bp clonase ii enzyme mix  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Gateway BP Clonase II Enzyme mix
    Description:
    Gateway BP Clonase II enzyme mix catalyzes the in vitro recombination of PCR products or subcloning DNA segments from clones containing attB sites and a donor vector containing attP sites to generate entry clones Gateway BP Clonase II contains enzymes and buffer in a single mix to enable convenient ten microliter reaction set up with fewer pipetting steps
    Catalog Number:
    11789020
    Price:
    None
    Applications:
    BP Clonase®|Cloning|Gateway Recombination|Gateway Cloning
    Category:
    Proteins Enzymes Peptides
    Buy from Supplier


    Structured Review

    Thermo Fisher bp clonase ii enzyme mix
    Drosophila destination vector and two-fragment schematic for Gateway MultiSite cloning. A) The Drosophila destination vector pDESThaw. This destination vector contains an hsp70 polyadenylation sequence, a PhiC31 attB site for PhiC31 integrase-mediate site-specific transgenesis, and mini- white as a transformation marker. Appropriate combinations of two, three, or four entry clones recombine in a position and orientation-specific manner with ampicillin-resistant pDESThaw in the LR reaction to generate expression clones. The LR reactions for two, three, and four fragment Gateway MultiSite recombination all use the LR <t>Clonase</t> II Plus enzyme mix. Both the BP and LR reactions take advantage of the Gateway cassette that includes a chloramphenicol resistance marker and the ccdB gene. The Gateway cassette is located between the attP sites in the pDONR vectors ( Figure S1 ) and between the attR1 and attR2 sites of the pDESThaw destination vector. The ccdB gene is toxic to any bacterial strain that does not contain a genetic suppressor including most common laboratory bacterial strains used for cloning such as DH10B and DH5α . ccdB containing clones were propagated using the now discontinued bacterial strain DB3.1 that has been replaced by Invitrogen with strain ccdB Survival 2 T1R. When BP and LR reactions are transformed into non-ccdB suppressor strains, only bacteria containing clones in which the Gateway cassette has been recombined out (and presumably the fragment(s) of interest recombined in) survive on kanamycin or ampicillin-selective plates. This results in a low frequency of colonies that do not contain the insert(s) of interest. B) Schematic diagram of two-fragment Gateway MultiSite recombination cloning. Fragment 1 and fragment 2 are amplified by PCR using oligonucleotides that incorporate flanking attB1 and attB5r sites in fragment 1 and flanking attB5 and attB2 sites in fragment 2. Fragment 1 is combined with pDONR 221 P1-P5r and fragment 2 is combined with pDONR 221 P5-P2 in separate BP reactions. The products of the BP reactions are pENTR attL1-Frag1-attR5 and pENTR attL5-Frag2-attL2. In the LR reaction both of these entry clones are combined with a destination vector to produce an expression clone containing fragment 1 and fragment 2 in a position and orientation-specific manner. Note that pENTR L1-R5 entry clones are also used in four-fragment Gateway MultiSite cloning. Schematic modified from the Invitrogen MultiSite Gateway Pro user manual.
    Gateway BP Clonase II enzyme mix catalyzes the in vitro recombination of PCR products or subcloning DNA segments from clones containing attB sites and a donor vector containing attP sites to generate entry clones Gateway BP Clonase II contains enzymes and buffer in a single mix to enable convenient ten microliter reaction set up with fewer pipetting steps
    https://www.bioz.com/result/bp clonase ii enzyme mix/product/Thermo Fisher
    Average 99 stars, based on 89 article reviews
    Price from $9.99 to $1999.99
    bp clonase ii enzyme mix - by Bioz Stars, 2020-09
    99/100 stars

    Images

    1) Product Images from "A Gateway MultiSite Recombination Cloning Toolkit"

