bioanalyser 2100  (Agilent technologies)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    2100 Bioanalyser
    Description:

    Catalog Number:
    G2938C
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Agilent technologies bioanalyser 2100
    Quality of root-extracted RNA. The analysis of the total RNA extracted from inoculated roots was performed using an Agilent Bioanalyser 2100. One microlitre of RQ1 DNase-treated total RNA was analysed for each sample. The days post-inoculation with  Gaeumannomyces graminis  var.  tritici  ( Ggt ) are indicated. M, RNA size marker; lanes 1, 3, 6, 9, RNA from uninfected wheat roots; lanes 2, 4, 7, 10, RNA from wheat roots infected with  Ggt ; lanes 5, 8, 11, RNA from wheat roots infected with  Ggt  and Pf29Arp; lane 12, RNA from soil-borne pathogenic fungus IV-26/00.

    https://www.bioz.com/result/bioanalyser 2100/product/Agilent technologies
    Average 99 stars, based on 128 article reviews
    Price from $9.99 to $1999.99
    bioanalyser 2100 - by Bioz Stars, 2019-12
    99/100 stars

    Images

    1) Product Images from "The biocontrol bacterium Pseudomonas fluorescens Pf29Arp strain affects the pathogenesis-related gene expression of the take-all fungus Gaeumannomyces graminis var. tritici on wheat roots"

    Article Title: The biocontrol bacterium Pseudomonas fluorescens Pf29Arp strain affects the pathogenesis-related gene expression of the take-all fungus Gaeumannomyces graminis var. tritici on wheat roots

    Journal: Molecular Plant Pathology

    doi: 10.1111/j.1364-3703.2011.00715.x

    Quality of root-extracted RNA. The analysis of the total RNA extracted from inoculated roots was performed using an Agilent Bioanalyser 2100. One microlitre of RQ1 DNase-treated total RNA was analysed for each sample. The days post-inoculation with  Gaeumannomyces graminis  var.  tritici  ( Ggt ) are indicated. M, RNA size marker; lanes 1, 3, 6, 9, RNA from uninfected wheat roots; lanes 2, 4, 7, 10, RNA from wheat roots infected with  Ggt ; lanes 5, 8, 11, RNA from wheat roots infected with  Ggt  and Pf29Arp; lane 12, RNA from soil-borne pathogenic fungus IV-26/00.
    Figure Legend Snippet: Quality of root-extracted RNA. The analysis of the total RNA extracted from inoculated roots was performed using an Agilent Bioanalyser 2100. One microlitre of RQ1 DNase-treated total RNA was analysed for each sample. The days post-inoculation with Gaeumannomyces graminis var. tritici ( Ggt ) are indicated. M, RNA size marker; lanes 1, 3, 6, 9, RNA from uninfected wheat roots; lanes 2, 4, 7, 10, RNA from wheat roots infected with Ggt ; lanes 5, 8, 11, RNA from wheat roots infected with Ggt and Pf29Arp; lane 12, RNA from soil-borne pathogenic fungus IV-26/00.

    Techniques Used: Marker, Infection

    2) Product Images from "Successful downstream application of the Paxgene Blood RNA system from small blood samples in paediatric patients for quantitative PCR analysis"

    Article Title: Successful downstream application of the Paxgene Blood RNA system from small blood samples in paediatric patients for quantitative PCR analysis

    Journal: BMC Immunology

    doi: 10.1186/1471-2172-8-20

    Agilent BioAnalyser 2100 traces of total RNA samples. Different volumes of peripheral blood were processed using PAXgene reagent as described in the text. A) Full scale 2.5 mL peripheral blood extraction B) 1.0 mL peripheral blood scaled down extraction C) 0.3 mL peripheral blood scaled down extraction D) Stratagene Universal RNA. The 2.5 mL and 1.0 mL extractions were run on eukaryote total RNA Nano chips and the 0.3 mL extractions and the Universal RNA shown were run on Pico chips. The 18s and 28s RNA peaks can be seen at approximately 42 and 48 seconds respectively.
    Figure Legend Snippet: Agilent BioAnalyser 2100 traces of total RNA samples. Different volumes of peripheral blood were processed using PAXgene reagent as described in the text. A) Full scale 2.5 mL peripheral blood extraction B) 1.0 mL peripheral blood scaled down extraction C) 0.3 mL peripheral blood scaled down extraction D) Stratagene Universal RNA. The 2.5 mL and 1.0 mL extractions were run on eukaryote total RNA Nano chips and the 0.3 mL extractions and the Universal RNA shown were run on Pico chips. The 18s and 28s RNA peaks can be seen at approximately 42 and 48 seconds respectively.

    Techniques Used:

    3) Product Images from "The biocontrol bacterium Pseudomonas fluorescens Pf29Arp strain affects the pathogenesis-related gene expression of the take-all fungus Gaeumannomyces graminis var. tritici on wheat roots"

    Article Title: The biocontrol bacterium Pseudomonas fluorescens Pf29Arp strain affects the pathogenesis-related gene expression of the take-all fungus Gaeumannomyces graminis var. tritici on wheat roots

    Journal: Molecular Plant Pathology

    doi: 10.1111/j.1364-3703.2011.00715.x

    Quality of root-extracted RNA. The analysis of the total RNA extracted from inoculated roots was performed using an Agilent Bioanalyser 2100. One microlitre of RQ1 DNase-treated total RNA was analysed for each sample. The days post-inoculation with  Gaeumannomyces graminis  var.  tritici  ( Ggt ) are indicated. M, RNA size marker; lanes 1, 3, 6, 9, RNA from uninfected wheat roots; lanes 2, 4, 7, 10, RNA from wheat roots infected with  Ggt ; lanes 5, 8, 11, RNA from wheat roots infected with  Ggt  and Pf29Arp; lane 12, RNA from soil-borne pathogenic fungus IV-26/00.
    Figure Legend Snippet: Quality of root-extracted RNA. The analysis of the total RNA extracted from inoculated roots was performed using an Agilent Bioanalyser 2100. One microlitre of RQ1 DNase-treated total RNA was analysed for each sample. The days post-inoculation with Gaeumannomyces graminis var. tritici ( Ggt ) are indicated. M, RNA size marker; lanes 1, 3, 6, 9, RNA from uninfected wheat roots; lanes 2, 4, 7, 10, RNA from wheat roots infected with Ggt ; lanes 5, 8, 11, RNA from wheat roots infected with Ggt and Pf29Arp; lane 12, RNA from soil-borne pathogenic fungus IV-26/00.

    Techniques Used: Marker, Infection

    4) Product Images from "An optimized method for the extraction of bacterial mRNA from plant roots infected with Escherichia coli O157:H7"

    Article Title: An optimized method for the extraction of bacterial mRNA from plant roots infected with Escherichia coli O157:H7

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2014.00286

    Total RNA from plant root extractions by BPEX and Bead/SDS/phenol methods . Intact plant roots were suspended in 20 ml of bacterial inoculum (OD 600  of 0.2) for 2 h at 18°C. Total RNA was extracted using either the BPEX or the Bead/SDS/phenol method and RNA quality was assessed by spectroscopy on a Bioanalyser 2100 machine (Agilent).  (A)  A montage of an electropherograph of the total RNA levels following extraction of inoculated plant material. The lanes show RNA from an  in vitro  culture of  E. coli  O157:H7 isolate Sakai only (lane S); uninfected lettuce roots (lane L);  E. coli  O157:H7 Sakai infected lettuce roots (Lane 1, 306 ng μl - 1 ; Lane 4, 119 ng μl - 1 ; Lane 5, 195 ng μl - 1 ); and  E. coli  O157:H7 Sakai infected spinach roots (Lane 2, 248 ng μl - 1 ; Lane 3, 301 ng μl - 1 ; Lane 6, 141 ng μl - 1 ). Lanes 1, 2, and 3 show extraction using the BPEX method, and Lanes 4, 5, and 6 using the Bead method. The samples were run alongside a commercial RNA transcript ladder (0.2, 0.5, 1.0, 2.0, 4.0, and 6.0 kb, Agilent); the 16S and 23S (bacterial), and 18S and 28S (plant)  r RNA bands are indicated. Electropherogram of  E. coli  O157:H7 Sakai infected lettuce roots extracted with  (B)  the BPEX method (sample derived from lane 1) or with  (C)  the novel Bead/SDS/phenol method (sample derived from lane 4). The uninfected spinach control was similar to lettuce (lane L) (not shown).
    Figure Legend Snippet: Total RNA from plant root extractions by BPEX and Bead/SDS/phenol methods . Intact plant roots were suspended in 20 ml of bacterial inoculum (OD 600 of 0.2) for 2 h at 18°C. Total RNA was extracted using either the BPEX or the Bead/SDS/phenol method and RNA quality was assessed by spectroscopy on a Bioanalyser 2100 machine (Agilent). (A) A montage of an electropherograph of the total RNA levels following extraction of inoculated plant material. The lanes show RNA from an in vitro culture of E. coli O157:H7 isolate Sakai only (lane S); uninfected lettuce roots (lane L); E. coli O157:H7 Sakai infected lettuce roots (Lane 1, 306 ng μl - 1 ; Lane 4, 119 ng μl - 1 ; Lane 5, 195 ng μl - 1 ); and E. coli O157:H7 Sakai infected spinach roots (Lane 2, 248 ng μl - 1 ; Lane 3, 301 ng μl - 1 ; Lane 6, 141 ng μl - 1 ). Lanes 1, 2, and 3 show extraction using the BPEX method, and Lanes 4, 5, and 6 using the Bead method. The samples were run alongside a commercial RNA transcript ladder (0.2, 0.5, 1.0, 2.0, 4.0, and 6.0 kb, Agilent); the 16S and 23S (bacterial), and 18S and 28S (plant) r RNA bands are indicated. Electropherogram of E. coli O157:H7 Sakai infected lettuce roots extracted with (B) the BPEX method (sample derived from lane 1) or with (C) the novel Bead/SDS/phenol method (sample derived from lane 4). The uninfected spinach control was similar to lettuce (lane L) (not shown).

    Techniques Used: Spectroscopy, In Vitro, Infection, Derivative Assay

    Related Articles

    Amplification:

    Article Title: TMEM45A is essential for hypoxia-induced chemoresistance in breast and liver cancer cells
    Article Snippet: RNA integrity was assessed using an Agilent 2100 Bioanalyser (Agilent). .. RNA integrity was assessed using an Agilent 2100 Bioanalyser (Agilent).

    Article Title: Effect of Protein Kinase C delta (PKC-?) Inhibition on the Transcriptome of Normal and Systemic Sclerosis Human Dermal Fibroblasts In Vitro
    Article Snippet: DNase-treated total RNA was ethanol precipitated and quantified on a NanoDrop ND-1000 spectrophotometer and RNA quality was analyzed on an Agilent 2100 bioanalyser (Agilent Technologies, Palo Alto, CA). .. The labeled cRNA was fragmented by heat and ion-mediated hydrolysis and was hybridized to the Human Genome HU133A oligonucleotide array GeneChip (Affymetrix) which contains ∼500,000 spots comprised of 22,283 different probe sets representing 14,397 unique genes.

