bl21 star de3 cells  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher bl21 star de3 cells
    Bl21 Star De3 Cells, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 star de3 cells/product/Thermo Fisher
    Average 99 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    bl21 star de3 cells - by Bioz Stars, 2020-02
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Characterization of N-acetylneuraminic acid synthase isoenzyme 1 from Campylobacter jejuni
    Article Snippet: Expression plasmid pTrc99A/cjneuB1 (containing neuB 1 gene from C. jejuni , cloned at the Nco I site in the polylinker region of the expression plasmid pTrc99A) was obtained from Dr Dennis Linton (Department of Neurology, United Medical and Dental School, Guy's Hospital, London, U.K.). .. Chemically competent E. coli TOP10 and BL21 Star (DE3) cells were purchased from Invitrogen.

    Article Title: Slow spontaneous ?-to-? structural conversion in a non-denaturing neutral condition reveals the intrinsically disordered property of the disulfide-reduced recombinant mouse prion protein
    Article Snippet: Protein expression and purification The mouse PrP gene cloned in the pET101/D-TOPO vector was kindly provided by Dr. Ilia V. Baskakov (Center for Biomedical Engineering and Technology, University of Maryland Biotechnology Institute, USA). .. The proteins were expressed in BL21 Star™ (DE3) cells (Invitrogen) and were purified using a protocol modified from a published method.

    Article Title: The fixABCX Genes in Rhodospirillum rubrum Encode a Putative Membrane Complex Participating in Electron Transfer to Nitrogenase
    Article Snippet: To investigate the cellular localization of FixC, fixC lacking the stop codon was PCR amplified by using Pfu-Taq DNA polymerase (Stratagene) with pRKDfix as the template and was cloned in pET101/D-TOPO (Invitrogen), which resulted in fixC fused to a C-terminal V5 epitope and a six-histidine tag. .. The final construct, designated pETfixC, was transformed into BL21 Star (DE3) cells (Invitrogen), and 500-ml cultures were grown at 30°C.

    Article Title: The diversity of the proline-rich domain of pneumococcal surface protein A (PspA): potential relevance to a broad-spectrum vaccine.
    Article Snippet: The amplified fragment was then digested with BamHI and HindIII and then cloned into the pET32b expression vector (Invitrogen) between the BamHI and HindIII restriction sites. .. Briefly, all of the vectors were transformed individually into BL21 Star (DE3) cells (Invitrogen, CA) and grown in liquid culture until they reached an OD600 of 0.6, induced with 1mM isopropyl-D-thiogalactopyranoside (IPTG; Sigma) for 3 hours, and subsequently purified on a cobalt resin column (Clontech, CA) following the manufacturer’s protocol for His tag purification [ ].

    Centrifugation:

    Article Title: Slow spontaneous ?-to-? structural conversion in a non-denaturing neutral condition reveals the intrinsically disordered property of the disulfide-reduced recombinant mouse prion protein
    Article Snippet: The proteins were expressed in BL21 Star™ (DE3) cells (Invitrogen) and were purified using a protocol modified from a published method. .. An overnight culture was used to inoculate fresh TB medium containing ampicillin (100 μg/mL) at a ratio of 2:100 and the cells were grown at 37°C with vigorous shaking (250 rpm) for 3 h (A600 nm = ~0.6) Protein expression was then induced by adding IPTG to a final concentration of 1 mM and the culture grown for an additional 5 h, then the cells were harvested by centrifugation at 1,900 g at 4°C for 10 min.

    Article Title: The fixABCX Genes in Rhodospirillum rubrum Encode a Putative Membrane Complex Participating in Electron Transfer to Nitrogenase
    Article Snippet: The final construct, designated pETfixC, was transformed into BL21 Star (DE3) cells (Invitrogen), and 500-ml cultures were grown at 30°C. .. When cultures were induced, they were incubated with 0.5 mM isopropyl-β- d -thiogalactopyranoside (IPTG) for 2 h. Cells were harvested by centrifugation for 15 min at 3,000 × g and washed in 25 ml of 50 mM Tris-HCl (pH 7.5), resuspended in 25 ml of 50 mM Tris-HCl (pH 7.5) containing 20 μg of DNase per ml, and broken by passage through a Ribi cell fractionator (Sorvall).

    Article Title: A transient reporter for editing enrichment (TREE) in human cells
    Article Snippet: RNP complex formation For purification of recombinant BE3 (rBE3) protein, BL21 Star DE3 cells (ThermoFisher) were transformed with pET42b-BE3 (Addgene #87437). .. Cells were then harvested by centrifugation followed by lysis by sonication in lysis buffer [50 mM NaH2 PO4 (pH 8.0), 300 mM NaCl, 10 mM imidazole, 1% Triton X-100, 1 mM Dithiothreitol (DTT) and 1 mg/ml lysozyme].

    Article Title: An engineered RNA binding protein with improved splicing regulation
    Article Snippet: Using BL21 Star (DE3) cells (Invitrogen), protein expression was induced using 0.5 mM IPTG at an OD600 = 0.6–0.7 for 2 h at 37°C. .. The lysate was then diluted with 1 volume of 1× PBS and incubated for 30 minutes on ice prior to centrifugation at 17,000 rpm.

    Amplification:

    Article Title: Characterization of N-acetylneuraminic acid synthase isoenzyme 1 from Campylobacter jejuni
    Article Snippet: The C. jejuni neuB1 gene was amplified by PCR with the forward primer GACGACGACAAGATGCAAATAAAAATAGATAAATTAA (CjLicFor) and the reverse primer GAGGAGAAGCCCGGTTCATTCAAAATCATCCCATGTTAGT (CjsasLicRev). .. Chemically competent E. coli TOP10 and BL21 Star (DE3) cells were purchased from Invitrogen.

    Article Title: The fixABCX Genes in Rhodospirillum rubrum Encode a Putative Membrane Complex Participating in Electron Transfer to Nitrogenase
    Article Snippet: To investigate the cellular localization of FixC, fixC lacking the stop codon was PCR amplified by using Pfu-Taq DNA polymerase (Stratagene) with pRKDfix as the template and was cloned in pET101/D-TOPO (Invitrogen), which resulted in fixC fused to a C-terminal V5 epitope and a six-histidine tag. .. The final construct, designated pETfixC, was transformed into BL21 Star (DE3) cells (Invitrogen), and 500-ml cultures were grown at 30°C.

