or transfected with siSC) and in cells knocked down of Ensa with siEnsa1 and GFP fluorescence intensity was analysed by FACS. c GFP levels in b were quantified by densitometry using ImageJ and represented as % of fluorescence towards GFP levels on parental cells. d HeLa cells, treated with SC siRNA (siSC) or siEnsa1 or siEnsa2, were stained with propidium iodide and analysed by FACS. DNA content ( x -axis, propidium iodide) is represented towards the relative number of cells ( y -axis, counts). Coloured panel represents a merge of all conditions. The quantification of % of total cells in SubG1, G1, S and G2/M phases in each cell type is represented as a bar histogram . e As for d except that U2OS instead of HeLa cells where used. f Endogenous Ensa levels in U2OS treated with siSC and siEnsa1 were analysed by western blot and shown. g Cells treated with control SC siRNA ( left ) or siEnsa1 ( right ) were incubated in the presence of BrdU for 30 min at 48 h post transfection and analysed by bivariate FACS. Intensity of BrdU incorporation and DNA content was analysed by using anti-BrdU antibodies and 7-AAD staining, respectively. Boxed area indicates the percentage of cells in S phase (incorporating BrdU), and in G1 (2n DNA content non incorporating BrdU) or G2/M (4n DNA content) phases (Flow Jo analysis). h Cells treated with siSC or siEnsa1 or siEnsa2 were incubated in presence of EdU for 60 min at 48 h post transfection and incorporated EdU was subsequently detected by Click-iT reagent. Scale bar , 5 μm. i The percentage of EdU-positive cells towards the total cell number (determined by differential interferene contrast microscopy (DIC)) in each condition was represented as a bar graph of the mean value ± standard deviation
    Figure Legend Snippet: Ensa KD strongly delays cells in S phase. a HeLa cells were treated with scramble siRNA (siSC) or Ensa siRNA#1 (siEnsa1) or #2 (siEnsa2) for 48 h. a Ensa levels and, as a loading control, β-tubulin(βTub) were checked in these cells by immunoblot. b Ensa-GFP was overexpressed in control cells (parental or transfected with siSC) and in cells knocked down of Ensa with siEnsa1 and GFP fluorescence intensity was analysed by FACS. c GFP levels in b were quantified by densitometry using ImageJ and represented as % of fluorescence towards GFP levels on parental cells. d HeLa cells, treated with SC siRNA (siSC) or siEnsa1 or siEnsa2, were stained with propidium iodide and analysed by FACS. DNA content ( x -axis, propidium iodide) is represented towards the relative number of cells ( y -axis, counts). Coloured panel represents a merge of all conditions. The quantification of % of total cells in SubG1, G1, S and G2/M phases in each cell type is represented as a bar histogram . e As for d except that U2OS instead of HeLa cells where used. f Endogenous Ensa levels in U2OS treated with siSC and siEnsa1 were analysed by western blot and shown. g Cells treated with control SC siRNA ( left ) or siEnsa1 ( right ) were incubated in the presence of BrdU for 30 min at 48 h post transfection and analysed by bivariate FACS. Intensity of BrdU incorporation and DNA content was analysed by using anti-BrdU antibodies and 7-AAD staining, respectively. Boxed area indicates the percentage of cells in S phase (incorporating BrdU), and in G1 (2n DNA content non incorporating BrdU) or G2/M (4n DNA content) phases (Flow Jo analysis). h Cells treated with siSC or siEnsa1 or siEnsa2 were incubated in presence of EdU for 60 min at 48 h post transfection and incorporated EdU was subsequently detected by Click-iT reagent. Scale bar , 5 μm. i The percentage of EdU-positive cells towards the total cell number (determined by differential interferene contrast microscopy (DIC)) in each condition was represented as a bar graph of the mean value ± standard deviation

    Techniques Used: Transfection, Fluorescence, FACS, Staining, Western Blot, Incubation, BrdU Incorporation Assay, Flow Cytometry, Microscopy, Standard Deviation

    Ensa KD increases S-phase length. a HeLa cells treated with SC or Ensa siRNA were blocked in G1/S by thymidine and released in fresh medium. Samples were taken at 4, 6, 8 and 10 h after release and processed by FACS to follow S-phase progression. b As for a except that U2OS cells were used and released at 4, 9, 14 and 17 h. c Scheme representing the experiment in which HeLa cells were treated with SC or Ensa siRNA for 48 h, pulsed with 10 µM EdU for 30 min and, after washing, incubated in fresh medium containing 5 µM thymidine for 2, 4, 6, 8 and 10 h. After a second pulse of 30 min with 10 µM, BrdU cells were fixed for immunofluorescence. d EdU/BrdU double staining of siSC and siEnsa-treated cells at 10 h after thymidine release is shown. EdU-positive cells are labelled in magenta and BrdU-positive cells in cyan . Resulting white co-localisation are cells still in S phase. Scale bar , 20 μm. e The % of EdU/BrdU-positive cells in d was counted and represented as a bar graph of the mean value ± standard deviation. A minimum of 80 cells was counted in each time point. f HeLa cells were or not (CT) transfected with increasing doses of siEnsa (12.5, 25 and 50 nM) and 24 h later synchronised in S phase by thymidine block. Cells were then released and followed by time-lapse microscopy. Time after thymidine release and cell rounding (G2/M transition) for each cell at each siRNA concentration was recorded and represented as a box-and-whiskers diagram showing median and minimum to maximum values. A minimum of 50 cells was counted per condition. g Asynchronous control or HeLa cells stably expressing a siEnsa-resistant transgene of human Ensa (R-Ensa) were transfected with siEnsa1 or with SC siRNA (only for parental cells). Cells were released 24 h later, recovered and used for FACS analysis. h As for g , except that cells were blocked in G1–S 24 h after transfection by thymidine and 9 h after release used for FACs analysis
    Figure Legend Snippet: Ensa KD increases S-phase length. a HeLa cells treated with SC or Ensa siRNA were blocked in G1/S by thymidine and released in fresh medium. Samples were taken at 4, 6, 8 and 10 h after release and processed by FACS to follow S-phase progression. b As for a except that U2OS cells were used and released at 4, 9, 14 and 17 h. c Scheme representing the experiment in which HeLa cells were treated with SC or Ensa siRNA for 48 h, pulsed with 10 µM EdU for 30 min and, after washing, incubated in fresh medium containing 5 µM thymidine for 2, 4, 6, 8 and 10 h. After a second pulse of 30 min with 10 µM, BrdU cells were fixed for immunofluorescence. d EdU/BrdU double staining of siSC and siEnsa-treated cells at 10 h after thymidine release is shown. EdU-positive cells are labelled in magenta and BrdU-positive cells in cyan . Resulting white co-localisation are cells still in S phase. Scale bar , 20 μm. e The % of EdU/BrdU-positive cells in d was counted and represented as a bar graph of the mean value ± standard deviation. A minimum of 80 cells was counted in each time point. f HeLa cells were or not (CT) transfected with increasing doses of siEnsa (12.5, 25 and 50 nM) and 24 h later synchronised in S phase by thymidine block. Cells were then released and followed by time-lapse microscopy. Time after thymidine release and cell rounding (G2/M transition) for each cell at each siRNA concentration was recorded and represented as a box-and-whiskers diagram showing median and minimum to maximum values. A minimum of 50 cells was counted per condition. g Asynchronous control or HeLa cells stably expressing a siEnsa-resistant transgene of human Ensa (R-Ensa) were transfected with siEnsa1 or with SC siRNA (only for parental cells). Cells were released 24 h later, recovered and used for FACS analysis. h As for g , except that cells were blocked in G1–S 24 h after transfection by thymidine and 9 h after release used for FACs analysis

    Techniques Used: FACS, Incubation, Immunofluorescence, Double Staining, Standard Deviation, Transfection, Blocking Assay, Time-lapse Microscopy, Concentration Assay, Stable Transfection, Expressing

    20) Product Images from "Proliferation pattern during rostrum regeneration of the symbiotic flatworm Paracatenula galateia: a pulse-chase-pulse analysis"

    Article Title: Proliferation pattern during rostrum regeneration of the symbiotic flatworm Paracatenula galateia: a pulse-chase-pulse analysis

    Journal: Cell and Tissue Research

    doi: 10.1007/s00441-012-1426-4

    Interference contrast and fluorescence micrographs of various stages of rostrum regeneration of P. galateia . Each horizontal column of the images belongs to the same stage. The time of regeneration (48 h, 120 h, 172 h and 264 h) is indicated far left . Top Type of image, incubation, or staining. As indicated by the color of the font , EdU label is shown in green , BrdU label in blue and serotonin in red . Far right Merged view ( Overlay ) of the three fluorescence images left plus the interference contrast image ( arrowheads important events in the regeneration process as described in text, stars image artifacts). Bars 100 μm
    Figure Legend Snippet: Interference contrast and fluorescence micrographs of various stages of rostrum regeneration of P. galateia . Each horizontal column of the images belongs to the same stage. The time of regeneration (48 h, 120 h, 172 h and 264 h) is indicated far left . Top Type of image, incubation, or staining. As indicated by the color of the font , EdU label is shown in green , BrdU label in blue and serotonin in red . Far right Merged view ( Overlay ) of the three fluorescence images left plus the interference contrast image ( arrowheads important events in the regeneration process as described in text, stars image artifacts). Bars 100 μm

    Techniques Used: Fluorescence, Incubation, Staining

    a Interference contrast image of P. galateia after 384 h of rostrum regeneration. b–e Fluorescent images of Paracatenula sp. “schnitzel” after 264 h of rostrum regeneration. b EdU-pulse with 264-h chase ( green ). c BrdU pulse-staining ( blue ). d Staining of serotonergic nerves ( red ). e Merged images ( Overlay ). Bars 100 μm
    Figure Legend Snippet: a Interference contrast image of P. galateia after 384 h of rostrum regeneration. b–e Fluorescent images of Paracatenula sp. “schnitzel” after 264 h of rostrum regeneration. b EdU-pulse with 264-h chase ( green ). c BrdU pulse-staining ( blue ). d Staining of serotonergic nerves ( red ). e Merged images ( Overlay ). Bars 100 μm

    Techniques Used: Staining

    P. galateia trophosome region fragment 172 h after decapitation. Cells labeled by a EdU pulse and 172-h chase ( green ) are strongly aggregated in the regenerating rostrum area. The labeled cells in the anterior region of the worm have been recruited to the wound area to contribute to the regeneration process ( arrows and dashed lines roughly indicate the sphere of influence). The EdU-labeled cells show an even distribution in the posterior region. Cells labeled after a BrdU pulse but no chase ( blue ) are evenly distributed over the worm's body and slightly aggregated in the regenerating rostrum. The light-blue staining indicates EdU/BrdU double-labeled cells. The staining of serotonergic nerves is shown in red . Bar 100 μm
    Figure Legend Snippet: P. galateia trophosome region fragment 172 h after decapitation. Cells labeled by a EdU pulse and 172-h chase ( green ) are strongly aggregated in the regenerating rostrum area. The labeled cells in the anterior region of the worm have been recruited to the wound area to contribute to the regeneration process ( arrows and dashed lines roughly indicate the sphere of influence). The EdU-labeled cells show an even distribution in the posterior region. Cells labeled after a BrdU pulse but no chase ( blue ) are evenly distributed over the worm's body and slightly aggregated in the regenerating rostrum. The light-blue staining indicates EdU/BrdU double-labeled cells. The staining of serotonergic nerves is shown in red . Bar 100 μm

    Techniques Used: Labeling, Staining

    Related Articles

    Clone Assay:

    Article Title: ZHX2 interacts with ephrin-B and regulates neural progenitor maintenance in the developing cerebral cortex
    Article Snippet: Flag-ZHX2-VP16 was cloned into pEF-Ub-GFP (modified from pEFGM) which carries an Ubiquitin promoter-EGFP expression cassette for tracing. .. Primary antibodies used in this study included a rabbit polyclonal anti-ephrin-B antibody C18 (Santa Cruz Biotech), anti-DCX (Santa Cruz), anti-BrdU (Sigma), Rat anti-HA (Roche), Sheep anti-Digoxigenin-AP (Roche), anti-GFP (Roche, Invitrogen).