    Article Title: Sperm transcriptome profiling in oligozoospermia
    Article Snippet: The reverse-transcribed cDNA amplicon is 148 bp long. .. The integrity of the RNA samples was assessed by the Agilent 2100 Bioanalyser.

    Article Title: PPARα Is Required for PPARδ Action in Regulation of Body Weight and Hepatic Steatosis in Mice
    Article Snippet: Total RNA was quantified on a NanoDrop spectrophotometer (ND-8000) and samples were amplified and labelled using Illumina TotalPrep RNA Amplification Kit (Invitrogen, UK). .. All samples passed quality check using Agilent 2100 Bioanalyser and 1.5 μ g/biotin-labelled sample was hybridized with MouseWG-6 v2.0 Expression BeadChips (Illumina, USA).

    Article Title: Molecular markers associated with outcome and metastasis in human pancreatic cancer
    Article Snippet: RNA concentration and purity were determined spectrophotometrically using the Nanodrop ND-1000 (Nanodrop Technologies, Wilmington, DE) and RNA integrity was assessed using a Bioanalyser 2100 (Agilent Technologies, Santa Clara, CA). .. Only samples with a RIN of at least 7.1 were used for further microarray analysis at the VIB Nucleomics Core ( http://www.nucleomics.be ).

    Article Title: Clinical and molecular characteristics of unicentric mediastinal Castleman disease
    Article Snippet: Quality control was performed using an Agilent 2100 Bioanalyser equipment (Agilent Technologies, USA). .. Quality control was performed using an Agilent 2100 Bioanalyser equipment (Agilent Technologies, USA).

    DNA Synthesis:

    Article Title: Excess of serotonin affects neocortical pyramidal neuron migration
    Article Snippet: Paragraph title: RNA isolation, complementary DNA synthesis and real-time quantitative PCR ... The quality of RNA was checked on an Agilent 2100 Bioanalyser (Agilent Technologies, Basel, CH) and converted into complementary DNA using standard procedures (Takara Bio, Shiga, Japan).

    Mass Spectrometry:

    Article Title: PPARα Is Required for PPARδ Action in Regulation of Body Weight and Hepatic Steatosis in Mice
    Article Snippet: All samples passed quality check using Agilent 2100 Bioanalyser and 1.5 μ g/biotin-labelled sample was hybridized with MouseWG-6 v2.0 Expression BeadChips (Illumina, USA). .. Expression data were normalized in GenomeStudio with background extraction.

    Synthesized:

    Article Title: The low affinity glucose transporter HxtB is also involved in glucose signalling and metabolism in Aspergillus nidulans
    Article Snippet: DNA was degraded with DNAse (Promega) according to manufacturer’s instructions and RNA was subsequently purified using the RNeasy® Mini Kit (Qiagen), according to manufacturer’s instructions. .. The quality of the RNA was verified using the Agilent Bioanalyser 2100 (Agilent technologies) and a RIM value of 8.0 as the RNA quality threshold. cDNA was synthesized from RNA using the ImProm-II™ Reverse Transcription System (Promega) according to manufacturer’s instructions. qRT-PCR was performed using the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) and the SYBR Green PCR Master Mix kit (Applied Biosystems), according to manufacturer’s instructions. .. Reactions and calculations were performed as previously described and gene expression were normalised by the expression of tubC .

    Quantitative RT-PCR:

    Article Title: De novo transcriptome assembly of the grapevine phylloxera allows identification of genes differentially expressed between leaf- and root-feeding forms
    Article Snippet: Paragraph title: Quantitative RT-PCR ... RNA samples purity and quality was checked with a Bioanalyser 2100 (Agilent) and quantified by spectrophotometery (Nanodrop Technologies).

    Article Title: The low affinity glucose transporter HxtB is also involved in glucose signalling and metabolism in Aspergillus nidulans
    Article Snippet: DNA was degraded with DNAse (Promega) according to manufacturer’s instructions and RNA was subsequently purified using the RNeasy® Mini Kit (Qiagen), according to manufacturer’s instructions. .. The quality of the RNA was verified using the Agilent Bioanalyser 2100 (Agilent technologies) and a RIM value of 8.0 as the RNA quality threshold. cDNA was synthesized from RNA using the ImProm-II™ Reverse Transcription System (Promega) according to manufacturer’s instructions. qRT-PCR was performed using the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) and the SYBR Green PCR Master Mix kit (Applied Biosystems), according to manufacturer’s instructions. .. Reactions and calculations were performed as previously described and gene expression were normalised by the expression of tubC .

    Real-time Polymerase Chain Reaction:

    Article Title: Excess of serotonin affects neocortical pyramidal neuron migration
    Article Snippet: Paragraph title: RNA isolation, complementary DNA synthesis and real-time quantitative PCR ... The quality of RNA was checked on an Agilent 2100 Bioanalyser (Agilent Technologies, Basel, CH) and converted into complementary DNA using standard procedures (Takara Bio, Shiga, Japan).

    Article Title: Serum-Nutrient Starvation Induces Cell Death Mediated by Bax and Puma That Is Counteracted by p21 and Unmasked by Bcl-xL Inhibition
    Article Snippet: Paragraph title: RNA extraction and quantitative real-time PCR ... The quality of the RNAs was assessed by analysis the 28S∶18S rRNA ratio using the RNA 6000 Nano Assay kit and the Agilent 2100 bioanalyser (Agilent Biotechnologies).

    Article Title: De novo transcriptome assembly of the grapevine phylloxera allows identification of genes differentially expressed between leaf- and root-feeding forms
    Article Snippet: RNA samples purity and quality was checked with a Bioanalyser 2100 (Agilent) and quantified by spectrophotometery (Nanodrop Technologies). .. Primer sequences used for qRT-PCR were designed using Primer 3 software; sequences are available in Additional file .

    Article Title: The low affinity glucose transporter HxtB is also involved in glucose signalling and metabolism in Aspergillus nidulans
    Article Snippet: DNA was degraded with DNAse (Promega) according to manufacturer’s instructions and RNA was subsequently purified using the RNeasy® Mini Kit (Qiagen), according to manufacturer’s instructions. .. The quality of the RNA was verified using the Agilent Bioanalyser 2100 (Agilent technologies) and a RIM value of 8.0 as the RNA quality threshold. cDNA was synthesized from RNA using the ImProm-II™ Reverse Transcription System (Promega) according to manufacturer’s instructions. qRT-PCR was performed using the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) and the SYBR Green PCR Master Mix kit (Applied Biosystems), according to manufacturer’s instructions. .. Reactions and calculations were performed as previously described and gene expression were normalised by the expression of tubC .

    Microarray:

    Article Title: Transcriptional Profiling of Whole Blood Identifies a Unique 5-Gene Signature for Myelofibrosis and Imminent Myelofibrosis Transformation
    Article Snippet: Gene expression microarray studies have been performed on whole blood from control subjects (n = 21) and patients with ET (n = 19), PV (n = 41), and PMF (n = 9). .. Quantity of RNA was determined with the NanoDrop spectrophotometer ND-8000 (NanoDrop Technologies, Wilmington, DE, USA) and quality of RNA was assessed using the Agilent 2100 Bioanalyser (Agilent Technologies, Palo Alto, CA).

    Article Title: Effect of Protein Kinase C delta (PKC-?) Inhibition on the Transcriptome of Normal and Systemic Sclerosis Human Dermal Fibroblasts In Vitro
    Article Snippet: Paragraph title: Microarray analysis ... DNase-treated total RNA was ethanol precipitated and quantified on a NanoDrop ND-1000 spectrophotometer and RNA quality was analyzed on an Agilent 2100 bioanalyser (Agilent Technologies, Palo Alto, CA).

    Article Title: PPARα Is Required for PPARδ Action in Regulation of Body Weight and Hepatic Steatosis in Mice
    Article Snippet: Paragraph title: 2.6. Microarray Analysis ... All samples passed quality check using Agilent 2100 Bioanalyser and 1.5 μ g/biotin-labelled sample was hybridized with MouseWG-6 v2.0 Expression BeadChips (Illumina, USA).

    Article Title: Circadian clock components control daily growth activities by modulating cytokinin levels and cell division‐associated gene expression in Populus trees, et al. Circadian clock components control daily growth activities by modulating cytokinin levels and cell division‐associated gene expression in Populus trees
    Article Snippet: Paragraph title: Microarray analysis ... Biotin‐labeled cRNA was cleaned up using the cRNA Cleanup Spin Column supplied in the Affymetrix GeneChip Sample Cleanup Module and assessed for quantity and quality using the Agilent 2100 Bioanalyser (Agilent). cRNA was fragmented by metal‐induced hydrolysis to break down full‐length cRNA to 35–200 base fragments, of which 15 μg of adjusted cRNA was used to prepare 300 μl of hybridization cocktail.

    Article Title: Transcriptional profile of GTP-mediated differentiation of C2C12 skeletal muscle cells
    Article Snippet: To perform the microarray experiments, MWG mouse 30k A microarray slides were used. .. The analysis of RNA samples was performed using an Agilent Bioanalyser 2100 with a Nano chip, according to the RNA sample amounts.

    Article Title: Neuronal MicroRNA Deregulation in Response to Alzheimer's Disease Amyloid-?
    Article Snippet: RNA quantity was routinely assessed on a NanoDrop 1000 spectrophotometer (Thermo Scientific). .. For microarray analysis, RNA quality was determined on a Bioanalyser 2100 (Agilent) and only RNA samples with an RNA integrity number (RIN) between 8 and 10 were used. .. Megaplex profiling using rodent TaqMan Low Density miRNA Arrays (TLDA) (Applied Biosystems) was used to assay the expression of 380 miRNAs as described by the manufacturer.

    Incubation:

    Article Title: TMEM45A is essential for hypoxia-induced chemoresistance in breast and liver cancer cells
    Article Snippet: At the end of the incubation, total RNA was extracted using the Trizol extraction kit (Invitrogen). .. RNA integrity was assessed using an Agilent 2100 Bioanalyser (Agilent).

    Article Title: Circadian clock components control daily growth activities by modulating cytokinin levels and cell division‐associated gene expression in Populus trees, et al. Circadian clock components control daily growth activities by modulating cytokinin levels and cell division‐associated gene expression in Populus trees
    Article Snippet: Following this, 10 units of T4 DNA polymerase (Invitrogen) were added to the reaction, which was incubated for a further 5 min at 16 °C before being terminated with ethylenediaminetetraacetic acid. .. Biotin‐labeled cRNA was cleaned up using the cRNA Cleanup Spin Column supplied in the Affymetrix GeneChip Sample Cleanup Module and assessed for quantity and quality using the Agilent 2100 Bioanalyser (Agilent). cRNA was fragmented by metal‐induced hydrolysis to break down full‐length cRNA to 35–200 base fragments, of which 15 μg of adjusted cRNA was used to prepare 300 μl of hybridization cocktail.