    Article Title: The diversity of the proline-rich domain of pneumococcal surface protein A (PspA): potential relevance to a broad-spectrum vaccine.
    Article Snippet: The amplified fragment was then digested with BamHI and HindIII and then cloned into the pET32b expression vector (Invitrogen) between the BamHI and HindIII restriction sites. .. Briefly, all of the vectors were transformed individually into BL21 Star (DE3) cells (Invitrogen, CA) and grown in liquid culture until they reached an OD600 of 0.6, induced with 1mM isopropyl-D-thiogalactopyranoside (IPTG; Sigma) for 3 hours, and subsequently purified on a cobalt resin column (Clontech, CA) following the manufacturer’s protocol for His tag purification [ ].

    Proton NMR:

    Article Title: Characterization of N-acetylneuraminic acid synthase isoenzyme 1 from Campylobacter jejuni
    Article Snippet: Chemically competent E. coli TOP10 and BL21 Star (DE3) cells were purchased from Invitrogen. .. 1 H-NMR spectra were recorded on a Bruker Avance DRX 300 (operating at 300.13 MHz for 1 H) using 2 H2 O for lock.

    Synthesized:

    Article Title: Heparan Sulfate Domains Required for Fibroblast Growth Factor 1 and 2 Signaling through Fibroblast Growth Factor Receptor 1c *
    Article Snippet: Polysaccharides containing either (i) alternating NA blocks of GlcA-GlcNAc or NS precursor blocks of GlcA-GlcNTFA repeating disaccharide units or (ii) an NA block with various specific sugar extensions at the non-reducing termini were synthesized. .. Here, the recombinant pmHS2 was constructed as an N-terminal fusion to His6 using a PET-15b vector (Novagen) expressed in BL21 star (DE3) cells (Invitrogen).

    Article Title: Splicing modulators act at the branch point adenosine binding pocket defined by the PHF5A–SF3b complex
    Article Snippet: Expression and crystallization of PHF5A Full-length human PHF5A, containing a C40S mutation for enhanced protein stability, was synthesized and subcloned between the Nde I and Eco RI sites of pET-28a with an N-terminal His-MBP-TEV cleavable tag. .. Protein was expressed in BL21 Star (DE3) cells (Thermofisher) grown in LB media.

    Blocking Assay:

    Article Title: Heparan Sulfate Domains Required for Fibroblast Growth Factor 1 and 2 Signaling through Fibroblast Growth Factor Receptor 1c *
    Article Snippet: Polysaccharides containing either (i) alternating NA blocks of GlcA-GlcNAc or NS precursor blocks of GlcA-GlcNTFA repeating disaccharide units or (ii) an NA block with various specific sugar extensions at the non-reducing termini were synthesized. .. Here, the recombinant pmHS2 was constructed as an N-terminal fusion to His6 using a PET-15b vector (Novagen) expressed in BL21 star (DE3) cells (Invitrogen).

    Incubation:

    Article Title: The fixABCX Genes in Rhodospirillum rubrum Encode a Putative Membrane Complex Participating in Electron Transfer to Nitrogenase
    Article Snippet: The final construct, designated pETfixC, was transformed into BL21 Star (DE3) cells (Invitrogen), and 500-ml cultures were grown at 30°C. .. When cultures were induced, they were incubated with 0.5 mM isopropyl-β- d -thiogalactopyranoside (IPTG) for 2 h. Cells were harvested by centrifugation for 15 min at 3,000 × g and washed in 25 ml of 50 mM Tris-HCl (pH 7.5), resuspended in 25 ml of 50 mM Tris-HCl (pH 7.5) containing 20 μg of DNase per ml, and broken by passage through a Ribi cell fractionator (Sorvall).

    Article Title: A transient reporter for editing enrichment (TREE) in human cells
    Article Snippet: RNP complex formation For purification of recombinant BE3 (rBE3) protein, BL21 Star DE3 cells (ThermoFisher) were transformed with pET42b-BE3 (Addgene #87437). .. The supernatant was incubated with 2 ml Ni-NTA beads (Qiagen, Germantown, MD, USA) equilibrated in lysis buffer for 1 h at 4°C, followed by washing with 5 ml wash buffer [50 mM NaH2 PO4 (pH 8.0), 300 mM NaCl and 20 mM imidazole] three times.

    Article Title: An engineered RNA binding protein with improved splicing regulation
    Article Snippet: Using BL21 Star (DE3) cells (Invitrogen), protein expression was induced using 0.5 mM IPTG at an OD600 = 0.6–0.7 for 2 h at 37°C. .. The lysate was then diluted with 1 volume of 1× PBS and incubated for 30 minutes on ice prior to centrifugation at 17,000 rpm.

    Expressing:

    Article Title: Enzymatic placement of 6-O-sulfo groups in heparan sulfate *
    Article Snippet: .. The expression of KfiA was carried out in BL21 star (DE3) cells (Invitrogen) coexpressing the bacterial chaperone proteins, GroEL and GroES. ..

    Article Title: Segmental motions, not a two-state concerted switch, underlie allostery in CheY
    Article Snippet: Paragraph title: Protein expression and purification ... The CheY vector was transformed into BL21 Star (DE3) cells (Invitrogen) and grown in minimal media with the appropriate isotope(s): 15 NH4 Cl (99%) and/or D-glucose (U-13 C6 -99%) as the sole nitrogen and carbon sources, respectively).

    Article Title: Characterization of N-acetylneuraminic acid synthase isoenzyme 1 from Campylobacter jejuni
    Article Snippet: An expression plasmid, pWVCjSAS, was constructed as follows. .. Chemically competent E. coli TOP10 and BL21 Star (DE3) cells were purchased from Invitrogen.

    Article Title: Slow spontaneous ?-to-? structural conversion in a non-denaturing neutral condition reveals the intrinsically disordered property of the disulfide-reduced recombinant mouse prion protein
    Article Snippet: Paragraph title: Protein expression and purification ... The proteins were expressed in BL21 Star™ (DE3) cells (Invitrogen) and were purified using a protocol modified from a published method.

