Structured Review

Millipore bl21 de3
Expression of ColG, H, and T constructs cloned in pET15b. For the nomenclature, compare Table 1 . M prestained protein ladder. Lane 1 <t>BL21</t> <t>DE3</t> cells before induction; lanes 2 – 5 hG1, hG2, hG3, and hG4 constructs of ColG 4 h after induction; lanes 6 – 9 hH1, hH2, hH3, and hH4 constructs of ColH 4 h after induction; lane 10 Tuner DE3 cells before induction; lanes 11 – 13 hT0, hT1, and hT3 constructs of ColT
Bl21 De3, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bl21 de3/product/Millipore
Average 99 stars, based on 1 article reviews
Price from $9.99 to $1999.99
bl21 de3 - by Bioz Stars, 2020-02
99/100 stars

Images

1) Product Images from "A universal strategy for high-yield production of soluble and functional clostridial collagenases in E. coli"

Article Title: A universal strategy for high-yield production of soluble and functional clostridial collagenases in E. coli

Journal: Applied Microbiology and Biotechnology

doi: 10.1007/s00253-009-1953-4

Expression of ColG, H, and T constructs cloned in pET15b. For the nomenclature, compare Table 1 . M prestained protein ladder. Lane 1 BL21 DE3 cells before induction; lanes 2 – 5 hG1, hG2, hG3, and hG4 constructs of ColG 4 h after induction; lanes 6 – 9 hH1, hH2, hH3, and hH4 constructs of ColH 4 h after induction; lane 10 Tuner DE3 cells before induction; lanes 11 – 13 hT0, hT1, and hT3 constructs of ColT
Figure Legend Snippet: Expression of ColG, H, and T constructs cloned in pET15b. For the nomenclature, compare Table 1 . M prestained protein ladder. Lane 1 BL21 DE3 cells before induction; lanes 2 – 5 hG1, hG2, hG3, and hG4 constructs of ColG 4 h after induction; lanes 6 – 9 hH1, hH2, hH3, and hH4 constructs of ColH 4 h after induction; lane 10 Tuner DE3 cells before induction; lanes 11 – 13 hT0, hT1, and hT3 constructs of ColT

Techniques Used: Expressing, Construct, Clone Assay

Related Articles

Clone Assay:

Article Title: Development of an efficient RNA interference method by feeding for the microcrustacean Daphnia
Article Snippet: This vector allows cloning of PCR products between two T7 promoters in opposite orientations. .. The following two bacterial strains harboring λDE3 lysogen (a source of T7 RNA polymerase) were used for generating dsRNA from the recombinant plasmids: BL21(DE3): ompT hsdSB (rB -mB -) gal dcm (Novagen) - a strain deficient in lon and ompT proteases and used for efficient production of recombinant proteins.

Article Title: Impairment of Fas-ligand–caveolin-1 interaction inhibits Fas-ligand translocation to rafts and Fas-ligand-induced cell death
Article Snippet: For producing GST-fusion proteins, PCR-fragments of N- (1–101 aa) and C-terminal (135–178 aa) domains of caveolin-1 were cloned into pET42b (Novagen). .. Transformation of BL21(DE3) with the plasmid and recombinant protein purification were carried out according to the manufacturer’s instructions (Novagen).

Article Title: Periplasmic superoxide dismutase SodCI of Salmonella binds peptidoglycan to remain tethered within the periplasm
Article Snippet: .. Hybrid SodC proteins, produced from pET21b clones in BL21(DE3), were purified using a nickel affinity resin (HIS-Select Nickel Affinity Gel, Sigma). ..

Article Title: Calcium/Calmodulin Stimulates the Autophosphorylation of Elongation Factor 2 Kinase on Thr-348 and Ser-500 to Regulate its Activity and Calcium Dependence
Article Snippet: .. Escherichia coli strain NovaBlue – for cloning – and BL21(DE3) and Rosetta-gami™ 2(DE3) – for recombinant protein expression – were from Novagen, EMD4Biosciences (Gibbstown, NJ). .. The pET-32a vector was obtained from Novagen.

Article Title: Dissecting the evolvability landscape of the CalB active site toward aromatic substrates
Article Snippet: DNA constructs and expression systems A codon-optimized gene of wild-type CalB was synthesized for optimal expression in E. coli (GenScript) and cloned into expression vector pET22b+ (MilliporeSigma). .. Overexpression of the CalB enzyme from IPTG-inducible vector pET22b+ was tested using 5 different E. coli strains: Rosetta-Gami (DE3), Rosetta (DE3), Rosetta 2 (DE3) PLacI, Origami 2 (DE3), and BL21 (DE3) (MilliporeSigma).

Centrifugation:

Article Title: FlgM proteins from different bacteria exhibit different structural characteristics
Article Snippet: Briefly, each clone was transformed into either BL21(DE3) or ROSETTA™ cells (Novagen) for expression. .. Expressed cells were collected by centrifugation and resuspended in Wash Buffer (50 mM NaH2 PO4 , 300 mM NaCl, 20 mM imidazole, pH 7.5), followed by addition of 1/10 volume Triton X-100 (10% solution), 10 μg/mL lysozyme, 5 μg/mL DNase, and 1 μg/mL MgCl2 to the resuspended cells.

Filtration:

Article Title: Calcium/Calmodulin Stimulates the Autophosphorylation of Elongation Factor 2 Kinase on Thr-348 and Ser-500 to Regulate its Activity and Calcium Dependence
Article Snippet: Escherichia coli strain NovaBlue – for cloning – and BL21(DE3) and Rosetta-gami™ 2(DE3) – for recombinant protein expression – were from Novagen, EMD4Biosciences (Gibbstown, NJ). .. The ÄKTA FPLC™ System and the HiPrep™ 26/60 Sephacryl™ S-200 HR gel filtration column were from Amersham Biosciences / GE Healthcare Life Sciences (Piscataway, NJ).

Synthesized:

Article Title: Dissecting the evolvability landscape of the CalB active site toward aromatic substrates
Article Snippet: Using the same codon-optimized WT CalB sequence, three previously reported mutants of CalB displaying increased activity to bulky substrates in nonaqueous conditions were also synthesized: S47L, I189A, and double mutant I189A-L278P , , . .. Overexpression of the CalB enzyme from IPTG-inducible vector pET22b+ was tested using 5 different E. coli strains: Rosetta-Gami (DE3), Rosetta (DE3), Rosetta 2 (DE3) PLacI, Origami 2 (DE3), and BL21 (DE3) (MilliporeSigma).

Construct:

Article Title: Impairment of Fas-ligand–caveolin-1 interaction inhibits Fas-ligand translocation to rafts and Fas-ligand-induced cell death
Article Snippet: To produce Fc-fusion proteins, COS-1 cells were transfected with the Signal pIg plus (Ingenius) constructs containing caveolin-1, DcR3, and FasL sequences or empty vector as a control using Lipofectamin 2000™ (Invitrogen). .. Transformation of BL21(DE3) with the plasmid and recombinant protein purification were carried out according to the manufacturer’s instructions (Novagen).

Article Title: Dissecting the evolvability landscape of the CalB active site toward aromatic substrates
Article Snippet: Paragraph title: DNA constructs and expression systems ... Overexpression of the CalB enzyme from IPTG-inducible vector pET22b+ was tested using 5 different E. coli strains: Rosetta-Gami (DE3), Rosetta (DE3), Rosetta 2 (DE3) PLacI, Origami 2 (DE3), and BL21 (DE3) (MilliporeSigma).

Article Title: NusA interaction with the ?-subunit of E. coli RNA Polymerase is via the UP-element site and releases autoinhibition
Article Snippet: E. coli NusA-SKK (residues 132-348) was expressed as a penta-histidine-tagged protein in BL21(DE3) from pET-11a (Novagen) as described previously ( ). .. Briefly, strains carrying these constructs were grown in M9 minimal medium supplemented with 15 NH4 Cl and 0.2% 13 C D-glucose as the sole nitrogen and carbon sources, respectively ( ).

Incubation:

Article Title: Impairment of Fas-ligand–caveolin-1 interaction inhibits Fas-ligand translocation to rafts and Fas-ligand-induced cell death
Article Snippet: The Fc-fusion proteins-containing incubation medium was collected, and the proteins were purified according to the manufacturer’s instructions (Ingenius). .. Transformation of BL21(DE3) with the plasmid and recombinant protein purification were carried out according to the manufacturer’s instructions (Novagen).

Article Title: Hydrogen Peroxide-Based Fluorometric Assay for Real-Time Monitoring of SAM-Dependent Methyltransferases
Article Snippet: Overnight LB-grown starter cultures of BL21(DE3) were used to inoculate 50 ml cultures of Overnight Express™ Instant TB Medium (Novagen) at 2% (v/v). .. After overnight incubation (18–24 h, 28°C, 180 rpm), cells were pelleted and resuspended in a lysis buffer containing 50 mM Tris-HCl (pH 7.5), lysozyme (2 mg/ml), and 2% (v/v) hexane, and incubated for 30 min at room temperature with gentle inversion.