    Formalin-fixed Paraffin-Embedded:

    Article Title: Clinical and molecular characteristics of unicentric mediastinal Castleman disease
    Article Snippet: After morphological control of the quality of the tumor sampling, DNA was extracted using the Maxwell® 16 FFPE Plus LEV DNA Purification Kit (Promega Corporation, Madison, WI) and quantified using Qubit™ fluorometric quantitation device (Thermo Fisher Scientific, France). .. Quality control was performed using an Agilent 2100 Bioanalyser equipment (Agilent Technologies, USA).

    Expressing:

    Article Title: Transcriptional Profiling of Whole Blood Identifies a Unique 5-Gene Signature for Myelofibrosis and Imminent Myelofibrosis Transformation
    Article Snippet: Gene expression microarray studies have been performed on whole blood from control subjects (n = 21) and patients with ET (n = 19), PV (n = 41), and PMF (n = 9). .. Quantity of RNA was determined with the NanoDrop spectrophotometer ND-8000 (NanoDrop Technologies, Wilmington, DE, USA) and quality of RNA was assessed using the Agilent 2100 Bioanalyser (Agilent Technologies, Palo Alto, CA).

    Article Title: PPARα Is Required for PPARδ Action in Regulation of Body Weight and Hepatic Steatosis in Mice
    Article Snippet: Total RNA was quantified on a NanoDrop spectrophotometer (ND-8000) and samples were amplified and labelled using Illumina TotalPrep RNA Amplification Kit (Invitrogen, UK). .. All samples passed quality check using Agilent 2100 Bioanalyser and 1.5 μ g/biotin-labelled sample was hybridized with MouseWG-6 v2.0 Expression BeadChips (Illumina, USA). .. BeadChips (n = 60) were scanned using an Illumina BeadArray reader and raw data were acquired using GenomeStudio software.

    Article Title: Molecular markers associated with outcome and metastasis in human pancreatic cancer
    Article Snippet: Paragraph title: Whole-genome expression analysis ... RNA concentration and purity were determined spectrophotometrically using the Nanodrop ND-1000 (Nanodrop Technologies, Wilmington, DE) and RNA integrity was assessed using a Bioanalyser 2100 (Agilent Technologies, Santa Clara, CA).

    Modification:

    Article Title: Distinct Epigenomic Features in End-Stage Failing Human Hearts
    Article Snippet: Homogenates were centrifuged at 3000 rpm for 3 minutes; supernatant was transferred to a clean Eppendorf; and RNA extraction was performed according to the manufacturer’s protocol with the following modification. .. Integrity of all RNA samples was checked with the 2100 Bioanalyser (Agilent Technologies).

    Hybridization:

    Article Title: TMEM45A is essential for hypoxia-induced chemoresistance in breast and liver cancer cells
    Article Snippet: RNA integrity was assessed using an Agilent 2100 Bioanalyser (Agilent). .. Sample was then converted and amplified to antisense cRNA, labeled with biotin, in an in vitro transcription reaction.

    Article Title: Effect of Protein Kinase C delta (PKC-?) Inhibition on the Transcriptome of Normal and Systemic Sclerosis Human Dermal Fibroblasts In Vitro
    Article Snippet: DNase-treated total RNA was ethanol precipitated and quantified on a NanoDrop ND-1000 spectrophotometer and RNA quality was analyzed on an Agilent 2100 bioanalyser (Agilent Technologies, Palo Alto, CA). .. The labeled cRNA was fragmented by heat and ion-mediated hydrolysis and was hybridized to the Human Genome HU133A oligonucleotide array GeneChip (Affymetrix) which contains ∼500,000 spots comprised of 22,283 different probe sets representing 14,397 unique genes.

    Article Title: Circadian clock components control daily growth activities by modulating cytokinin levels and cell division‐associated gene expression in Populus trees, et al. Circadian clock components control daily growth activities by modulating cytokinin levels and cell division‐associated gene expression in Populus trees
    Article Snippet: Double‐stranded cDNA was cleaned up using the cDNA Cleanup Spin Column supplied in the Affymetrix GeneChip Sample Cleanup Module (Affymetrix) and used as a template for in vitro transcription of biotin‐labeled cRNA using the ENZO BioArray RNA Transcript Labeling Kit (Affymetrix). .. Biotin‐labeled cRNA was cleaned up using the cRNA Cleanup Spin Column supplied in the Affymetrix GeneChip Sample Cleanup Module and assessed for quantity and quality using the Agilent 2100 Bioanalyser (Agilent). cRNA was fragmented by metal‐induced hydrolysis to break down full‐length cRNA to 35–200 base fragments, of which 15 μg of adjusted cRNA was used to prepare 300 μl of hybridization cocktail. .. Two hundred microlitres of hybridization cocktail were hybridized with the GeneChip and scanned on the Affymetrix Gene Array Scanner 2500A using Micro Array Suite 5.0 software.

    Article Title: Transcriptional profile of GTP-mediated differentiation of C2C12 skeletal muscle cells
    Article Snippet: The analysis of RNA samples was performed using an Agilent Bioanalyser 2100 with a Nano chip, according to the RNA sample amounts. .. The RNA amplification and labelling reactions were carried out using two-step amino-allyl labelling.

    Article Title: Molecular markers associated with outcome and metastasis in human pancreatic cancer
    Article Snippet: RNA concentration and purity were determined spectrophotometrically using the Nanodrop ND-1000 (Nanodrop Technologies, Wilmington, DE) and RNA integrity was assessed using a Bioanalyser 2100 (Agilent Technologies, Santa Clara, CA). .. Per sample, an amount of 100 ng of total RNA spiked with bacterial RNA transcript positive controls (Affymetrix) was amplified and labelled using the GeneChip 3' IVT express kit (Affymetrix).

    Flow Cytometry:

    Article Title: Excess of serotonin affects neocortical pyramidal neuron migration
    Article Snippet: Cortical slices were prepared and cortices were dissected under a stereo microscope (Leica M165 FC, Heerbrugg, CH). .. The quality of RNA was checked on an Agilent 2100 Bioanalyser (Agilent Technologies, Basel, CH) and converted into complementary DNA using standard procedures (Takara Bio, Shiga, Japan).

    Peptide Mass Fingerprinting:

    Article Title: Transcriptional Profiling of Whole Blood Identifies a Unique 5-Gene Signature for Myelofibrosis and Imminent Myelofibrosis Transformation
    Article Snippet: Gene expression microarray studies have been performed on whole blood from control subjects (n = 21) and patients with ET (n = 19), PV (n = 41), and PMF (n = 9). .. Quantity of RNA was determined with the NanoDrop spectrophotometer ND-8000 (NanoDrop Technologies, Wilmington, DE, USA) and quality of RNA was assessed using the Agilent 2100 Bioanalyser (Agilent Technologies, Palo Alto, CA).

    Ligation:

    Article Title: Integrated analysis of the local and systemic changes preceding the development of post-partum cytological endometritis
    Article Snippet: The Agilent 2100 Bioanalyser (Agilent Technologies) was used to assess the quality of RNA, and RIN values ranged from 6 to 9.9 across all samples used (Additional file : Table S1). .. The Agilent 2100 Bioanalyser (Agilent Technologies) was used to assess the quality of RNA, and RIN values ranged from 6 to 9.9 across all samples used (Additional file : Table S1).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Sperm transcriptome profiling in oligozoospermia
    Article Snippet: The purity of these samples was estimated by RT-PCR using protamine-2 specific primers [ ] that produce a 310 bp in samples containing genomic DNA (not shown). .. The integrity of the RNA samples was assessed by the Agilent 2100 Bioanalyser.

    Generated:

    Article Title: Circadian clock components control daily growth activities by modulating cytokinin levels and cell division‐associated gene expression in Populus trees, et al. Circadian clock components control daily growth activities by modulating cytokinin levels and cell division‐associated gene expression in Populus trees
    Article Snippet: Biotin‐labeled cRNA was cleaned up using the cRNA Cleanup Spin Column supplied in the Affymetrix GeneChip Sample Cleanup Module and assessed for quantity and quality using the Agilent 2100 Bioanalyser (Agilent). cRNA was fragmented by metal‐induced hydrolysis to break down full‐length cRNA to 35–200 base fragments, of which 15 μg of adjusted cRNA was used to prepare 300 μl of hybridization cocktail. .. For microarray data analysis, CEL files were preprocessed with Robust Multiarray Average (RMA) in GeneSpring version 12.5 (Agilent Technologies), in which further statistical analysis was completed.

    Sequencing:

    Article Title: Excess of serotonin affects neocortical pyramidal neuron migration
    Article Snippet: The quality of RNA was checked on an Agilent 2100 Bioanalyser (Agilent Technologies, Basel, CH) and converted into complementary DNA using standard procedures (Takara Bio, Shiga, Japan). .. SYBR green-based real-time PCR (Qiagen) was used to quantify the expression of 5-HT6 receptor (forward primer: 5′-GGTGCCATCTGCTTCACCTA-3′ reverse primer: 5′-CAGCCAGGTGACAAAGAACA-3′).

    Article Title: Integrated analysis of the local and systemic changes preceding the development of post-partum cytological endometritis
    Article Snippet: Paragraph title: RNA extraction, library preparation and NGS sequencing ... The Agilent 2100 Bioanalyser (Agilent Technologies) was used to assess the quality of RNA, and RIN values ranged from 6 to 9.9 across all samples used (Additional file : Table S1).

    Article Title: Population genetic diversity and hybrid detection in captive zebras
    Article Snippet: Short fragments were removed using AMPure XP beads, and the quality and quantity of the library were assessed using Agilent 2100 Bioanalyser (Agilent). .. Library fragments were mixed with capture beads and clonally amplified through emulsion PCR using the GS-Junior Titanium emPCR kit (Roche).

    Article Title: Clinical and molecular characteristics of unicentric mediastinal Castleman disease
    Article Snippet: Paragraph title: Sequencing ... Quality control was performed using an Agilent 2100 Bioanalyser equipment (Agilent Technologies, USA).

    Weight Gain:

    Article Title: PPARα Is Required for PPARδ Action in Regulation of Body Weight and Hepatic Steatosis in Mice
    Article Snippet: All samples passed quality check using Agilent 2100 Bioanalyser and 1.5 μ g/biotin-labelled sample was hybridized with MouseWG-6 v2.0 Expression BeadChips (Illumina, USA). .. Microarray data were analyzed using GenomeStudio, MeV v. 4.8.1. and MS Excel.

    DNA Extraction:

    Article Title: Polyketide synthesis genes associated with toxin production in two species of Gambierdiscus (Dinophyceae)
    Article Snippet: For, DNA extraction the cell pellet was extracted via FastDNA® Spin kit for Soil (MP Biomedicals, Solon, OH). .. The RNA purity, quantity and integrity were assessed using Nanodrop ND-1000 (Thermo Scientific, Woltham, MA) and 2100 Bioanalyser (Agilent Technologies, Santa Clara, CA).

    Isolation:

    Article Title: Elucidating how the saprophytic fungus Aspergillus nidulans uses the plant polyester suberin as carbon source
    Article Snippet: Paragraph title: RNA isolation and cRNA preparation ... Quantification and purity of RNA were determined on a NanoDrop 1000 Spectrophotometer (Thermo Scientific) and RNA integrity analysed using an Agilent 2100 Bioanalyser with a RNA 6000 Nano Assay (Agilent Technologies).