    Article Title: Involvement of SIRT7 in resumption of rDNA transcription at the exit from mitosis
    Article Snippet: SIRT7-YFP was obtained by cloning hSIRT7 cDNA into the Gateway entry vector pENTR-D-TOPO (Invitrogen), and recombined into pdEYFP ( ). .. The other antibodies were anti-SIRT7-N-terminal (S5947, Sigma-Aldrich), anti-UBF (F-9, Santa Cruz Biotechnology), anti-RPA116/135 (N-17, Santa Cruz Biotechnology), anti-SIRT1 (Abcam), anti-TBP (N-12, Santa Cruz Biotechnology), anti-TTF-1 , anti-BrdU (Sigma-Aldrich) and Texas Red-, FITC- or horseradish peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories).

    Immunocytochemistry:

    Article Title: PAK1 Promotes the Proliferation and Inhibits Apoptosis of Human Spermatogonial Stem Cells via PDK1/KDR/ZNF367 and ERK1/2 and AKT Pathways
    Article Snippet: The cells were starved in DMEM/F12 for 24 hr, and 30 μg/mL BrdU (Sigma, St. Louis, MO) was added to the culture medium. .. After 16 hr of culture, cells were fixed in 4% PFA for 30 min. Immunocytochemistry was conducted using anti-BrdU (Sigma) according to the method described previously. .. After three times washing with PBS, rhodamine-conjugated secondary antibody (Invitrogen, Carlsbad, USA) was added to cells and incubated for 1 hr at room temperature.

    Article Title: Polysialic Acid Directs Tumor Cell Growth by Controlling Heterophilic Neural Cell Adhesion Molecule Interactions
    Article Snippet: Alternatively, cells were fixed as described for immunocytochemistry, washed with phosphate buffer, and mounted in Vectashield containing 4′,6′-diamidino-2-phenylindole (DAPI; Linaris) to analyze the morphology of the nuclei with DAPI fluorescence. .. After incubating with 2 N HCl for 15 min at 37°C and then 0.1 M borate, pH 8.5, for 10 min, BrdU was detected with an anti-BrdU antibody diluted 1:100 (Chemicon).

    Immunostaining:

    Article Title: Ponatinib exerts anti-angiogenic effects in the zebrafish and human umbilical vein endothelial cells via blocking VEGFR signaling pathway
    Article Snippet: Cell proliferation of HUVECs was determined by BrdU incorporation assay. .. HUVECs were seeded in 6-well culture plate and incubated with medium containing BrdU (3 μg/mL) and drugs for 24 h. The cells were then fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100 for immunostaining with BrdU antibody (Sigma). .. Images were visualized and photographed using the EVOS Cell Imaging System (Thermo Fisher; Waltham, MA).

    Article Title: Her4-Positive Population in the Tectum Opticum Is Proliferating Neural Precursors in the Adult Zebrafish Brain
    Article Snippet: Immunohistochemistry was performed as described by . .. For immunostaining, anti-Myc (1/5000, Santa Cruz) and anti-BrdU (1/1000, Sigma) antibodies were used. .. Whole-mount immunostaining was performed as described by with a minor modifaction.

    Article Title: Prostate Sphere-forming Stem Cells Are Derived from the P63-expressing Basal Compartment
    Article Snippet: The cells were cultured in fresh medium for another 7 days prior to being harvested for analyses. .. Immunostaining with anti-BrdU antibody (1:500 dilution; Sigma) was used to detect BrdU-labeled cells. .. Dissociated single prostate cells were incubated with FITC-conjugated anti-CD31, -CD45, -Ter119 antibodies, and phycoerythrin-conjugated anti-Sca-1 antibody (eBioscience), or Alexa 647-conjugated anti-CD49f antibody (Biolegend) diluted in the cell sorting buffer (2% FBS in PBS).

    Ex Vivo:

    Article Title: Endothelial Cell Phenotypes are Maintained During Angiogenesis in Cultured Microvascular Networks
    Article Snippet: BrdU labeling of Day 3 (Ex Vivo ) tissues was achieved by a 2-hour incubation with BrdU supplemented media (1 mg BrdU per 1 ml MEM + 1% PenStrep) at 37 °C followed by a 30-minute methanol fixation. .. For both models of angiogenesis, following fixation mesentery tissues were washed three times in PBS, incubated for 1 hour in 2 M HCl, washed three times in PBS + 0.1% saponin, and incubated with anti-BrdU (1:100; Sigma-Aldrich; St. Louis, MO) at 4 °C overnight.

    Incubation:

    Article Title: Endothelial Cell Phenotypes are Maintained During Angiogenesis in Cultured Microvascular Networks
    Article Snippet: BrdU labeling of Day 3 (Ex Vivo ) tissues was achieved by a 2-hour incubation with BrdU supplemented media (1 mg BrdU per 1 ml MEM + 1% PenStrep) at 37 °C followed by a 30-minute methanol fixation. .. For both models of angiogenesis, following fixation mesentery tissues were washed three times in PBS, incubated for 1 hour in 2 M HCl, washed three times in PBS + 0.1% saponin, and incubated with anti-BrdU (1:100; Sigma-Aldrich; St. Louis, MO) at 4 °C overnight. .. Tissues were subsequently labeled for PECAM and DAPI following BrdU labeling.

    Article Title: Bid Expression Network Controls Neuronal Cell Fate During Avian Ciliary Ganglion Development
    Article Snippet: Neurons were counted on every tenth HE-stained section as described ( ). .. Sections were de-paraffinized and heated in citrate buffer for improved antigen retrieval and further incubated with anti-islet-1/2 (40.2D6) 1:50; anti-gag (AMV3C2, 1:200; both from Developmental Studies Hybridoma Bank, University of Iowa), anti-BrdU (Sigma; 1:1000); anti-active-caspase-3 (R & D; 1:500) and visualized using biotinylated secondary antibodies (donkey-anti-mouse; -anti-rabbit; -anti-rat; 1:100; Dianova, Hamburg, Germany) and diaminobenzidine (Vectastain Peroxidase ABC-kit 6100, Vector Laboratories, CA, United States). .. Sections were de-paraffinized and in situ hybridization and preparation of digoxigenin-labeled probes for chicken BID and BCL-XL were performed as described previously ( ).

    Article Title: NPTX2 is a key component in the regulation of anxiety
    Article Snippet: Sections were then counterstained with cresyl violet and mounted in DPX. .. For BrdU/NeuN double labeling, sections were incubated in 2 M HCl for 30 min at 37 °C, neutralized in boric acid (Sigma) for 15 min (pH 8.5) and washed three times in PBS before incubation with BrdU antibodies (1∶250, Accurate) and NeuN (1∶400 Millipore). .. Following three washes in PBS (5 min each), sections were incubated with the fluorescent secondary antibody (1∶250, Alex Fluor 488 and Texas Red, Invitrogen) for 2 h in 0.3% Triton/PBS with 2% of goat serum.

    Article Title: Ponatinib exerts anti-angiogenic effects in the zebrafish and human umbilical vein endothelial cells via blocking VEGFR signaling pathway
    Article Snippet: Cell proliferation of HUVECs was determined by BrdU incorporation assay. .. HUVECs were seeded in 6-well culture plate and incubated with medium containing BrdU (3 μg/mL) and drugs for 24 h. The cells were then fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100 for immunostaining with BrdU antibody (Sigma). .. Images were visualized and photographed using the EVOS Cell Imaging System (Thermo Fisher; Waltham, MA).

    Article Title: Polysialic Acid Directs Tumor Cell Growth by Controlling Heterophilic Neural Cell Adhesion Molecule Interactions
    Article Snippet: Cells were incubated for 16 h with 10 μM BrdU prior to fixation. .. After incubating with 2 N HCl for 15 min at 37°C and then 0.1 M borate, pH 8.5, for 10 min, BrdU was detected with an anti-BrdU antibody diluted 1:100 (Chemicon).

    Article Title: HPV Episome Levels are Potently Decreased by Pyrrole-Imidazole Polyamides
    Article Snippet: Immunohistochemistry was conducted after de-waxing in xylene and re-hydrating through a graded ethanol series. .. Sections were incubated for 30 min in 2N HCl at 37°C, rinsed in tap water, and transferred to Tris-buffered saline with Tween (TBST: 50 mM Tris-HCl, 150 mM NaCl, and 0.025% Tween-20) and blocked with 3% normal rabbit serum (MP Biomedicals) for 1 h. Slides were drained and incubated 1 h with antibromodeoxyuridine (BrdU) antibody (clone BU-33; Sigma) at 2.5 µg/mL in diluent buffer (DB: 50 mM Tris-HCl, 150 mM NaCl, 1% bovine serum albumin (BSA), 0.1% Tween-20, pH 7.2). .. After 3 rinses (5 min each) with TBST, a biotinylated rabbit anti-mouse IgG (Vector Labs, cat. # BA-9200) was applied to the sections at 3 µg/mL for 30 min at r.t.

    Article Title: Her4-Positive Population in the Tectum Opticum Is Proliferating Neural Precursors in the Adult Zebrafish Brain
    Article Snippet: For immunostaining, anti-Myc (1/5000, Santa Cruz) and anti-BrdU (1/1000, Sigma) antibodies were used. .. For immunostaining, anti-Myc (1/5000, Santa Cruz) and anti-BrdU (1/1000, Sigma) antibodies were used.

    Article Title: Microbiota-induced activation of epithelial IL-6 signaling links inflammasome-driven inflammation with transmissible cancer
    Article Snippet: Organs were removed and fixed in 10% neutral formalin solution overnight at 4°C, then embedded in paraffin, sectioned, and stained with H & E. Slides were prepared at the Yale University Department of Pathology. .. Paraffin-embedded sections were rehydrated, subjected to heat-induced epitope retrieval, and incubated with the following antibodies: anti-BrdU (1:4,000; Sigma), anti-Ki67 (1:100; Lab Vision). .. The DAKO EnVision System was used for detection.

    Article Title:
    Article Snippet: For proliferation, 2.5 × 103 cells were plated in 96-well plates in DMEM alone and serum-starved for 36 h, then treated with thrombin (5 n m ), MMP-1 (5 n m ), 10% FBS (Invitrogen), and/or RWJ-56110 (5 μ m ), and incubated at 37 °C for 3 days. .. For BrdU incorporation experiments, 50 μ m BrdU (Sigma) was added to 200,000 cells 24 h after adding proteases/inhibitors and allowed to incorporate for 2 h. Permeabilized cells were stained with 1:10 anti-BrdU monoclonal Ab (G3G4, DSHB-Univ Iowa)/FITC-conjugated secondary (1:10; Invitrogen), and the ratio of BrdU-positive cells/negative cells was assessed by FACS.

    Article Title: G-overhang dynamics at Tetrahymena telomeres
    Article Snippet: The newly replicated DNA strands were separated from the parental strands by immunoprecipitation with antibody to BrdU (Sigma). .. The newly replicated DNA strands were separated from the parental strands by immunoprecipitation with antibody to BrdU (Sigma).

    Article Title: Prostate Sphere-forming Stem Cells Are Derived from the P63-expressing Basal Compartment
    Article Snippet: After incubation at 37 °C for 40 h, the spheres were harvested as described and BrdU positive cells were identified by immunostaining. .. Immunostaining with anti-BrdU antibody (1:500 dilution; Sigma) was used to detect BrdU-labeled cells.

    Proliferation Assay:

    Article Title: Microbiota-induced activation of epithelial IL-6 signaling links inflammasome-driven inflammation with transmissible cancer
    Article Snippet: Paraffin-embedded sections were rehydrated, subjected to heat-induced epitope retrieval, and incubated with the following antibodies: anti-BrdU (1:4,000; Sigma), anti-Ki67 (1:100; Lab Vision). .. Paraffin-embedded sections were rehydrated, subjected to heat-induced epitope retrieval, and incubated with the following antibodies: anti-BrdU (1:4,000; Sigma), anti-Ki67 (1:100; Lab Vision).

    Article Title: Sphingosine 1-Phosphate Receptors Are Essential Mediators of Eyelid Closure during Embryonic Development
    Article Snippet: Paragraph title: Cell Proliferation Assay ... MEFs were grown on poly- l -lysine-coated coverslips at low density, serum-starved for 4 h, treated with or without EGF overnight in the presence of BrdU (catalog no. 00-0103, Invitrogen), fixed with 70% ethanol, labeled with an anti-BrdU antibody (Millipore), and stained with propidium iodide (Invitrogen).

