bigdye terminator v3 1 cycle sequencing kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    BigDye Terminator v3 1 Cycle Sequencing Kit
    Description:
    The BigDye Terminator v3 1 Cycle Sequencing Kit s robust highly flexible chemistry is ideal for de novo sequencing resequencing and finishing with PCR product Plasmid Fosmid and BAC templates • Improve the quality of your results for a wide range of sequencing applications • Optimized for long read lengths • Better dye mobility characteristics • Improved performance reading through GT rich regions • Get longer higher quality reads with more uniform peak heights and optimal signal balance • Enhance your productivity and reduce costs Get More Uniform Peak Heights Improved AccuracyWith BigDye Terminator v3 1 kit superior chemistry you generate data with uniform peak heights and optimized signal balance This results in longer higher quality reads and more accurate base assignments for heterozygote and mutation detection For Research Use Only Not for use in diagnostics procedures
    Catalog Number:
    4337454
    Price:
    None
    Applications:
    Kits & Reagents for Sanger Sequencing|Sanger Sequencing|Sanger Sequencing Technology & Accessories|Sequencing
    Category:
    Kits and Assays
    Buy from Supplier


    Structured Review

    Thermo Fisher bigdye terminator v3 1 cycle sequencing kit
    DNA cleavage and strand exchange by SprA. ( A ) Direct sequencing of the intermediates of the SprA-mediated integration reaction. The intermediates: the left and right half-sites of attP , were directly sequenced using a <t>BigDye</t> Terminator <t>v3.1</t> Cycle Sequencing Kit and an ABI 3500 DNA analyzer. The 16 bp overlapping sequence is underlined. The 3΄-end nucleotides indicated by the circles are adenines added by the terminal transferase activity of Taq polymerase used for the cycle sequencing reaction. The cleavage point of attP is shown to the left (indicated by the lines and triangles). ( B ) Effects of point mutations of the central dinucleotides on DNA recombination. Point mutations were introduced into the AAA nucleotides at the center of the attB site (A→T). In vitro integration recombination was performed using 0.5 μM SprA and 50 ng each of the wild-type attP and the mutated attB substrates.
    The BigDye Terminator v3 1 Cycle Sequencing Kit s robust highly flexible chemistry is ideal for de novo sequencing resequencing and finishing with PCR product Plasmid Fosmid and BAC templates • Improve the quality of your results for a wide range of sequencing applications • Optimized for long read lengths • Better dye mobility characteristics • Improved performance reading through GT rich regions • Get longer higher quality reads with more uniform peak heights and optimal signal balance • Enhance your productivity and reduce costs Get More Uniform Peak Heights Improved AccuracyWith BigDye Terminator v3 1 kit superior chemistry you generate data with uniform peak heights and optimized signal balance This results in longer higher quality reads and more accurate base assignments for heterozygote and mutation detection For Research Use Only Not for use in diagnostics procedures
    https://www.bioz.com/result/bigdye terminator v3 1 cycle sequencing kit/product/Thermo Fisher
    Average 90 stars, based on 3052 article reviews
    Price from $9.99 to $1999.99
    bigdye terminator v3 1 cycle sequencing kit - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "Mechanism of bacterial gene rearrangement: SprA-catalyzed precise DNA recombination and its directionality control by SprB ensure the gene rearrangement and stable expression of spsM during sporulation in Bacillus subtilis"

    Article Title: Mechanism of bacterial gene rearrangement: SprA-catalyzed precise DNA recombination and its directionality control by SprB ensure the gene rearrangement and stable expression of spsM during sporulation in Bacillus subtilis

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx466

    DNA cleavage and strand exchange by SprA. ( A ) Direct sequencing of the intermediates of the SprA-mediated integration reaction. The intermediates: the left and right half-sites of attP , were directly sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit and an ABI 3500 DNA analyzer. The 16 bp overlapping sequence is underlined. The 3΄-end nucleotides indicated by the circles are adenines added by the terminal transferase activity of Taq polymerase used for the cycle sequencing reaction. The cleavage point of attP is shown to the left (indicated by the lines and triangles). ( B ) Effects of point mutations of the central dinucleotides on DNA recombination. Point mutations were introduced into the AAA nucleotides at the center of the attB site (A→T). In vitro integration recombination was performed using 0.5 μM SprA and 50 ng each of the wild-type attP and the mutated attB substrates.
    Figure Legend Snippet: DNA cleavage and strand exchange by SprA. ( A ) Direct sequencing of the intermediates of the SprA-mediated integration reaction. The intermediates: the left and right half-sites of attP , were directly sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit and an ABI 3500 DNA analyzer. The 16 bp overlapping sequence is underlined. The 3΄-end nucleotides indicated by the circles are adenines added by the terminal transferase activity of Taq polymerase used for the cycle sequencing reaction. The cleavage point of attP is shown to the left (indicated by the lines and triangles). ( B ) Effects of point mutations of the central dinucleotides on DNA recombination. Point mutations were introduced into the AAA nucleotides at the center of the attB site (A→T). In vitro integration recombination was performed using 0.5 μM SprA and 50 ng each of the wild-type attP and the mutated attB substrates.