    Article Title: Excess of serotonin affects neocortical pyramidal neuron migration
    Article Snippet: Paragraph title: RNA isolation, complementary DNA synthesis and real-time quantitative PCR ... The quality of RNA was checked on an Agilent 2100 Bioanalyser (Agilent Technologies, Basel, CH) and converted into complementary DNA using standard procedures (Takara Bio, Shiga, Japan).

    Article Title: Effect of Protein Kinase C delta (PKC-?) Inhibition on the Transcriptome of Normal and Systemic Sclerosis Human Dermal Fibroblasts In Vitro
    Article Snippet: Following exposure to rottlerin, DNA-free total RNA was isolated utilizing the RNeasy micro kit (Qiagen, Valencia, CA), according to the manufacturer's protocol. .. DNase-treated total RNA was ethanol precipitated and quantified on a NanoDrop ND-1000 spectrophotometer and RNA quality was analyzed on an Agilent 2100 bioanalyser (Agilent Technologies, Palo Alto, CA).

    RNA Extraction:

    Article Title: Polyketide synthesis genes associated with toxin production in two species of Gambierdiscus (Dinophyceae)
    Article Snippet: Paragraph title: DNA and RNA extraction ... The RNA purity, quantity and integrity were assessed using Nanodrop ND-1000 (Thermo Scientific, Woltham, MA) and 2100 Bioanalyser (Agilent Technologies, Santa Clara, CA).

    Article Title: Serum-Nutrient Starvation Induces Cell Death Mediated by Bax and Puma That Is Counteracted by p21 and Unmasked by Bcl-xL Inhibition
    Article Snippet: Paragraph title: RNA extraction and quantitative real-time PCR ... The quality of the RNAs was assessed by analysis the 28S∶18S rRNA ratio using the RNA 6000 Nano Assay kit and the Agilent 2100 bioanalyser (Agilent Biotechnologies).

    Article Title: Integrated analysis of the local and systemic changes preceding the development of post-partum cytological endometritis
    Article Snippet: Paragraph title: RNA extraction, library preparation and NGS sequencing ... The Agilent 2100 Bioanalyser (Agilent Technologies) was used to assess the quality of RNA, and RIN values ranged from 6 to 9.9 across all samples used (Additional file : Table S1).

    Article Title: Distinct Epigenomic Features in End-Stage Failing Human Hearts
    Article Snippet: Homogenates were centrifuged at 3000 rpm for 3 minutes; supernatant was transferred to a clean Eppendorf; and RNA extraction was performed according to the manufacturer’s protocol with the following modification. .. Integrity of all RNA samples was checked with the 2100 Bioanalyser (Agilent Technologies).

    Article Title: Molecular markers associated with outcome and metastasis in human pancreatic cancer
    Article Snippet: Only representative snap-frozen PDAC material- defined as a minimum of 30% cancer cells on H & E staining – was used for RNA extraction. .. RNA concentration and purity were determined spectrophotometrically using the Nanodrop ND-1000 (Nanodrop Technologies, Wilmington, DE) and RNA integrity was assessed using a Bioanalyser 2100 (Agilent Technologies, Santa Clara, CA).

    Article Title: The low affinity glucose transporter HxtB is also involved in glucose signalling and metabolism in Aspergillus nidulans
    Article Snippet: Paragraph title: RNA extraction and qRT-PCR ... The quality of the RNA was verified using the Agilent Bioanalyser 2100 (Agilent technologies) and a RIM value of 8.0 as the RNA quality threshold. cDNA was synthesized from RNA using the ImProm-II™ Reverse Transcription System (Promega) according to manufacturer’s instructions. qRT-PCR was performed using the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) and the SYBR Green PCR Master Mix kit (Applied Biosystems), according to manufacturer’s instructions.

    Article Title: Neuronal MicroRNA Deregulation in Response to Alzheimer's Disease Amyloid-?
    Article Snippet: Paragraph title: RNA extraction and microarray analysis ... For microarray analysis, RNA quality was determined on a Bioanalyser 2100 (Agilent) and only RNA samples with an RNA integrity number (RIN) between 8 and 10 were used.

    Microscopy:

    Article Title: Excess of serotonin affects neocortical pyramidal neuron migration
    Article Snippet: Cortical slices were prepared and cortices were dissected under a stereo microscope (Leica M165 FC, Heerbrugg, CH). .. The quality of RNA was checked on an Agilent 2100 Bioanalyser (Agilent Technologies, Basel, CH) and converted into complementary DNA using standard procedures (Takara Bio, Shiga, Japan).

    Purification:

    Article Title: Elucidating how the saprophytic fungus Aspergillus nidulans uses the plant polyester suberin as carbon source
    Article Snippet: Total RNA was isolated from fungal mycelia (grounded to powder using mortar and pestle in liquid nitrogen) using the RNeasy Plant Mini Kit (QIAGEN) and further purified by ethanol precipitation [ ]. .. Quantification and purity of RNA were determined on a NanoDrop 1000 Spectrophotometer (Thermo Scientific) and RNA integrity analysed using an Agilent 2100 Bioanalyser with a RNA 6000 Nano Assay (Agilent Technologies).

    Article Title: Polyketide synthesis genes associated with toxin production in two species of Gambierdiscus (Dinophyceae)
    Article Snippet: The obtained RNA was purified using the RNeasy Plant mini kit (Qiagen, Limberg, Netherlands) according to the manufactures protocol. .. The RNA purity, quantity and integrity were assessed using Nanodrop ND-1000 (Thermo Scientific, Woltham, MA) and 2100 Bioanalyser (Agilent Technologies, Santa Clara, CA).

    Article Title: Population genetic diversity and hybrid detection in captive zebras
    Article Snippet: After checking the quality of genomic DNA by resolution on a 0.5% agarose gel and spectrophotometry (Nanodrop, USA), 500 ng of the genomic DNA was nebulized at 0.24 MPa for 1 min, and purified using the MinElute PCR Purification kit (QIAGEN). .. Short fragments were removed using AMPure XP beads, and the quality and quantity of the library were assessed using Agilent 2100 Bioanalyser (Agilent).

    Article Title: Transcriptional profile of GTP-mediated differentiation of C2C12 skeletal muscle cells
    Article Snippet: Total RNA from these C2C12 cells was then purified using NucleoSpin RNA II kits (Macherey-Nagel, Duren, Germany), according to the manufacturer's instructions. .. The analysis of RNA samples was performed using an Agilent Bioanalyser 2100 with a Nano chip, according to the RNA sample amounts.

    Article Title: Molecular markers associated with outcome and metastasis in human pancreatic cancer
    Article Snippet: RNA concentration and purity were determined spectrophotometrically using the Nanodrop ND-1000 (Nanodrop Technologies, Wilmington, DE) and RNA integrity was assessed using a Bioanalyser 2100 (Agilent Technologies, Santa Clara, CA). .. Per sample, an amount of 100 ng of total RNA spiked with bacterial RNA transcript positive controls (Affymetrix) was amplified and labelled using the GeneChip 3' IVT express kit (Affymetrix).

    Article Title: The low affinity glucose transporter HxtB is also involved in glucose signalling and metabolism in Aspergillus nidulans
    Article Snippet: DNA was degraded with DNAse (Promega) according to manufacturer’s instructions and RNA was subsequently purified using the RNeasy® Mini Kit (Qiagen), according to manufacturer’s instructions. .. The quality of the RNA was verified using the Agilent Bioanalyser 2100 (Agilent technologies) and a RIM value of 8.0 as the RNA quality threshold. cDNA was synthesized from RNA using the ImProm-II™ Reverse Transcription System (Promega) according to manufacturer’s instructions. qRT-PCR was performed using the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) and the SYBR Green PCR Master Mix kit (Applied Biosystems), according to manufacturer’s instructions.

    Polymerase Chain Reaction:

    Article Title: Integrated analysis of the local and systemic changes preceding the development of post-partum cytological endometritis
    Article Snippet: The Agilent 2100 Bioanalyser (Agilent Technologies) was used to assess the quality of RNA, and RIN values ranged from 6 to 9.9 across all samples used (Additional file : Table S1). .. The Agilent 2100 Bioanalyser (Agilent Technologies) was used to assess the quality of RNA, and RIN values ranged from 6 to 9.9 across all samples used (Additional file : Table S1).

    Article Title: Population genetic diversity and hybrid detection in captive zebras
    Article Snippet: After checking the quality of genomic DNA by resolution on a 0.5% agarose gel and spectrophotometry (Nanodrop, USA), 500 ng of the genomic DNA was nebulized at 0.24 MPa for 1 min, and purified using the MinElute PCR Purification kit (QIAGEN). .. Short fragments were removed using AMPure XP beads, and the quality and quantity of the library were assessed using Agilent 2100 Bioanalyser (Agilent).

    Article Title: The low affinity glucose transporter HxtB is also involved in glucose signalling and metabolism in Aspergillus nidulans
    Article Snippet: DNA was degraded with DNAse (Promega) according to manufacturer’s instructions and RNA was subsequently purified using the RNeasy® Mini Kit (Qiagen), according to manufacturer’s instructions. .. The quality of the RNA was verified using the Agilent Bioanalyser 2100 (Agilent technologies) and a RIM value of 8.0 as the RNA quality threshold. cDNA was synthesized from RNA using the ImProm-II™ Reverse Transcription System (Promega) according to manufacturer’s instructions. qRT-PCR was performed using the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) and the SYBR Green PCR Master Mix kit (Applied Biosystems), according to manufacturer’s instructions. .. Reactions and calculations were performed as previously described and gene expression were normalised by the expression of tubC .

    Article Title: Neuronal MicroRNA Deregulation in Response to Alzheimer's Disease Amyloid-?
    Article Snippet: For microarray analysis, RNA quality was determined on a Bioanalyser 2100 (Agilent) and only RNA samples with an RNA integrity number (RIN) between 8 and 10 were used. .. For microarray analysis, RNA quality was determined on a Bioanalyser 2100 (Agilent) and only RNA samples with an RNA integrity number (RIN) between 8 and 10 were used.

    Article Title: Clinical and molecular characteristics of unicentric mediastinal Castleman disease
    Article Snippet: Multiplex PCR library were prepared using the AmpliSeq™ Cancer Hotspot v2 (Life Technologies) covering more than 2800 COSMIC hotspot mutations within the following 50 genes ( SMARCB1 , RB1 , TP53 , ERBB4 , FBXW7 , BRAF , TP53 , KIT , GNAS , HRAS , EGFR , PDGFRA , PIK3CA , CDKN2A , ERBB2 , ABL1 , JAK2 , KRAS , NRAS , NOTCH1 , ATM , FGFR1 , STK11 , PTPN11 , APC , SMAD4 , PTEN , SMO , CTNNB1 , RET , IDH2 , SRC , EZH2 , VHL , MPL , NPM1 , FLT3 , FGFR3 , CDH1 , KDR , HNF1A , MLH1 , ALK , IDH1 , GNAQ , AKT1 , JAK3 , FGFR2 , GNA11 , MET , CSF1R , CDKN2A ) and Ion AmpliSeq™ library kit V2. .. Quality control was performed using an Agilent 2100 Bioanalyser equipment (Agilent Technologies, USA).