    Article Title: Overexpression of H1 Calponin in Osteoblast Lineage Cells Leads to a Decrease in Bone Mass by Disrupting Osteoblast Function and Promoting Osteoclast Formation
    Article Snippet: Paragraph title: Cell proliferation assay ... For bromodeoxyuridine (BrdU) incorporation assay, cells were labeled with 4 μg/mL BrdU (Sigma Aldrich) for 4 hours at 37°C and detected by anti-BrdU monoclonal antibody (Sigma Aldrich) as reported. ( )

    Expressing:

    Article Title: ZHX2 interacts with ephrin-B and regulates neural progenitor maintenance in the developing cerebral cortex
    Article Snippet: Flag-ZHX2-VP16 was cloned into pEF-Ub-GFP (modified from pEFGM) which carries an Ubiquitin promoter-EGFP expression cassette for tracing. .. Primary antibodies used in this study included a rabbit polyclonal anti-ephrin-B antibody C18 (Santa Cruz Biotech), anti-DCX (Santa Cruz), anti-BrdU (Sigma), Rat anti-HA (Roche), Sheep anti-Digoxigenin-AP (Roche), anti-GFP (Roche, Invitrogen).

    Article Title: Involvement of SIRT7 in resumption of rDNA transcription at the exit from mitosis
    Article Snippet: Human RPA43, PAF49, PAF53 and TIF-1A/Rrn3 antibodies were raised in sheep immunized with full-length recombinant proteins produced using baculovirus or Escherichia coli expression systems. .. The other antibodies were anti-SIRT7-N-terminal (S5947, Sigma-Aldrich), anti-UBF (F-9, Santa Cruz Biotechnology), anti-RPA116/135 (N-17, Santa Cruz Biotechnology), anti-SIRT1 (Abcam), anti-TBP (N-12, Santa Cruz Biotechnology), anti-TTF-1 , anti-BrdU (Sigma-Aldrich) and Texas Red-, FITC- or horseradish peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories).

    Modification:

    Article Title: ZHX2 interacts with ephrin-B and regulates neural progenitor maintenance in the developing cerebral cortex
    Article Snippet: Flag-ZHX2-VP16 was cloned into pEF-Ub-GFP (modified from pEFGM) which carries an Ubiquitin promoter-EGFP expression cassette for tracing. .. Primary antibodies used in this study included a rabbit polyclonal anti-ephrin-B antibody C18 (Santa Cruz Biotech), anti-DCX (Santa Cruz), anti-BrdU (Sigma), Rat anti-HA (Roche), Sheep anti-Digoxigenin-AP (Roche), anti-GFP (Roche, Invitrogen).

    Immunohistochemistry:

    Article Title: Endothelial Cell Phenotypes are Maintained During Angiogenesis in Cultured Microvascular Networks
    Article Snippet: Paragraph title: Immunohistochemistry ... For both models of angiogenesis, following fixation mesentery tissues were washed three times in PBS, incubated for 1 hour in 2 M HCl, washed three times in PBS + 0.1% saponin, and incubated with anti-BrdU (1:100; Sigma-Aldrich; St. Louis, MO) at 4 °C overnight.

    Article Title: Bid Expression Network Controls Neuronal Cell Fate During Avian Ciliary Ganglion Development
    Article Snippet: Paragraph title: Immunohistochemistry ... Sections were de-paraffinized and heated in citrate buffer for improved antigen retrieval and further incubated with anti-islet-1/2 (40.2D6) 1:50; anti-gag (AMV3C2, 1:200; both from Developmental Studies Hybridoma Bank, University of Iowa), anti-BrdU (Sigma; 1:1000); anti-active-caspase-3 (R & D; 1:500) and visualized using biotinylated secondary antibodies (donkey-anti-mouse; -anti-rabbit; -anti-rat; 1:100; Dianova, Hamburg, Germany) and diaminobenzidine (Vectastain Peroxidase ABC-kit 6100, Vector Laboratories, CA, United States).

    Article Title: NPTX2 is a key component in the regulation of anxiety
    Article Snippet: Paragraph title: Immunohistochemistry and quantification ... For BrdU/NeuN double labeling, sections were incubated in 2 M HCl for 30 min at 37 °C, neutralized in boric acid (Sigma) for 15 min (pH 8.5) and washed three times in PBS before incubation with BrdU antibodies (1∶250, Accurate) and NeuN (1∶400 Millipore).

    Article Title: HPV Episome Levels are Potently Decreased by Pyrrole-Imidazole Polyamides
    Article Snippet: Paragraph title: Tissue Processing, Immunohistochemistry, and Cell Counts ... Sections were incubated for 30 min in 2N HCl at 37°C, rinsed in tap water, and transferred to Tris-buffered saline with Tween (TBST: 50 mM Tris-HCl, 150 mM NaCl, and 0.025% Tween-20) and blocked with 3% normal rabbit serum (MP Biomedicals) for 1 h. Slides were drained and incubated 1 h with antibromodeoxyuridine (BrdU) antibody (clone BU-33; Sigma) at 2.5 µg/mL in diluent buffer (DB: 50 mM Tris-HCl, 150 mM NaCl, 1% bovine serum albumin (BSA), 0.1% Tween-20, pH 7.2).

    Article Title: Her4-Positive Population in the Tectum Opticum Is Proliferating Neural Precursors in the Adult Zebrafish Brain
    Article Snippet: Paragraph title: Immunohistochemistry ... For immunostaining, anti-Myc (1/5000, Santa Cruz) and anti-BrdU (1/1000, Sigma) antibodies were used.

    Article Title: Microbiota-induced activation of epithelial IL-6 signaling links inflammasome-driven inflammation with transmissible cancer
    Article Snippet: Paragraph title: Immunohistochemistry. ... Paraffin-embedded sections were rehydrated, subjected to heat-induced epitope retrieval, and incubated with the following antibodies: anti-BrdU (1:4,000; Sigma), anti-Ki67 (1:100; Lab Vision).

    Immunoprecipitation:

    Article Title: G-overhang dynamics at Tetrahymena telomeres
    Article Snippet: The rDNA was gel purified, ligated to the 5′-end-labeled foldback oligonucleotide Napatel (5′-ATCTCGGGCCCGCGGCCGCCTAATAGGCGGCCGCGGGCCCGAGATACCCC) as described above, and digested with Pst I to release the leading and lagging strand telomeres. .. The newly replicated DNA strands were separated from the parental strands by immunoprecipitation with antibody to BrdU (Sigma). .. Protein G beads were prepared by incubating 10 ml of beads with 10 ml of antibody for 1 h at room temperature in 200 µl of 20 mM Tris pH 8.6, 100 mM H3 BO3 , 120 mM NaCl, 100 mM KCl, 1.5 mM MgCl2 , 0.1 mM EDTA, 5 mM β-mercaptoethanol, and then washing the beads three times with phosphate-buffered saline (PBS)/1% Triton X-100.

    Cell Counting:

    Article Title: Overexpression of H1 Calponin in Osteoblast Lineage Cells Leads to a Decrease in Bone Mass by Disrupting Osteoblast Function and Promoting Osteoclast Formation
    Article Snippet: Cell proliferation analysis was performed by cell counting. .. For bromodeoxyuridine (BrdU) incorporation assay, cells were labeled with 4 μg/mL BrdU (Sigma Aldrich) for 4 hours at 37°C and detected by anti-BrdU monoclonal antibody (Sigma Aldrich) as reported. ( )

    Cell Culture:

    Article Title: PAK1 Promotes the Proliferation and Inhibits Apoptosis of Human Spermatogonial Stem Cells via PDK1/KDR/ZNF367 and ERK1/2 and AKT Pathways
    Article Snippet: In total, 1 × 105 cells/well of the human SSC line were placed on 12-well plates with DMEM/F12 containing 10% FBS and cultured for 12 hr. .. After 16 hr of culture, cells were fixed in 4% PFA for 30 min. Immunocytochemistry was conducted using anti-BrdU (Sigma) according to the method described previously.

    Article Title: Prostate Sphere-forming Stem Cells Are Derived from the P63-expressing Basal Compartment
    Article Snippet: Immunostaining with anti-BrdU antibody (1:500 dilution; Sigma) was used to detect BrdU-labeled cells. .. Immunostaining with anti-BrdU antibody (1:500 dilution; Sigma) was used to detect BrdU-labeled cells.

    Hemagglutination Assay:

    Article Title: ZHX2 interacts with ephrin-B and regulates neural progenitor maintenance in the developing cerebral cortex
    Article Snippet: GFP-EphrinB1CD, HA-EphrinB1CD, Myc6-Z0, Gal4-ZHX2, Gal4-ZHX2-VP16 and DsRed-ZHX2 were cloned into pcDNA3.1Zeocin (Invitrogen). .. Primary antibodies used in this study included a rabbit polyclonal anti-ephrin-B antibody C18 (Santa Cruz Biotech), anti-DCX (Santa Cruz), anti-BrdU (Sigma), Rat anti-HA (Roche), Sheep anti-Digoxigenin-AP (Roche), anti-GFP (Roche, Invitrogen).

    other:

    Article Title: Visualizing Coronavirus RNA Synthesis in Time by Using Click Chemistry
    Article Snippet: The anti-5-bromodeoxyuridine (BrdU) antibody was purchased from Sigma-Aldrich.

    Polymerase Chain Reaction:

    Article Title: Involvement of SIRT7 in resumption of rDNA transcription at the exit from mitosis
    Article Snippet: Human SIRT7 (hSIRT7) cDNA (clone IMAGE 5087554) was PCR-amplified and subcloned into the Eco RI/ Sal I sites of the pMIGR1 retroviral vector provided by S.A. Leibovitch (INRA, Montpellier, France) to generate the GFP-SIRT7 construct and into the Eco RI/ Not I sites of the pGEX4T1 (Amersham) to obtain the GST-SIRT7 construct. .. The other antibodies were anti-SIRT7-N-terminal (S5947, Sigma-Aldrich), anti-UBF (F-9, Santa Cruz Biotechnology), anti-RPA116/135 (N-17, Santa Cruz Biotechnology), anti-SIRT1 (Abcam), anti-TBP (N-12, Santa Cruz Biotechnology), anti-TTF-1 , anti-BrdU (Sigma-Aldrich) and Texas Red-, FITC- or horseradish peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories).

    Injection:

    Article Title: Endothelial Cell Phenotypes are Maintained During Angiogenesis in Cultured Microvascular Networks
    Article Snippet: For both models of angiogenesis, following fixation mesentery tissues were washed three times in PBS, incubated for 1 hour in 2 M HCl, washed three times in PBS + 0.1% saponin, and incubated with anti-BrdU (1:100; Sigma-Aldrich; St. Louis, MO) at 4 °C overnight. .. Tissues were subsequently labeled for PECAM and DAPI following BrdU labeling.

    Article Title: Microbiota-induced activation of epithelial IL-6 signaling links inflammasome-driven inflammation with transmissible cancer
    Article Snippet: Paraffin-embedded sections were rehydrated, subjected to heat-induced epitope retrieval, and incubated with the following antibodies: anti-BrdU (1:4,000; Sigma), anti-Ki67 (1:100; Lab Vision). .. Paraffin-embedded sections were rehydrated, subjected to heat-induced epitope retrieval, and incubated with the following antibodies: anti-BrdU (1:4,000; Sigma), anti-Ki67 (1:100; Lab Vision).

    Article Title: Activation of mTORC1 in Collecting Ducts Causes Hyperkalemia
    Article Snippet: Four- and 6-week-old control and KO mice and 6-week-old KO mice with 2 weeks rapamycin treatment were given a single intraperitoneal injection of 1 ml BrdU (Invitrogen) per 100 g body weight. .. The proliferative activity of CCD was assessed on 5- μ m sections using immunofluorescence as described above, and anti-BrdU primary antibody (1:1000; Sigma-Aldrich).