    Article Title: Chemoenzymatic Design of Heparan Sulfate Oligosaccharides *
    Article Snippet: .. The expression of pmHS2 was carried out in BL21 star (DE3) cells (Invitrogen) coexpressing bacteria chaperone proteins, GroEL and GroES. ..

    Article Title: Splicing modulators act at the branch point adenosine binding pocket defined by the PHF5A–SF3b complex
    Article Snippet: Paragraph title: Expression and crystallization of PHF5A ... Protein was expressed in BL21 Star (DE3) cells (Thermofisher) grown in LB media.

    Article Title: Purification and Characterization of a Transmembrane Domain-Deleted Form of Lecithin Retinol Acyltransferase
    Article Snippet: The expression vector, pET 21b(+) was obtained from Novagen, Inc. (Madison, WI), and the polymerase chain reaction (PCR) core reagent was from Applied Biosystems (Foster City, CA). .. Escherichia coli One Shot cells, BL21 STAR (DE3) cells, and ProBond Resin for purification of histidine-tagged (6X His-tag) and Precast gels (4–20%, 8 × 8 cm) for SDS/native polyacrylamide gel electrophoresis (PAGE) were from Invitrogen (Carlsbad, CA).

    Article Title: The diversity of the proline-rich domain of pneumococcal surface protein A (PspA): potential relevance to a broad-spectrum vaccine.
    Article Snippet: Protein expression and purification were carried out as previously described in Daniels et al., 2010 [ ]. .. Briefly, all of the vectors were transformed individually into BL21 Star (DE3) cells (Invitrogen, CA) and grown in liquid culture until they reached an OD600 of 0.6, induced with 1mM isopropyl-D-thiogalactopyranoside (IPTG; Sigma) for 3 hours, and subsequently purified on a cobalt resin column (Clontech, CA) following the manufacturer’s protocol for His tag purification [ ].

    Article Title: A transient reporter for editing enrichment (TREE) in human cells
    Article Snippet: RNP complex formation For purification of recombinant BE3 (rBE3) protein, BL21 Star DE3 cells (ThermoFisher) were transformed with pET42b-BE3 (Addgene #87437). .. Protein expression was induced for 18 h in 2L baffled flasks at 16°C with 0.5 mM isopropyl β-d-1-thiogalactopyranoside (IPTG).

    Article Title: An engineered RNA binding protein with improved splicing regulation
    Article Snippet: .. Using BL21 Star (DE3) cells (Invitrogen), protein expression was induced using 0.5 mM IPTG at an OD600 = 0.6–0.7 for 2 h at 37°C. .. Following induction, cells were lysed in B-PER (bacterial protein extraction reagent) (Pierce) supplemented with DNase I (5 U/ml) and lysozyme (0.1 mg/ml) for 30 minutes at room temperature.

    Article Title: Lysines in RNA polymerase II C-terminal domain contribute to TAF15 fibril recruitment
    Article Snippet: .. Expression plasmids were transformed into BL21 Star (DE3) cells (Life Technologies) and grown overnight in starter cultures. ..

    Modification:

    Article Title: SRB-2: a promiscuous rainbow aptamer for live-cell RNA imaging
    Article Snippet: HeLa cells (DSMZ, ACC 57) were cultured at 37°C under 5% CO2 in Dulbecco's Modified Eagle's Medium, high glucose, without phenol red (Sigma Aldrich) supplemented with 10% FBS, 2 mM GlutaMAX, 100 unit/ml penicillin and 100 μg/ml streptomycin. .. BL21 Star™ (DE3) cells (Thermo Fisher Scientific) were typically grown at 37°C with shaking at 150 rpm in Luria-Bertani (LB) medium.

    Article Title: Slow spontaneous ?-to-? structural conversion in a non-denaturing neutral condition reveals the intrinsically disordered property of the disulfide-reduced recombinant mouse prion protein
    Article Snippet: .. The proteins were expressed in BL21 Star™ (DE3) cells (Invitrogen) and were purified using a protocol modified from a published method. .. An overnight culture was used to inoculate fresh TB medium containing ampicillin (100 μg/mL) at a ratio of 2:100 and the cells were grown at 37°C with vigorous shaking (250 rpm) for 3 h (A600 nm = ~0.6) Protein expression was then induced by adding IPTG to a final concentration of 1 mM and the culture grown for an additional 5 h, then the cells were harvested by centrifugation at 1,900 g at 4°C for 10 min.

    Western Blot:

    Article Title: The fixABCX Genes in Rhodospirillum rubrum Encode a Putative Membrane Complex Participating in Electron Transfer to Nitrogenase
    Article Snippet: The final construct, designated pETfixC, was transformed into BL21 Star (DE3) cells (Invitrogen), and 500-ml cultures were grown at 30°C. .. The soluble and membrane fractions were prepared from the cell extract by centrifugation at 100,000 × g for 1 h. The membrane fraction was resuspended in 12 ml of 50 mM Tris-HCl (pH 7.5) and subjected to washing with Na2 CO3 as described by Molloy et al. ( ) by adding 34 ml of ice-cold 0.1 M Na2 Co3 (pH 11) to 6 ml of resuspended membranes and stirring the preparation on ice for 1 h. After the carbonate wash the soluble and membrane fractions were separated by centrifugation at 100,000 × g for 1 h. The cellular localization of FixC and E. coli Lep was determined by SDS-PAGE and Western blot analysis.

    Transformation Assay:

    Article Title: Segmental motions, not a two-state concerted switch, underlie allostery in CheY
    Article Snippet: .. The CheY vector was transformed into BL21 Star (DE3) cells (Invitrogen) and grown in minimal media with the appropriate isotope(s): 15 NH4 Cl (99%) and/or D-glucose (U-13 C6 -99%) as the sole nitrogen and carbon sources, respectively). ..