    Labeling:

    Article Title: TMEM45A is essential for hypoxia-induced chemoresistance in breast and liver cancer cells
    Article Snippet: RNA integrity was assessed using an Agilent 2100 Bioanalyser (Agilent). .. RNA integrity was assessed using an Agilent 2100 Bioanalyser (Agilent).

    Article Title: Effect of Protein Kinase C delta (PKC-?) Inhibition on the Transcriptome of Normal and Systemic Sclerosis Human Dermal Fibroblasts In Vitro
    Article Snippet: DNase-treated total RNA was ethanol precipitated and quantified on a NanoDrop ND-1000 spectrophotometer and RNA quality was analyzed on an Agilent 2100 bioanalyser (Agilent Technologies, Palo Alto, CA). .. DNase-treated total RNA was ethanol precipitated and quantified on a NanoDrop ND-1000 spectrophotometer and RNA quality was analyzed on an Agilent 2100 bioanalyser (Agilent Technologies, Palo Alto, CA).

    Article Title: Circadian clock components control daily growth activities by modulating cytokinin levels and cell division‐associated gene expression in Populus trees, et al. Circadian clock components control daily growth activities by modulating cytokinin levels and cell division‐associated gene expression in Populus trees
    Article Snippet: Double‐stranded cDNA was cleaned up using the cDNA Cleanup Spin Column supplied in the Affymetrix GeneChip Sample Cleanup Module (Affymetrix) and used as a template for in vitro transcription of biotin‐labeled cRNA using the ENZO BioArray RNA Transcript Labeling Kit (Affymetrix). .. Biotin‐labeled cRNA was cleaned up using the cRNA Cleanup Spin Column supplied in the Affymetrix GeneChip Sample Cleanup Module and assessed for quantity and quality using the Agilent 2100 Bioanalyser (Agilent). cRNA was fragmented by metal‐induced hydrolysis to break down full‐length cRNA to 35–200 base fragments, of which 15 μg of adjusted cRNA was used to prepare 300 μl of hybridization cocktail.

    cDNA Library Assay:

    Article Title: Integrated analysis of the local and systemic changes preceding the development of post-partum cytological endometritis
    Article Snippet: The Agilent 2100 Bioanalyser (Agilent Technologies) was used to assess the quality of RNA, and RIN values ranged from 6 to 9.9 across all samples used (Additional file : Table S1). .. The Agilent 2100 Bioanalyser (Agilent Technologies) was used to assess the quality of RNA, and RIN values ranged from 6 to 9.9 across all samples used (Additional file : Table S1).

    Chromatin Immunoprecipitation:

    Article Title: Transcriptional profile of GTP-mediated differentiation of C2C12 skeletal muscle cells
    Article Snippet: The total RNA extractions were quantified spectrophotometrically (GeneQuant pro, Amersham). .. The analysis of RNA samples was performed using an Agilent Bioanalyser 2100 with a Nano chip, according to the RNA sample amounts. .. The RNA amplification and labelling reactions were carried out using two-step amino-allyl labelling.

    Plasmid Preparation:

    Article Title: Effect of Protein Kinase C delta (PKC-?) Inhibition on the Transcriptome of Normal and Systemic Sclerosis Human Dermal Fibroblasts In Vitro
    Article Snippet: DNase-treated total RNA was ethanol precipitated and quantified on a NanoDrop ND-1000 spectrophotometer and RNA quality was analyzed on an Agilent 2100 bioanalyser (Agilent Technologies, Palo Alto, CA). .. The labeled cRNA was fragmented by heat and ion-mediated hydrolysis and was hybridized to the Human Genome HU133A oligonucleotide array GeneChip (Affymetrix) which contains ∼500,000 spots comprised of 22,283 different probe sets representing 14,397 unique genes.

    Software:

    Article Title: Effect of Protein Kinase C delta (PKC-?) Inhibition on the Transcriptome of Normal and Systemic Sclerosis Human Dermal Fibroblasts In Vitro
    Article Snippet: DNase-treated total RNA was ethanol precipitated and quantified on a NanoDrop ND-1000 spectrophotometer and RNA quality was analyzed on an Agilent 2100 bioanalyser (Agilent Technologies, Palo Alto, CA). .. DNase-treated total RNA was ethanol precipitated and quantified on a NanoDrop ND-1000 spectrophotometer and RNA quality was analyzed on an Agilent 2100 bioanalyser (Agilent Technologies, Palo Alto, CA).

    Article Title: Serum-Nutrient Starvation Induces Cell Death Mediated by Bax and Puma That Is Counteracted by p21 and Unmasked by Bcl-xL Inhibition
    Article Snippet: The quality of the RNAs was assessed by analysis the 28S∶18S rRNA ratio using the RNA 6000 Nano Assay kit and the Agilent 2100 bioanalyser (Agilent Biotechnologies). .. The quality of the RNAs was assessed by analysis the 28S∶18S rRNA ratio using the RNA 6000 Nano Assay kit and the Agilent 2100 bioanalyser (Agilent Biotechnologies).

    Article Title: De novo transcriptome assembly of the grapevine phylloxera allows identification of genes differentially expressed between leaf- and root-feeding forms
    Article Snippet: RNA samples purity and quality was checked with a Bioanalyser 2100 (Agilent) and quantified by spectrophotometery (Nanodrop Technologies). .. RNA samples purity and quality was checked with a Bioanalyser 2100 (Agilent) and quantified by spectrophotometery (Nanodrop Technologies).

    SYBR Green Assay:

    Article Title: Serum-Nutrient Starvation Induces Cell Death Mediated by Bax and Puma That Is Counteracted by p21 and Unmasked by Bcl-xL Inhibition
    Article Snippet: The quality of the RNAs was assessed by analysis the 28S∶18S rRNA ratio using the RNA 6000 Nano Assay kit and the Agilent 2100 bioanalyser (Agilent Biotechnologies). .. Following foward and reverse primers designed with Amplifix software were used: p21 ( 5′-CAGCATGACAGATTTCTACCAC -3′ and 5′-GAGACTAAGGCAGAAGATGTAGAG -3′ ), rplpO ( 5′-GATGACCAGCCCAAAGGAGA -3′ and 5′- GTGATGTGCAGCTGATCAAGACT-3′ ), ß2microglobulin ( 5′-GGCATCTTCAAACCTCCATGATG -3′ and 5′- TTCACCCCCACTGAAAAAGATGA -3′ ).

    Article Title: De novo transcriptome assembly of the grapevine phylloxera allows identification of genes differentially expressed between leaf- and root-feeding forms
    Article Snippet: RNA samples purity and quality was checked with a Bioanalyser 2100 (Agilent) and quantified by spectrophotometery (Nanodrop Technologies). .. Primer sequences used for qRT-PCR were designed using Primer 3 software; sequences are available in Additional file .

    Article Title: The low affinity glucose transporter HxtB is also involved in glucose signalling and metabolism in Aspergillus nidulans
    Article Snippet: DNA was degraded with DNAse (Promega) according to manufacturer’s instructions and RNA was subsequently purified using the RNeasy® Mini Kit (Qiagen), according to manufacturer’s instructions. .. The quality of the RNA was verified using the Agilent Bioanalyser 2100 (Agilent technologies) and a RIM value of 8.0 as the RNA quality threshold. cDNA was synthesized from RNA using the ImProm-II™ Reverse Transcription System (Promega) according to manufacturer’s instructions. qRT-PCR was performed using the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) and the SYBR Green PCR Master Mix kit (Applied Biosystems), according to manufacturer’s instructions. .. Reactions and calculations were performed as previously described and gene expression were normalised by the expression of tubC .

    Multiplex Assay:

    Article Title: Serum-Nutrient Starvation Induces Cell Death Mediated by Bax and Puma That Is Counteracted by p21 and Unmasked by Bcl-xL Inhibition
    Article Snippet: The quality of the RNAs was assessed by analysis the 28S∶18S rRNA ratio using the RNA 6000 Nano Assay kit and the Agilent 2100 bioanalyser (Agilent Biotechnologies). .. Following foward and reverse primers designed with Amplifix software were used: p21 ( 5′-CAGCATGACAGATTTCTACCAC -3′ and 5′-GAGACTAAGGCAGAAGATGTAGAG -3′ ), rplpO ( 5′-GATGACCAGCCCAAAGGAGA -3′ and 5′- GTGATGTGCAGCTGATCAAGACT-3′ ), ß2microglobulin ( 5′-GGCATCTTCAAACCTCCATGATG -3′ and 5′- TTCACCCCCACTGAAAAAGATGA -3′ ).

    Article Title: Clinical and molecular characteristics of unicentric mediastinal Castleman disease
    Article Snippet: Multiplex PCR library were prepared using the AmpliSeq™ Cancer Hotspot v2 (Life Technologies) covering more than 2800 COSMIC hotspot mutations within the following 50 genes ( SMARCB1 , RB1 , TP53 , ERBB4 , FBXW7 , BRAF , TP53 , KIT , GNAS , HRAS , EGFR , PDGFRA , PIK3CA , CDKN2A , ERBB2 , ABL1 , JAK2 , KRAS , NRAS , NOTCH1 , ATM , FGFR1 , STK11 , PTPN11 , APC , SMAD4 , PTEN , SMO , CTNNB1 , RET , IDH2 , SRC , EZH2 , VHL , MPL , NPM1 , FLT3 , FGFR3 , CDH1 , KDR , HNF1A , MLH1 , ALK , IDH1 , GNAQ , AKT1 , JAK3 , FGFR2 , GNA11 , MET , CSF1R , CDKN2A ) and Ion AmpliSeq™ library kit V2. .. Quality control was performed using an Agilent 2100 Bioanalyser equipment (Agilent Technologies, USA).

    Agarose Gel Electrophoresis:

    Article Title: Population genetic diversity and hybrid detection in captive zebras
    Article Snippet: After checking the quality of genomic DNA by resolution on a 0.5% agarose gel and spectrophotometry (Nanodrop, USA), 500 ng of the genomic DNA was nebulized at 0.24 MPa for 1 min, and purified using the MinElute PCR Purification kit (QIAGEN). .. Short fragments were removed using AMPure XP beads, and the quality and quantity of the library were assessed using Agilent 2100 Bioanalyser (Agilent).

    In Vitro:

    Article Title: Elucidating how the saprophytic fungus Aspergillus nidulans uses the plant polyester suberin as carbon source
    Article Snippet: Quantification and purity of RNA were determined on a NanoDrop 1000 Spectrophotometer (Thermo Scientific) and RNA integrity analysed using an Agilent 2100 Bioanalyser with a RNA 6000 Nano Assay (Agilent Technologies). .. Quantification and purity of RNA were determined on a NanoDrop 1000 Spectrophotometer (Thermo Scientific) and RNA integrity analysed using an Agilent 2100 Bioanalyser with a RNA 6000 Nano Assay (Agilent Technologies).