    Article Title: Mapping stem cell activities in the feather follicle
    Article Snippet: For pulse labelling, chickens were injected intraperitoneally with BrdU (Sigma) at 50mg per kg (body weight). .. Samples were fixed in 4% paraformaldehyde, mounted in paraffin, sectioned at 8 µm, stained with antibody against BrdU (Chemicon) and counterstained with haematoxylin and eosin.

    Recombinant:

    Article Title: Involvement of SIRT7 in resumption of rDNA transcription at the exit from mitosis
    Article Snippet: Human RPA43, PAF49, PAF53 and TIF-1A/Rrn3 antibodies were raised in sheep immunized with full-length recombinant proteins produced using baculovirus or Escherichia coli expression systems. .. The other antibodies were anti-SIRT7-N-terminal (S5947, Sigma-Aldrich), anti-UBF (F-9, Santa Cruz Biotechnology), anti-RPA116/135 (N-17, Santa Cruz Biotechnology), anti-SIRT1 (Abcam), anti-TBP (N-12, Santa Cruz Biotechnology), anti-TTF-1 , anti-BrdU (Sigma-Aldrich) and Texas Red-, FITC- or horseradish peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories).

    Immunofluorescence:

    Article Title: NPTX2 is a key component in the regulation of anxiety
    Article Snippet: For BrdU/NeuN double labeling, sections were incubated in 2 M HCl for 30 min at 37 °C, neutralized in boric acid (Sigma) for 15 min (pH 8.5) and washed three times in PBS before incubation with BrdU antibodies (1∶250, Accurate) and NeuN (1∶400 Millipore). .. Following three washes in PBS (5 min each), sections were incubated with the fluorescent secondary antibody (1∶250, Alex Fluor 488 and Texas Red, Invitrogen) for 2 h in 0.3% Triton/PBS with 2% of goat serum.

    Article Title: Activation of mTORC1 in Collecting Ducts Causes Hyperkalemia
    Article Snippet: Two hours later, they were euthanized by cervical dislocation; the kidneys were removed and immediately fixed in 4% paraformaldehyde, then processed using paraffin wax and standard methods. .. The proliferative activity of CCD was assessed on 5- μ m sections using immunofluorescence as described above, and anti-BrdU primary antibody (1:1000; Sigma-Aldrich). .. Apoptosis of CCD cells was evaluated on 5- μ m sections by TUNEL assay using a commercial kit (Promega).

    In Vivo:

    Article Title: Endothelial Cell Phenotypes are Maintained During Angiogenesis in Cultured Microvascular Networks
    Article Snippet: For Day 3 (In Vivo ) BrdU labeling, a 30 ml BrdU solution (1 mg BrdU per 1 ml sterile saline) was warmed to 37 °C and perfused into the abdominal cavity of an anesthetized rat and incubated for 2 hours. .. For both models of angiogenesis, following fixation mesentery tissues were washed three times in PBS, incubated for 1 hour in 2 M HCl, washed three times in PBS + 0.1% saponin, and incubated with anti-BrdU (1:100; Sigma-Aldrich; St. Louis, MO) at 4 °C overnight.

    Gene Knockout:

    Article Title: Activation of mTORC1 in Collecting Ducts Causes Hyperkalemia
    Article Snippet: Four- and 6-week-old control and KO mice and 6-week-old KO mice with 2 weeks rapamycin treatment were given a single intraperitoneal injection of 1 ml BrdU (Invitrogen) per 100 g body weight. .. The proliferative activity of CCD was assessed on 5- μ m sections using immunofluorescence as described above, and anti-BrdU primary antibody (1:1000; Sigma-Aldrich).

    Fluorescence:

    Article Title: NPTX2 is a key component in the regulation of anxiety
    Article Snippet: For BrdU/NeuN double labeling, sections were incubated in 2 M HCl for 30 min at 37 °C, neutralized in boric acid (Sigma) for 15 min (pH 8.5) and washed three times in PBS before incubation with BrdU antibodies (1∶250, Accurate) and NeuN (1∶400 Millipore). .. Then, slides were incubated in 0.01 M citric acid buffer for 15 min at 95 °C, rinsed in PBS and incubated overnight at room temperature in rabbit anti-NPTX2 antibody (1:1000, Proteintech), mouse anti-NeuN antibody (1:400, Millipore), mouse anti-GFAP antibody (1:1000, Sigma).

    Article Title: PAK1 Promotes the Proliferation and Inhibits Apoptosis of Human Spermatogonial Stem Cells via PDK1/KDR/ZNF367 and ERK1/2 and AKT Pathways
    Article Snippet: After 16 hr of culture, cells were fixed in 4% PFA for 30 min. Immunocytochemistry was conducted using anti-BrdU (Sigma) according to the method described previously. .. After three times washing with PBS, rhodamine-conjugated secondary antibody (Invitrogen, Carlsbad, USA) was added to cells and incubated for 1 hr at room temperature.

    Article Title: Polysialic Acid Directs Tumor Cell Growth by Controlling Heterophilic Neural Cell Adhesion Molecule Interactions
    Article Snippet: Alternatively, cells were fixed as described for immunocytochemistry, washed with phosphate buffer, and mounted in Vectashield containing 4′,6′-diamidino-2-phenylindole (DAPI; Linaris) to analyze the morphology of the nuclei with DAPI fluorescence. .. After incubating with 2 N HCl for 15 min at 37°C and then 0.1 M borate, pH 8.5, for 10 min, BrdU was detected with an anti-BrdU antibody diluted 1:100 (Chemicon).

    Metabolic Assay:

    Article Title: Polysialic Acid Directs Tumor Cell Growth by Controlling Heterophilic Neural Cell Adhesion Molecule Interactions
    Article Snippet: For each treatment, phase contrast images of three wells were captured with an Axiovert 135 microscope (Zeiss) and a charge-coupled device camera, and cells were counted to compare cell numbers with the results of the metabolic assay. .. After incubating with 2 N HCl for 15 min at 37°C and then 0.1 M borate, pH 8.5, for 10 min, BrdU was detected with an anti-BrdU antibody diluted 1:100 (Chemicon).

    Avidin-Biotin Assay:

    Article Title: HPV Episome Levels are Potently Decreased by Pyrrole-Imidazole Polyamides
    Article Snippet: Sections were incubated for 30 min in 2N HCl at 37°C, rinsed in tap water, and transferred to Tris-buffered saline with Tween (TBST: 50 mM Tris-HCl, 150 mM NaCl, and 0.025% Tween-20) and blocked with 3% normal rabbit serum (MP Biomedicals) for 1 h. Slides were drained and incubated 1 h with antibromodeoxyuridine (BrdU) antibody (clone BU-33; Sigma) at 2.5 µg/mL in diluent buffer (DB: 50 mM Tris-HCl, 150 mM NaCl, 1% bovine serum albumin (BSA), 0.1% Tween-20, pH 7.2). .. Sections were incubated for 30 min in 2N HCl at 37°C, rinsed in tap water, and transferred to Tris-buffered saline with Tween (TBST: 50 mM Tris-HCl, 150 mM NaCl, and 0.025% Tween-20) and blocked with 3% normal rabbit serum (MP Biomedicals) for 1 h. Slides were drained and incubated 1 h with antibromodeoxyuridine (BrdU) antibody (clone BU-33; Sigma) at 2.5 µg/mL in diluent buffer (DB: 50 mM Tris-HCl, 150 mM NaCl, 1% bovine serum albumin (BSA), 0.1% Tween-20, pH 7.2).

    Labeling:

    Article Title:
    Article Snippet: Paragraph title: FUrd Labeling ... FUrd incorporation was detected using anti-BrdU antibody (Sigma) and Alexa488-conjugated secondary antibody.

    Article Title: Endothelial Cell Phenotypes are Maintained During Angiogenesis in Cultured Microvascular Networks
    Article Snippet: BrdU labeling of Day 3 (Ex Vivo ) tissues was achieved by a 2-hour incubation with BrdU supplemented media (1 mg BrdU per 1 ml MEM + 1% PenStrep) at 37 °C followed by a 30-minute methanol fixation. .. For both models of angiogenesis, following fixation mesentery tissues were washed three times in PBS, incubated for 1 hour in 2 M HCl, washed three times in PBS + 0.1% saponin, and incubated with anti-BrdU (1:100; Sigma-Aldrich; St. Louis, MO) at 4 °C overnight.

    Article Title: NPTX2 is a key component in the regulation of anxiety
    Article Snippet: Sections were then counterstained with cresyl violet and mounted in DPX. .. For BrdU/NeuN double labeling, sections were incubated in 2 M HCl for 30 min at 37 °C, neutralized in boric acid (Sigma) for 15 min (pH 8.5) and washed three times in PBS before incubation with BrdU antibodies (1∶250, Accurate) and NeuN (1∶400 Millipore). .. Following three washes in PBS (5 min each), sections were incubated with the fluorescent secondary antibody (1∶250, Alex Fluor 488 and Texas Red, Invitrogen) for 2 h in 0.3% Triton/PBS with 2% of goat serum.

    Article Title: Sphingosine 1-Phosphate Receptors Are Essential Mediators of Eyelid Closure during Embryonic Development
    Article Snippet: Cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay as described ( ). .. MEFs were grown on poly- l -lysine-coated coverslips at low density, serum-starved for 4 h, treated with or without EGF overnight in the presence of BrdU (catalog no. 00-0103, Invitrogen), fixed with 70% ethanol, labeled with an anti-BrdU antibody (Millipore), and stained with propidium iodide (Invitrogen). .. Positive nuclei were counted relative to the total number of propidium iodide-labeled nuclei.

    Article Title: Overexpression of H1 Calponin in Osteoblast Lineage Cells Leads to a Decrease in Bone Mass by Disrupting Osteoblast Function and Promoting Osteoclast Formation
    Article Snippet: Cells were seeded at 2 × 104 cells/well in 24-multiwell plates on the first day, and the cell number was counted using counting chamber every day. .. For bromodeoxyuridine (BrdU) incorporation assay, cells were labeled with 4 μg/mL BrdU (Sigma Aldrich) for 4 hours at 37°C and detected by anti-BrdU monoclonal antibody (Sigma Aldrich) as reported. ( ) .. P1 passage osteoblasts were seeded in 6-cm dishes at 2 × 105 cells/dish.

    Article Title: Prostate Sphere-forming Stem Cells Are Derived from the P63-expressing Basal Compartment
    Article Snippet: Paragraph title: BrdU Labeling ... Immunostaining with anti-BrdU antibody (1:500 dilution; Sigma) was used to detect BrdU-labeled cells.

    Mouse Assay:

    Article Title: Microbiota-induced activation of epithelial IL-6 signaling links inflammasome-driven inflammation with transmissible cancer
    Article Snippet: Paraffin-embedded sections were rehydrated, subjected to heat-induced epitope retrieval, and incubated with the following antibodies: anti-BrdU (1:4,000; Sigma), anti-Ki67 (1:100; Lab Vision). .. Paraffin-embedded sections were rehydrated, subjected to heat-induced epitope retrieval, and incubated with the following antibodies: anti-BrdU (1:4,000; Sigma), anti-Ki67 (1:100; Lab Vision).

    Article Title: Activation of mTORC1 in Collecting Ducts Causes Hyperkalemia
    Article Snippet: Four- and 6-week-old control and KO mice and 6-week-old KO mice with 2 weeks rapamycin treatment were given a single intraperitoneal injection of 1 ml BrdU (Invitrogen) per 100 g body weight. .. The proliferative activity of CCD was assessed on 5- μ m sections using immunofluorescence as described above, and anti-BrdU primary antibody (1:1000; Sigma-Aldrich).

    Microscopy:

    Article Title: PAK1 Promotes the Proliferation and Inhibits Apoptosis of Human Spermatogonial Stem Cells via PDK1/KDR/ZNF367 and ERK1/2 and AKT Pathways
    Article Snippet: After 16 hr of culture, cells were fixed in 4% PFA for 30 min. Immunocytochemistry was conducted using anti-BrdU (Sigma) according to the method described previously. .. After three times washing with PBS, rhodamine-conjugated secondary antibody (Invitrogen, Carlsbad, USA) was added to cells and incubated for 1 hr at room temperature.