    Article Title: A Gateway MultiSite Recombination Cloning Toolkit

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0024531

    Drosophila destination vector and two-fragment schematic for Gateway MultiSite cloning. A) The Drosophila destination vector pDESThaw. This destination vector contains an hsp70 polyadenylation sequence, a PhiC31 attB site for PhiC31 integrase-mediate site-specific transgenesis, and mini- white as a transformation marker. Appropriate combinations of two, three, or four entry clones recombine in a position and orientation-specific manner with ampicillin-resistant pDESThaw in the LR reaction to generate expression clones. The LR reactions for two, three, and four fragment Gateway MultiSite recombination all use the LR Clonase II Plus enzyme mix. Both the BP and LR reactions take advantage of the Gateway cassette that includes a chloramphenicol resistance marker and the ccdB gene. The Gateway cassette is located between the attP sites in the pDONR vectors ( Figure S1 ) and between the attR1 and attR2 sites of the pDESThaw destination vector. The ccdB gene is toxic to any bacterial strain that does not contain a genetic suppressor including most common laboratory bacterial strains used for cloning such as DH10B and DH5α . ccdB containing clones were propagated using the now discontinued bacterial strain DB3.1 that has been replaced by Invitrogen with strain ccdB Survival 2 T1R. When BP and LR reactions are transformed into non-ccdB suppressor strains, only bacteria containing clones in which the Gateway cassette has been recombined out (and presumably the fragment(s) of interest recombined in) survive on kanamycin or ampicillin-selective plates. This results in a low frequency of colonies that do not contain the insert(s) of interest. B) Schematic diagram of two-fragment Gateway MultiSite recombination cloning. Fragment 1 and fragment 2 are amplified by PCR using oligonucleotides that incorporate flanking attB1 and attB5r sites in fragment 1 and flanking attB5 and attB2 sites in fragment 2. Fragment 1 is combined with pDONR 221 P1-P5r and fragment 2 is combined with pDONR 221 P5-P2 in separate BP reactions. The products of the BP reactions are pENTR attL1-Frag1-attR5 and pENTR attL5-Frag2-attL2. In the LR reaction both of these entry clones are combined with a destination vector to produce an expression clone containing fragment 1 and fragment 2 in a position and orientation-specific manner. Note that pENTR L1-R5 entry clones are also used in four-fragment Gateway MultiSite cloning. Schematic modified from the Invitrogen MultiSite Gateway Pro user manual.
    Figure Legend Snippet: Drosophila destination vector and two-fragment schematic for Gateway MultiSite cloning. A) The Drosophila destination vector pDESThaw. This destination vector contains an hsp70 polyadenylation sequence, a PhiC31 attB site for PhiC31 integrase-mediate site-specific transgenesis, and mini- white as a transformation marker. Appropriate combinations of two, three, or four entry clones recombine in a position and orientation-specific manner with ampicillin-resistant pDESThaw in the LR reaction to generate expression clones. The LR reactions for two, three, and four fragment Gateway MultiSite recombination all use the LR Clonase II Plus enzyme mix. Both the BP and LR reactions take advantage of the Gateway cassette that includes a chloramphenicol resistance marker and the ccdB gene. The Gateway cassette is located between the attP sites in the pDONR vectors ( Figure S1 ) and between the attR1 and attR2 sites of the pDESThaw destination vector. The ccdB gene is toxic to any bacterial strain that does not contain a genetic suppressor including most common laboratory bacterial strains used for cloning such as DH10B and DH5α . ccdB containing clones were propagated using the now discontinued bacterial strain DB3.1 that has been replaced by Invitrogen with strain ccdB Survival 2 T1R. When BP and LR reactions are transformed into non-ccdB suppressor strains, only bacteria containing clones in which the Gateway cassette has been recombined out (and presumably the fragment(s) of interest recombined in) survive on kanamycin or ampicillin-selective plates. This results in a low frequency of colonies that do not contain the insert(s) of interest. B) Schematic diagram of two-fragment Gateway MultiSite recombination cloning. Fragment 1 and fragment 2 are amplified by PCR using oligonucleotides that incorporate flanking attB1 and attB5r sites in fragment 1 and flanking attB5 and attB2 sites in fragment 2. Fragment 1 is combined with pDONR 221 P1-P5r and fragment 2 is combined with pDONR 221 P5-P2 in separate BP reactions. The products of the BP reactions are pENTR attL1-Frag1-attR5 and pENTR attL5-Frag2-attL2. In the LR reaction both of these entry clones are combined with a destination vector to produce an expression clone containing fragment 1 and fragment 2 in a position and orientation-specific manner. Note that pENTR L1-R5 entry clones are also used in four-fragment Gateway MultiSite cloning. Schematic modified from the Invitrogen MultiSite Gateway Pro user manual.

    Techniques Used: Plasmid Preparation, Clone Assay, Sequencing, Transformation Assay, Marker, Expressing, Amplification, Polymerase Chain Reaction, Modification

    Related Articles

    Clone Assay:

    Article Title: Live imaging defines the dynamics and molecular basis of in vivo mitophagy
    Article Snippet: .. Middle entry vector pME:mito-GR was generated using BP Gateway cloning using pCLBW cox8 EGFP mCherry ( ) and pDONR221 (Invitrogen) using Gateway BP Clonase II Enzyme (Invitrogen) mix following manufacturer’s instructions. .. LR Gateway cloning was used to generate Tg(ubi:mito-GR) and Tg(-2.8fabp10a:mito-GR).