Article Title: RIAM Activates Integrins by Linking Talin to Ras GTPase Membrane-targeting Sequences
Article Snippet: His-tagged full-length talin was expressed in BL21(DE3) with 0.2 m m isopropyl 1-thio- d -galactopyranoside overnight at room temperature and purified using Ni-NTA His-bind® resin (Novagen) affinity matrix. .. 10 μg of purified GST fusion RIAM proteins on affinity matrix was mixed with 20 μg of His-tagged talin and incubated at 4 °C for 1 h. After washing the beads with reaction buffer, samples were fractionated on 4–20% SDS-PAGE gel (Invitrogen).

Activity Assay:

Article Title: Dissecting the evolvability landscape of the CalB active site toward aromatic substrates
Article Snippet: Using the same codon-optimized WT CalB sequence, three previously reported mutants of CalB displaying increased activity to bulky substrates in nonaqueous conditions were also synthesized: S47L, I189A, and double mutant I189A-L278P , , . .. Overexpression of the CalB enzyme from IPTG-inducible vector pET22b+ was tested using 5 different E. coli strains: Rosetta-Gami (DE3), Rosetta (DE3), Rosetta 2 (DE3) PLacI, Origami 2 (DE3), and BL21 (DE3) (MilliporeSigma).

Expressing:

Article Title: Impairment of Fas-ligand–caveolin-1 interaction inhibits Fas-ligand translocation to rafts and Fas-ligand-induced cell death
Article Snippet: To engineer the tetracycline-inducible T-REx expression of normal and mutant FasL, HeLa cells were transfected according to the manufacturer’s recommendations (Invitrogen). .. Transformation of BL21(DE3) with the plasmid and recombinant protein purification were carried out according to the manufacturer’s instructions (Novagen).

Article Title: FlgM proteins from different bacteria exhibit different structural characteristics
Article Snippet: .. Briefly, each clone was transformed into either BL21(DE3) or ROSETTA™ cells (Novagen) for expression. .. An overnight culture was used to inoculate expression cultures, which were induced at 18 °C overnight by addition of 1 mM IPTG.

Article Title: Hydrogen Peroxide-Based Fluorometric Assay for Real-Time Monitoring of SAM-Dependent Methyltransferases
Article Snippet: Paragraph title: Protein expression and purification ... Overnight LB-grown starter cultures of BL21(DE3) were used to inoculate 50 ml cultures of Overnight Express™ Instant TB Medium (Novagen) at 2% (v/v).

Article Title: Regulation of the Membrane Insertion and Conductance Activity of the Metamorphic Chloride Intracellular Channel Protein CLIC1 by Cholesterol
Article Snippet: .. Recombinant CLIC1 Protein Expression and Purification Recombinant CLIC1 protein was expressed in the E-coli bacterial strain, BL21(DE3) using the His-tag pET28a vector system (Novagen), as previously described . .. Briefly, transformed cells were grown in 2xYT media at 37 °C in a shaking incubator, with CLIC1 protein expression induced following addition of 1 mM isopropylthio-beta-galactoside (IPTG) at mid-log growth phase.

Article Title: Calcium/Calmodulin Stimulates the Autophosphorylation of Elongation Factor 2 Kinase on Thr-348 and Ser-500 to Regulate its Activity and Calcium Dependence
Article Snippet: .. Escherichia coli strain NovaBlue – for cloning – and BL21(DE3) and Rosetta-gami™ 2(DE3) – for recombinant protein expression – were from Novagen, EMD4Biosciences (Gibbstown, NJ). .. The pET-32a vector was obtained from Novagen.

Article Title: Dissecting the evolvability landscape of the CalB active site toward aromatic substrates
Article Snippet: Paragraph title: DNA constructs and expression systems ... Overexpression of the CalB enzyme from IPTG-inducible vector pET22b+ was tested using 5 different E. coli strains: Rosetta-Gami (DE3), Rosetta (DE3), Rosetta 2 (DE3) PLacI, Origami 2 (DE3), and BL21 (DE3) (MilliporeSigma).

Article Title: Bacterial expression strategies for several Sus scrofa diacylglycerol kinase alpha constructs: solubility challenges
Article Snippet: .. Protein expression The BL21(DE3) or Rosetta™(DE3) (Novagen®) strains of E. coli were transformed with the plasmid(s) of interest, and successful transformants were selected on Luria Bertani (LB) agar (1.5% (w/v)) with the appropriate antibiotic (kanamycin (30 μg/mL) for pT71myc and pET28-HisMBP-FLAGpp, chloramphenicol (35 μg/mL) for the chaperones, and carbenicillin (100 μg/mL) for pGEX-4T2 and pET32a). ..

Article Title: RIAM Activates Integrins by Linking Talin to Ras GTPase Membrane-targeting Sequences
Article Snippet: In Vitro Protein Interaction Assay —Bacterial expression plasmids encoding glutathione S -transferase (GST)-RIAM, GST-Lpd, their mutants, or GST vector were expressed in BL21(DE3) (Novagen, Madison, WI), and recombinant proteins were purified on glutathione-Sepharose beads according to manufacturer's instructions (GE Healthcare). .. His-tagged full-length talin was expressed in BL21(DE3) with 0.2 m m isopropyl 1-thio- d -galactopyranoside overnight at room temperature and purified using Ni-NTA His-bind® resin (Novagen) affinity matrix.

Transformation Assay:

Article Title: Optimizing Recombinant Protein Production in the Escherichia coli Periplasm Alleviates Stress
Article Snippet: .. However, rather than BL21(DE3) transformed with pLemo, Tuner(DE3) (Novagen) transformed with pLemo was used ( ). .. Tuner(DE3) is a BL21(DE3)-derived strain lacking the gene encoding β-galactosidase, which is the protein that is recognized by the model recombinant protein, the scFv BL1, used in this study.

Article Title: Impairment of Fas-ligand–caveolin-1 interaction inhibits Fas-ligand translocation to rafts and Fas-ligand-induced cell death
Article Snippet: .. Transformation of BL21(DE3) with the plasmid and recombinant protein purification were carried out according to the manufacturer’s instructions (Novagen). .. For all constructs, the correct reading frames were confirmed by DNA sequencing.

Article Title: FlgM proteins from different bacteria exhibit different structural characteristics
Article Snippet: .. Briefly, each clone was transformed into either BL21(DE3) or ROSETTA™ cells (Novagen) for expression. .. An overnight culture was used to inoculate expression cultures, which were induced at 18 °C overnight by addition of 1 mM IPTG.

Article Title: Regulation of the Membrane Insertion and Conductance Activity of the Metamorphic Chloride Intracellular Channel Protein CLIC1 by Cholesterol
Article Snippet: Recombinant CLIC1 Protein Expression and Purification Recombinant CLIC1 protein was expressed in the E-coli bacterial strain, BL21(DE3) using the His-tag pET28a vector system (Novagen), as previously described . .. Briefly, transformed cells were grown in 2xYT media at 37 °C in a shaking incubator, with CLIC1 protein expression induced following addition of 1 mM isopropylthio-beta-galactoside (IPTG) at mid-log growth phase.

Article Title: Bacterial expression strategies for several Sus scrofa diacylglycerol kinase alpha constructs: solubility challenges
Article Snippet: .. Protein expression The BL21(DE3) or Rosetta™(DE3) (Novagen®) strains of E. coli were transformed with the plasmid(s) of interest, and successful transformants were selected on Luria Bertani (LB) agar (1.5% (w/v)) with the appropriate antibiotic (kanamycin (30 μg/mL) for pT71myc and pET28-HisMBP-FLAGpp, chloramphenicol (35 μg/mL) for the chaperones, and carbenicillin (100 μg/mL) for pGEX-4T2 and pET32a). ..

Over Expression:

Article Title: Dissecting the evolvability landscape of the CalB active site toward aromatic substrates
Article Snippet: .. Overexpression of the CalB enzyme from IPTG-inducible vector pET22b+ was tested using 5 different E. coli strains: Rosetta-Gami (DE3), Rosetta (DE3), Rosetta 2 (DE3) PLacI, Origami 2 (DE3), and BL21 (DE3) (MilliporeSigma). .. The selection markers employed were a combination of kanamycin and chloramphenicol (Rosetta-Gami (DE3)), chloramphenicol (Rosetta (DE3) and Rosetta 2 ((DE3)-PLacI), and streptomycin (Origami 2 (DE3)).

Electroporation:

Article Title: Dissecting the evolvability landscape of the CalB active site toward aromatic substrates
Article Snippet: Overexpression of the CalB enzyme from IPTG-inducible vector pET22b+ was tested using 5 different E. coli strains: Rosetta-Gami (DE3), Rosetta (DE3), Rosetta 2 (DE3) PLacI, Origami 2 (DE3), and BL21 (DE3) (MilliporeSigma). .. Carbenicillin was used as resistance marker for expression vector pET22b+, which was electro-transformed into each strain using 0.1-cm Gene Pulser/MicroPulser electroporation cuvettes (Bio-Rad) and an ECM 630 electroporator (BTX Harvard Apparatus).