    Article Title: Polysialic Acid Directs Tumor Cell Growth by Controlling Heterophilic Neural Cell Adhesion Molecule Interactions
    Article Snippet: For each treatment, phase contrast images of three wells were captured with an Axiovert 135 microscope (Zeiss) and a charge-coupled device camera, and cells were counted to compare cell numbers with the results of the metabolic assay. .. After incubating with 2 N HCl for 15 min at 37°C and then 0.1 M borate, pH 8.5, for 10 min, BrdU was detected with an anti-BrdU antibody diluted 1:100 (Chemicon).

    Staining:

    Article Title: Endothelial Cell Phenotypes are Maintained During Angiogenesis in Cultured Microvascular Networks
    Article Snippet: Nuclear staining was achieved by a 10-minute incubation with DAPI (1:3000; Invitrogen; Carlsbad, CA) at room temperature. .. For both models of angiogenesis, following fixation mesentery tissues were washed three times in PBS, incubated for 1 hour in 2 M HCl, washed three times in PBS + 0.1% saponin, and incubated with anti-BrdU (1:100; Sigma-Aldrich; St. Louis, MO) at 4 °C overnight.

    Article Title: NPTX2 is a key component in the regulation of anxiety
    Article Snippet: All sections for NPTX2, DCX (doublecortin), Ki67, BrdU (5-bromo-2’-deoxyuridine), and c-Fos staining were sliced at a thickness of 40 µm. .. For BrdU/NeuN double labeling, sections were incubated in 2 M HCl for 30 min at 37 °C, neutralized in boric acid (Sigma) for 15 min (pH 8.5) and washed three times in PBS before incubation with BrdU antibodies (1∶250, Accurate) and NeuN (1∶400 Millipore).

    Article Title: Sphingosine 1-Phosphate Receptors Are Essential Mediators of Eyelid Closure during Embryonic Development
    Article Snippet: Cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay as described ( ). .. MEFs were grown on poly- l -lysine-coated coverslips at low density, serum-starved for 4 h, treated with or without EGF overnight in the presence of BrdU (catalog no. 00-0103, Invitrogen), fixed with 70% ethanol, labeled with an anti-BrdU antibody (Millipore), and stained with propidium iodide (Invitrogen). .. Positive nuclei were counted relative to the total number of propidium iodide-labeled nuclei.

    Article Title: Mapping stem cell activities in the feather follicle
    Article Snippet: For label-retaining studies of growth phase follicles, 1-month-old chickens were fed BrdU in their drinking water (1 mg ml−1 ) for 1 week, and ‘chased’ (left to metabolize the BrdU in their system) for 1 week, 2 weeks, and so on. .. Samples were fixed in 4% paraformaldehyde, mounted in paraffin, sectioned at 8 µm, stained with antibody against BrdU (Chemicon) and counterstained with haematoxylin and eosin. .. In chickens, neighbouring flight feathers on the wing moult in sequential order.

    Article Title:
    Article Snippet: Residual crystal violet was resuspended in 100% methanol (Sigma) and absorbance read at 595 nm. .. For BrdU incorporation experiments, 50 μ m BrdU (Sigma) was added to 200,000 cells 24 h after adding proteases/inhibitors and allowed to incorporate for 2 h. Permeabilized cells were stained with 1:10 anti-BrdU monoclonal Ab (G3G4, DSHB-Univ Iowa)/FITC-conjugated secondary (1:10; Invitrogen), and the ratio of BrdU-positive cells/negative cells was assessed by FACS. .. For migration, 25 × 103 cells were plated in the top chamber of a 24-well Boyden chamber (Fisher) in 0.1% FBS/DMEM.

    Purification:

    Article Title: G-overhang dynamics at Tetrahymena telomeres
    Article Snippet: The rDNA was gel purified, ligated to the 5′-end-labeled foldback oligonucleotide Napatel (5′-ATCTCGGGCCCGCGGCCGCCTAATAGGCGGCCGCGGGCCCGAGATACCCC) as described above, and digested with Pst I to release the leading and lagging strand telomeres. .. The newly replicated DNA strands were separated from the parental strands by immunoprecipitation with antibody to BrdU (Sigma).

    Plasmid Preparation:

    Article Title: HPV Episome Levels are Potently Decreased by Pyrrole-Imidazole Polyamides
    Article Snippet: Sections were incubated for 30 min in 2N HCl at 37°C, rinsed in tap water, and transferred to Tris-buffered saline with Tween (TBST: 50 mM Tris-HCl, 150 mM NaCl, and 0.025% Tween-20) and blocked with 3% normal rabbit serum (MP Biomedicals) for 1 h. Slides were drained and incubated 1 h with antibromodeoxyuridine (BrdU) antibody (clone BU-33; Sigma) at 2.5 µg/mL in diluent buffer (DB: 50 mM Tris-HCl, 150 mM NaCl, 1% bovine serum albumin (BSA), 0.1% Tween-20, pH 7.2). .. Sections were incubated for 30 min in 2N HCl at 37°C, rinsed in tap water, and transferred to Tris-buffered saline with Tween (TBST: 50 mM Tris-HCl, 150 mM NaCl, and 0.025% Tween-20) and blocked with 3% normal rabbit serum (MP Biomedicals) for 1 h. Slides were drained and incubated 1 h with antibromodeoxyuridine (BrdU) antibody (clone BU-33; Sigma) at 2.5 µg/mL in diluent buffer (DB: 50 mM Tris-HCl, 150 mM NaCl, 1% bovine serum albumin (BSA), 0.1% Tween-20, pH 7.2).

    Article Title: Involvement of SIRT7 in resumption of rDNA transcription at the exit from mitosis
    Article Snippet: Paragraph title: Plasmid constructs and antibodies ... The other antibodies were anti-SIRT7-N-terminal (S5947, Sigma-Aldrich), anti-UBF (F-9, Santa Cruz Biotechnology), anti-RPA116/135 (N-17, Santa Cruz Biotechnology), anti-SIRT1 (Abcam), anti-TBP (N-12, Santa Cruz Biotechnology), anti-TTF-1 , anti-BrdU (Sigma-Aldrich) and Texas Red-, FITC- or horseradish peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories).

    Article Title: Her4-Positive Population in the Tectum Opticum Is Proliferating Neural Precursors in the Adult Zebrafish Brain
    Article Snippet: For immunostaining, anti-Myc (1/5000, Santa Cruz) and anti-BrdU (1/1000, Sigma) antibodies were used. .. For immunostaining, anti-Myc (1/5000, Santa Cruz) and anti-BrdU (1/1000, Sigma) antibodies were used.

    Agarose Gel Electrophoresis:

    Article Title: G-overhang dynamics at Tetrahymena telomeres
    Article Snippet: The newly replicated DNA strands were separated from the parental strands by immunoprecipitation with antibody to BrdU (Sigma). .. The 70 µl reaction was incubated for 30 min at room temperature, the beads were then washed six times with PBS/1% Triton X-100, and the bound DNA eluted by boiling for 5 min in 10 mM Tris pH 8.0, 1 mM EDTA, 1% SDS.

    BrdU Incorporation Assay:

    Article Title: PAK1 Promotes the Proliferation and Inhibits Apoptosis of Human Spermatogonial Stem Cells via PDK1/KDR/ZNF367 and ERK1/2 and AKT Pathways
    Article Snippet: Paragraph title: BrdU Incorporation Assay ... After 16 hr of culture, cells were fixed in 4% PFA for 30 min. Immunocytochemistry was conducted using anti-BrdU (Sigma) according to the method described previously.

    Article Title: Ponatinib exerts anti-angiogenic effects in the zebrafish and human umbilical vein endothelial cells via blocking VEGFR signaling pathway
    Article Snippet: Paragraph title: BrdU incorporation assay ... HUVECs were seeded in 6-well culture plate and incubated with medium containing BrdU (3 μg/mL) and drugs for 24 h. The cells were then fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100 for immunostaining with BrdU antibody (Sigma).

    Article Title: Activation of mTORC1 in Collecting Ducts Causes Hyperkalemia
    Article Snippet: Paragraph title: BrdU Incorporation and Apoptosis Assay ... The proliferative activity of CCD was assessed on 5- μ m sections using immunofluorescence as described above, and anti-BrdU primary antibody (1:1000; Sigma-Aldrich).

    Article Title: Overexpression of H1 Calponin in Osteoblast Lineage Cells Leads to a Decrease in Bone Mass by Disrupting Osteoblast Function and Promoting Osteoclast Formation
    Article Snippet: Cells were seeded at 2 × 104 cells/well in 24-multiwell plates on the first day, and the cell number was counted using counting chamber every day. .. For bromodeoxyuridine (BrdU) incorporation assay, cells were labeled with 4 μg/mL BrdU (Sigma Aldrich) for 4 hours at 37°C and detected by anti-BrdU monoclonal antibody (Sigma Aldrich) as reported. ( ) .. P1 passage osteoblasts were seeded in 6-cm dishes at 2 × 105 cells/dish.

    Article Title:
    Article Snippet: Residual crystal violet was resuspended in 100% methanol (Sigma) and absorbance read at 595 nm. .. For BrdU incorporation experiments, 50 μ m BrdU (Sigma) was added to 200,000 cells 24 h after adding proteases/inhibitors and allowed to incorporate for 2 h. Permeabilized cells were stained with 1:10 anti-BrdU monoclonal Ab (G3G4, DSHB-Univ Iowa)/FITC-conjugated secondary (1:10; Invitrogen), and the ratio of BrdU-positive cells/negative cells was assessed by FACS. .. For migration, 25 × 103 cells were plated in the top chamber of a 24-well Boyden chamber (Fisher) in 0.1% FBS/DMEM.

    Apoptosis Assay:

    Article Title: Activation of mTORC1 in Collecting Ducts Causes Hyperkalemia
    Article Snippet: Paragraph title: BrdU Incorporation and Apoptosis Assay ... The proliferative activity of CCD was assessed on 5- μ m sections using immunofluorescence as described above, and anti-BrdU primary antibody (1:1000; Sigma-Aldrich).

    Produced:

    Article Title: Involvement of SIRT7 in resumption of rDNA transcription at the exit from mitosis
    Article Snippet: Human RPA43, PAF49, PAF53 and TIF-1A/Rrn3 antibodies were raised in sheep immunized with full-length recombinant proteins produced using baculovirus or Escherichia coli expression systems. .. The other antibodies were anti-SIRT7-N-terminal (S5947, Sigma-Aldrich), anti-UBF (F-9, Santa Cruz Biotechnology), anti-RPA116/135 (N-17, Santa Cruz Biotechnology), anti-SIRT1 (Abcam), anti-TBP (N-12, Santa Cruz Biotechnology), anti-TTF-1 , anti-BrdU (Sigma-Aldrich) and Texas Red-, FITC- or horseradish peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories).

    Concentration Assay:

    Article Title: Prostate Sphere-forming Stem Cells Are Derived from the P63-expressing Basal Compartment
    Article Snippet: BrdU (Sigma) was added to the culture medium at a final concentration of 2.5 μ m . .. Immunostaining with anti-BrdU antibody (1:500 dilution; Sigma) was used to detect BrdU-labeled cells.

    Construct:

    Article Title: Involvement of SIRT7 in resumption of rDNA transcription at the exit from mitosis
    Article Snippet: Paragraph title: Plasmid constructs and antibodies ... The other antibodies were anti-SIRT7-N-terminal (S5947, Sigma-Aldrich), anti-UBF (F-9, Santa Cruz Biotechnology), anti-RPA116/135 (N-17, Santa Cruz Biotechnology), anti-SIRT1 (Abcam), anti-TBP (N-12, Santa Cruz Biotechnology), anti-TTF-1 , anti-BrdU (Sigma-Aldrich) and Texas Red-, FITC- or horseradish peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories).

    Migration:

    Article Title:
    Article Snippet: Paragraph title: Proliferation and Migration Assays ... For BrdU incorporation experiments, 50 μ m BrdU (Sigma) was added to 200,000 cells 24 h after adding proteases/inhibitors and allowed to incorporate for 2 h. Permeabilized cells were stained with 1:10 anti-BrdU monoclonal Ab (G3G4, DSHB-Univ Iowa)/FITC-conjugated secondary (1:10; Invitrogen), and the ratio of BrdU-positive cells/negative cells was assessed by FACS.