    Article Title: saeRS and sarA Act Synergistically to Repress Protease Production and Promote Biofilm Formation in Staphylococcus aureus
    Article Snippet: .. To construct pFNBA, fnbA and its promoter region were amplified from UAMS-1 using primers that incorporated the corresponding att sites and cloned into pLL99 using the Gateway BP Clonase II enzyme (Invitrogen, Grand Island, NY). .. The ssp:: lux reporter was generated by amplifying the promoter region of the sspABC operon from UAMS-1 and cloning into the EcoR1 site of pMK4 lux ABCDE .

    Article Title: Protein Sialylation Regulates a Gene Expression Signature that Promotes Breast Cancer Cell Pathogenicity
    Article Snippet: .. These oligos were cloned into pENTR/TER+ (Addgene #17338) using Gateway BP Clonase II (Invitrogen) and then into pLenti-X1-puro (Addgene #17297) using Gateway LR Clonase II (Invitrogen). .. Inducible expression of a hairpin targeting eGFP was used as a control. shControl: GATCCCGCAAGCTGACCCTGAAGTTCATGT gtgctgtccATGAACTTCAGGGTCAGCTTGCTTTTTGGAAA.

    Article Title: p16 Protein and Gigaxonin Are Associated with the Ubiquitination of NFκB in Cisplatin-induced Senescence of Cancer Cells *
    Article Snippet: .. Well characterized 390 amino acid-NFκB cDNA (Clontech) was amplified and cloned into pDONR221 using the Gateway BP Clonase II (Invitrogen) and subsequently into pGLAP1 N-term EGFP-TEV-S tag vector using the Gateway LR Clonase II (Invitrogen) as previously described ( ). .. Stable cell lines were generated by transfecting HeLa Flp-In T-REx cells with pGLAP1-NFκB vector, using FuGENE 6 transfection reagent (Promega Scientific).

    Article Title: MSL3 coordinates a transcriptional and translational meiotic program in female Drosophila
    Article Snippet: .. PCR products were cloned into pDONR (Thermo Fisher, 11789-020) and swapped into pENTR (Thermo Fisher, 11791-020) using BP and LR reactions, respectively. .. The plasmid was sent for injection into w1118 flies (Genetic Services).

    Amplification:

    Article Title: saeRS and sarA Act Synergistically to Repress Protease Production and Promote Biofilm Formation in Staphylococcus aureus
    Article Snippet: .. To construct pFNBA, fnbA and its promoter region were amplified from UAMS-1 using primers that incorporated the corresponding att sites and cloned into pLL99 using the Gateway BP Clonase II enzyme (Invitrogen, Grand Island, NY). .. The ssp:: lux reporter was generated by amplifying the promoter region of the sspABC operon from UAMS-1 and cloning into the EcoR1 site of pMK4 lux ABCDE .

    Article Title: p16 Protein and Gigaxonin Are Associated with the Ubiquitination of NFκB in Cisplatin-induced Senescence of Cancer Cells *
    Article Snippet: .. Well characterized 390 amino acid-NFκB cDNA (Clontech) was amplified and cloned into pDONR221 using the Gateway BP Clonase II (Invitrogen) and subsequently into pGLAP1 N-term EGFP-TEV-S tag vector using the Gateway LR Clonase II (Invitrogen) as previously described ( ). .. Stable cell lines were generated by transfecting HeLa Flp-In T-REx cells with pGLAP1-NFκB vector, using FuGENE 6 transfection reagent (Promega Scientific).

    Construct:

    Article Title: saeRS and sarA Act Synergistically to Repress Protease Production and Promote Biofilm Formation in Staphylococcus aureus
    Article Snippet: .. To construct pFNBA, fnbA and its promoter region were amplified from UAMS-1 using primers that incorporated the corresponding att sites and cloned into pLL99 using the Gateway BP Clonase II enzyme (Invitrogen, Grand Island, NY). .. The ssp:: lux reporter was generated by amplifying the promoter region of the sspABC operon from UAMS-1 and cloning into the EcoR1 site of pMK4 lux ABCDE .

    Article Title: One step construction of Agrobacterium-Recombination-ready-plasmids (OSCAR), an efficient and robust tool for ATMT based gene deletion construction in fungi.
    Article Snippet: .. Increasing availability of genomic data and sophistication of analytical methodology in fungi has elevated the need for functional genomics tools in these organisms. .. Increasing availability of genomic data and sophistication of analytical methodology in fungi has elevated the need for functional genomics tools in these organisms.

