bl21 de3 plyss rosetta  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Millipore bl21 de3 plyss rosetta
    Purification of SXT-Exo and lambda-Exo, and determination of their multimericity by size exclusion chromatography . Panel A : Size exclusion chromatogram of purified SXT-Exo protein expressed from plasmid pEA1-1. Panel B : Size exclusion chromatogram of purified lambda-Exo protein expressed from plasmid pEE4. Panel C : 12% polyacrylamide gel (SDS-PAGE) analysis of the SXT-Exo purification procedure and purified SXT-Bet, SXT-Ssb, lambda-Bet and lambda-Exo proteins; lane 1: Benchmark protein ladder (Invitrogen); lane 2: pEA1-1/ E. coli <t>BL21</t> (DE3) <t>pLysS</t> <t>Rosetta</t> whole cell extract immediately prior to induction; lane 3: whole cell extract 6 hours after induction with IPTG; lane 4: supernatant from cell extract 6 hours post induction; lane 5: purified SXT-Exo; lane 6: purified SXT-Bet expressed from pX28-1; lane 7: purified SXT-Ssb expressed from pSB2; lane 8: purified lambda-Bet expressed from p1DB; lane 9: purified lambda-Exo expressed from pEE4.
    Bl21 De3 Plyss Rosetta, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 de3 plyss rosetta/product/Millipore
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    bl21 de3 plyss rosetta - by Bioz Stars, 2020-04
    92/100 stars

    Related Products / Commonly Used Together

    bl21
    e. coli bl21
    vegf121-pe38-pet28a plasmid

    Images

    1) Product Images from "Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae"

    Article Title: Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-12-16

    Purification of SXT-Exo and lambda-Exo, and determination of their multimericity by size exclusion chromatography . Panel A : Size exclusion chromatogram of purified SXT-Exo protein expressed from plasmid pEA1-1. Panel B : Size exclusion chromatogram of purified lambda-Exo protein expressed from plasmid pEE4. Panel C : 12% polyacrylamide gel (SDS-PAGE) analysis of the SXT-Exo purification procedure and purified SXT-Bet, SXT-Ssb, lambda-Bet and lambda-Exo proteins; lane 1: Benchmark protein ladder (Invitrogen); lane 2: pEA1-1/ E. coli BL21 (DE3) pLysS Rosetta whole cell extract immediately prior to induction; lane 3: whole cell extract 6 hours after induction with IPTG; lane 4: supernatant from cell extract 6 hours post induction; lane 5: purified SXT-Exo; lane 6: purified SXT-Bet expressed from pX28-1; lane 7: purified SXT-Ssb expressed from pSB2; lane 8: purified lambda-Bet expressed from p1DB; lane 9: purified lambda-Exo expressed from pEE4.
    Figure Legend Snippet: Purification of SXT-Exo and lambda-Exo, and determination of their multimericity by size exclusion chromatography . Panel A : Size exclusion chromatogram of purified SXT-Exo protein expressed from plasmid pEA1-1. Panel B : Size exclusion chromatogram of purified lambda-Exo protein expressed from plasmid pEE4. Panel C : 12% polyacrylamide gel (SDS-PAGE) analysis of the SXT-Exo purification procedure and purified SXT-Bet, SXT-Ssb, lambda-Bet and lambda-Exo proteins; lane 1: Benchmark protein ladder (Invitrogen); lane 2: pEA1-1/ E. coli BL21 (DE3) pLysS Rosetta whole cell extract immediately prior to induction; lane 3: whole cell extract 6 hours after induction with IPTG; lane 4: supernatant from cell extract 6 hours post induction; lane 5: purified SXT-Exo; lane 6: purified SXT-Bet expressed from pX28-1; lane 7: purified SXT-Ssb expressed from pSB2; lane 8: purified lambda-Bet expressed from p1DB; lane 9: purified lambda-Exo expressed from pEE4.

    Techniques Used: Purification, Size-exclusion Chromatography, Plasmid Preparation, SDS Page

    Related Articles

    Acetylene Reduction Assay:

    Article Title: Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae
    Article Snippet: All gene targeting, gene cloning and plasmid propagation procedures were performed in E. coli DH10B [Invitrogen, genotype: F- mcr A Δ(mrr -hsd RMS-mcr BC) Φ80lac ZΔM15 Δlac X74 rec A1 end A1 ara D139 Δ(ara leu ) 7697 gal U gal K rps L nup G λ-], incubating plates and liquid cultures at 37°C. .. Protein expression was performed in E. coli BL21 (DE3) or BL21 (DE3) pLysS Rosetta (Novagen); inducing expression by the addition of isopropyl-1-thio-β-D-galactopyranoside (IPTG, USB) to between 0.1 to 0.5 mM; incubating cultures post-induction at 20-37°C.