    FACS:

    Article Title:
    Article Snippet: Residual crystal violet was resuspended in 100% methanol (Sigma) and absorbance read at 595 nm. .. For BrdU incorporation experiments, 50 μ m BrdU (Sigma) was added to 200,000 cells 24 h after adding proteases/inhibitors and allowed to incorporate for 2 h. Permeabilized cells were stained with 1:10 anti-BrdU monoclonal Ab (G3G4, DSHB-Univ Iowa)/FITC-conjugated secondary (1:10; Invitrogen), and the ratio of BrdU-positive cells/negative cells was assessed by FACS. .. For migration, 25 × 103 cells were plated in the top chamber of a 24-well Boyden chamber (Fisher) in 0.1% FBS/DMEM.

    Wright Stain:

    Article Title:
    Article Snippet: For BrdU incorporation experiments, 50 μ m BrdU (Sigma) was added to 200,000 cells 24 h after adding proteases/inhibitors and allowed to incorporate for 2 h. Permeabilized cells were stained with 1:10 anti-BrdU monoclonal Ab (G3G4, DSHB-Univ Iowa)/FITC-conjugated secondary (1:10; Invitrogen), and the ratio of BrdU-positive cells/negative cells was assessed by FACS. .. Inhibitors (5 μ m RWJ-56110 or 200 ng/ml pertussis toxin) were added directly to cells in the top chamber, chemoattractant was added to 0.1% FBS/DMEM in bottom chamber.

    Activity Assay:

    Article Title: Activation of mTORC1 in Collecting Ducts Causes Hyperkalemia
    Article Snippet: Two hours later, they were euthanized by cervical dislocation; the kidneys were removed and immediately fixed in 4% paraformaldehyde, then processed using paraffin wax and standard methods. .. The proliferative activity of CCD was assessed on 5- μ m sections using immunofluorescence as described above, and anti-BrdU primary antibody (1:1000; Sigma-Aldrich). .. Apoptosis of CCD cells was evaluated on 5- μ m sections by TUNEL assay using a commercial kit (Promega).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 83
    Millipore cell proliferation elisa brdu kit
    The role of miR-150/HIF-1α and miR-150/VEGFA in regulating HKCs proliferation (A, B) pcDNA3.1/HIF-1α and pcDNA3.1/VEGFA was transfected into HKCs to achieve ectopic expression of HIF-1α or VEGFA, respectively. The protein expression of HIF-1α and VEGFA was verified using Western blot assays. (C) HaCaT cells were co-transfected with pcDNA3.1/HIF-1α and NC mimics/miR-150 mimics, and the cell viability was monitored in each group using CCK-8 assays. (D) HKCs were co-transfected with pcDNA3.1/VEGFA and NC mimics/miR-150 mimics, and the cell viability was monitored in each group using CCK-8 assays. (E) HKCs were co-transfected with pcDNA3.1/HIF-1α and NC mimics/miR-150 mimics, and the cell proliferation was monitored in each group using <t>BrdU-ELISA</t> assays. (D) HKCs were co-transfected with pcDNA3.1/VEGFA and NC mimics/miR-150 mimics, and the cell proliferation was monitored in each group using BrdU-ELISA assays. The data are presented as mean ± SD of three independent experiments. * P
    Cell Proliferation Elisa Brdu Kit, supplied by Millipore, used in various techniques. Bioz Stars score: 83/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cell proliferation elisa brdu kit/product/Millipore
    Average 83 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    cell proliferation elisa brdu kit - by Bioz Stars, 2019-10
    83/100 stars
      Buy from Supplier

    99
    Millipore brdu cell proliferation assay kit
    Conditioned media from palmitate-stimulated macrophages promote <t>SMC</t> proliferation and migration. A. To evaluate SMC proliferation, RAW 264.7 cells were stimulated with BSA control, palmitate (250 µM) for 4 hours. Conditioned media were collected 20 hours later. SMCs were serum-starved for 24 hours and treated with each conditioned media or PDGF (25 ng/mL)/IL-1β (10 ng/mL). <t>BrdU</t> incorporation assay showed that palmitate-conditioned media modestly increased cell proliferation compared to the control. B. In the wound healing assay, SMCs were gently scraped with a pipette tips. SMCs were serum-starved and treated with each conditioned media or PDGF/IL-1β as described in BrdU assay. Wound sites along the scratches were examined and photographed at 100-fold maginification. C. The width of the wound gap was measured on the photograph and expressed as % of control. The wound gaps were shorter in cells treated with palmitate-conditioned media or PDGF/IL-1β. D. In Boyden chamber assay, SMCs were incubated with each conditioned media or PDGF/IL-1β in the chamber for 4-24 hours. After crystal violet staining, migrated cells in the filters were observed under a microscope (Olympus, Tokyo, Japan). E. In addition, after crystal violet staining, the surface of membrane was eluted by methanol and optical density was measured using a microplate reader. Treatment with palmitate-conditioned media or PDGF/IL-1β induced significant SMC migration. Data are means ± SE of three independent experiments. *p
    Brdu Cell Proliferation Assay Kit, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 117 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/brdu cell proliferation assay kit/product/Millipore
    Average 99 stars, based on 117 article reviews
    Price from $9.99 to $1999.99
    brdu cell proliferation assay kit - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    87
    Millipore brdu proliferation assay
    Exogenous <t>S100A8/A9</t> induces keratinocyte proliferation. a: Assessment of the proliferation by <t>BrdU</t> assay. To assess the role of S100A8/A9 in normal primary, AK and SCC cultures, they were treated with purified S100A8/A9 for 24 hours and proliferation was assessed by BrdU incorporation. The induction of cellular proliferation was between 30–70% (2 way Anova, p
    Brdu Proliferation Assay, supplied by Millipore, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/brdu proliferation assay/product/Millipore
    Average 87 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    brdu proliferation assay - by Bioz Stars, 2019-10
    87/100 stars
      Buy from Supplier

    Image Search Results


    The role of miR-150/HIF-1α and miR-150/VEGFA in regulating HKCs proliferation (A, B) pcDNA3.1/HIF-1α and pcDNA3.1/VEGFA was transfected into HKCs to achieve ectopic expression of HIF-1α or VEGFA, respectively. The protein expression of HIF-1α and VEGFA was verified using Western blot assays. (C) HaCaT cells were co-transfected with pcDNA3.1/HIF-1α and NC mimics/miR-150 mimics, and the cell viability was monitored in each group using CCK-8 assays. (D) HKCs were co-transfected with pcDNA3.1/VEGFA and NC mimics/miR-150 mimics, and the cell viability was monitored in each group using CCK-8 assays. (E) HKCs were co-transfected with pcDNA3.1/HIF-1α and NC mimics/miR-150 mimics, and the cell proliferation was monitored in each group using BrdU-ELISA assays. (D) HKCs were co-transfected with pcDNA3.1/VEGFA and NC mimics/miR-150 mimics, and the cell proliferation was monitored in each group using BrdU-ELISA assays. The data are presented as mean ± SD of three independent experiments. * P

    Journal: PLoS ONE

    Article Title: MiR-150 regulates human keratinocyte proliferation in hypoxic conditions through targeting HIF-1α and VEGFA: Implications for psoriasis treatment

    doi: 10.1371/journal.pone.0175459

    Figure Lengend Snippet: The role of miR-150/HIF-1α and miR-150/VEGFA in regulating HKCs proliferation (A, B) pcDNA3.1/HIF-1α and pcDNA3.1/VEGFA was transfected into HKCs to achieve ectopic expression of HIF-1α or VEGFA, respectively. The protein expression of HIF-1α and VEGFA was verified using Western blot assays. (C) HaCaT cells were co-transfected with pcDNA3.1/HIF-1α and NC mimics/miR-150 mimics, and the cell viability was monitored in each group using CCK-8 assays. (D) HKCs were co-transfected with pcDNA3.1/VEGFA and NC mimics/miR-150 mimics, and the cell viability was monitored in each group using CCK-8 assays. (E) HKCs were co-transfected with pcDNA3.1/HIF-1α and NC mimics/miR-150 mimics, and the cell proliferation was monitored in each group using BrdU-ELISA assays. (D) HKCs were co-transfected with pcDNA3.1/VEGFA and NC mimics/miR-150 mimics, and the cell proliferation was monitored in each group using BrdU-ELISA assays. The data are presented as mean ± SD of three independent experiments. * P

    Article Snippet: After 24 h, we removed the medium and transfected cells with the indicated miRNA mimics, miRNA inhibitor, pcDNA3.1/HIF-1α or pcDNA3.1/ VEGFA at 37°C for 24 h. Cell proliferation was detected by using Cell Proliferation ELISA-BrdU Kit (Millipore, USA) following the manufacturer’s protocols.

    Techniques: Transfection, Expressing, Western Blot, CCK-8 Assay, Enzyme-linked Immunosorbent Assay

    The detailed role of miR-150 in regulating HaCaT cell and HKCs proliferation. NC mimics/miR-150 mimics or NC inhibitor/miR-150 inhibitor was transfected into HaCaT cells (A) and HKCs (D) to achieve miR-150 overexpression or inhibition. The expression efficiency was verified using qPCR assays. The cell viability of HaCaT cells (B) and HKCs (E) transfected with NC mimics/miR-150 mimics or NC inhibitor/miR-150 inhibitor was monitored using CCK-8 assays. The cell proliferation of HaCaT cells (C) and HKCs (F) transfected with NC mimics/miR-150 mimics or NC inhibitor/miR-150 inhibitor was monitored using BrdU-ELISA assays.The data are presented as mean ± SD of three independent experiments. * P

    Journal: PLoS ONE

    Article Title: MiR-150 regulates human keratinocyte proliferation in hypoxic conditions through targeting HIF-1α and VEGFA: Implications for psoriasis treatment

    doi: 10.1371/journal.pone.0175459

    Figure Lengend Snippet: The detailed role of miR-150 in regulating HaCaT cell and HKCs proliferation. NC mimics/miR-150 mimics or NC inhibitor/miR-150 inhibitor was transfected into HaCaT cells (A) and HKCs (D) to achieve miR-150 overexpression or inhibition. The expression efficiency was verified using qPCR assays. The cell viability of HaCaT cells (B) and HKCs (E) transfected with NC mimics/miR-150 mimics or NC inhibitor/miR-150 inhibitor was monitored using CCK-8 assays. The cell proliferation of HaCaT cells (C) and HKCs (F) transfected with NC mimics/miR-150 mimics or NC inhibitor/miR-150 inhibitor was monitored using BrdU-ELISA assays.The data are presented as mean ± SD of three independent experiments. * P

    Article Snippet: After 24 h, we removed the medium and transfected cells with the indicated miRNA mimics, miRNA inhibitor, pcDNA3.1/HIF-1α or pcDNA3.1/ VEGFA at 37°C for 24 h. Cell proliferation was detected by using Cell Proliferation ELISA-BrdU Kit (Millipore, USA) following the manufacturer’s protocols.