Transfection:

Article Title: Impairment of Fas-ligand–caveolin-1 interaction inhibits Fas-ligand translocation to rafts and Fas-ligand-induced cell death
Article Snippet: To produce Fc-fusion proteins, COS-1 cells were transfected with the Signal pIg plus (Ingenius) constructs containing caveolin-1, DcR3, and FasL sequences or empty vector as a control using Lipofectamin 2000™ (Invitrogen). .. Transformation of BL21(DE3) with the plasmid and recombinant protein purification were carried out according to the manufacturer’s instructions (Novagen).

Sequencing:

Article Title: Optimizing Recombinant Protein Production in the Escherichia coli Periplasm Alleviates Stress
Article Snippet: However, rather than BL21(DE3) transformed with pLemo, Tuner(DE3) (Novagen) transformed with pLemo was used ( ). .. The genetic information encoding the scFv BL1 was fused at the 5′ end to the genetic information encoding the DsbA signal sequence and at the 3′ end to the genetic information encoding a His6 tag.

Article Title: Impairment of Fas-ligand–caveolin-1 interaction inhibits Fas-ligand translocation to rafts and Fas-ligand-induced cell death
Article Snippet: Transformation of BL21(DE3) with the plasmid and recombinant protein purification were carried out according to the manufacturer’s instructions (Novagen). .. The caveolin-1 target sequence used is: 5′ACCTCGAGCGAGAAGCAAGTGTACGATCAAGAGTCGTACACTTGCTTCTCGCTCTT3′.

Article Title: Dissecting the evolvability landscape of the CalB active site toward aromatic substrates
Article Snippet: Using the same codon-optimized WT CalB sequence, three previously reported mutants of CalB displaying increased activity to bulky substrates in nonaqueous conditions were also synthesized: S47L, I189A, and double mutant I189A-L278P , , . .. Overexpression of the CalB enzyme from IPTG-inducible vector pET22b+ was tested using 5 different E. coli strains: Rosetta-Gami (DE3), Rosetta (DE3), Rosetta 2 (DE3) PLacI, Origami 2 (DE3), and BL21 (DE3) (MilliporeSigma).

Chromatography:

Article Title: Regulation of the Membrane Insertion and Conductance Activity of the Metamorphic Chloride Intracellular Channel Protein CLIC1 by Cholesterol
Article Snippet: Recombinant CLIC1 Protein Expression and Purification Recombinant CLIC1 protein was expressed in the E-coli bacterial strain, BL21(DE3) using the His-tag pET28a vector system (Novagen), as previously described . .. The soluble lysate was then run through a Ni-NTA chromatography column (Novagen) followed by cleavage and release of the protein from its His-tag using 50 NIH units of bovine plasma thrombin (Sigma Aldrich) per litre of cell culture.

Article Title: NusA interaction with the ?-subunit of E. coli RNA Polymerase is via the UP-element site and releases autoinhibition
Article Snippet: E. coli NusA-SKK (residues 132-348) was expressed as a penta-histidine-tagged protein in BL21(DE3) from pET-11a (Novagen) as described previously ( ). .. In the case of AR1, AR2, and αCTD the recombinant proteins were purified under native conditions by nickel-affinity chromatography (5 mL His-trap chelating column, GE Health Care) and eluted by applying an imidazole step gradient.

Protease Inhibitor:

Article Title: RIAM Activates Integrins by Linking Talin to Ras GTPase Membrane-targeting Sequences
Article Snippet: His-tagged full-length talin was expressed in BL21(DE3) with 0.2 m m isopropyl 1-thio- d -galactopyranoside overnight at room temperature and purified using Ni-NTA His-bind® resin (Novagen) affinity matrix. .. Interaction of GST-RIAM proteins or GST with His-talin was conducted in a reaction buffer (50 m m Tris-HCl (pH 7.4), 200 m m NaCl, 0.1% Triton X-100, 5–10 mg/ml bovine serum albumin, 1 m m phenylmethylsulfonyl fluoride, 10 μ m E-64, protease inhibitor mixture (complete mini, Roche Applied Science).

Protein Interaction Assay:

Article Title: RIAM Activates Integrins by Linking Talin to Ras GTPase Membrane-targeting Sequences
Article Snippet: In Vitro Protein Interaction Assay —Bacterial expression plasmids encoding glutathione S -transferase (GST)-RIAM, GST-Lpd, their mutants, or GST vector were expressed in BL21(DE3) (Novagen, Madison, WI), and recombinant proteins were purified on glutathione-Sepharose beads according to manufacturer's instructions (GE Healthcare). .. His-tagged full-length talin was expressed in BL21(DE3) with 0.2 m m isopropyl 1-thio- d -galactopyranoside overnight at room temperature and purified using Ni-NTA His-bind® resin (Novagen) affinity matrix.

DNA Sequencing:

Article Title: Impairment of Fas-ligand–caveolin-1 interaction inhibits Fas-ligand translocation to rafts and Fas-ligand-induced cell death
Article Snippet: Transformation of BL21(DE3) with the plasmid and recombinant protein purification were carried out according to the manufacturer’s instructions (Novagen). .. For all constructs, the correct reading frames were confirmed by DNA sequencing.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Impairment of Fas-ligand–caveolin-1 interaction inhibits Fas-ligand translocation to rafts and Fas-ligand-induced cell death
Article Snippet: Caveolin-1 and DcR3 cDNAs were produced by RT-PCR with total mRNA of HeLa cells and cloned into the Signal pIg plus (Ingenius). .. Transformation of BL21(DE3) with the plasmid and recombinant protein purification were carried out according to the manufacturer’s instructions (Novagen).

Sonication:

Article Title: FlgM proteins from different bacteria exhibit different structural characteristics
Article Snippet: Briefly, each clone was transformed into either BL21(DE3) or ROSETTA™ cells (Novagen) for expression. .. Cells were lysed using a combination of freeze/ thaw and sonication.

Recombinant:

Article Title: Development of an efficient RNA interference method by feeding for the microcrustacean Daphnia
Article Snippet: .. The following two bacterial strains harboring λDE3 lysogen (a source of T7 RNA polymerase) were used for generating dsRNA from the recombinant plasmids: BL21(DE3): ompT hsdSB (rB -mB -) gal dcm (Novagen) - a strain deficient in lon and ompT proteases and used for efficient production of recombinant proteins. .. HT115 (DE3) (W3110, rnc14::DTn10 (Addgene, [ ]) - a strain deficient in RNase III and used for efficient production of dsRNAs.

Article Title: Optimizing Recombinant Protein Production in the Escherichia coli Periplasm Alleviates Stress
Article Snippet: However, rather than BL21(DE3) transformed with pLemo, Tuner(DE3) (Novagen) transformed with pLemo was used ( ). .. Tuner(DE3) is a BL21(DE3)-derived strain lacking the gene encoding β-galactosidase, which is the protein that is recognized by the model recombinant protein, the scFv BL1, used in this study.

Article Title: Impairment of Fas-ligand–caveolin-1 interaction inhibits Fas-ligand translocation to rafts and Fas-ligand-induced cell death
Article Snippet: .. Transformation of BL21(DE3) with the plasmid and recombinant protein purification were carried out according to the manufacturer’s instructions (Novagen). .. For all constructs, the correct reading frames were confirmed by DNA sequencing.

Article Title: Hydrogen Peroxide-Based Fluorometric Assay for Real-Time Monitoring of SAM-Dependent Methyltransferases
Article Snippet: Overnight LB-grown starter cultures of BL21(DE3) were used to inoculate 50 ml cultures of Overnight Express™ Instant TB Medium (Novagen) at 2% (v/v). .. The column was washed five times with 0.5 ml 50 mM Tris-HCl (pH 7.5), and the recombinant his-tagged protein eluted with 80 μl 0.4 M imidazole, prepared in 50 mM Tris-HCl buffer (pH 7.5).

Article Title: Regulation of the Membrane Insertion and Conductance Activity of the Metamorphic Chloride Intracellular Channel Protein CLIC1 by Cholesterol
Article Snippet: .. Recombinant CLIC1 Protein Expression and Purification Recombinant CLIC1 protein was expressed in the E-coli bacterial strain, BL21(DE3) using the His-tag pET28a vector system (Novagen), as previously described . .. Briefly, transformed cells were grown in 2xYT media at 37 °C in a shaking incubator, with CLIC1 protein expression induced following addition of 1 mM isopropylthio-beta-galactoside (IPTG) at mid-log growth phase.

Article Title: Calcium/Calmodulin Stimulates the Autophosphorylation of Elongation Factor 2 Kinase on Thr-348 and Ser-500 to Regulate its Activity and Calcium Dependence
Article Snippet: .. Escherichia coli strain NovaBlue – for cloning – and BL21(DE3) and Rosetta-gami™ 2(DE3) – for recombinant protein expression – were from Novagen, EMD4Biosciences (Gibbstown, NJ). .. The pET-32a vector was obtained from Novagen.