    Article Title: TMEM45A is essential for hypoxia-induced chemoresistance in breast and liver cancer cells
    Article Snippet: RNA integrity was assessed using an Agilent 2100 Bioanalyser (Agilent). .. RNA integrity was assessed using an Agilent 2100 Bioanalyser (Agilent).

    Article Title: Circadian clock components control daily growth activities by modulating cytokinin levels and cell division‐associated gene expression in Populus trees, et al. Circadian clock components control daily growth activities by modulating cytokinin levels and cell division‐associated gene expression in Populus trees
    Article Snippet: Double‐stranded cDNA was cleaned up using the cDNA Cleanup Spin Column supplied in the Affymetrix GeneChip Sample Cleanup Module (Affymetrix) and used as a template for in vitro transcription of biotin‐labeled cRNA using the ENZO BioArray RNA Transcript Labeling Kit (Affymetrix). .. Biotin‐labeled cRNA was cleaned up using the cRNA Cleanup Spin Column supplied in the Affymetrix GeneChip Sample Cleanup Module and assessed for quantity and quality using the Agilent 2100 Bioanalyser (Agilent). cRNA was fragmented by metal‐induced hydrolysis to break down full‐length cRNA to 35–200 base fragments, of which 15 μg of adjusted cRNA was used to prepare 300 μl of hybridization cocktail.

    Ethanol Precipitation:

    Article Title: Elucidating how the saprophytic fungus Aspergillus nidulans uses the plant polyester suberin as carbon source
    Article Snippet: Total RNA was isolated from fungal mycelia (grounded to powder using mortar and pestle in liquid nitrogen) using the RNeasy Plant Mini Kit (QIAGEN) and further purified by ethanol precipitation [ ]. .. Quantification and purity of RNA were determined on a NanoDrop 1000 Spectrophotometer (Thermo Scientific) and RNA integrity analysed using an Agilent 2100 Bioanalyser with a RNA 6000 Nano Assay (Agilent Technologies).

    Next-Generation Sequencing:

    Article Title: Integrated analysis of the local and systemic changes preceding the development of post-partum cytological endometritis
    Article Snippet: Paragraph title: RNA extraction, library preparation and NGS sequencing ... The Agilent 2100 Bioanalyser (Agilent Technologies) was used to assess the quality of RNA, and RIN values ranged from 6 to 9.9 across all samples used (Additional file : Table S1).

    Article Title: Clinical and molecular characteristics of unicentric mediastinal Castleman disease
    Article Snippet: Paraffin-embedded samples were characterized using NGS (AmpliSeq™ Ion Torrent, Life Technologies) designed to amplify small DNA fragments. .. Quality control was performed using an Agilent 2100 Bioanalyser equipment (Agilent Technologies, USA).

    Laser Capture Microdissection:

    Article Title: Molecular markers associated with outcome and metastasis in human pancreatic cancer
    Article Snippet: RNA concentration and purity were determined spectrophotometrically using the Nanodrop ND-1000 (Nanodrop Technologies, Wilmington, DE) and RNA integrity was assessed using a Bioanalyser 2100 (Agilent Technologies, Santa Clara, CA). .. RNA concentration and purity were determined spectrophotometrically using the Nanodrop ND-1000 (Nanodrop Technologies, Wilmington, DE) and RNA integrity was assessed using a Bioanalyser 2100 (Agilent Technologies, Santa Clara, CA).

    TLDA Assay:

    Article Title: Neuronal MicroRNA Deregulation in Response to Alzheimer's Disease Amyloid-?
    Article Snippet: For microarray analysis, RNA quality was determined on a Bioanalyser 2100 (Agilent) and only RNA samples with an RNA integrity number (RIN) between 8 and 10 were used. .. For microarray analysis, RNA quality was determined on a Bioanalyser 2100 (Agilent) and only RNA samples with an RNA integrity number (RIN) between 8 and 10 were used.

    Spectrophotometry:

    Article Title: Elucidating how the saprophytic fungus Aspergillus nidulans uses the plant polyester suberin as carbon source
    Article Snippet: Total RNA was isolated from fungal mycelia (grounded to powder using mortar and pestle in liquid nitrogen) using the RNeasy Plant Mini Kit (QIAGEN) and further purified by ethanol precipitation [ ]. .. Quantification and purity of RNA were determined on a NanoDrop 1000 Spectrophotometer (Thermo Scientific) and RNA integrity analysed using an Agilent 2100 Bioanalyser with a RNA 6000 Nano Assay (Agilent Technologies). .. Fragmented and biotinylated cRNA was obtained by following GeneChip 3’ IVT Express Kit protocols.

    Article Title: Transcriptional Profiling of Whole Blood Identifies a Unique 5-Gene Signature for Myelofibrosis and Imminent Myelofibrosis Transformation
    Article Snippet: Total RNA was extracted from whole-blood using the Paxgene Blood RNA Kit (Qiagen, Franklin Lakes, NJ, USA). .. Quantity of RNA was determined with the NanoDrop spectrophotometer ND-8000 (NanoDrop Technologies, Wilmington, DE, USA) and quality of RNA was assessed using the Agilent 2100 Bioanalyser (Agilent Technologies, Palo Alto, CA). .. 300 ng of total RNA was converted to amplified RNA (aRNA) and fragmented using the MessageAmpTM III RNA amplification kit (Ambion, Austin, TX, USA).

    Article Title: Effect of Protein Kinase C delta (PKC-?) Inhibition on the Transcriptome of Normal and Systemic Sclerosis Human Dermal Fibroblasts In Vitro
    Article Snippet: Following exposure to rottlerin, DNA-free total RNA was isolated utilizing the RNeasy micro kit (Qiagen, Valencia, CA), according to the manufacturer's protocol. .. DNase-treated total RNA was ethanol precipitated and quantified on a NanoDrop ND-1000 spectrophotometer and RNA quality was analyzed on an Agilent 2100 bioanalyser (Agilent Technologies, Palo Alto, CA). .. Double-stranded cDNA was synthesized using T7 Oligo dT (Integrated DNA Technologies, Coralville, IA) and Superscript II double-stranded cDNA Kit (Invitrogen, Carlsbad, CA).

    Article Title: PPARα Is Required for PPARδ Action in Regulation of Body Weight and Hepatic Steatosis in Mice
    Article Snippet: Total RNA was quantified on a NanoDrop spectrophotometer (ND-8000) and samples were amplified and labelled using Illumina TotalPrep RNA Amplification Kit (Invitrogen, UK). .. All samples passed quality check using Agilent 2100 Bioanalyser and 1.5 μ g/biotin-labelled sample was hybridized with MouseWG-6 v2.0 Expression BeadChips (Illumina, USA).

    Article Title: Integrated analysis of the local and systemic changes preceding the development of post-partum cytological endometritis
    Article Snippet: The Nano-Drop ND-1000 UV–vis Spectrophotometer (NanoDrop Technologies Inc., Wilmington, DE, USA) was used to quantify the concentration of RNA. .. The Agilent 2100 Bioanalyser (Agilent Technologies) was used to assess the quality of RNA, and RIN values ranged from 6 to 9.9 across all samples used (Additional file : Table S1).

    Article Title: Population genetic diversity and hybrid detection in captive zebras
    Article Snippet: After checking the quality of genomic DNA by resolution on a 0.5% agarose gel and spectrophotometry (Nanodrop, USA), 500 ng of the genomic DNA was nebulized at 0.24 MPa for 1 min, and purified using the MinElute PCR Purification kit (QIAGEN). .. Short fragments were removed using AMPure XP beads, and the quality and quantity of the library were assessed using Agilent 2100 Bioanalyser (Agilent).

    Article Title: Neuronal MicroRNA Deregulation in Response to Alzheimer's Disease Amyloid-?
    Article Snippet: RNA quantity was routinely assessed on a NanoDrop 1000 spectrophotometer (Thermo Scientific). .. For microarray analysis, RNA quality was determined on a Bioanalyser 2100 (Agilent) and only RNA samples with an RNA integrity number (RIN) between 8 and 10 were used.

    Sampling:

    Article Title: Clinical and molecular characteristics of unicentric mediastinal Castleman disease
    Article Snippet: After morphological control of the quality of the tumor sampling, DNA was extracted using the Maxwell® 16 FFPE Plus LEV DNA Purification Kit (Promega Corporation, Madison, WI) and quantified using Qubit™ fluorometric quantitation device (Thermo Fisher Scientific, France). .. Quality control was performed using an Agilent 2100 Bioanalyser equipment (Agilent Technologies, USA).

    Concentration Assay:

    Article Title: TMEM45A is essential for hypoxia-induced chemoresistance in breast and liver cancer cells
    Article Snippet: RNA concentration and purity were determined spectrophotometrically using the Nanodrop ND-1000 (NanoDrop Products). .. RNA integrity was assessed using an Agilent 2100 Bioanalyser (Agilent).

    Article Title: Integrated analysis of the local and systemic changes preceding the development of post-partum cytological endometritis
    Article Snippet: The Nano-Drop ND-1000 UV–vis Spectrophotometer (NanoDrop Technologies Inc., Wilmington, DE, USA) was used to quantify the concentration of RNA. .. The Agilent 2100 Bioanalyser (Agilent Technologies) was used to assess the quality of RNA, and RIN values ranged from 6 to 9.9 across all samples used (Additional file : Table S1).

    Article Title: Distinct Epigenomic Features in End-Stage Failing Human Hearts
    Article Snippet: After chloroform extraction, ethanol was added to samples to a final concentration of 35%, and samples were loaded onto PureLink RNA columns (Invitrogen, 12183–018A). .. Integrity of all RNA samples was checked with the 2100 Bioanalyser (Agilent Technologies).

    Article Title: Molecular markers associated with outcome and metastasis in human pancreatic cancer
    Article Snippet: Total RNA was extracted using Trizol (Invitrogen, Grand Island, NY) and the RNeasy mini kit (Qiagen, Venlo, The Netherlands) according to the manufacturer’s guidelines. .. RNA concentration and purity were determined spectrophotometrically using the Nanodrop ND-1000 (Nanodrop Technologies, Wilmington, DE) and RNA integrity was assessed using a Bioanalyser 2100 (Agilent Technologies, Santa Clara, CA). .. Only samples with a RIN of at least 7.1 were used for further microarray analysis at the VIB Nucleomics Core ( http://www.nucleomics.be ).

    Quantitation Assay:

    Article Title: Clinical and molecular characteristics of unicentric mediastinal Castleman disease
    Article Snippet: After morphological control of the quality of the tumor sampling, DNA was extracted using the Maxwell® 16 FFPE Plus LEV DNA Purification Kit (Promega Corporation, Madison, WI) and quantified using Qubit™ fluorometric quantitation device (Thermo Fisher Scientific, France). .. Quality control was performed using an Agilent 2100 Bioanalyser equipment (Agilent Technologies, USA).

    MicroChIP Assay:

    Article Title: Anomalous Separation of Small Y-Chromosomal DNA Fragments on Microchip Electrophoresis
    Article Snippet: Paragraph title: 2.1. Microchip System ... Separation was performed on the Agilent 2100 Bioanalyser (Agilent Technologies, Waldbronn, Germany) which has epifluorescent detection with a semiconductor laser which emits at 630 nm.