    Article Title: The fixABCX Genes in Rhodospirillum rubrum Encode a Putative Membrane Complex Participating in Electron Transfer to Nitrogenase
    Article Snippet: .. The final construct, designated pETfixC, was transformed into BL21 Star (DE3) cells (Invitrogen), and 500-ml cultures were grown at 30°C. .. When cultures were induced, they were incubated with 0.5 mM isopropyl-β- d -thiogalactopyranoside (IPTG) for 2 h. Cells were harvested by centrifugation for 15 min at 3,000 × g and washed in 25 ml of 50 mM Tris-HCl (pH 7.5), resuspended in 25 ml of 50 mM Tris-HCl (pH 7.5) containing 20 μg of DNase per ml, and broken by passage through a Ribi cell fractionator (Sorvall).

    Article Title: The diversity of the proline-rich domain of pneumococcal surface protein A (PspA): potential relevance to a broad-spectrum vaccine.
    Article Snippet: .. Briefly, all of the vectors were transformed individually into BL21 Star (DE3) cells (Invitrogen, CA) and grown in liquid culture until they reached an OD600 of 0.6, induced with 1mM isopropyl-D-thiogalactopyranoside (IPTG; Sigma) for 3 hours, and subsequently purified on a cobalt resin column (Clontech, CA) following the manufacturer’s protocol for His tag purification [ ]. .. A buffer exchange process was used to remove imidazole from the final product using a buffer (pH 8.0) containing 50mM NaPO4 and 200mM NaCl.

    Article Title: A transient reporter for editing enrichment (TREE) in human cells
    Article Snippet: .. RNP complex formation For purification of recombinant BE3 (rBE3) protein, BL21 Star DE3 cells (ThermoFisher) were transformed with pET42b-BE3 (Addgene #87437). .. Protein expression was induced for 18 h in 2L baffled flasks at 16°C with 0.5 mM isopropyl β-d-1-thiogalactopyranoside (IPTG).

    Article Title: Lysines in RNA polymerase II C-terminal domain contribute to TAF15 fibril recruitment
    Article Snippet: .. Expression plasmids were transformed into BL21 Star (DE3) cells (Life Technologies) and grown overnight in starter cultures. ..

    Crystallization Assay:

    Article Title: Splicing modulators act at the branch point adenosine binding pocket defined by the PHF5A–SF3b complex
    Article Snippet: Paragraph title: Expression and crystallization of PHF5A ... Protein was expressed in BL21 Star (DE3) cells (Thermofisher) grown in LB media.

    Buffer Exchange:

    Article Title: The diversity of the proline-rich domain of pneumococcal surface protein A (PspA): potential relevance to a broad-spectrum vaccine.
    Article Snippet: Briefly, all of the vectors were transformed individually into BL21 Star (DE3) cells (Invitrogen, CA) and grown in liquid culture until they reached an OD600 of 0.6, induced with 1mM isopropyl-D-thiogalactopyranoside (IPTG; Sigma) for 3 hours, and subsequently purified on a cobalt resin column (Clontech, CA) following the manufacturer’s protocol for His tag purification [ ]. .. A buffer exchange process was used to remove imidazole from the final product using a buffer (pH 8.0) containing 50mM NaPO4 and 200mM NaCl.

    Cell Culture:

    Article Title: SRB-2: a promiscuous rainbow aptamer for live-cell RNA imaging
    Article Snippet: HeLa cells (DSMZ, ACC 57) were cultured at 37°C under 5% CO2 in Dulbecco's Modified Eagle's Medium, high glucose, without phenol red (Sigma Aldrich) supplemented with 10% FBS, 2 mM GlutaMAX, 100 unit/ml penicillin and 100 μg/ml streptomycin. .. BL21 Star™ (DE3) cells (Thermo Fisher Scientific) were typically grown at 37°C with shaking at 150 rpm in Luria-Bertani (LB) medium.

    DNA Sequencing:

    Article Title: The diversity of the proline-rich domain of pneumococcal surface protein A (PspA): potential relevance to a broad-spectrum vaccine.
    Article Snippet: DNA sequencing was done to confirm the identity of the pspA gene fragment incorporated into the recombinant plasmid. .. Briefly, all of the vectors were transformed individually into BL21 Star (DE3) cells (Invitrogen, CA) and grown in liquid culture until they reached an OD600 of 0.6, induced with 1mM isopropyl-D-thiogalactopyranoside (IPTG; Sigma) for 3 hours, and subsequently purified on a cobalt resin column (Clontech, CA) following the manufacturer’s protocol for His tag purification [ ].

    Polymerase Chain Reaction:

    Article Title: Segmental motions, not a two-state concerted switch, underlie allostery in CheY
    Article Snippet: Mutants were made by site-directed mutagenesis PCR. .. The CheY vector was transformed into BL21 Star (DE3) cells (Invitrogen) and grown in minimal media with the appropriate isotope(s): 15 NH4 Cl (99%) and/or D-glucose (U-13 C6 -99%) as the sole nitrogen and carbon sources, respectively).

    Article Title: Characterization of N-acetylneuraminic acid synthase isoenzyme 1 from Campylobacter jejuni
    Article Snippet: The PCR fragment was ligated into the plasmid vector pET30 E/K Lic from Novagen according to the manufacturer's instructions. .. Chemically competent E. coli TOP10 and BL21 Star (DE3) cells were purchased from Invitrogen.

    Article Title: The fixABCX Genes in Rhodospirillum rubrum Encode a Putative Membrane Complex Participating in Electron Transfer to Nitrogenase
    Article Snippet: To investigate the cellular localization of FixC, fixC lacking the stop codon was PCR amplified by using Pfu-Taq DNA polymerase (Stratagene) with pRKDfix as the template and was cloned in pET101/D-TOPO (Invitrogen), which resulted in fixC fused to a C-terminal V5 epitope and a six-histidine tag. .. The final construct, designated pETfixC, was transformed into BL21 Star (DE3) cells (Invitrogen), and 500-ml cultures were grown at 30°C.

    Article Title: Purification and Characterization of a Transmembrane Domain-Deleted Form of Lecithin Retinol Acyltransferase
    Article Snippet: The expression vector, pET 21b(+) was obtained from Novagen, Inc. (Madison, WI), and the polymerase chain reaction (PCR) core reagent was from Applied Biosystems (Foster City, CA). .. Escherichia coli One Shot cells, BL21 STAR (DE3) cells, and ProBond Resin for purification of histidine-tagged (6X His-tag) and Precast gels (4–20%, 8 × 8 cm) for SDS/native polyacrylamide gel electrophoresis (PAGE) were from Invitrogen (Carlsbad, CA).