    Techniques: Transfection, Over Expression, Inhibition, Expressing, Real-time Polymerase Chain Reaction, CCK-8 Assay, Enzyme-linked Immunosorbent Assay

    The role of miR-150/HIF-1α and miR-150/VEGFA in regulating HaCaT cell proliferation (A, B) pcDNA3.1/HIF-1α and pcDNA3.1/VEGFA was transfected into HaCaT cells to achieve ectopic expression of HIF-1α or VEGFA, respectively. The protein expression of HIF-1α and VEGFA was verified using Western blot assays. (C) HaCaT cells were co-transfected with pcDNA3.1/HIF-1α and NC mimics/miR-150 mimics, and the cell viability was monitored in each group using CCK-8 assays. (D) HaCaT cells were co-transfected with pcDNA3.1/VEGFA and NC mimics/miR-150 mimics, and the cell viability was monitored in each group using CCK-8 assays. (E) HaCaT cells were co-transfected with pcDNA3.1/HIF-1α and NC mimics/miR-150 mimics, and the cell proliferation was monitored in each group using BrdU-ELISA assays. (D) HaCaT cells were co-transfected with pcDNA3.1/VEGFA and NC mimics/miR-150 mimics, and the cell proliferation was monitored in each group using BrdU-ELISA assays. The data are presented as mean ± SD of three independent experiments. * P

    Journal: PLoS ONE

    Article Title: MiR-150 regulates human keratinocyte proliferation in hypoxic conditions through targeting HIF-1α and VEGFA: Implications for psoriasis treatment

    doi: 10.1371/journal.pone.0175459

    Figure Lengend Snippet: The role of miR-150/HIF-1α and miR-150/VEGFA in regulating HaCaT cell proliferation (A, B) pcDNA3.1/HIF-1α and pcDNA3.1/VEGFA was transfected into HaCaT cells to achieve ectopic expression of HIF-1α or VEGFA, respectively. The protein expression of HIF-1α and VEGFA was verified using Western blot assays. (C) HaCaT cells were co-transfected with pcDNA3.1/HIF-1α and NC mimics/miR-150 mimics, and the cell viability was monitored in each group using CCK-8 assays. (D) HaCaT cells were co-transfected with pcDNA3.1/VEGFA and NC mimics/miR-150 mimics, and the cell viability was monitored in each group using CCK-8 assays. (E) HaCaT cells were co-transfected with pcDNA3.1/HIF-1α and NC mimics/miR-150 mimics, and the cell proliferation was monitored in each group using BrdU-ELISA assays. (D) HaCaT cells were co-transfected with pcDNA3.1/VEGFA and NC mimics/miR-150 mimics, and the cell proliferation was monitored in each group using BrdU-ELISA assays. The data are presented as mean ± SD of three independent experiments. * P

    Article Snippet: After 24 h, we removed the medium and transfected cells with the indicated miRNA mimics, miRNA inhibitor, pcDNA3.1/HIF-1α or pcDNA3.1/ VEGFA at 37°C for 24 h. Cell proliferation was detected by using Cell Proliferation ELISA-BrdU Kit (Millipore, USA) following the manufacturer’s protocols.

    Techniques: Transfection, Expressing, Western Blot, CCK-8 Assay, Enzyme-linked Immunosorbent Assay

    Effects of miR-150 on human keratinocytes and expression of HIF-1α and VEGFA in hypoxic condition The cell viability of HaCaT cells (A) and HKCs (C) transfected with NC mimics/miR-150 mimics in 1% O2 condition or 20% O2 condition was monitored using CCK-8 assays. The cell proliferation of HaCaT cells (B) and HKCs (D) transfected with NC mimics/miR-150 mimics in 1% O2 condition or 20% O2 condition was monitored using BrdU-ELISA assays. (E) and (F) The protein expression of HIF-1α and VEGFA in HaCaT cells and HKCs transfected with NC mimics/miR-150 mimics in 1% O2 condition or 20% O2 condition was monitored using Western blot assays. (G) and (H) The protein expression of HIF-1α and VEGFA in HaCaT cells and HKCs transfected with NC mimics/miR-150 mimics or NC inhibitor/miR-150 inhibitor was monitored using Western blot assays. The data are presented as mean ± SD of three independent experiments. * P

    Journal: PLoS ONE

    Article Title: MiR-150 regulates human keratinocyte proliferation in hypoxic conditions through targeting HIF-1α and VEGFA: Implications for psoriasis treatment

    doi: 10.1371/journal.pone.0175459

    Figure Lengend Snippet: Effects of miR-150 on human keratinocytes and expression of HIF-1α and VEGFA in hypoxic condition The cell viability of HaCaT cells (A) and HKCs (C) transfected with NC mimics/miR-150 mimics in 1% O2 condition or 20% O2 condition was monitored using CCK-8 assays. The cell proliferation of HaCaT cells (B) and HKCs (D) transfected with NC mimics/miR-150 mimics in 1% O2 condition or 20% O2 condition was monitored using BrdU-ELISA assays. (E) and (F) The protein expression of HIF-1α and VEGFA in HaCaT cells and HKCs transfected with NC mimics/miR-150 mimics in 1% O2 condition or 20% O2 condition was monitored using Western blot assays. (G) and (H) The protein expression of HIF-1α and VEGFA in HaCaT cells and HKCs transfected with NC mimics/miR-150 mimics or NC inhibitor/miR-150 inhibitor was monitored using Western blot assays. The data are presented as mean ± SD of three independent experiments. * P

    Article Snippet: After 24 h, we removed the medium and transfected cells with the indicated miRNA mimics, miRNA inhibitor, pcDNA3.1/HIF-1α or pcDNA3.1/ VEGFA at 37°C for 24 h. Cell proliferation was detected by using Cell Proliferation ELISA-BrdU Kit (Millipore, USA) following the manufacturer’s protocols.

    Techniques: Expressing, Transfection, CCK-8 Assay, Enzyme-linked Immunosorbent Assay, Western Blot

    The effects of TGFBR2 knockdown on HG-induced cell proliferation, differentiation and collagen accumulation in HCFs HCFs were transfected with si-TGFBR2 or si-NC, and then treated with 5.5 or 25 mM glucose for 24 h. ( A ) The protein expression of TGFBR2 was determined by Western blot. α-Tubulin was detected as a loading control. ( B ) Cell proliferation was assessed by Brdu-ELISA assay. ( C ) The mRNA level of α-SMA was determined by qRT-PCR. ( D ) The mRNA levels of collagen I, III and VI were determined by qRT-PCR. All data are presented as mean ± S.E.M. ( n =4). ** P

    Journal: Bioscience Reports

    Article Title: MicroRNA-9 inhibits high glucose-induced proliferation, differentiation and collagen accumulation of cardiac fibroblasts by down-regulation of TGFBR2

    doi: 10.1042/BSR20160346

    Figure Lengend Snippet: The effects of TGFBR2 knockdown on HG-induced cell proliferation, differentiation and collagen accumulation in HCFs HCFs were transfected with si-TGFBR2 or si-NC, and then treated with 5.5 or 25 mM glucose for 24 h. ( A ) The protein expression of TGFBR2 was determined by Western blot. α-Tubulin was detected as a loading control. ( B ) Cell proliferation was assessed by Brdu-ELISA assay. ( C ) The mRNA level of α-SMA was determined by qRT-PCR. ( D ) The mRNA levels of collagen I, III and VI were determined by qRT-PCR. All data are presented as mean ± S.E.M. ( n =4). ** P

    Article Snippet: After 24 h, we removed the medium and transfected cells with miR-9 mimic or inhibitor at 37°C for 24 h. cell proliferation was detected by using Cell Proliferation ELISA-BrdU Kit (Millipore) following the manufacturer's protocols.

    Techniques: Transfection, Expressing, Western Blot, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR

    TGFBR2 was involved in the effects of miR-9 on HG-induced cell proliferation, differentiation and collagen accumulation in HCFs HCFs were transfected with either miR-9 mimic with pcDNA-TGFBR2 or pcDNA3.1, and then treated with 5.5 or 25 mM glucose for 24 h. ( A ) The protein expression of TGFBR2 was determined by Western blot. α-tubulin was detected as a loading control. ( B ) Cell proliferation was assessed by Brdu-ELISA assay. ( C ) The mRNA level of α-SMA was determined by qRT-PCR. ( D ) The mRNA levels of collagen I, III and VI were determined by qRT-PCR. All data are presented as mean ± S.E.M. ( n =4). ** P

    Journal: Bioscience Reports

    Article Title: MicroRNA-9 inhibits high glucose-induced proliferation, differentiation and collagen accumulation of cardiac fibroblasts by down-regulation of TGFBR2

    doi: 10.1042/BSR20160346

    Figure Lengend Snippet: TGFBR2 was involved in the effects of miR-9 on HG-induced cell proliferation, differentiation and collagen accumulation in HCFs HCFs were transfected with either miR-9 mimic with pcDNA-TGFBR2 or pcDNA3.1, and then treated with 5.5 or 25 mM glucose for 24 h. ( A ) The protein expression of TGFBR2 was determined by Western blot. α-tubulin was detected as a loading control. ( B ) Cell proliferation was assessed by Brdu-ELISA assay. ( C ) The mRNA level of α-SMA was determined by qRT-PCR. ( D ) The mRNA levels of collagen I, III and VI were determined by qRT-PCR. All data are presented as mean ± S.E.M. ( n =4). ** P

    Article Snippet: After 24 h, we removed the medium and transfected cells with miR-9 mimic or inhibitor at 37°C for 24 h. cell proliferation was detected by using Cell Proliferation ELISA-BrdU Kit (Millipore) following the manufacturer's protocols.

    Techniques: Transfection, Expressing, Western Blot, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR

    Effects of miR-9 on HG-induced cell viability and proliferation in HCFs HCFs were transfected with miR-9 inhibitor or mimic, and then treated with 5.5 or 25 mM glucose for 24 h. ( A and C ) Cell viability of HCFs was detected by CCK-8 assay. ( B and D ) Cell proliferation of HCFs was determined by Brdu-ELISA assay. ( E ) The level of miR-9 was determined by qRT-PCR. The data shown are mean ± S.E.M. ( n =4). * P

    Journal: Bioscience Reports

    Article Title: MicroRNA-9 inhibits high glucose-induced proliferation, differentiation and collagen accumulation of cardiac fibroblasts by down-regulation of TGFBR2

    doi: 10.1042/BSR20160346

    Figure Lengend Snippet: Effects of miR-9 on HG-induced cell viability and proliferation in HCFs HCFs were transfected with miR-9 inhibitor or mimic, and then treated with 5.5 or 25 mM glucose for 24 h. ( A and C ) Cell viability of HCFs was detected by CCK-8 assay. ( B and D ) Cell proliferation of HCFs was determined by Brdu-ELISA assay. ( E ) The level of miR-9 was determined by qRT-PCR. The data shown are mean ± S.E.M. ( n =4). * P

    Article Snippet: After 24 h, we removed the medium and transfected cells with miR-9 mimic or inhibitor at 37°C for 24 h. cell proliferation was detected by using Cell Proliferation ELISA-BrdU Kit (Millipore) following the manufacturer's protocols.

    Techniques: Transfection, CCK-8 Assay, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR

    Conditioned media from palmitate-stimulated macrophages promote SMC proliferation and migration. A. To evaluate SMC proliferation, RAW 264.7 cells were stimulated with BSA control, palmitate (250 µM) for 4 hours. Conditioned media were collected 20 hours later. SMCs were serum-starved for 24 hours and treated with each conditioned media or PDGF (25 ng/mL)/IL-1β (10 ng/mL). BrdU incorporation assay showed that palmitate-conditioned media modestly increased cell proliferation compared to the control. B. In the wound healing assay, SMCs were gently scraped with a pipette tips. SMCs were serum-starved and treated with each conditioned media or PDGF/IL-1β as described in BrdU assay. Wound sites along the scratches were examined and photographed at 100-fold maginification. C. The width of the wound gap was measured on the photograph and expressed as % of control. The wound gaps were shorter in cells treated with palmitate-conditioned media or PDGF/IL-1β. D. In Boyden chamber assay, SMCs were incubated with each conditioned media or PDGF/IL-1β in the chamber for 4-24 hours. After crystal violet staining, migrated cells in the filters were observed under a microscope (Olympus, Tokyo, Japan). E. In addition, after crystal violet staining, the surface of membrane was eluted by methanol and optical density was measured using a microplate reader. Treatment with palmitate-conditioned media or PDGF/IL-1β induced significant SMC migration. Data are means ± SE of three independent experiments. *p

    Journal: PLoS ONE

    Article Title: Palmitate Promotes the Paracrine Effects of Macrophages on Vascular Smooth Muscle Cells: The Role of Bone Morphogenetic Proteins

    doi: 10.1371/journal.pone.0029100

    Figure Lengend Snippet: Conditioned media from palmitate-stimulated macrophages promote SMC proliferation and migration. A. To evaluate SMC proliferation, RAW 264.7 cells were stimulated with BSA control, palmitate (250 µM) for 4 hours. Conditioned media were collected 20 hours later. SMCs were serum-starved for 24 hours and treated with each conditioned media or PDGF (25 ng/mL)/IL-1β (10 ng/mL). BrdU incorporation assay showed that palmitate-conditioned media modestly increased cell proliferation compared to the control. B. In the wound healing assay, SMCs were gently scraped with a pipette tips. SMCs were serum-starved and treated with each conditioned media or PDGF/IL-1β as described in BrdU assay. Wound sites along the scratches were examined and photographed at 100-fold maginification. C. The width of the wound gap was measured on the photograph and expressed as % of control. The wound gaps were shorter in cells treated with palmitate-conditioned media or PDGF/IL-1β. D. In Boyden chamber assay, SMCs were incubated with each conditioned media or PDGF/IL-1β in the chamber for 4-24 hours. After crystal violet staining, migrated cells in the filters were observed under a microscope (Olympus, Tokyo, Japan). E. In addition, after crystal violet staining, the surface of membrane was eluted by methanol and optical density was measured using a microplate reader. Treatment with palmitate-conditioned media or PDGF/IL-1β induced significant SMC migration. Data are means ± SE of three independent experiments. *p

    Article Snippet: SMC proliferation was examined using a BrdU cell proliferation assay kit (Millipore Chemicon, Billerica, MA, USA) according to the manufacturer's protocol.RAW264.7 cells were stimulated with BSA control or palmitate (250 µM)for 4 hours.