    Selection:

    Article Title: In Vitro Evaluation of Vegf-Pseudomonas Exotoxin: A Conjugated on Tumor Cells
    Article Snippet: Protein expression in E. coli The VEGF121-PE38-pET28a plasmid was transformed into BL21 (DE3), BL21 (DE3) pLysS Rosetta (Millipore, USA) E. coli strains by CaCl2 method. .. After colony selection, a single colony containing the recombinant expression vector were cultured at 37°C in 2XTY medium (5 ml) containing 50 μg/ml kanamycin.

    Clone Assay:

    Article Title: Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae
    Article Snippet: All gene targeting, gene cloning and plasmid propagation procedures were performed in E. coli DH10B [Invitrogen, genotype: F- mcr A Δ(mrr -hsd RMS-mcr BC) Φ80lac ZΔM15 Δlac X74 rec A1 end A1 ara D139 Δ(ara leu ) 7697 gal U gal K rps L nup G λ-], incubating plates and liquid cultures at 37°C. .. Protein expression was performed in E. coli BL21 (DE3) or BL21 (DE3) pLysS Rosetta (Novagen); inducing expression by the addition of isopropyl-1-thio-β-D-galactopyranoside (IPTG, USB) to between 0.1 to 0.5 mM; incubating cultures post-induction at 20-37°C.

    Cell Culture:

    Article Title: In Vitro Evaluation of Vegf-Pseudomonas Exotoxin: A Conjugated on Tumor Cells
    Article Snippet: Protein expression in E. coli The VEGF121-PE38-pET28a plasmid was transformed into BL21 (DE3), BL21 (DE3) pLysS Rosetta (Millipore, USA) E. coli strains by CaCl2 method. .. After colony selection, a single colony containing the recombinant expression vector were cultured at 37°C in 2XTY medium (5 ml) containing 50 μg/ml kanamycin.

    Incubation:

    Article Title: In Vitro Evaluation of Vegf-Pseudomonas Exotoxin: A Conjugated on Tumor Cells
    Article Snippet: Protein expression in E. coli The VEGF121-PE38-pET28a plasmid was transformed into BL21 (DE3), BL21 (DE3) pLysS Rosetta (Millipore, USA) E. coli strains by CaCl2 method. .. In early log phase (OD = 0.5 at 600 nm), the protein expression was induced by adding 0.3 mM IPTG (Sigma-Aldrich, Germany) and incubated at 37°C overnight.

    Recombinant:

    Article Title: In Vitro Evaluation of Vegf-Pseudomonas Exotoxin: A Conjugated on Tumor Cells
    Article Snippet: Protein expression in E. coli The VEGF121-PE38-pET28a plasmid was transformed into BL21 (DE3), BL21 (DE3) pLysS Rosetta (Millipore, USA) E. coli strains by CaCl2 method. .. After colony selection, a single colony containing the recombinant expression vector were cultured at 37°C in 2XTY medium (5 ml) containing 50 μg/ml kanamycin.

    Construct:

    Article Title: Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae
    Article Snippet: All arabinose-inducible plasmids constructed here are derivatives of pBAD-ETγ (see Additional File ), and contain identical 4503 bp NcoI/HindIII backbone fragments, which houses the ColE1 ori , bla ampicillin resistance gene, araC repressor, PBAD operator/promoter region, and ribosome binding site immediately upstream of the adjacent NcoI and NdeI restriction sites. .. Protein expression was performed in E. coli BL21 (DE3) or BL21 (DE3) pLysS Rosetta (Novagen); inducing expression by the addition of isopropyl-1-thio-β-D-galactopyranoside (IPTG, USB) to between 0.1 to 0.5 mM; incubating cultures post-induction at 20-37°C.

    Expressing:

    Article Title: In Vitro Evaluation of Vegf-Pseudomonas Exotoxin: A Conjugated on Tumor Cells
    Article Snippet: .. Protein expression in E. coli The VEGF121-PE38-pET28a plasmid was transformed into BL21 (DE3), BL21 (DE3) pLysS Rosetta (Millipore, USA) E. coli strains by CaCl2 method. .. After colony selection, a single colony containing the recombinant expression vector were cultured at 37°C in 2XTY medium (5 ml) containing 50 μg/ml kanamycin.

    Article Title: Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae
    Article Snippet: .. Protein expression was performed in E. coli BL21 (DE3) or BL21 (DE3) pLysS Rosetta (Novagen); inducing expression by the addition of isopropyl-1-thio-β-D-galactopyranoside (IPTG, USB) to between 0.1 to 0.5 mM; incubating cultures post-induction at 20-37°C. .. Plasmid construction The SXT-exo (s066) gene [GenBank: AY055428.1 , 73921 - 74937] was PCR amplified from plasmid pJB1, using the Sexofor (TATA CATATG AAGGTTATCGACCTATCAC) and SexoRevX (TTAA CTCGAG TTAAAAATAAAATGAGCTCGGCGA) primers.