    DNA Purification:

    Article Title: Clinical and molecular characteristics of unicentric mediastinal Castleman disease
    Article Snippet: After morphological control of the quality of the tumor sampling, DNA was extracted using the Maxwell® 16 FFPE Plus LEV DNA Purification Kit (Promega Corporation, Madison, WI) and quantified using Qubit™ fluorometric quantitation device (Thermo Fisher Scientific, France). .. Quality control was performed using an Agilent 2100 Bioanalyser equipment (Agilent Technologies, USA).

    Staining:

    Article Title: TMEM45A is essential for hypoxia-induced chemoresistance in breast and liver cancer cells
    Article Snippet: RNA integrity was assessed using an Agilent 2100 Bioanalyser (Agilent). .. Sample was then converted and amplified to antisense cRNA, labeled with biotin, in an in vitro transcription reaction.

    Article Title: Effect of Protein Kinase C delta (PKC-?) Inhibition on the Transcriptome of Normal and Systemic Sclerosis Human Dermal Fibroblasts In Vitro
    Article Snippet: DNase-treated total RNA was ethanol precipitated and quantified on a NanoDrop ND-1000 spectrophotometer and RNA quality was analyzed on an Agilent 2100 bioanalyser (Agilent Technologies, Palo Alto, CA). .. The labeled cRNA was fragmented by heat and ion-mediated hydrolysis and was hybridized to the Human Genome HU133A oligonucleotide array GeneChip (Affymetrix) which contains ∼500,000 spots comprised of 22,283 different probe sets representing 14,397 unique genes.

    Article Title: Molecular markers associated with outcome and metastasis in human pancreatic cancer
    Article Snippet: Only representative snap-frozen PDAC material- defined as a minimum of 30% cancer cells on H & E staining – was used for RNA extraction. .. RNA concentration and purity were determined spectrophotometrically using the Nanodrop ND-1000 (Nanodrop Technologies, Wilmington, DE) and RNA integrity was assessed using a Bioanalyser 2100 (Agilent Technologies, Santa Clara, CA).

    Variant Assay:

    Article Title: Clinical and molecular characteristics of unicentric mediastinal Castleman disease
    Article Snippet: Quality control was performed using an Agilent 2100 Bioanalyser equipment (Agilent Technologies, USA). .. Quality control was performed using an Agilent 2100 Bioanalyser equipment (Agilent Technologies, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Agilent technologies 2100 bioanalyzer
    Postfixation processing of an RNA 50mer with excess formaldehyde removed. Gel-simulated image (Agilent <t>2100</t> <t>Bioanalyzer)</t> of the RNA 50mer fixed in 5% buffered formaldehyde (pH 7.4) for 2 hours. A: Lane L: RNA ladder. Lane 1: Non–formaldehyde-treated
    2100 Bioanalyzer, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 99/100, based on 6120 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/2100 bioanalyzer/product/Agilent technologies
    Average 99 stars, based on 6120 article reviews
    Price from $9.99 to $1999.99
    2100 bioanalyzer - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    Postfixation processing of an RNA 50mer with excess formaldehyde removed. Gel-simulated image (Agilent 2100 Bioanalyzer) of the RNA 50mer fixed in 5% buffered formaldehyde (pH 7.4) for 2 hours. A: Lane L: RNA ladder. Lane 1: Non–formaldehyde-treated

    Journal:

    Article Title: The Effect of Formaldehyde Fixation on RNA

    doi: 10.1016/j.jmoldx.2011.01.010

    Figure Lengend Snippet: Postfixation processing of an RNA 50mer with excess formaldehyde removed. Gel-simulated image (Agilent 2100 Bioanalyzer) of the RNA 50mer fixed in 5% buffered formaldehyde (pH 7.4) for 2 hours. A: Lane L: RNA ladder. Lane 1: Non–formaldehyde-treated

    Article Snippet: The compositions of the total HeLa RNA and RNA 50mer preparations were characterized by capillary electrophoresis using a 2100 bioanalyzer (Agilent Technologies, Santa Clara, CA).

    Techniques:

    Effects of fixation and postfixation processing on total cellular RNA: gel-simulated image (Agilent 2100 Bioanalyzer) of total cellular RNA fixed in 5% buffered formaldehyde (pH 7.4) for 2 hours. Lane L: RNA ladder. Lane 1: Native non–formaldehyde-treated

    Journal:

    Article Title: The Effect of Formaldehyde Fixation on RNA

    doi: 10.1016/j.jmoldx.2011.01.010

    Figure Lengend Snippet: Effects of fixation and postfixation processing on total cellular RNA: gel-simulated image (Agilent 2100 Bioanalyzer) of total cellular RNA fixed in 5% buffered formaldehyde (pH 7.4) for 2 hours. Lane L: RNA ladder. Lane 1: Native non–formaldehyde-treated

    Article Snippet: The compositions of the total HeLa RNA and RNA 50mer preparations were characterized by capillary electrophoresis using a 2100 bioanalyzer (Agilent Technologies, Santa Clara, CA).

    Techniques:

    Effects of buffer composition on postfixation processing of an RNA 50mer: gel-simulated image (Agilent 2100 Bioanalyzer). Lane L: RNA ladder. Lane 1: Native RNA 50mer. Lane 2: RNA 50mer fixed in 5% buffered formaldehyde (pH 7.4) for 2 hours. Excess formaldehyde

    Journal:

    Article Title: The Effect of Formaldehyde Fixation on RNA

    doi: 10.1016/j.jmoldx.2011.01.010

    Figure Lengend Snippet: Effects of buffer composition on postfixation processing of an RNA 50mer: gel-simulated image (Agilent 2100 Bioanalyzer). Lane L: RNA ladder. Lane 1: Native RNA 50mer. Lane 2: RNA 50mer fixed in 5% buffered formaldehyde (pH 7.4) for 2 hours. Excess formaldehyde

    Article Snippet: The compositions of the total HeLa RNA and RNA 50mer preparations were characterized by capillary electrophoresis using a 2100 bioanalyzer (Agilent Technologies, Santa Clara, CA).

    Techniques:

    Postformaldehyde fixation processing of an RNA 50mer. Gel-simulated image (Agilent 2100 Bioanalyzer) of the RNA 50mer fixed in 5% buffered formaldehyde (pH 7.4) for 2 hours and then heated at 70°C for 30 minutes, where indicated, in the following

    Journal:

    Article Title: The Effect of Formaldehyde Fixation on RNA

    doi: 10.1016/j.jmoldx.2011.01.010

    Figure Lengend Snippet: Postformaldehyde fixation processing of an RNA 50mer. Gel-simulated image (Agilent 2100 Bioanalyzer) of the RNA 50mer fixed in 5% buffered formaldehyde (pH 7.4) for 2 hours and then heated at 70°C for 30 minutes, where indicated, in the following

    Article Snippet: The compositions of the total HeLa RNA and RNA 50mer preparations were characterized by capillary electrophoresis using a 2100 bioanalyzer (Agilent Technologies, Santa Clara, CA).

    Techniques:

    Effects of fixation and postfixation processing on total HeLa RNA. Electropherograms (Agilent 2100 Bioanalyzer) of total cellular RNA fixed in 5% buffered formaldehyde (pH 7.4) for 2 hours. FU denotes fluorescence units. A: Non–formaldehyde-treated

    Journal:

    Article Title: The Effect of Formaldehyde Fixation on RNA

    doi: 10.1016/j.jmoldx.2011.01.010

    Figure Lengend Snippet: Effects of fixation and postfixation processing on total HeLa RNA. Electropherograms (Agilent 2100 Bioanalyzer) of total cellular RNA fixed in 5% buffered formaldehyde (pH 7.4) for 2 hours. FU denotes fluorescence units. A: Non–formaldehyde-treated

    Article Snippet: The compositions of the total HeLa RNA and RNA 50mer preparations were characterized by capillary electrophoresis using a 2100 bioanalyzer (Agilent Technologies, Santa Clara, CA).

    Techniques: Fluorescence

    Analysis of plasma cfDNA obtained from one representative pregnant donor blood stored at 22°C using Agilent Bioanalyzer 2100 instrument and Agilent DNA high sensitivity Kit. A, Overlaid electropherograms of plasma cfDNA extracted from blood stored (at 22°C) in K 3 EDTA tubes at days 0, 3, 7, 14 and 28. B, Overlaid electropherograms of plasma cfDNA extracted from blood stored (at 22°C) in ProTeck tubes at days 0, 3, 7, 14 and 28. C, Bioanalyzer gel image for blood stored in K 3 EDTA tubes. D, Bioanalyzer gel image for blood stored in ProTeck tubes. Cell-free DNA obtained from 3 pregnant donors were analyzed. This figure shows only the results of one representative pregnant donor.

    Journal: PLoS ONE

    Article Title: A novel approach to stabilize fetal cell-free DNA fraction in maternal blood samples for extended period of time

    doi: 10.1371/journal.pone.0208508

    Figure Lengend Snippet: Analysis of plasma cfDNA obtained from one representative pregnant donor blood stored at 22°C using Agilent Bioanalyzer 2100 instrument and Agilent DNA high sensitivity Kit. A, Overlaid electropherograms of plasma cfDNA extracted from blood stored (at 22°C) in K 3 EDTA tubes at days 0, 3, 7, 14 and 28. B, Overlaid electropherograms of plasma cfDNA extracted from blood stored (at 22°C) in ProTeck tubes at days 0, 3, 7, 14 and 28. C, Bioanalyzer gel image for blood stored in K 3 EDTA tubes. D, Bioanalyzer gel image for blood stored in ProTeck tubes. Cell-free DNA obtained from 3 pregnant donors were analyzed. This figure shows only the results of one representative pregnant donor.

    Article Snippet: The Agilent 2100 Expert software analyze DNA profile of each sample automatically and displays electropherogram for each sample.

    Techniques:

    Analysis of plasma cfDNA obtained from one representative pregnant donor blood stored at 30°C using Agilent Bioanalyzer 2100 instrument and Agilent DNA high sensitivity Kit. A, Overlaid electropherograms of plasma cfDNA extracted from blood stored in K 3 EDTA tubes at days 0, 2, 3, 7 and 14. B, Overlaid electropherograms of plasma cfDNA extracted from blood stored in ProTeck tubes at days 0, 2, 3, 7 and 14. C, Bioanalyzer gel image for blood stored in K 3 EDTA tubes. D, Bioanalyzer gel image for blood stored in ProTeck tubes. Cell-free DNA obtained from 3 pregnant donors were analyzed. This figure shows only the results of one representative pregnant donor.