Article Title: NusA interaction with the ?-subunit of E. coli RNA Polymerase is via the UP-element site and releases autoinhibition
Article Snippet: E. coli NusA-SKK (residues 132-348) was expressed as a penta-histidine-tagged protein in BL21(DE3) from pET-11a (Novagen) as described previously ( ). .. In the case of AR1, AR2, and αCTD the recombinant proteins were purified under native conditions by nickel-affinity chromatography (5 mL His-trap chelating column, GE Health Care) and eluted by applying an imidazole step gradient.

Article Title: RIAM Activates Integrins by Linking Talin to Ras GTPase Membrane-targeting Sequences
Article Snippet: In Vitro Protein Interaction Assay —Bacterial expression plasmids encoding glutathione S -transferase (GST)-RIAM, GST-Lpd, their mutants, or GST vector were expressed in BL21(DE3) (Novagen, Madison, WI), and recombinant proteins were purified on glutathione-Sepharose beads according to manufacturer's instructions (GE Healthcare). .. His-tagged full-length talin was expressed in BL21(DE3) with 0.2 m m isopropyl 1-thio- d -galactopyranoside overnight at room temperature and purified using Ni-NTA His-bind® resin (Novagen) affinity matrix.

Mutagenesis:

Article Title: Impairment of Fas-ligand–caveolin-1 interaction inhibits Fas-ligand translocation to rafts and Fas-ligand-induced cell death
Article Snippet: To engineer the tetracycline-inducible T-REx expression of normal and mutant FasL, HeLa cells were transfected according to the manufacturer’s recommendations (Invitrogen). .. Transformation of BL21(DE3) with the plasmid and recombinant protein purification were carried out according to the manufacturer’s instructions (Novagen).

Article Title: Directed Evolution of a Highly Specific FN3 Monobody to the SH3 Domain of Human Lyn Tyrosine Kinase
Article Snippet: Bacterial strains, plasmids, and phagemids The BL21-DE3 (fhuA2 [lon] ompT gal (λ DE3) [dcm] ΔhsdS ) and C41-DE3 (F–ompT hsdSB (rB - mB - ) gal dcm (DE3)) strains of E . coli were purchased from Novagen (Madison, WI) and Lucigen (Middleton, WI), respectively. .. Such uracilated ssDNA was used for Kunkel mutagenesis [ , ].

Article Title: Calcium/Calmodulin Stimulates the Autophosphorylation of Elongation Factor 2 Kinase on Thr-348 and Ser-500 to Regulate its Activity and Calcium Dependence
Article Snippet: Escherichia coli strain NovaBlue – for cloning – and BL21(DE3) and Rosetta-gami™ 2(DE3) – for recombinant protein expression – were from Novagen, EMD4Biosciences (Gibbstown, NJ). .. A Techne Genius Thermal Cycler purchased from Techne, Inc. (Burlington, NJ) was used for site-directed mutagenesis.

Article Title: Dissecting the evolvability landscape of the CalB active site toward aromatic substrates
Article Snippet: Using the same codon-optimized WT CalB sequence, three previously reported mutants of CalB displaying increased activity to bulky substrates in nonaqueous conditions were also synthesized: S47L, I189A, and double mutant I189A-L278P , , . .. Overexpression of the CalB enzyme from IPTG-inducible vector pET22b+ was tested using 5 different E. coli strains: Rosetta-Gami (DE3), Rosetta (DE3), Rosetta 2 (DE3) PLacI, Origami 2 (DE3), and BL21 (DE3) (MilliporeSigma).

Article Title: RIAM Activates Integrins by Linking Talin to Ras GTPase Membrane-targeting Sequences
Article Snippet: Mammalian expression constructs for HA-mouse full-length talin and its mutant (W359A) constructs were previously reported ( ). .. His-tagged full-length talin was expressed in BL21(DE3) with 0.2 m m isopropyl 1-thio- d -galactopyranoside overnight at room temperature and purified using Ni-NTA His-bind® resin (Novagen) affinity matrix.

Subcloning:

Article Title: A universal strategy for high-yield production of soluble and functional clostridial collagenases in E. coli
Article Snippet: E. coli strain XL1 Blue (Stratagene, La Jolla, USA) was used for subcloning. .. Strains BL21, BL21 DE3, Tuner DE3, Origami DE3, and Rosetta DE3 (Novagen, Madison, USA) were used as host strains for protein expression.

Size-exclusion Chromatography:

Article Title: Optimizing Recombinant Protein Production in the Escherichia coli Periplasm Alleviates Stress
Article Snippet: However, rather than BL21(DE3) transformed with pLemo, Tuner(DE3) (Novagen) transformed with pLemo was used ( ). .. The DsbA signal sequence directs BL1 to the Sec translocon, and the His6 tag enables the detection of both the precursor form and the processed form of the scFv BL1 by means of immunoblotting ( ).

Purification:

Article Title: Impairment of Fas-ligand–caveolin-1 interaction inhibits Fas-ligand translocation to rafts and Fas-ligand-induced cell death
Article Snippet: The Fc-fusion proteins-containing incubation medium was collected, and the proteins were purified according to the manufacturer’s instructions (Ingenius). .. Transformation of BL21(DE3) with the plasmid and recombinant protein purification were carried out according to the manufacturer’s instructions (Novagen).

Article Title: FlgM proteins from different bacteria exhibit different structural characteristics
Article Snippet: Paragraph title: 2.6. Expression and purification of FlgM ... Briefly, each clone was transformed into either BL21(DE3) or ROSETTA™ cells (Novagen) for expression.

Article Title: Hydrogen Peroxide-Based Fluorometric Assay for Real-Time Monitoring of SAM-Dependent Methyltransferases
Article Snippet: Paragraph title: Protein expression and purification ... Overnight LB-grown starter cultures of BL21(DE3) were used to inoculate 50 ml cultures of Overnight Express™ Instant TB Medium (Novagen) at 2% (v/v).

Article Title: Periplasmic superoxide dismutase SodCI of Salmonella binds peptidoglycan to remain tethered within the periplasm
Article Snippet: .. Hybrid SodC proteins, produced from pET21b clones in BL21(DE3), were purified using a nickel affinity resin (HIS-Select Nickel Affinity Gel, Sigma). ..

Article Title: Regulation of the Membrane Insertion and Conductance Activity of the Metamorphic Chloride Intracellular Channel Protein CLIC1 by Cholesterol
Article Snippet: .. Recombinant CLIC1 Protein Expression and Purification Recombinant CLIC1 protein was expressed in the E-coli bacterial strain, BL21(DE3) using the His-tag pET28a vector system (Novagen), as previously described . .. Briefly, transformed cells were grown in 2xYT media at 37 °C in a shaking incubator, with CLIC1 protein expression induced following addition of 1 mM isopropylthio-beta-galactoside (IPTG) at mid-log growth phase.

Article Title: Dissecting the evolvability landscape of the CalB active site toward aromatic substrates
Article Snippet: A C-terminal 6-histidine Tag was designed to facilitate the purification process of all CalB variants. .. Overexpression of the CalB enzyme from IPTG-inducible vector pET22b+ was tested using 5 different E. coli strains: Rosetta-Gami (DE3), Rosetta (DE3), Rosetta 2 (DE3) PLacI, Origami 2 (DE3), and BL21 (DE3) (MilliporeSigma).

Article Title: NusA interaction with the ?-subunit of E. coli RNA Polymerase is via the UP-element site and releases autoinhibition
Article Snippet: E. coli αCTD (residues 233-329) was expressed as a deca-histidine-tagged protein in BL21(DE3) from pET-19b (Novagen) and purified as described previously ( ). .. E. coli NusA-SKK (residues 132-348) was expressed as a penta-histidine-tagged protein in BL21(DE3) from pET-11a (Novagen) as described previously ( ).

Article Title: RIAM Activates Integrins by Linking Talin to Ras GTPase Membrane-targeting Sequences
Article Snippet: .. His-tagged full-length talin was expressed in BL21(DE3) with 0.2 m m isopropyl 1-thio- d -galactopyranoside overnight at room temperature and purified using Ni-NTA His-bind® resin (Novagen) affinity matrix. .. Purified talin was dialyzed overnight in a buffer (50 m m Tris-HCl (pH 7.4), 200 m m NaCl, 0.1% Triton X-100, and 1 m m dithiothreitol).

Protein Purification:

Article Title: Impairment of Fas-ligand–caveolin-1 interaction inhibits Fas-ligand translocation to rafts and Fas-ligand-induced cell death
Article Snippet: .. Transformation of BL21(DE3) with the plasmid and recombinant protein purification were carried out according to the manufacturer’s instructions (Novagen). .. For all constructs, the correct reading frames were confirmed by DNA sequencing.

Polymerase Chain Reaction:

Article Title: Development of an efficient RNA interference method by feeding for the microcrustacean Daphnia
Article Snippet: This vector allows cloning of PCR products between two T7 promoters in opposite orientations. .. The following two bacterial strains harboring λDE3 lysogen (a source of T7 RNA polymerase) were used for generating dsRNA from the recombinant plasmids: BL21(DE3): ompT hsdSB (rB -mB -) gal dcm (Novagen) - a strain deficient in lon and ompT proteases and used for efficient production of recombinant proteins.