    Techniques: Migration, BrdU Incorporation Assay, Wound Healing Assay, Transferring, BrdU Staining, Boyden Chamber Assay, Incubation, Staining, Microscopy

    The effects of recombinant BMP2 and BMP4 on SMC proliferation, migration, and phenotypic change. A. Quiescent SMCs were treated with various concentration of BMP2 or BMP4 for 24 hours. Cell proliferation was analyzed by BrdU incorporation assay. Recombinant BMP2 and BMP4 did not have obvious effects on SMC proliferation. B. SMC migration assessment was conducted using Boyden chamber assay and BMP2 and BMP4 significantly promoted SMC migration. C. SMCs were treated with various concentration of recombinant BMP2 or BMP4 for 24 hours. Equal amount of protein was separated by SDS-PAGE and immunoblots showed both recombinant BMPs induced phenotypic change of SMCs with lowering expression of SM α-actin and SM22α.

    Journal: PLoS ONE

    Article Title: Palmitate Promotes the Paracrine Effects of Macrophages on Vascular Smooth Muscle Cells: The Role of Bone Morphogenetic Proteins

    doi: 10.1371/journal.pone.0029100

    Figure Lengend Snippet: The effects of recombinant BMP2 and BMP4 on SMC proliferation, migration, and phenotypic change. A. Quiescent SMCs were treated with various concentration of BMP2 or BMP4 for 24 hours. Cell proliferation was analyzed by BrdU incorporation assay. Recombinant BMP2 and BMP4 did not have obvious effects on SMC proliferation. B. SMC migration assessment was conducted using Boyden chamber assay and BMP2 and BMP4 significantly promoted SMC migration. C. SMCs were treated with various concentration of recombinant BMP2 or BMP4 for 24 hours. Equal amount of protein was separated by SDS-PAGE and immunoblots showed both recombinant BMPs induced phenotypic change of SMCs with lowering expression of SM α-actin and SM22α.

    Article Snippet: SMC proliferation was examined using a BrdU cell proliferation assay kit (Millipore Chemicon, Billerica, MA, USA) according to the manufacturer's protocol.RAW264.7 cells were stimulated with BSA control or palmitate (250 µM)for 4 hours.

    Techniques: Recombinant, Migration, Concentration Assay, BrdU Incorporation Assay, Boyden Chamber Assay, SDS Page, Western Blot, Expressing

    The effect of neutralization or knocking-down of BMPs on SMC proliferation, migration, and phenotypic change. A. THP-1 cells differentiated with PMA were stimulated with BSA control or palmitate for 4 hours and conditioned media were collected 20 hours later. Palmitate-conditioned media were treated without or with 2 µg/mL of anti-BMP2, anti-BMP4, or both for 1 hour. Each conditioned media was added to serum starved SMCs for 72 hours. Cell proliferation was analyzed by BrdU incorporation assay. Promotion of SMC proliferation by palmitate-conditioned media was abrogated by combined treatment of anti-BMP2/anti-BMP4. B. Each conditioned media described above was added to SMCs for 24 hours. Cell migration assay was conducted using Boyden chamber assay. Promotion of SMC migration by palmitate-conditioned media was inhibited by treatment of anti-BMP2 or anti-BMP4 or combination of both. C. Each conditioned media described above was added to SMCs for 24 hours. Immunoblots showed that anti-BMP4 or anti-BMP2/anti-BMP4 combination inhibited phenotypic change of SMCs. D. The band intensities were determined by quantitative densitometry. E. THP-1 cell-derived macrophages were transfected with BMP2 or BMP4 or both siRNA for 24 hours. Immunoblots demonstrated knockdown of BMP2 or BMP4 or both BMPs in the macrophages. F. SMCs were treated with palmitate-conditioned media from macrophages without or with knockdown of BMPs for 24 hours. Equal amount of protein were separated by SDS-PAGE, and immunoblots showed that knockdown of BMP4 or both BMPs abrogated phenotypic change of SMCs. Data are illustrated in arbitrary integrator unit relative to β-actin and represent the means ± SE from three independent experiments. *p

    Journal: PLoS ONE

    Article Title: Palmitate Promotes the Paracrine Effects of Macrophages on Vascular Smooth Muscle Cells: The Role of Bone Morphogenetic Proteins

    doi: 10.1371/journal.pone.0029100

    Figure Lengend Snippet: The effect of neutralization or knocking-down of BMPs on SMC proliferation, migration, and phenotypic change. A. THP-1 cells differentiated with PMA were stimulated with BSA control or palmitate for 4 hours and conditioned media were collected 20 hours later. Palmitate-conditioned media were treated without or with 2 µg/mL of anti-BMP2, anti-BMP4, or both for 1 hour. Each conditioned media was added to serum starved SMCs for 72 hours. Cell proliferation was analyzed by BrdU incorporation assay. Promotion of SMC proliferation by palmitate-conditioned media was abrogated by combined treatment of anti-BMP2/anti-BMP4. B. Each conditioned media described above was added to SMCs for 24 hours. Cell migration assay was conducted using Boyden chamber assay. Promotion of SMC migration by palmitate-conditioned media was inhibited by treatment of anti-BMP2 or anti-BMP4 or combination of both. C. Each conditioned media described above was added to SMCs for 24 hours. Immunoblots showed that anti-BMP4 or anti-BMP2/anti-BMP4 combination inhibited phenotypic change of SMCs. D. The band intensities were determined by quantitative densitometry. E. THP-1 cell-derived macrophages were transfected with BMP2 or BMP4 or both siRNA for 24 hours. Immunoblots demonstrated knockdown of BMP2 or BMP4 or both BMPs in the macrophages. F. SMCs were treated with palmitate-conditioned media from macrophages without or with knockdown of BMPs for 24 hours. Equal amount of protein were separated by SDS-PAGE, and immunoblots showed that knockdown of BMP4 or both BMPs abrogated phenotypic change of SMCs. Data are illustrated in arbitrary integrator unit relative to β-actin and represent the means ± SE from three independent experiments. *p

    Article Snippet: SMC proliferation was examined using a BrdU cell proliferation assay kit (Millipore Chemicon, Billerica, MA, USA) according to the manufacturer's protocol.RAW264.7 cells were stimulated with BSA control or palmitate (250 µM)for 4 hours.

    Techniques: Neutralization, Migration, BrdU Incorporation Assay, Cell Migration Assay, Boyden Chamber Assay, Western Blot, Derivative Assay, Transfection, SDS Page

    Exogenous S100A8/A9 induces keratinocyte proliferation. a: Assessment of the proliferation by BrdU assay. To assess the role of S100A8/A9 in normal primary, AK and SCC cultures, they were treated with purified S100A8/A9 for 24 hours and proliferation was assessed by BrdU incorporation. The induction of cellular proliferation was between 30–70% (2 way Anova, p

    Journal: PLoS ONE

    Article Title: S100A8/A9 Stimulates Keratinocyte Proliferation in the Development of Squamous Cell Carcinoma of the Skin via the Receptor for Advanced Glycation-End Products

    doi: 10.1371/journal.pone.0120971

    Figure Lengend Snippet: Exogenous S100A8/A9 induces keratinocyte proliferation. a: Assessment of the proliferation by BrdU assay. To assess the role of S100A8/A9 in normal primary, AK and SCC cultures, they were treated with purified S100A8/A9 for 24 hours and proliferation was assessed by BrdU incorporation. The induction of cellular proliferation was between 30–70% (2 way Anova, p

    Article Snippet: For determination of the effect of RAGE knockdown on cellular proliferation with a following S100A8/A9 stimulation, BrdU proliferation assay was performed.

    Techniques: BrdU Staining, Purification, BrdU Incorporation Assay

    The receptor RAGE critically mediates the cellular response to S100A8/A9. a: Direct blockade by a specific RAGE blocking antibody reduces cellular proliferation. RAGE dependent proliferation was analyzed in normal primary, AK and SCC cells. Cells were incubated for 1 hour with a blocking anti-RAGE antibody (80μg/ml, as recommended by manufacturer) followed by S100A8/A9 stimulation for additional 24 hours. The differences in the proliferation after the blockade were assessed by BrdU incorporation (1 way Anova, Bonferroni`s Multiple test, **p

    Journal: PLoS ONE

    Article Title: S100A8/A9 Stimulates Keratinocyte Proliferation in the Development of Squamous Cell Carcinoma of the Skin via the Receptor for Advanced Glycation-End Products

    doi: 10.1371/journal.pone.0120971

    Figure Lengend Snippet: The receptor RAGE critically mediates the cellular response to S100A8/A9. a: Direct blockade by a specific RAGE blocking antibody reduces cellular proliferation. RAGE dependent proliferation was analyzed in normal primary, AK and SCC cells. Cells were incubated for 1 hour with a blocking anti-RAGE antibody (80μg/ml, as recommended by manufacturer) followed by S100A8/A9 stimulation for additional 24 hours. The differences in the proliferation after the blockade were assessed by BrdU incorporation (1 way Anova, Bonferroni`s Multiple test, **p

    Article Snippet: For determination of the effect of RAGE knockdown on cellular proliferation with a following S100A8/A9 stimulation, BrdU proliferation assay was performed.

    Techniques: Blocking Assay, Incubation, BrdU Incorporation Assay

    Endogenous S100A8/A9 is involved in cellular proliferation. a: Spontaneous secretion of S100A8/A9 from normal and SCC-derived keratinocytes. Normal and SCC-derived keratinocytes were grown in 96 well plates for 24 hours. Afterwards, supernatant was collected and preceded for the assessment of secreted S100A8/A9 using specific ELISA for S100A8/A9. b: Blockade of RAGE using anti RAGE blocking antibody reduces spontaneous proliferation of keratinocytes. Normal and SCC-derived keratinocytes were incubated with a blocking anti-RAGE antibody (8ug/100μl) for 24 hours. A decrease of the proliferation rate was detected (20–30%) based on the BrdU incorporation (t-test *p = 0.002). All the results are presented as percentage deviation from corresponding control and represent the mean +/- SD of duplicate values.

    Journal: PLoS ONE

    Article Title: S100A8/A9 Stimulates Keratinocyte Proliferation in the Development of Squamous Cell Carcinoma of the Skin via the Receptor for Advanced Glycation-End Products

    doi: 10.1371/journal.pone.0120971

    Figure Lengend Snippet: Endogenous S100A8/A9 is involved in cellular proliferation. a: Spontaneous secretion of S100A8/A9 from normal and SCC-derived keratinocytes. Normal and SCC-derived keratinocytes were grown in 96 well plates for 24 hours. Afterwards, supernatant was collected and preceded for the assessment of secreted S100A8/A9 using specific ELISA for S100A8/A9. b: Blockade of RAGE using anti RAGE blocking antibody reduces spontaneous proliferation of keratinocytes. Normal and SCC-derived keratinocytes were incubated with a blocking anti-RAGE antibody (8ug/100μl) for 24 hours. A decrease of the proliferation rate was detected (20–30%) based on the BrdU incorporation (t-test *p = 0.002). All the results are presented as percentage deviation from corresponding control and represent the mean +/- SD of duplicate values.

    Article Snippet: For determination of the effect of RAGE knockdown on cellular proliferation with a following S100A8/A9 stimulation, BrdU proliferation assay was performed.

    Techniques: Derivative Assay, Enzyme-linked Immunosorbent Assay, Blocking Assay, Incubation, BrdU Incorporation Assay, T-Test