    Journal: PLoS ONE

    Article Title: A novel approach to stabilize fetal cell-free DNA fraction in maternal blood samples for extended period of time

    doi: 10.1371/journal.pone.0208508

    Figure Lengend Snippet: Analysis of plasma cfDNA obtained from one representative pregnant donor blood stored at 30°C using Agilent Bioanalyzer 2100 instrument and Agilent DNA high sensitivity Kit. A, Overlaid electropherograms of plasma cfDNA extracted from blood stored in K 3 EDTA tubes at days 0, 2, 3, 7 and 14. B, Overlaid electropherograms of plasma cfDNA extracted from blood stored in ProTeck tubes at days 0, 2, 3, 7 and 14. C, Bioanalyzer gel image for blood stored in K 3 EDTA tubes. D, Bioanalyzer gel image for blood stored in ProTeck tubes. Cell-free DNA obtained from 3 pregnant donors were analyzed. This figure shows only the results of one representative pregnant donor.

    Article Snippet: The Agilent 2100 Expert software analyze DNA profile of each sample automatically and displays electropherogram for each sample.

    Techniques:

    Analysis of plasma cfDNA obtained from one representative pregnant donor blood stored at 4°C using Agilent Bioanalyzer 2100 instrument and Agilent DNA high sensitivity Kit. A, Overlaid electropherograms of plasma cfDNA extracted from blood stored in K 3 EDTA tubes at days 0, 3, 7, 14 and 21. B, Overlaid electropherograms of plasma cfDNA extracted from blood stored in ProTeck tubes at days 0, 3, 7, 14 and 21. C, Bioanalyzer gel image for blood stored in K 3 EDTA tubes. D, Bioanalyzer gel image for blood stored in ProTeck tubes. Cell-free DNA obtained from 3 pregnant donors were analyzed. This figure shows only the results of one representative pregnant donor.

    Journal: PLoS ONE

    Article Title: A novel approach to stabilize fetal cell-free DNA fraction in maternal blood samples for extended period of time

    doi: 10.1371/journal.pone.0208508

    Figure Lengend Snippet: Analysis of plasma cfDNA obtained from one representative pregnant donor blood stored at 4°C using Agilent Bioanalyzer 2100 instrument and Agilent DNA high sensitivity Kit. A, Overlaid electropherograms of plasma cfDNA extracted from blood stored in K 3 EDTA tubes at days 0, 3, 7, 14 and 21. B, Overlaid electropherograms of plasma cfDNA extracted from blood stored in ProTeck tubes at days 0, 3, 7, 14 and 21. C, Bioanalyzer gel image for blood stored in K 3 EDTA tubes. D, Bioanalyzer gel image for blood stored in ProTeck tubes. Cell-free DNA obtained from 3 pregnant donors were analyzed. This figure shows only the results of one representative pregnant donor.

    Article Snippet: The Agilent 2100 Expert software analyze DNA profile of each sample automatically and displays electropherogram for each sample.

    Techniques:

    Application of Nextera DNA Flex to bacterial amplicons. a Libraries prepared using Nextera DNA Flex showed more consistent, even coverage compared with libraries prepared using Nextera XT; data depicts the sequence coverage of libraries prepared from the 3 kb E. coli amplicon. b PCR products ranging in size from 50 bp to 3 kb amplified from E. coli gDNA visualized on a 1% agarose gel. c Libraries prepared from a 1 ng input of these E. coli amplicons resulted in Bioanalyzer traces that depicted a slight increase in fragment size with increasing amplicon size. d Libraries were sequenced on a MiSeq and coverage of the E. coli genome determined for the different amplicon fragment size inputs. Sequenceable libraries were generated from amplicons ranging in size from 50 bp to 3 kb. e When sequencing data was downsampled to 25,000 reads, the larger fragment inputs were reaching a coverage maximum

    Journal: BMC Genomics

    Article Title: Bead-linked transposomes enable a normalization-free workflow for NGS library preparation

    doi: 10.1186/s12864-018-5096-9

    Figure Lengend Snippet: Application of Nextera DNA Flex to bacterial amplicons. a Libraries prepared using Nextera DNA Flex showed more consistent, even coverage compared with libraries prepared using Nextera XT; data depicts the sequence coverage of libraries prepared from the 3 kb E. coli amplicon. b PCR products ranging in size from 50 bp to 3 kb amplified from E. coli gDNA visualized on a 1% agarose gel. c Libraries prepared from a 1 ng input of these E. coli amplicons resulted in Bioanalyzer traces that depicted a slight increase in fragment size with increasing amplicon size. d Libraries were sequenced on a MiSeq and coverage of the E. coli genome determined for the different amplicon fragment size inputs. Sequenceable libraries were generated from amplicons ranging in size from 50 bp to 3 kb. e When sequencing data was downsampled to 25,000 reads, the larger fragment inputs were reaching a coverage maximum

    Article Snippet: Where described, library quality was determined by running 1 μl of the pooled library or an individual library on a Bioanalyzer (Agilent 2100 Bioanalyzer) using a High Sensitivity DNA kit (Agilent, cat. no. 5067–4626) or on a Fragment Analyzer (Advanced Analytical Fragment Analyzer) with the High Sensitivity NGS Fragment Analysis Kit (Advanced Analytical, cat. no. DNF-474).

    Techniques: Sequencing, Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Generated

    Bioanalyzer traces of libraries prepared from various sample types and species. a Libraries prepared from samples with a varied degree of formalin fixation; a higher ΔCq indicates more FFPE-induced DNA degradation compared with a positive control. b Increasing FFPE-induced DNA degradation has a small effect on average fragment size but a marked effect on the total library yield. Increasing the DNA input from 100 ng to 150 ng did not increase library yield, indicating bead saturation at a DNA input of around 100 ng regardless of the degree of DNA degradation. c Libraries prepared from gDNA from a range of animal (human, Angus, and mouse), plant (Arabidopsis and alfalfa), and bacterial ( E. coli and B. cereus ) species

    Journal: BMC Genomics

    Article Title: Bead-linked transposomes enable a normalization-free workflow for NGS library preparation

    doi: 10.1186/s12864-018-5096-9

    Figure Lengend Snippet: Bioanalyzer traces of libraries prepared from various sample types and species. a Libraries prepared from samples with a varied degree of formalin fixation; a higher ΔCq indicates more FFPE-induced DNA degradation compared with a positive control. b Increasing FFPE-induced DNA degradation has a small effect on average fragment size but a marked effect on the total library yield. Increasing the DNA input from 100 ng to 150 ng did not increase library yield, indicating bead saturation at a DNA input of around 100 ng regardless of the degree of DNA degradation. c Libraries prepared from gDNA from a range of animal (human, Angus, and mouse), plant (Arabidopsis and alfalfa), and bacterial ( E. coli and B. cereus ) species

    Article Snippet: Where described, library quality was determined by running 1 μl of the pooled library or an individual library on a Bioanalyzer (Agilent 2100 Bioanalyzer) using a High Sensitivity DNA kit (Agilent, cat. no. 5067–4626) or on a Fragment Analyzer (Advanced Analytical Fragment Analyzer) with the High Sensitivity NGS Fragment Analysis Kit (Advanced Analytical, cat. no. DNF-474).

    Techniques: Formalin-fixed Paraffin-Embedded, Positive Control

    Application of Nextera DNA Flex to human amplicons. a Human leukocyte antigen (HLA) gene amplicons used as inputs for library preparation visualized on a 1% agarose gel. Lanes and expected amplicon sizes are as follows: 1, KBL Ladder; 2, HLA-A (4.1 kb); 3, HLA-B (2.8 kb); 4, HLA-C (4.2 kb); 5, HLA-DPA1 (10.3 kb); 6, HLA-DPB1 (9.7 kb); 7, HLA-DQA1 (7.3 kb); 8, HLA-DRB2 (4.6 kb); 9, HLA-DQB1 (7.1 kb). b Nextera DNA Flex library yields of all HLA amplicons were within the acceptable values of > 4 ng/μl and 9–13 ng/μl for 1 ng and 100–300 ng inputs, respectively. The yields for Nextera DNA Flex libraries were higher than for those prepared using TruSight HLA; for TruSight HLA, libraries were prepared from 1 ng of each amplicon and then pooled. c The Bioanalyzer profiles depict library fragment size distributions within the acceptable range; the distribution is narrower for the Nextera DNA Flex libraries (1 ng DNA inputs) than the TruSight HLA libraries. d Sequencing coverage depth and uniformity were higher for libraries prepared using Nextera DNA Flex (Flex) compared with TruSight HLA (TS HLA). e Libraries were sequenced on a NextSeq 550, with downsampling to 25,000 reads per amplicon. Library preparation using Nextera DNA Flex (orange) resulted in more uniform coverage of the entire human mitochondrial chromosome when compared with Nextera XT (grey). The location of the PCR primers used to create the two mtDNA amplicons are depicted by blue and red arrows. Dotted-line rectangle indicates the D-Loop region. f Zoomed in view shows more uniform coverage with Nextera DNA Flex within the D-Loop region

    Journal: BMC Genomics

    Article Title: Bead-linked transposomes enable a normalization-free workflow for NGS library preparation

    doi: 10.1186/s12864-018-5096-9

    Figure Lengend Snippet: Application of Nextera DNA Flex to human amplicons. a Human leukocyte antigen (HLA) gene amplicons used as inputs for library preparation visualized on a 1% agarose gel. Lanes and expected amplicon sizes are as follows: 1, KBL Ladder; 2, HLA-A (4.1 kb); 3, HLA-B (2.8 kb); 4, HLA-C (4.2 kb); 5, HLA-DPA1 (10.3 kb); 6, HLA-DPB1 (9.7 kb); 7, HLA-DQA1 (7.3 kb); 8, HLA-DRB2 (4.6 kb); 9, HLA-DQB1 (7.1 kb). b Nextera DNA Flex library yields of all HLA amplicons were within the acceptable values of > 4 ng/μl and 9–13 ng/μl for 1 ng and 100–300 ng inputs, respectively. The yields for Nextera DNA Flex libraries were higher than for those prepared using TruSight HLA; for TruSight HLA, libraries were prepared from 1 ng of each amplicon and then pooled. c The Bioanalyzer profiles depict library fragment size distributions within the acceptable range; the distribution is narrower for the Nextera DNA Flex libraries (1 ng DNA inputs) than the TruSight HLA libraries. d Sequencing coverage depth and uniformity were higher for libraries prepared using Nextera DNA Flex (Flex) compared with TruSight HLA (TS HLA). e Libraries were sequenced on a NextSeq 550, with downsampling to 25,000 reads per amplicon. Library preparation using Nextera DNA Flex (orange) resulted in more uniform coverage of the entire human mitochondrial chromosome when compared with Nextera XT (grey). The location of the PCR primers used to create the two mtDNA amplicons are depicted by blue and red arrows. Dotted-line rectangle indicates the D-Loop region. f Zoomed in view shows more uniform coverage with Nextera DNA Flex within the D-Loop region

    Article Snippet: Where described, library quality was determined by running 1 μl of the pooled library or an individual library on a Bioanalyzer (Agilent 2100 Bioanalyzer) using a High Sensitivity DNA kit (Agilent, cat. no. 5067–4626) or on a Fragment Analyzer (Advanced Analytical Fragment Analyzer) with the High Sensitivity NGS Fragment Analysis Kit (Advanced Analytical, cat. no. DNF-474).

    Techniques: Agarose Gel Electrophoresis, Amplification, Sequencing, Polymerase Chain Reaction