Article Title: Impairment of Fas-ligand–caveolin-1 interaction inhibits Fas-ligand translocation to rafts and Fas-ligand-induced cell death
Article Snippet: For producing GST-fusion proteins, PCR-fragments of N- (1–101 aa) and C-terminal (135–178 aa) domains of caveolin-1 were cloned into pET42b (Novagen). .. Transformation of BL21(DE3) with the plasmid and recombinant protein purification were carried out according to the manufacturer’s instructions (Novagen).

Positron Emission Tomography:

Article Title: Calcium/Calmodulin Stimulates the Autophosphorylation of Elongation Factor 2 Kinase on Thr-348 and Ser-500 to Regulate its Activity and Calcium Dependence
Article Snippet: Escherichia coli strain NovaBlue – for cloning – and BL21(DE3) and Rosetta-gami™ 2(DE3) – for recombinant protein expression – were from Novagen, EMD4Biosciences (Gibbstown, NJ). .. The pET-32a vector was obtained from Novagen.

Article Title: NusA interaction with the ?-subunit of E. coli RNA Polymerase is via the UP-element site and releases autoinhibition
Article Snippet: .. E. coli NusA-SKK (residues 132-348) was expressed as a penta-histidine-tagged protein in BL21(DE3) from pET-11a (Novagen) as described previously ( ). .. Briefly, strains carrying these constructs were grown in M9 minimal medium supplemented with 15 NH4 Cl and 0.2% 13 C D-glucose as the sole nitrogen and carbon sources, respectively ( ).

Affinity Column:

Article Title: Periplasmic superoxide dismutase SodCI of Salmonella binds peptidoglycan to remain tethered within the periplasm
Article Snippet: Hybrid SodC proteins, produced from pET21b clones in BL21(DE3), were purified using a nickel affinity resin (HIS-Select Nickel Affinity Gel, Sigma). .. The resulting extract was loaded onto a nickel affinity column and the column was washed with KPi buffer, pH 7.8.

Chromatin Immunoprecipitation:

Article Title: A new versatile immobilization tag based on the ultra high affinity and reversibility of the calmodulin-calmodulin binding peptide interaction
Article Snippet: NTA chip, Resource S 1ml column and HiTrap MabSelect SuRe 5 ml column are from GE Healthcare Life Sciences. .. E. coli DH5α and XL1-Blue cells are from Agilent Life Sciences and BL21, BL21(DE3), Tuner(DE3) are from Novagen.

SDS Page:

Article Title: RIAM Activates Integrins by Linking Talin to Ras GTPase Membrane-targeting Sequences
Article Snippet: His-tagged full-length talin was expressed in BL21(DE3) with 0.2 m m isopropyl 1-thio- d -galactopyranoside overnight at room temperature and purified using Ni-NTA His-bind® resin (Novagen) affinity matrix. .. 10 μg of purified GST fusion RIAM proteins on affinity matrix was mixed with 20 μg of His-tagged talin and incubated at 4 °C for 1 h. After washing the beads with reaction buffer, samples were fractionated on 4–20% SDS-PAGE gel (Invitrogen).

Plasmid Preparation:

Article Title: Development of an efficient RNA interference method by feeding for the microcrustacean Daphnia
Article Snippet: This vector allows cloning of PCR products between two T7 promoters in opposite orientations. .. The following two bacterial strains harboring λDE3 lysogen (a source of T7 RNA polymerase) were used for generating dsRNA from the recombinant plasmids: BL21(DE3): ompT hsdSB (rB -mB -) gal dcm (Novagen) - a strain deficient in lon and ompT proteases and used for efficient production of recombinant proteins.

Article Title: Impairment of Fas-ligand–caveolin-1 interaction inhibits Fas-ligand translocation to rafts and Fas-ligand-induced cell death
Article Snippet: .. Transformation of BL21(DE3) with the plasmid and recombinant protein purification were carried out according to the manufacturer’s instructions (Novagen). .. For all constructs, the correct reading frames were confirmed by DNA sequencing.

Article Title: Regulation of the Membrane Insertion and Conductance Activity of the Metamorphic Chloride Intracellular Channel Protein CLIC1 by Cholesterol
Article Snippet: .. Recombinant CLIC1 Protein Expression and Purification Recombinant CLIC1 protein was expressed in the E-coli bacterial strain, BL21(DE3) using the His-tag pET28a vector system (Novagen), as previously described . .. Briefly, transformed cells were grown in 2xYT media at 37 °C in a shaking incubator, with CLIC1 protein expression induced following addition of 1 mM isopropylthio-beta-galactoside (IPTG) at mid-log growth phase.

Article Title: Calcium/Calmodulin Stimulates the Autophosphorylation of Elongation Factor 2 Kinase on Thr-348 and Ser-500 to Regulate its Activity and Calcium Dependence
Article Snippet: Escherichia coli strain NovaBlue – for cloning – and BL21(DE3) and Rosetta-gami™ 2(DE3) – for recombinant protein expression – were from Novagen, EMD4Biosciences (Gibbstown, NJ). .. The pET-32a vector was obtained from Novagen.

Article Title: Dissecting the evolvability landscape of the CalB active site toward aromatic substrates
Article Snippet: .. Overexpression of the CalB enzyme from IPTG-inducible vector pET22b+ was tested using 5 different E. coli strains: Rosetta-Gami (DE3), Rosetta (DE3), Rosetta 2 (DE3) PLacI, Origami 2 (DE3), and BL21 (DE3) (MilliporeSigma). .. The selection markers employed were a combination of kanamycin and chloramphenicol (Rosetta-Gami (DE3)), chloramphenicol (Rosetta (DE3) and Rosetta 2 ((DE3)-PLacI), and streptomycin (Origami 2 (DE3)).

Article Title: Bacterial expression strategies for several Sus scrofa diacylglycerol kinase alpha constructs: solubility challenges
Article Snippet: .. Protein expression The BL21(DE3) or Rosetta™(DE3) (Novagen®) strains of E. coli were transformed with the plasmid(s) of interest, and successful transformants were selected on Luria Bertani (LB) agar (1.5% (w/v)) with the appropriate antibiotic (kanamycin (30 μg/mL) for pT71myc and pET28-HisMBP-FLAGpp, chloramphenicol (35 μg/mL) for the chaperones, and carbenicillin (100 μg/mL) for pGEX-4T2 and pET32a). ..

Article Title: RIAM Activates Integrins by Linking Talin to Ras GTPase Membrane-targeting Sequences
Article Snippet: In Vitro Protein Interaction Assay —Bacterial expression plasmids encoding glutathione S -transferase (GST)-RIAM, GST-Lpd, their mutants, or GST vector were expressed in BL21(DE3) (Novagen, Madison, WI), and recombinant proteins were purified on glutathione-Sepharose beads according to manufacturer's instructions (GE Healthcare). .. His-tagged full-length talin was expressed in BL21(DE3) with 0.2 m m isopropyl 1-thio- d -galactopyranoside overnight at room temperature and purified using Ni-NTA His-bind® resin (Novagen) affinity matrix.

Functional Assay:

Article Title: Directed Evolution of a Highly Specific FN3 Monobody to the SH3 Domain of Human Lyn Tyrosine Kinase
Article Snippet: Bacterial strains, plasmids, and phagemids The BL21-DE3 (fhuA2 [lon] ompT gal (λ DE3) [dcm] ΔhsdS ) and C41-DE3 (F–ompT hsdSB (rB - mB - ) gal dcm (DE3)) strains of E . coli were purchased from Novagen (Madison, WI) and Lucigen (Middleton, WI), respectively. .. CJ236 bacterial cells (FΔ(HindIII) ::cat (Tra+ Pil+ CamR )/ ung-1 relA1 dut-1 thi-1 spoT1 mcrA ) from New England BioLabs (Ipswich, MA), which lack functional dUTPase and uracil-N glycosylase, were used for generating single-stranded DNA (ssDNA) template that contained uracil inserted in the place of thymine residues.

Selection:

Article Title: Dissecting the evolvability landscape of the CalB active site toward aromatic substrates
Article Snippet: Overexpression of the CalB enzyme from IPTG-inducible vector pET22b+ was tested using 5 different E. coli strains: Rosetta-Gami (DE3), Rosetta (DE3), Rosetta 2 (DE3) PLacI, Origami 2 (DE3), and BL21 (DE3) (MilliporeSigma). .. The selection markers employed were a combination of kanamycin and chloramphenicol (Rosetta-Gami (DE3)), chloramphenicol (Rosetta (DE3) and Rosetta 2 ((DE3)-PLacI), and streptomycin (Origami 2 (DE3)).

In Vitro:

Article Title: RIAM Activates Integrins by Linking Talin to Ras GTPase Membrane-targeting Sequences
Article Snippet: In Vitro Protein Interaction Assay —Bacterial expression plasmids encoding glutathione S -transferase (GST)-RIAM, GST-Lpd, their mutants, or GST vector were expressed in BL21(DE3) (Novagen, Madison, WI), and recombinant proteins were purified on glutathione-Sepharose beads according to manufacturer's instructions (GE Healthcare). .. His-tagged full-length talin was expressed in BL21(DE3) with 0.2 m m isopropyl 1-thio- d -galactopyranoside overnight at room temperature and purified using Ni-NTA His-bind® resin (Novagen) affinity matrix.

