biotin binding streptavidin agarose beads  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Millipore biotin binding streptavidin agarose beads
    Biotin Binding Streptavidin Agarose Beads, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/biotin binding streptavidin agarose beads/product/Millipore
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    biotin binding streptavidin agarose beads - by Bioz Stars, 2020-04
    92/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: Chronic stress and intestinal barrier dysfunction: Glucocorticoid receptor and transcription repressor HES1 regulate tight junction protein Claudin-1 promoter
    Article Snippet: The biotinylated sense and antisense oligonucleotides (random sense sequence: GGGTACAGGGCGTTGATCCGCTGATACTT; GRE (−18 to −47) sense sequence: GGGCGGTTTGGTGTCCCAGAGAACTCCAC; and GRE (−459 to −488) sense sequence: GAATAATCTTGAAGAACAGAGGGGAACAC) were obtained from Invitrogen/Life Technologies (Grand Island, NY, US). .. Biotin binding streptavidin agarose beads (Sigma-Aldrich, St. Louis, MO, US) were pre-equilibrated by washing once with HEPES buffer (10 mmol/L HEPES, pH 7.5, 1 mmol/L EDTA, 10% glycerol) and re-suspended in one bed-volume of HEPES buffer.

    Incubation:

    Article Title: Chronic stress and intestinal barrier dysfunction: Glucocorticoid receptor and transcription repressor HES1 regulate tight junction protein Claudin-1 promoter
    Article Snippet: Biotin binding streptavidin agarose beads (Sigma-Aldrich, St. Louis, MO, US) were pre-equilibrated by washing once with HEPES buffer (10 mmol/L HEPES, pH 7.5, 1 mmol/L EDTA, 10% glycerol) and re-suspended in one bed-volume of HEPES buffer. .. Annealed random, GRE (−18 to −47) and GRE (−459 to −488) oligonucleotides (10 nmol in 10 μL) were added to 0.2 mL of 50% slurry plus 500 μL HEPES buffer and incubated at 4 °C for 2 h with constant rotation.

    Binding Assay:

    Article Title: Chronic stress and intestinal barrier dysfunction: Glucocorticoid receptor and transcription repressor HES1 regulate tight junction protein Claudin-1 promoter
    Article Snippet: .. Biotin binding streptavidin agarose beads (Sigma-Aldrich, St. Louis, MO, US) were pre-equilibrated by washing once with HEPES buffer (10 mmol/L HEPES, pH 7.5, 1 mmol/L EDTA, 10% glycerol) and re-suspended in one bed-volume of HEPES buffer. .. Annealed random, GRE (−18 to −47) and GRE (−459 to −488) oligonucleotides (10 nmol in 10 μL) were added to 0.2 mL of 50% slurry plus 500 μL HEPES buffer and incubated at 4 °C for 2 h with constant rotation.

    Pull Down Assay:

    Article Title: Chronic stress and intestinal barrier dysfunction: Glucocorticoid receptor and transcription repressor HES1 regulate tight junction protein Claudin-1 promoter
    Article Snippet: Paragraph title: DNA Pull-Down Assay ... Biotin binding streptavidin agarose beads (Sigma-Aldrich, St. Louis, MO, US) were pre-equilibrated by washing once with HEPES buffer (10 mmol/L HEPES, pH 7.5, 1 mmol/L EDTA, 10% glycerol) and re-suspended in one bed-volume of HEPES buffer.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Millipore streptavidin agarose bead suspension
    Outline of the ICP-MS based protease assay. The protease substrate was digested with α-chymotrypsin. The undigested substrate was separated from the digestion product by adding <t>streptavidin</t> agarose bead suspension followed by centrifuging. The
    Streptavidin Agarose Bead Suspension, supplied by Millipore, used in various techniques. Bioz Stars score: 86/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin agarose bead suspension/product/Millipore
    Average 86 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    streptavidin agarose bead suspension - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    Image Search Results


    Outline of the ICP-MS based protease assay. The protease substrate was digested with α-chymotrypsin. The undigested substrate was separated from the digestion product by adding streptavidin agarose bead suspension followed by centrifuging. The

    Journal: Analytical biochemistry

    Article Title: Development of inductively coupled plasma-mass spectrometry (ICP-MS) based protease assays

    doi: 10.1016/j.ab.2009.11.010

    Figure Lengend Snippet: Outline of the ICP-MS based protease assay. The protease substrate was digested with α-chymotrypsin. The undigested substrate was separated from the digestion product by adding streptavidin agarose bead suspension followed by centrifuging. The

    Article Snippet: Streptavidin Agarose bead suspension (binding capacity: > 85 nmol free biotin/mL) was purchased from EMD Biosciences. α-Chymotrypsin from bovine pancreas Type II was purchased from Sigma and was used without any further purification. α-Chymotrypsin fluorogenic substrate [Suc-AAPF-AMC] was purchased from EMD Biosciences.

    Techniques: Mass Spectrometry, Protease Assay

    Optimization of the streptavidin agarose bead suspension required in the assay. A 20 μM solution of substrate 2 was diluted 20 times (5 μL into 100 μl 8 M Urea) and different amounts of streptavidin agarose bead suspension (binding

    Journal: Analytical biochemistry

    Article Title: Development of inductively coupled plasma-mass spectrometry (ICP-MS) based protease assays

    doi: 10.1016/j.ab.2009.11.010

    Figure Lengend Snippet: Optimization of the streptavidin agarose bead suspension required in the assay. A 20 μM solution of substrate 2 was diluted 20 times (5 μL into 100 μl 8 M Urea) and different amounts of streptavidin agarose bead suspension (binding

    Article Snippet: Streptavidin Agarose bead suspension (binding capacity: > 85 nmol free biotin/mL) was purchased from EMD Biosciences. α-Chymotrypsin from bovine pancreas Type II was purchased from Sigma and was used without any further purification. α-Chymotrypsin fluorogenic substrate [Suc-AAPF-AMC] was purchased from EMD Biosciences.

    Techniques: Binding Assay