    Sonication:

    Article Title: A transient reporter for editing enrichment (TREE) in human cells
    Article Snippet: RNP complex formation For purification of recombinant BE3 (rBE3) protein, BL21 Star DE3 cells (ThermoFisher) were transformed with pET42b-BE3 (Addgene #87437). .. Cells were then harvested by centrifugation followed by lysis by sonication in lysis buffer [50 mM NaH2 PO4 (pH 8.0), 300 mM NaCl, 10 mM imidazole, 1% Triton X-100, 1 mM Dithiothreitol (DTT) and 1 mg/ml lysozyme].

    Recombinant:

    Article Title: Heparan Sulfate Domains Required for Fibroblast Growth Factor 1 and 2 Signaling through Fibroblast Growth Factor Receptor 1c *
    Article Snippet: .. Here, the recombinant pmHS2 was constructed as an N-terminal fusion to His6 using a PET-15b vector (Novagen) expressed in BL21 star (DE3) cells (Invitrogen). .. In subsequent block reactions, 0.5–2 m m heparosan trisaccharide (GlcA-GlcNAc (or TFA)-GlcA-pNP) was used as an acceptor to maintain a continuous block as desired.

    Article Title: Identification of nucleotides and amino acids that mediate the interaction between ribosomal protein L30 and the SECIS element
    Article Snippet: .. Protein purification Recombinant rat L30 was expressed in BL21 Star (DE3) cells (Invitrogen). ..

    Article Title: The diversity of the proline-rich domain of pneumococcal surface protein A (PspA): potential relevance to a broad-spectrum vaccine.
    Article Snippet: DNA sequencing was done to confirm the identity of the pspA gene fragment incorporated into the recombinant plasmid. .. Briefly, all of the vectors were transformed individually into BL21 Star (DE3) cells (Invitrogen, CA) and grown in liquid culture until they reached an OD600 of 0.6, induced with 1mM isopropyl-D-thiogalactopyranoside (IPTG; Sigma) for 3 hours, and subsequently purified on a cobalt resin column (Clontech, CA) following the manufacturer’s protocol for His tag purification [ ].

    Article Title: A transient reporter for editing enrichment (TREE) in human cells
    Article Snippet: .. RNP complex formation For purification of recombinant BE3 (rBE3) protein, BL21 Star DE3 cells (ThermoFisher) were transformed with pET42b-BE3 (Addgene #87437). .. Protein expression was induced for 18 h in 2L baffled flasks at 16°C with 0.5 mM isopropyl β-d-1-thiogalactopyranoside (IPTG).

    Mutagenesis:

    Article Title: Segmental motions, not a two-state concerted switch, underlie allostery in CheY
    Article Snippet: Mutants were made by site-directed mutagenesis PCR. .. The CheY vector was transformed into BL21 Star (DE3) cells (Invitrogen) and grown in minimal media with the appropriate isotope(s): 15 NH4 Cl (99%) and/or D-glucose (U-13 C6 -99%) as the sole nitrogen and carbon sources, respectively).

    Article Title: Splicing modulators act at the branch point adenosine binding pocket defined by the PHF5A–SF3b complex
    Article Snippet: Expression and crystallization of PHF5A Full-length human PHF5A, containing a C40S mutation for enhanced protein stability, was synthesized and subcloned between the Nde I and Eco RI sites of pET-28a with an N-terminal His-MBP-TEV cleavable tag. .. Protein was expressed in BL21 Star (DE3) cells (Thermofisher) grown in LB media.

    Isolation:

    Article Title: Characterization of N-acetylneuraminic acid synthase isoenzyme 1 from Campylobacter jejuni
    Article Snippet: The high-fidelity polymerase KOD XL (Novagen, Madison, WI, U.S.A.) was used with genomic DNA isolated from C. jejuni strain PG836 (kindly provided by Dr Patricia Guerry, Naval Medical Research, Silver Spring, MD, U.S.A.) as a template. .. Chemically competent E. coli TOP10 and BL21 Star (DE3) cells were purchased from Invitrogen.

    Article Title: An engineered RNA binding protein with improved splicing regulation
    Article Snippet: Using BL21 Star (DE3) cells (Invitrogen), protein expression was induced using 0.5 mM IPTG at an OD600 = 0.6–0.7 for 2 h at 37°C. .. The supernatant was isolated and mixed with glutathione agarose (Sigma) for 2 h at 4°C.

    Purification:

    Article Title: Enzymatic placement of 6-O-sulfo groups in heparan sulfate *
    Article Snippet: Paragraph title: Expression and purification of HS biosynthetic enzymes ... The expression of KfiA was carried out in BL21 star (DE3) cells (Invitrogen) coexpressing the bacterial chaperone proteins, GroEL and GroES.

    Article Title: Segmental motions, not a two-state concerted switch, underlie allostery in CheY
    Article Snippet: Paragraph title: Protein expression and purification ... The CheY vector was transformed into BL21 Star (DE3) cells (Invitrogen) and grown in minimal media with the appropriate isotope(s): 15 NH4 Cl (99%) and/or D-glucose (U-13 C6 -99%) as the sole nitrogen and carbon sources, respectively).

    Article Title: Slow spontaneous ?-to-? structural conversion in a non-denaturing neutral condition reveals the intrinsically disordered property of the disulfide-reduced recombinant mouse prion protein
    Article Snippet: .. The proteins were expressed in BL21 Star™ (DE3) cells (Invitrogen) and were purified using a protocol modified from a published method. .. An overnight culture was used to inoculate fresh TB medium containing ampicillin (100 μg/mL) at a ratio of 2:100 and the cells were grown at 37°C with vigorous shaking (250 rpm) for 3 h (A600 nm = ~0.6) Protein expression was then induced by adding IPTG to a final concentration of 1 mM and the culture grown for an additional 5 h, then the cells were harvested by centrifugation at 1,900 g at 4°C for 10 min.