Nuclear Magnetic Resonance:

Article Title: NusA interaction with the ?-subunit of E. coli RNA Polymerase is via the UP-element site and releases autoinhibition
Article Snippet: E. coli NusA-SKK (residues 132-348) was expressed as a penta-histidine-tagged protein in BL21(DE3) from pET-11a (Novagen) as described previously ( ). .. To improve the resolution and sensitivity of the NMR spectra, deuterated M9 minimal medium supplemented with 15 NH4 Cl and 0.2% 13 C D-glucose has been used for NusA-SKK.

Produced:

Article Title: Impairment of Fas-ligand–caveolin-1 interaction inhibits Fas-ligand translocation to rafts and Fas-ligand-induced cell death
Article Snippet: Caveolin-1 and DcR3 cDNAs were produced by RT-PCR with total mRNA of HeLa cells and cloned into the Signal pIg plus (Ingenius). .. Transformation of BL21(DE3) with the plasmid and recombinant protein purification were carried out according to the manufacturer’s instructions (Novagen).

Article Title: Periplasmic superoxide dismutase SodCI of Salmonella binds peptidoglycan to remain tethered within the periplasm
Article Snippet: .. Hybrid SodC proteins, produced from pET21b clones in BL21(DE3), were purified using a nickel affinity resin (HIS-Select Nickel Affinity Gel, Sigma). ..

Marker:

Article Title: Dissecting the evolvability landscape of the CalB active site toward aromatic substrates
Article Snippet: Overexpression of the CalB enzyme from IPTG-inducible vector pET22b+ was tested using 5 different E. coli strains: Rosetta-Gami (DE3), Rosetta (DE3), Rosetta 2 (DE3) PLacI, Origami 2 (DE3), and BL21 (DE3) (MilliporeSigma). .. Carbenicillin was used as resistance marker for expression vector pET22b+, which was electro-transformed into each strain using 0.1-cm Gene Pulser/MicroPulser electroporation cuvettes (Bio-Rad) and an ECM 630 electroporator (BTX Harvard Apparatus).

Lysis:

Article Title: Hydrogen Peroxide-Based Fluorometric Assay for Real-Time Monitoring of SAM-Dependent Methyltransferases
Article Snippet: Overnight LB-grown starter cultures of BL21(DE3) were used to inoculate 50 ml cultures of Overnight Express™ Instant TB Medium (Novagen) at 2% (v/v). .. After overnight incubation (18–24 h, 28°C, 180 rpm), cells were pelleted and resuspended in a lysis buffer containing 50 mM Tris-HCl (pH 7.5), lysozyme (2 mg/ml), and 2% (v/v) hexane, and incubated for 30 min at room temperature with gentle inversion.

Fast Protein Liquid Chromatography:

Article Title: Calcium/Calmodulin Stimulates the Autophosphorylation of Elongation Factor 2 Kinase on Thr-348 and Ser-500 to Regulate its Activity and Calcium Dependence
Article Snippet: Escherichia coli strain NovaBlue – for cloning – and BL21(DE3) and Rosetta-gami™ 2(DE3) – for recombinant protein expression – were from Novagen, EMD4Biosciences (Gibbstown, NJ). .. The ÄKTA FPLC™ System and the HiPrep™ 26/60 Sephacryl™ S-200 HR gel filtration column were from Amersham Biosciences / GE Healthcare Life Sciences (Piscataway, NJ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    The CONTROLLER BL21 DE3 Chemically Competent Cells are an E coli strain optimized for high efficiency transformation They are ideal for cloning and propagation of plasmid clones They give high
      Buy from Supplier

    85
    Millipore lsrb bl21 ∆ luxs protein
    Binding of <t>LsrB</t> to endogenous AI-2. Purified LsrB (BL21) and LsrB <t>(BL21∆luxS)</t> proteins (5 mg/ml) were incubated for 10 min at 37, 50 and 60 °C to release endogenous AI-2, respectively. After incubation, the LsrB proteins were removed by ultrafiltration (10,000-Da cut-off; EMD Millipore), and the filtered reaction products were tested for AI-2 activity using a V. harveyi BB170 bioassay. The extent of LsrB binding to endogenous AI-2 was evaluated using an AI-2 assay, which showed that recombinant LsrB (BL21) bound to endogenous AI-2 (produced by wild-type strain BL21) and was released from LsrB (BL21) at 50 or 60 °C, respectively ( a ). However, since the luxS mutant BL21∆luxS did not produce endogenous AI-2, no AI-2 could be released from the recombinant LsrB (BL21∆luxS) ( b ). Moreover, the recombinant LuxS protein, which was expressed in strain BL21 (pColdTF-lsrB) as a negative control, also showed no AI-2 binding activity ( c ). AI-2 (10 μM) was used as a positive control
    Lsrb Bl21 ∆ Luxs Protein, supplied by Millipore, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lsrb bl21 ∆ luxs protein/product/Millipore
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    lsrb bl21 ∆ luxs protein - by Bioz Stars, 2020-02
    85/100 stars
      Buy from Supplier

    82
    Millipore bl21 ∆ luxs
    Construction and identification of luxS mutant strain <t>BL21∆luxS</t>
    Bl21 ∆ Luxs, supplied by Millipore, used in various techniques. Bioz Stars score: 82/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 ∆ luxs/product/Millipore
    Average 82 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    bl21 ∆ luxs - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    77
    Millipore buffer a bl21 pes2i pellets
    SDS-PAGE analysis of purified protein . Shown are the CaroS2K (A) and CaroS2I (B). Samples were subjected to electrophoresis in 10% polyacrylamide gels, which were stained with Coomassie blue. Lane M, molecular weight standards (kDa); lane 1, cell lysate of E. coli <t>BL21/pET32a;</t> lane 4, cell lysate of BL21/pET30b; lanes 2 and 5, IPTG-induced cell lysates of BL21/pES2kI and <t>BL21/pES2I,</t> respectively; lanes 3 and 6, purified protein obtained after elution. The arrowheads indicate the killing protein of carocin S2K (A) and the immunity protein of carocin S2I (B).
    Buffer A Bl21 Pes2i Pellets, supplied by Millipore, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/buffer a bl21 pes2i pellets/product/Millipore
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    buffer a bl21 pes2i pellets - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    Image Search Results


    Binding of LsrB to endogenous AI-2. Purified LsrB (BL21) and LsrB (BL21∆luxS) proteins (5 mg/ml) were incubated for 10 min at 37, 50 and 60 °C to release endogenous AI-2, respectively. After incubation, the LsrB proteins were removed by ultrafiltration (10,000-Da cut-off; EMD Millipore), and the filtered reaction products were tested for AI-2 activity using a V. harveyi BB170 bioassay. The extent of LsrB binding to endogenous AI-2 was evaluated using an AI-2 assay, which showed that recombinant LsrB (BL21) bound to endogenous AI-2 (produced by wild-type strain BL21) and was released from LsrB (BL21) at 50 or 60 °C, respectively ( a ). However, since the luxS mutant BL21∆luxS did not produce endogenous AI-2, no AI-2 could be released from the recombinant LsrB (BL21∆luxS) ( b ). Moreover, the recombinant LuxS protein, which was expressed in strain BL21 (pColdTF-lsrB) as a negative control, also showed no AI-2 binding activity ( c ). AI-2 (10 μM) was used as a positive control

    Journal: AMB Express

    Article Title: LsrB-based and temperature-dependent identification of bacterial AI-2 receptor

    doi: 10.1186/s13568-017-0486-y

    Figure Lengend Snippet: Binding of LsrB to endogenous AI-2. Purified LsrB (BL21) and LsrB (BL21∆luxS) proteins (5 mg/ml) were incubated for 10 min at 37, 50 and 60 °C to release endogenous AI-2, respectively. After incubation, the LsrB proteins were removed by ultrafiltration (10,000-Da cut-off; EMD Millipore), and the filtered reaction products were tested for AI-2 activity using a V. harveyi BB170 bioassay. The extent of LsrB binding to endogenous AI-2 was evaluated using an AI-2 assay, which showed that recombinant LsrB (BL21) bound to endogenous AI-2 (produced by wild-type strain BL21) and was released from LsrB (BL21) at 50 or 60 °C, respectively ( a ). However, since the luxS mutant BL21∆luxS did not produce endogenous AI-2, no AI-2 could be released from the recombinant LsrB (BL21∆luxS) ( b ). Moreover, the recombinant LuxS protein, which was expressed in strain BL21 (pColdTF-lsrB) as a negative control, also showed no AI-2 binding activity ( c ). AI-2 (10 μM) was used as a positive control

    Article Snippet: After incubation, the LsrB (BL21∆luxS) protein was removed by ultrafiltration (10,000-Da cut-off, EMD Millipore) and the filtered reaction products were tested for AI-2 activity by investigating the binding activity of LsrB (BL21∆luxS) to exogenous AI-2.