    Electroporation:

    Article Title: Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae
    Article Snippet: All oligonucleotides, linear dsDNA and plasmid DNA were transformed into E. coli cells by electroporation using a MicroPulser electroporator with 1 mm gap electroporation cuvettes (BioRad). .. Protein expression was performed in E. coli BL21 (DE3) or BL21 (DE3) pLysS Rosetta (Novagen); inducing expression by the addition of isopropyl-1-thio-β-D-galactopyranoside (IPTG, USB) to between 0.1 to 0.5 mM; incubating cultures post-induction at 20-37°C.

    Transformation Assay:

    Article Title: In Vitro Evaluation of Vegf-Pseudomonas Exotoxin: A Conjugated on Tumor Cells
    Article Snippet: .. Protein expression in E. coli The VEGF121-PE38-pET28a plasmid was transformed into BL21 (DE3), BL21 (DE3) pLysS Rosetta (Millipore, USA) E. coli strains by CaCl2 method. .. After colony selection, a single colony containing the recombinant expression vector were cultured at 37°C in 2XTY medium (5 ml) containing 50 μg/ml kanamycin.

    Article Title: Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae
    Article Snippet: Transformed cells were plated onto Luria-Bertani (LB) agar (USB), and liquid cultures were grown in LB medium (USB); supplementing with kanamycin (Kan, 50 μg/ml, USB), ampicillin (Amp, 50 μg/ml, USB) and/or chloramphenicol (Cm, 30 μg/ml, Sigma) for plasmid maintenance, where appropriate. .. Protein expression was performed in E. coli BL21 (DE3) or BL21 (DE3) pLysS Rosetta (Novagen); inducing expression by the addition of isopropyl-1-thio-β-D-galactopyranoside (IPTG, USB) to between 0.1 to 0.5 mM; incubating cultures post-induction at 20-37°C.

    Binding Assay:

    Article Title: Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae
    Article Snippet: All arabinose-inducible plasmids constructed here are derivatives of pBAD-ETγ (see Additional File ), and contain identical 4503 bp NcoI/HindIII backbone fragments, which houses the ColE1 ori , bla ampicillin resistance gene, araC repressor, PBAD operator/promoter region, and ribosome binding site immediately upstream of the adjacent NcoI and NdeI restriction sites. .. Protein expression was performed in E. coli BL21 (DE3) or BL21 (DE3) pLysS Rosetta (Novagen); inducing expression by the addition of isopropyl-1-thio-β-D-galactopyranoside (IPTG, USB) to between 0.1 to 0.5 mM; incubating cultures post-induction at 20-37°C.

    Plasmid Preparation:

    Article Title: In Vitro Evaluation of Vegf-Pseudomonas Exotoxin: A Conjugated on Tumor Cells
    Article Snippet: .. Protein expression in E. coli The VEGF121-PE38-pET28a plasmid was transformed into BL21 (DE3), BL21 (DE3) pLysS Rosetta (Millipore, USA) E. coli strains by CaCl2 method. .. After colony selection, a single colony containing the recombinant expression vector were cultured at 37°C in 2XTY medium (5 ml) containing 50 μg/ml kanamycin.

    Article Title: Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae
    Article Snippet: Transformed cells were plated onto Luria-Bertani (LB) agar (USB), and liquid cultures were grown in LB medium (USB); supplementing with kanamycin (Kan, 50 μg/ml, USB), ampicillin (Amp, 50 μg/ml, USB) and/or chloramphenicol (Cm, 30 μg/ml, Sigma) for plasmid maintenance, where appropriate. .. Protein expression was performed in E. coli BL21 (DE3) or BL21 (DE3) pLysS Rosetta (Novagen); inducing expression by the addition of isopropyl-1-thio-β-D-galactopyranoside (IPTG, USB) to between 0.1 to 0.5 mM; incubating cultures post-induction at 20-37°C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore bl21
    Bl21, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 62 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21/product/Millipore
    Average 99 stars, based on 62 article reviews
    Price from $9.99 to $1999.99
    bl21 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    94
    Millipore rosetta bl21
    Rosetta Bl21, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rosetta bl21/product/Millipore
    Average 94 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    rosetta bl21 - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    92
    Millipore bl21 de3 plyss rosetta
    Bl21 De3 Plyss Rosetta, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 de3 plyss rosetta/product/Millipore
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    bl21 de3 plyss rosetta - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    Image Search Results