    Article Title: Chemoenzymatic Design of Heparan Sulfate Oligosaccharides *
    Article Snippet: N -sulfotransferase (NST), C5 -epi, 2-OST, 6-OST-1, 6-OST-3, 3-OST-1, 3-OST-5, and N -acetyl- d -glucosaminyl transferase of E. coli K5 strain (KfiA) were expressed and purified as previously described ( , , ). .. The expression of pmHS2 was carried out in BL21 star (DE3) cells (Invitrogen) coexpressing bacteria chaperone proteins, GroEL and GroES.

    Article Title: Identification of nucleotides and amino acids that mediate the interaction between ribosomal protein L30 and the SECIS element
    Article Snippet: Protein purification Recombinant rat L30 was expressed in BL21 Star (DE3) cells (Invitrogen). .. Purification buffers (PB) contained 20 mM HEPES-HCl, pH 8.0 and the indicated amounts of NaCl and imidazole.

    Article Title: Purification and Characterization of a Transmembrane Domain-Deleted Form of Lecithin Retinol Acyltransferase
    Article Snippet: .. Escherichia coli One Shot cells, BL21 STAR (DE3) cells, and ProBond Resin for purification of histidine-tagged (6X His-tag) and Precast gels (4–20%, 8 × 8 cm) for SDS/native polyacrylamide gel electrophoresis (PAGE) were from Invitrogen (Carlsbad, CA). .. The Wizard Plus Miniprep system was from Promega Corp. (Madison, WI).

    Article Title: The diversity of the proline-rich domain of pneumococcal surface protein A (PspA): potential relevance to a broad-spectrum vaccine.
    Article Snippet: .. Briefly, all of the vectors were transformed individually into BL21 Star (DE3) cells (Invitrogen, CA) and grown in liquid culture until they reached an OD600 of 0.6, induced with 1mM isopropyl-D-thiogalactopyranoside (IPTG; Sigma) for 3 hours, and subsequently purified on a cobalt resin column (Clontech, CA) following the manufacturer’s protocol for His tag purification [ ]. .. A buffer exchange process was used to remove imidazole from the final product using a buffer (pH 8.0) containing 50mM NaPO4 and 200mM NaCl.

    Article Title: A transient reporter for editing enrichment (TREE) in human cells
    Article Snippet: .. RNP complex formation For purification of recombinant BE3 (rBE3) protein, BL21 Star DE3 cells (ThermoFisher) were transformed with pET42b-BE3 (Addgene #87437). .. Protein expression was induced for 18 h in 2L baffled flasks at 16°C with 0.5 mM isopropyl β-d-1-thiogalactopyranoside (IPTG).

    Article Title: An engineered RNA binding protein with improved splicing regulation
    Article Snippet: Paragraph title: Protein expression and purification ... Using BL21 Star (DE3) cells (Invitrogen), protein expression was induced using 0.5 mM IPTG at an OD600 = 0.6–0.7 for 2 h at 37°C.

    Protein Purification:

    Article Title: Identification of nucleotides and amino acids that mediate the interaction between ribosomal protein L30 and the SECIS element
    Article Snippet: .. Protein purification Recombinant rat L30 was expressed in BL21 Star (DE3) cells (Invitrogen). ..

    Sequencing:

    Article Title: Splicing modulators act at the branch point adenosine binding pocket defined by the PHF5A–SF3b complex
    Article Snippet: The codon optimized sequence was: atggcaaaacaccatccggacttaatcttttgccgcaagcaggccggtgttgcaatcggccgtctgtgcgagaaatgcgacggcaagtgcgtgatctgtgacagctatgtgcgccctagtaccctggttcgcatctgcgacgagtgcaattatggcagctatcagggccgttgcgttatttgcggtggtccgggtgttagcgatgcctattactgcaaagaatgcaccattcaggaaaaggatcgcgatggctgtccgaagatcgttaacctgggcagcagcaaaaccgacctgttttacgaacgtaagaagtatggcttcaagaaacgctga. .. Protein was expressed in BL21 Star (DE3) cells (Thermofisher) grown in LB media.

    Article Title: Purification and Characterization of a Transmembrane Domain-Deleted Form of Lecithin Retinol Acyltransferase
    Article Snippet: Escherichia coli One Shot cells, BL21 STAR (DE3) cells, and ProBond Resin for purification of histidine-tagged (6X His-tag) and Precast gels (4–20%, 8 × 8 cm) for SDS/native polyacrylamide gel electrophoresis (PAGE) were from Invitrogen (Carlsbad, CA). .. Sequenase 2.0 for dideoxy chain termination sequence analysis was obtained from USB Corp. (Cleveland, OH).

    Protein Extraction:

    Article Title: An engineered RNA binding protein with improved splicing regulation
    Article Snippet: Using BL21 Star (DE3) cells (Invitrogen), protein expression was induced using 0.5 mM IPTG at an OD600 = 0.6–0.7 for 2 h at 37°C. .. Following induction, cells were lysed in B-PER (bacterial protein extraction reagent) (Pierce) supplemented with DNase I (5 U/ml) and lysozyme (0.1 mg/ml) for 30 minutes at room temperature.

    Construct:

    Article Title: Characterization of N-acetylneuraminic acid synthase isoenzyme 1 from Campylobacter jejuni
    Article Snippet: An expression plasmid, pWVCjSAS, was constructed as follows. .. Chemically competent E. coli TOP10 and BL21 Star (DE3) cells were purchased from Invitrogen.

    Article Title: Heparan Sulfate Domains Required for Fibroblast Growth Factor 1 and 2 Signaling through Fibroblast Growth Factor Receptor 1c *
    Article Snippet: .. Here, the recombinant pmHS2 was constructed as an N-terminal fusion to His6 using a PET-15b vector (Novagen) expressed in BL21 star (DE3) cells (Invitrogen). .. In subsequent block reactions, 0.5–2 m m heparosan trisaccharide (GlcA-GlcNAc (or TFA)-GlcA-pNP) was used as an acceptor to maintain a continuous block as desired.