    Techniques: Binding Assay, Purification, Incubation, Activity Assay, Recombinant, Produced, Mutagenesis, Negative Control, Positive Control

    Schematic chart of strategy for binding of LsrB to endogenous AI-2 or exogenous AI-2. The extent of LsrB binding to endogenous AI-2 was evaluated using an AI-2 assay, which showed that recombinant LsrB (BL21) bound to endogenous AI-2 (produced by wild-type strain BL21) and was released from LsrB (BL21) at 50 or 60 °C. However, since the luxS mutant BL21∆luxS did not produce endogenous AI-2, no AI-2 could be released from the recombinant LsrB (BL21∆luxS). The combination of endogenous AI-2 produced by BL21 (DE3), which is known to interfere with the binding of AI-2 to LsrB (BL21), resulted in the loss in the ability of LsrB (BL21) to bind to exogenous AI-2. Hence, the BL21 (DE3) luxS mutant, which was incapable of producing endogenous AI-2, but could bind to exogenous AI-2

    Journal: AMB Express

    Article Title: LsrB-based and temperature-dependent identification of bacterial AI-2 receptor

    doi: 10.1186/s13568-017-0486-y

    Figure Lengend Snippet: Schematic chart of strategy for binding of LsrB to endogenous AI-2 or exogenous AI-2. The extent of LsrB binding to endogenous AI-2 was evaluated using an AI-2 assay, which showed that recombinant LsrB (BL21) bound to endogenous AI-2 (produced by wild-type strain BL21) and was released from LsrB (BL21) at 50 or 60 °C. However, since the luxS mutant BL21∆luxS did not produce endogenous AI-2, no AI-2 could be released from the recombinant LsrB (BL21∆luxS). The combination of endogenous AI-2 produced by BL21 (DE3), which is known to interfere with the binding of AI-2 to LsrB (BL21), resulted in the loss in the ability of LsrB (BL21) to bind to exogenous AI-2. Hence, the BL21 (DE3) luxS mutant, which was incapable of producing endogenous AI-2, but could bind to exogenous AI-2

    Article Snippet: After incubation, the LsrB (BL21∆luxS) protein was removed by ultrafiltration (10,000-Da cut-off, EMD Millipore) and the filtered reaction products were tested for AI-2 activity by investigating the binding activity of LsrB (BL21∆luxS) to exogenous AI-2.

    Techniques: Binding Assay, Recombinant, Produced, Mutagenesis

    SDS-PAGE analysis of total cellular proteins and purified fusion proteins from BL21∆luxS cells. Lane 1 and lane 5: SDS-PAGE analysis of total cellular proteins from BL21∆luxS containing pCold TF (serve as negative control). Lane 2 and lane 6: SDS-PAGE analysis of total cellular proteins containing expression plasmids pCold-TF-lsrB ( a ) and pCold-TF-luxS ( b ), respectively. Lane 3 and lane 7: SDS-PAGE analysis of total precipitation proteins containing expression plasmids pCold-TF-lsrB and pCold-TF-luxS, respectively. Lane 4 and lane 8: elution of the LsrB and LuxS purified fusion protein from the affinity column, respectively

    Journal: AMB Express

    Article Title: LsrB-based and temperature-dependent identification of bacterial AI-2 receptor

    doi: 10.1186/s13568-017-0486-y

    Figure Lengend Snippet: SDS-PAGE analysis of total cellular proteins and purified fusion proteins from BL21∆luxS cells. Lane 1 and lane 5: SDS-PAGE analysis of total cellular proteins from BL21∆luxS containing pCold TF (serve as negative control). Lane 2 and lane 6: SDS-PAGE analysis of total cellular proteins containing expression plasmids pCold-TF-lsrB ( a ) and pCold-TF-luxS ( b ), respectively. Lane 3 and lane 7: SDS-PAGE analysis of total precipitation proteins containing expression plasmids pCold-TF-lsrB and pCold-TF-luxS, respectively. Lane 4 and lane 8: elution of the LsrB and LuxS purified fusion protein from the affinity column, respectively

    Article Snippet: After incubation, the LsrB (BL21∆luxS) protein was removed by ultrafiltration (10,000-Da cut-off, EMD Millipore) and the filtered reaction products were tested for AI-2 activity by investigating the binding activity of LsrB (BL21∆luxS) to exogenous AI-2.

    Techniques: SDS Page, Purification, Negative Control, Expressing, Affinity Column

    Construction and identification of luxS mutant strain BL21∆luxS

    Journal: AMB Express

    Article Title: LsrB-based and temperature-dependent identification of bacterial AI-2 receptor

    doi: 10.1186/s13568-017-0486-y

    Figure Lengend Snippet: Construction and identification of luxS mutant strain BL21∆luxS

    Article Snippet: Cell-free culture fluid (CF) was prepared as follows: E. coli strains BL21 (DE3), BL21∆luxS and DH5a were grown in LB at 37 °C, and then pelleted by centrifugation at 12,000 g at 4 °C for 10 min. Then, the resulting supernatants were filtered through a 0.22-μm filter (EMD Millipore, Bedford, MA, USA) to obtain CF samples.

    Techniques: Mutagenesis

    The AI-2 activity in BL21∆luxS. The wild strain BL21 secretes AI-2-like molecules, and can induce V . harveyi BB170 bioluminescence, whereas no bioluminescence induction was observed for the mutant BL21∆ luxS . V . harveyi BB152 served as

    Journal: AMB Express

    Article Title: LsrB-based and temperature-dependent identification of bacterial AI-2 receptor

    doi: 10.1186/s13568-017-0486-y

    Figure Lengend Snippet: The AI-2 activity in BL21∆luxS. The wild strain BL21 secretes AI-2-like molecules, and can induce V . harveyi BB170 bioluminescence, whereas no bioluminescence induction was observed for the mutant BL21∆ luxS . V . harveyi BB152 served as

    Article Snippet: Cell-free culture fluid (CF) was prepared as follows: E. coli strains BL21 (DE3), BL21∆luxS and DH5a were grown in LB at 37 °C, and then pelleted by centrifugation at 12,000 g at 4 °C for 10 min. Then, the resulting supernatants were filtered through a 0.22-μm filter (EMD Millipore, Bedford, MA, USA) to obtain CF samples.

    Techniques: Activity Assay, Mutagenesis

    SDS-PAGE analysis of total cellular proteins and purified fusion proteins from BL21∆luxS cells. Lane 1 and lane 5: SDS-PAGE analysis of total cellular proteins from BL21∆luxS containing pCold TF (serve as negative control). Lane 2 and

    Journal: AMB Express

    Article Title: LsrB-based and temperature-dependent identification of bacterial AI-2 receptor

    doi: 10.1186/s13568-017-0486-y

    Figure Lengend Snippet: SDS-PAGE analysis of total cellular proteins and purified fusion proteins from BL21∆luxS cells. Lane 1 and lane 5: SDS-PAGE analysis of total cellular proteins from BL21∆luxS containing pCold TF (serve as negative control). Lane 2 and

    Article Snippet: Cell-free culture fluid (CF) was prepared as follows: E. coli strains BL21 (DE3), BL21∆luxS and DH5a were grown in LB at 37 °C, and then pelleted by centrifugation at 12,000 g at 4 °C for 10 min. Then, the resulting supernatants were filtered through a 0.22-μm filter (EMD Millipore, Bedford, MA, USA) to obtain CF samples.

    Techniques: SDS Page, Purification, Negative Control

    Binding of LsrB to endogenous AI-2. Purified LsrB (BL21) and LsrB (BL21∆luxS) proteins (5 mg/ml) were incubated for 10 min at 37, 50 and 60 °C to release endogenous AI-2, respectively. After incubation, the LsrB proteins were removed by ultrafiltration (10,000-Da cut-off; EMD Millipore), and the filtered reaction products were tested for AI-2 activity using a V. harveyi BB170 bioassay. The extent of LsrB binding to endogenous AI-2 was evaluated using an AI-2 assay, which showed that recombinant LsrB (BL21) bound to endogenous AI-2 (produced by wild-type strain BL21) and was released from LsrB (BL21) at 50 or 60 °C, respectively ( a ). However, since the luxS mutant BL21∆luxS did not produce endogenous AI-2, no AI-2 could be released from the recombinant LsrB (BL21∆luxS) ( b ). Moreover, the recombinant LuxS protein, which was expressed in strain BL21 (pColdTF-lsrB) as a negative control, also showed no AI-2 binding activity ( c ). AI-2 (10 μM) was used as a positive control

    Journal: AMB Express

    Article Title: LsrB-based and temperature-dependent identification of bacterial AI-2 receptor

    doi: 10.1186/s13568-017-0486-y

    Figure Lengend Snippet: Binding of LsrB to endogenous AI-2. Purified LsrB (BL21) and LsrB (BL21∆luxS) proteins (5 mg/ml) were incubated for 10 min at 37, 50 and 60 °C to release endogenous AI-2, respectively. After incubation, the LsrB proteins were removed by ultrafiltration (10,000-Da cut-off; EMD Millipore), and the filtered reaction products were tested for AI-2 activity using a V. harveyi BB170 bioassay. The extent of LsrB binding to endogenous AI-2 was evaluated using an AI-2 assay, which showed that recombinant LsrB (BL21) bound to endogenous AI-2 (produced by wild-type strain BL21) and was released from LsrB (BL21) at 50 or 60 °C, respectively ( a ). However, since the luxS mutant BL21∆luxS did not produce endogenous AI-2, no AI-2 could be released from the recombinant LsrB (BL21∆luxS) ( b ). Moreover, the recombinant LuxS protein, which was expressed in strain BL21 (pColdTF-lsrB) as a negative control, also showed no AI-2 binding activity ( c ). AI-2 (10 μM) was used as a positive control

    Article Snippet: Cell-free culture fluid (CF) was prepared as follows: E. coli strains BL21 (DE3), BL21∆luxS and DH5a were grown in LB at 37 °C, and then pelleted by centrifugation at 12,000g at 4 °C for 10 min. Then, the resulting supernatants were filtered through a 0.22-μm filter (EMD Millipore, Bedford, MA, USA) to obtain CF samples.