    Polymerase Chain Reaction:

    Article Title: One step construction of Agrobacterium-Recombination-ready-plasmids (OSCAR), an efficient and robust tool for ATMT based gene deletion construction in fungi.
    Article Snippet: .. Increasing availability of genomic data and sophistication of analytical methodology in fungi has elevated the need for functional genomics tools in these organisms. .. Increasing availability of genomic data and sophistication of analytical methodology in fungi has elevated the need for functional genomics tools in these organisms.

    Article Title: MSL3 coordinates a transcriptional and translational meiotic program in female Drosophila
    Article Snippet: .. PCR products were cloned into pDONR (Thermo Fisher, 11789-020) and swapped into pENTR (Thermo Fisher, 11791-020) using BP and LR reactions, respectively. .. The plasmid was sent for injection into w1118 flies (Genetic Services).

    Article Title: NEDD4 family ubiquitin ligases associate with LCMV Z’s PPXY domain and are required for virus budding, but not via direct ubiquitination of Z
    Article Snippet: .. The AttB1/AttB2-flanked PCR products were shuttled into a Gateway donor vector using the Gateway BP Clonase II enzyme (11789100, Thermo Fisher Scientific) then into a modified pCAGGS destination vector that has been previously described [ , ] using the LR Clonase II enzyme (11791100, Thermo Fisher Scientific). .. The double point mutant KK10/77RR was generated essentially as described above using the K10 only and K77 only plasmids as templates.

    Generated:

    Article Title: Live imaging defines the dynamics and molecular basis of in vivo mitophagy
    Article Snippet: .. Middle entry vector pME:mito-GR was generated using BP Gateway cloning using pCLBW cox8 EGFP mCherry ( ) and pDONR221 (Invitrogen) using Gateway BP Clonase II Enzyme (Invitrogen) mix following manufacturer’s instructions. .. LR Gateway cloning was used to generate Tg(ubi:mito-GR) and Tg(-2.8fabp10a:mito-GR).

    Modification:

    Article Title: NEDD4 family ubiquitin ligases associate with LCMV Z’s PPXY domain and are required for virus budding, but not via direct ubiquitination of Z
    Article Snippet: .. The AttB1/AttB2-flanked PCR products were shuttled into a Gateway donor vector using the Gateway BP Clonase II enzyme (11789100, Thermo Fisher Scientific) then into a modified pCAGGS destination vector that has been previously described [ , ] using the LR Clonase II enzyme (11791100, Thermo Fisher Scientific). .. The double point mutant KK10/77RR was generated essentially as described above using the K10 only and K77 only plasmids as templates.

    Plasmid Preparation:

    Article Title: Live imaging defines the dynamics and molecular basis of in vivo mitophagy
    Article Snippet: .. Middle entry vector pME:mito-GR was generated using BP Gateway cloning using pCLBW cox8 EGFP mCherry ( ) and pDONR221 (Invitrogen) using Gateway BP Clonase II Enzyme (Invitrogen) mix following manufacturer’s instructions. .. LR Gateway cloning was used to generate Tg(ubi:mito-GR) and Tg(-2.8fabp10a:mito-GR).

    Article Title: p16 Protein and Gigaxonin Are Associated with the Ubiquitination of NFκB in Cisplatin-induced Senescence of Cancer Cells *
    Article Snippet: .. Well characterized 390 amino acid-NFκB cDNA (Clontech) was amplified and cloned into pDONR221 using the Gateway BP Clonase II (Invitrogen) and subsequently into pGLAP1 N-term EGFP-TEV-S tag vector using the Gateway LR Clonase II (Invitrogen) as previously described ( ). .. Stable cell lines were generated by transfecting HeLa Flp-In T-REx cells with pGLAP1-NFκB vector, using FuGENE 6 transfection reagent (Promega Scientific).

    Article Title: NEDD4 family ubiquitin ligases associate with LCMV Z’s PPXY domain and are required for virus budding, but not via direct ubiquitination of Z
    Article Snippet: .. The AttB1/AttB2-flanked PCR products were shuttled into a Gateway donor vector using the Gateway BP Clonase II enzyme (11789100, Thermo Fisher Scientific) then into a modified pCAGGS destination vector that has been previously described [ , ] using the LR Clonase II enzyme (11791100, Thermo Fisher Scientific). .. The double point mutant KK10/77RR was generated essentially as described above using the K10 only and K77 only plasmids as templates.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher gateway bp clonase ii enzyme mix
    Gateway Bp Clonase Ii Enzyme Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 438 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gateway bp clonase ii enzyme mix/product/Thermo Fisher
    Average 99 stars, based on 438 article reviews
    Price from $9.99 to $1999.99
    gateway bp clonase ii enzyme mix - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results