    Article Title: The fixABCX Genes in Rhodospirillum rubrum Encode a Putative Membrane Complex Participating in Electron Transfer to Nitrogenase
    Article Snippet: .. The final construct, designated pETfixC, was transformed into BL21 Star (DE3) cells (Invitrogen), and 500-ml cultures were grown at 30°C. .. When cultures were induced, they were incubated with 0.5 mM isopropyl-β- d -thiogalactopyranoside (IPTG) for 2 h. Cells were harvested by centrifugation for 15 min at 3,000 × g and washed in 25 ml of 50 mM Tris-HCl (pH 7.5), resuspended in 25 ml of 50 mM Tris-HCl (pH 7.5) containing 20 μg of DNase per ml, and broken by passage through a Ribi cell fractionator (Sorvall).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Purification and Characterization of a Transmembrane Domain-Deleted Form of Lecithin Retinol Acyltransferase
    Article Snippet: .. Escherichia coli One Shot cells, BL21 STAR (DE3) cells, and ProBond Resin for purification of histidine-tagged (6X His-tag) and Precast gels (4–20%, 8 × 8 cm) for SDS/native polyacrylamide gel electrophoresis (PAGE) were from Invitrogen (Carlsbad, CA). .. The Wizard Plus Miniprep system was from Promega Corp. (Madison, WI).

    Lysis:

    Article Title: Slow spontaneous ?-to-? structural conversion in a non-denaturing neutral condition reveals the intrinsically disordered property of the disulfide-reduced recombinant mouse prion protein
    Article Snippet: The proteins were expressed in BL21 Star™ (DE3) cells (Invitrogen) and were purified using a protocol modified from a published method. .. The cell pellet (about 34 g from 2.4 L of culture) was resuspended in 300 mL of cell lysis buffer (50 mM TRIS-HCl, 100 mM NaCl, pH 8.0) and the cells lysed by addition of 0.5 X CelLyticB (Sigma), 0.15 mg/mL of lysozyme, 50 μg/mL of DNaseI, 7 mM MgCl2 , and 1 mM PMSF.

    Article Title: A transient reporter for editing enrichment (TREE) in human cells
    Article Snippet: RNP complex formation For purification of recombinant BE3 (rBE3) protein, BL21 Star DE3 cells (ThermoFisher) were transformed with pET42b-BE3 (Addgene #87437). .. Cells were then harvested by centrifugation followed by lysis by sonication in lysis buffer [50 mM NaH2 PO4 (pH 8.0), 300 mM NaCl, 10 mM imidazole, 1% Triton X-100, 1 mM Dithiothreitol (DTT) and 1 mg/ml lysozyme].

    SDS Page:

    Article Title: The fixABCX Genes in Rhodospirillum rubrum Encode a Putative Membrane Complex Participating in Electron Transfer to Nitrogenase
    Article Snippet: The final construct, designated pETfixC, was transformed into BL21 Star (DE3) cells (Invitrogen), and 500-ml cultures were grown at 30°C. .. The soluble and membrane fractions were prepared from the cell extract by centrifugation at 100,000 × g for 1 h. The membrane fraction was resuspended in 12 ml of 50 mM Tris-HCl (pH 7.5) and subjected to washing with Na2 CO3 as described by Molloy et al. ( ) by adding 34 ml of ice-cold 0.1 M Na2 Co3 (pH 11) to 6 ml of resuspended membranes and stirring the preparation on ice for 1 h. After the carbonate wash the soluble and membrane fractions were separated by centrifugation at 100,000 × g for 1 h. The cellular localization of FixC and E. coli Lep was determined by SDS-PAGE and Western blot analysis.

    Plasmid Preparation:

    Article Title: Enzymatic placement of 6-O-sulfo groups in heparan sulfate *
    Article Snippet: PmHS2 was expressed as an N -terminal fusion protein with a 6 × His-tag using a PET-15b vector (Novagen) ( ). .. The expression of KfiA was carried out in BL21 star (DE3) cells (Invitrogen) coexpressing the bacterial chaperone proteins, GroEL and GroES.

    Article Title: Segmental motions, not a two-state concerted switch, underlie allostery in CheY
    Article Snippet: .. The CheY vector was transformed into BL21 Star (DE3) cells (Invitrogen) and grown in minimal media with the appropriate isotope(s): 15 NH4 Cl (99%) and/or D-glucose (U-13 C6 -99%) as the sole nitrogen and carbon sources, respectively). ..

    Article Title: Characterization of N-acetylneuraminic acid synthase isoenzyme 1 from Campylobacter jejuni
    Article Snippet: The PCR fragment was ligated into the plasmid vector pET30 E/K Lic from Novagen according to the manufacturer's instructions. .. Chemically competent E. coli TOP10 and BL21 Star (DE3) cells were purchased from Invitrogen.

    Article Title: Slow spontaneous ?-to-? structural conversion in a non-denaturing neutral condition reveals the intrinsically disordered property of the disulfide-reduced recombinant mouse prion protein
    Article Snippet: Protein expression and purification The mouse PrP gene cloned in the pET101/D-TOPO vector was kindly provided by Dr. Ilia V. Baskakov (Center for Biomedical Engineering and Technology, University of Maryland Biotechnology Institute, USA). .. The proteins were expressed in BL21 Star™ (DE3) cells (Invitrogen) and were purified using a protocol modified from a published method.

    Article Title: Chemoenzymatic Design of Heparan Sulfate Oligosaccharides *
    Article Snippet: PmHS2 was expressed as an N -terminal fusion to His6 using a PET-15b vector (Novagen) ( ). .. The expression of pmHS2 was carried out in BL21 star (DE3) cells (Invitrogen) coexpressing bacteria chaperone proteins, GroEL and GroES.

    Article Title: Heparan Sulfate Domains Required for Fibroblast Growth Factor 1 and 2 Signaling through Fibroblast Growth Factor Receptor 1c *
    Article Snippet: .. Here, the recombinant pmHS2 was constructed as an N-terminal fusion to His6 using a PET-15b vector (Novagen) expressed in BL21 star (DE3) cells (Invitrogen). .. In subsequent block reactions, 0.5–2 m m heparosan trisaccharide (GlcA-GlcNAc (or TFA)-GlcA-pNP) was used as an acceptor to maintain a continuous block as desired.