    Techniques: Binding Assay, Purification, Incubation, Activity Assay, Recombinant, Produced, Mutagenesis, Negative Control, Positive Control

    Schematic chart of strategy for binding of LsrB to endogenous AI-2 or exogenous AI-2. The extent of LsrB binding to endogenous AI-2 was evaluated using an AI-2 assay, which showed that recombinant LsrB (BL21) bound to endogenous AI-2 (produced by wild-type strain BL21) and was released from LsrB (BL21) at 50 or 60 °C. However, since the luxS mutant BL21∆luxS did not produce endogenous AI-2, no AI-2 could be released from the recombinant LsrB (BL21∆luxS). The combination of endogenous AI-2 produced by BL21 (DE3), which is known to interfere with the binding of AI-2 to LsrB (BL21), resulted in the loss in the ability of LsrB (BL21) to bind to exogenous AI-2. Hence, the BL21 (DE3) luxS mutant, which was incapable of producing endogenous AI-2, but could bind to exogenous AI-2

    Journal: AMB Express

    Article Title: LsrB-based and temperature-dependent identification of bacterial AI-2 receptor

    doi: 10.1186/s13568-017-0486-y

    Figure Lengend Snippet: Schematic chart of strategy for binding of LsrB to endogenous AI-2 or exogenous AI-2. The extent of LsrB binding to endogenous AI-2 was evaluated using an AI-2 assay, which showed that recombinant LsrB (BL21) bound to endogenous AI-2 (produced by wild-type strain BL21) and was released from LsrB (BL21) at 50 or 60 °C. However, since the luxS mutant BL21∆luxS did not produce endogenous AI-2, no AI-2 could be released from the recombinant LsrB (BL21∆luxS). The combination of endogenous AI-2 produced by BL21 (DE3), which is known to interfere with the binding of AI-2 to LsrB (BL21), resulted in the loss in the ability of LsrB (BL21) to bind to exogenous AI-2. Hence, the BL21 (DE3) luxS mutant, which was incapable of producing endogenous AI-2, but could bind to exogenous AI-2

    Article Snippet: Cell-free culture fluid (CF) was prepared as follows: E. coli strains BL21 (DE3), BL21∆luxS and DH5a were grown in LB at 37 °C, and then pelleted by centrifugation at 12,000g at 4 °C for 10 min. Then, the resulting supernatants were filtered through a 0.22-μm filter (EMD Millipore, Bedford, MA, USA) to obtain CF samples.

    Techniques: Binding Assay, Recombinant, Produced, Mutagenesis

    The AI-2 activity in BL21∆luxS. The wild strain BL21 secretes AI-2-like molecules, and can induce V . harveyi BB170 bioluminescence, whereas no bioluminescence induction was observed for the mutant BL21∆ luxS . V . harveyi BB152 served as a positive control and E. coli DH5α as a negative control. The figure represents the means of the results from three independent experiments. The error bars indicate standard deviations

    Journal: AMB Express

    Article Title: LsrB-based and temperature-dependent identification of bacterial AI-2 receptor

    doi: 10.1186/s13568-017-0486-y

    Figure Lengend Snippet: The AI-2 activity in BL21∆luxS. The wild strain BL21 secretes AI-2-like molecules, and can induce V . harveyi BB170 bioluminescence, whereas no bioluminescence induction was observed for the mutant BL21∆ luxS . V . harveyi BB152 served as a positive control and E. coli DH5α as a negative control. The figure represents the means of the results from three independent experiments. The error bars indicate standard deviations

    Article Snippet: Cell-free culture fluid (CF) was prepared as follows: E. coli strains BL21 (DE3), BL21∆luxS and DH5a were grown in LB at 37 °C, and then pelleted by centrifugation at 12,000g at 4 °C for 10 min. Then, the resulting supernatants were filtered through a 0.22-μm filter (EMD Millipore, Bedford, MA, USA) to obtain CF samples.

    Techniques: Activity Assay, Mutagenesis, Positive Control, Negative Control

    SDS-PAGE analysis of total cellular proteins and purified fusion proteins from BL21∆luxS cells. Lane 1 and lane 5: SDS-PAGE analysis of total cellular proteins from BL21∆luxS containing pCold TF (serve as negative control). Lane 2 and lane 6: SDS-PAGE analysis of total cellular proteins containing expression plasmids pCold-TF-lsrB ( a ) and pCold-TF-luxS ( b ), respectively. Lane 3 and lane 7: SDS-PAGE analysis of total precipitation proteins containing expression plasmids pCold-TF-lsrB and pCold-TF-luxS, respectively. Lane 4 and lane 8: elution of the LsrB and LuxS purified fusion protein from the affinity column, respectively

    Journal: AMB Express

    Article Title: LsrB-based and temperature-dependent identification of bacterial AI-2 receptor

    doi: 10.1186/s13568-017-0486-y

    Figure Lengend Snippet: SDS-PAGE analysis of total cellular proteins and purified fusion proteins from BL21∆luxS cells. Lane 1 and lane 5: SDS-PAGE analysis of total cellular proteins from BL21∆luxS containing pCold TF (serve as negative control). Lane 2 and lane 6: SDS-PAGE analysis of total cellular proteins containing expression plasmids pCold-TF-lsrB ( a ) and pCold-TF-luxS ( b ), respectively. Lane 3 and lane 7: SDS-PAGE analysis of total precipitation proteins containing expression plasmids pCold-TF-lsrB and pCold-TF-luxS, respectively. Lane 4 and lane 8: elution of the LsrB and LuxS purified fusion protein from the affinity column, respectively

    Article Snippet: Cell-free culture fluid (CF) was prepared as follows: E. coli strains BL21 (DE3), BL21∆luxS and DH5a were grown in LB at 37 °C, and then pelleted by centrifugation at 12,000g at 4 °C for 10 min. Then, the resulting supernatants were filtered through a 0.22-μm filter (EMD Millipore, Bedford, MA, USA) to obtain CF samples.

    Techniques: SDS Page, Purification, Negative Control, Expressing, Affinity Column

    SDS-PAGE analysis of purified protein . Shown are the CaroS2K (A) and CaroS2I (B). Samples were subjected to electrophoresis in 10% polyacrylamide gels, which were stained with Coomassie blue. Lane M, molecular weight standards (kDa); lane 1, cell lysate of E. coli BL21/pET32a; lane 4, cell lysate of BL21/pET30b; lanes 2 and 5, IPTG-induced cell lysates of BL21/pES2kI and BL21/pES2I, respectively; lanes 3 and 6, purified protein obtained after elution. The arrowheads indicate the killing protein of carocin S2K (A) and the immunity protein of carocin S2I (B).

    Journal: BMC Microbiology

    Article Title: Cloning, purification, and functional characterization of Carocin S2, a ribonuclease bacteriocin produced by Pectobacterium carotovorum

    doi: 10.1186/1471-2180-11-99

    Figure Lengend Snippet: SDS-PAGE analysis of purified protein . Shown are the CaroS2K (A) and CaroS2I (B). Samples were subjected to electrophoresis in 10% polyacrylamide gels, which were stained with Coomassie blue. Lane M, molecular weight standards (kDa); lane 1, cell lysate of E. coli BL21/pET32a; lane 4, cell lysate of BL21/pET30b; lanes 2 and 5, IPTG-induced cell lysates of BL21/pES2kI and BL21/pES2I, respectively; lanes 3 and 6, purified protein obtained after elution. The arrowheads indicate the killing protein of carocin S2K (A) and the immunity protein of carocin S2I (B).

    Article Snippet: After purification through a P-100 size-exclusion column (BioRad, USA), the CaroS2K fractions were pooled and concentrated using an Amicon centriprep-50 column (Millipore, USA) and dissolved in buffer A. BL21/pES2I pellets were precipitated by ammonium sulfate (70-100%) and resuspended in buffer A. CaroS2I purification involved a similar chromatographic procedure using the Amicon centriprep-3 column (Millipore, USA).

    Techniques: SDS Page, Purification, Electrophoresis, Staining, Molecular Weight