    Article Title: Purification and Characterization of a Transmembrane Domain-Deleted Form of Lecithin Retinol Acyltransferase
    Article Snippet: The expression vector, pET 21b(+) was obtained from Novagen, Inc. (Madison, WI), and the polymerase chain reaction (PCR) core reagent was from Applied Biosystems (Foster City, CA). .. Escherichia coli One Shot cells, BL21 STAR (DE3) cells, and ProBond Resin for purification of histidine-tagged (6X His-tag) and Precast gels (4–20%, 8 × 8 cm) for SDS/native polyacrylamide gel electrophoresis (PAGE) were from Invitrogen (Carlsbad, CA).

    Article Title: The diversity of the proline-rich domain of pneumococcal surface protein A (PspA): potential relevance to a broad-spectrum vaccine.
    Article Snippet: DNA sequencing was done to confirm the identity of the pspA gene fragment incorporated into the recombinant plasmid. .. Briefly, all of the vectors were transformed individually into BL21 Star (DE3) cells (Invitrogen, CA) and grown in liquid culture until they reached an OD600 of 0.6, induced with 1mM isopropyl-D-thiogalactopyranoside (IPTG; Sigma) for 3 hours, and subsequently purified on a cobalt resin column (Clontech, CA) following the manufacturer’s protocol for His tag purification [ ].

    Positron Emission Tomography:

    Article Title: Enzymatic placement of 6-O-sulfo groups in heparan sulfate *
    Article Snippet: PmHS2 was expressed as an N -terminal fusion protein with a 6 × His-tag using a PET-15b vector (Novagen) ( ). .. The expression of KfiA was carried out in BL21 star (DE3) cells (Invitrogen) coexpressing the bacterial chaperone proteins, GroEL and GroES.

    Article Title: Chemoenzymatic Design of Heparan Sulfate Oligosaccharides *
    Article Snippet: PmHS2 was expressed as an N -terminal fusion to His6 using a PET-15b vector (Novagen) ( ). .. The expression of pmHS2 was carried out in BL21 star (DE3) cells (Invitrogen) coexpressing bacteria chaperone proteins, GroEL and GroES.

    Article Title: Heparan Sulfate Domains Required for Fibroblast Growth Factor 1 and 2 Signaling through Fibroblast Growth Factor Receptor 1c *
    Article Snippet: .. Here, the recombinant pmHS2 was constructed as an N-terminal fusion to His6 using a PET-15b vector (Novagen) expressed in BL21 star (DE3) cells (Invitrogen). .. In subsequent block reactions, 0.5–2 m m heparosan trisaccharide (GlcA-GlcNAc (or TFA)-GlcA-pNP) was used as an acceptor to maintain a continuous block as desired.

    Article Title: Splicing modulators act at the branch point adenosine binding pocket defined by the PHF5A–SF3b complex
    Article Snippet: Expression and crystallization of PHF5A Full-length human PHF5A, containing a C40S mutation for enhanced protein stability, was synthesized and subcloned between the Nde I and Eco RI sites of pET-28a with an N-terminal His-MBP-TEV cleavable tag. .. Protein was expressed in BL21 Star (DE3) cells (Thermofisher) grown in LB media.

    Article Title: Purification and Characterization of a Transmembrane Domain-Deleted Form of Lecithin Retinol Acyltransferase
    Article Snippet: The expression vector, pET 21b(+) was obtained from Novagen, Inc. (Madison, WI), and the polymerase chain reaction (PCR) core reagent was from Applied Biosystems (Foster City, CA). .. Escherichia coli One Shot cells, BL21 STAR (DE3) cells, and ProBond Resin for purification of histidine-tagged (6X His-tag) and Precast gels (4–20%, 8 × 8 cm) for SDS/native polyacrylamide gel electrophoresis (PAGE) were from Invitrogen (Carlsbad, CA).

    Spectrophotometry:

    Article Title: SRB-2: a promiscuous rainbow aptamer for live-cell RNA imaging
    Article Snippet: Absorbance spectra were recorded on a Cary 50 UV-Vis spectrophotometer (Varian). .. BL21 Star™ (DE3) cells (Thermo Fisher Scientific) were typically grown at 37°C with shaking at 150 rpm in Luria-Bertani (LB) medium.

    Concentration Assay:

    Article Title: Segmental motions, not a two-state concerted switch, underlie allostery in CheY
    Article Snippet: The CheY vector was transformed into BL21 Star (DE3) cells (Invitrogen) and grown in minimal media with the appropriate isotope(s): 15 NH4 Cl (99%) and/or D-glucose (U-13 C6 -99%) as the sole nitrogen and carbon sources, respectively). .. Isopropyl 1-thio-β-D-galactopyranoside was added to a final concentration of 1 mM and cells were grown for an additional 22–26 hours (32–36 hours if 2 H2 O used) at 20 °C.

    Article Title: Slow spontaneous ?-to-? structural conversion in a non-denaturing neutral condition reveals the intrinsically disordered property of the disulfide-reduced recombinant mouse prion protein
    Article Snippet: The proteins were expressed in BL21 Star™ (DE3) cells (Invitrogen) and were purified using a protocol modified from a published method. .. An overnight culture was used to inoculate fresh TB medium containing ampicillin (100 μg/mL) at a ratio of 2:100 and the cells were grown at 37°C with vigorous shaking (250 rpm) for 3 h (A600 nm = ~0.6) Protein expression was then induced by adding IPTG to a final concentration of 1 mM and the culture grown for an additional 5 h, then the cells were harvested by centrifugation at 1,900 g at 4°C for 10 min.

    Staining:

    Article Title: SRB-2: a promiscuous rainbow aptamer for live-cell RNA imaging
    Article Snippet: Agarose gels were stained with ethidium bromide and visualized by UV illumination using AlphaImager™2200. .. BL21 Star™ (DE3) cells (Thermo Fisher Scientific) were typically grown at 37°C with shaking at 150 rpm in Luria-Bertani (LB) medium.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher bl21 star de3 plyss one shot chemically competent e coli
    Bl21 Star De3 Plyss One Shot Chemically Competent E Coli, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 star de3 plyss one shot chemically competent e coli/product/Thermo Fisher
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    bl21 star de3 plyss one shot chemically competent e coli - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher bl21 star de3 cells
    Bl21 Star De3 Cells, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 43 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 star de3 cells/product/Thermo Fisher
    Average 99 stars, based on 43 article reviews
    Price from $9.99 to $1999.99
    bl21 star de3 cells - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results