    Techniques Used: Sequencing, Activity Assay, In Vitro

    Related Articles

    Clone Assay:

    Article Title: CSL311, a novel, potent, therapeutic monoclonal antibody for the treatment of diseases mediated by the common β chain of the IL-3, GM-CSF and IL-5 receptors
    Article Snippet: Recombinant Fab fragments of 9A2 and affinity matured variants were generated by cloning the entire light chain and a truncated heavy chain, where a stop codon was introduced after amino acid 241, separately into pcDNA3.1 as described above. .. The nt sequences of all plasmid constructs were verified by sequencing both strands using BigDye™ Terminator Version 3.1 Ready Reaction Cycle Sequencing (Invitrogen™, Thermo Fisher Scientific.4337455) and an Applied Biosystems 3130xl Genetic Analyzer.

    Article Title: Differential Gene Expression in the Liver of the African Lungfish, Protopterus annectens, after 6 Months of Aestivation in Air or 1 Day of Arousal from 6 Months of Aestivation
    Article Snippet: Differentially expressed cDNAs were cloned using pGEM-T easy vector system kit (Promega Corporation, Madison, WI, USA), transformed into chemically competent JM109 Escherichia coli (Promega Corporation), and plated onto Luria-Bertani (LB) agar with ampicillin, 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) and isopropyl β-D-thiogalactopyranoside (IPTG). .. Approximately 80–100 ng of plasmid DNA was used in BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Corporation) with 2 μM T7 primers.

    Article Title: Template properties of mutagenic cytosine analogues in reverse transcription
    Article Snippet: PCR roducts were purified on 2% agarose gel, and a part of the purified DNA was sequenced directly using a BigDye terminator v3.1 Cycle Sequencing Kit and an ABI PRISM 3100-Avant Genetic Analyzer (Applied Biosystems). .. The remaining cDNA was ligated into pBluescript II SK (−) after digestion by SacI and KpnI, and cloned in E.coli , and the integrated plasmid obtained from the bacteria were sequenced with ABI PRISM 3100-Avant Genetic Analyzer.

    Article Title: Majority of Children With Type 1 Diabetes Produce and Deposit Anti-Tissue Transglutaminase Antibodies in the Small Intestine
    Article Snippet: .. The V genes from the different anti-TG2 scFv clones were sequenced (BigDye Terminator v3.1 Cycle Sequencing kit; Applied Biosystems), and the VH gene families used were assessed by screening against the V BASE ( http://vbase.mrc-cpe.cam.ac.uk ) database ( ). .. Immunofluorescence analysis with the different gene family anti-TG2 scFvs was performed on histological sections of monkey esophagus (MeDiCa, Encinitas, CA).

    Amplification:

    Article Title: New Insights into Samango Monkey Speciation in South Africa
    Article Snippet: After the initial PCR amplification, products were purified according to the Exo/Sap amplicon purification method described by Werle [ ]. .. Cycle sequencing of the PCR products obtained was performed with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer’s protocol.

    Article Title: Generation of Single-Copy Transposon Insertions in Clostridium perfringens by Electroporation of Phage Mu DNA Transposition Complexes ▿
    Article Snippet: For amplification of the genome regions 5′ and 3′ of the inserted transposon, the primer pair Y-linker primer (CTGCTCGAATTCAAGCTTCT) and Em-Mu seq rev (ATCAGCGGCCGCGATC) and the primer pair Y-linker primer and Em-Mu seq fw (TCTGCAGACGCGTCGACGTCA), respectively, were used. .. Nucleotide sequences were analyzed using a BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA), a DyeEx 2.0 spin kit (Qiagen), and an ABI Prism 3100 genetic analyzer (Applied Biosystems).

    Article Title: Multiplexed CRISPR/Cas9-mediated knockout of 19 Fanconi anemia pathway genes in zebrafish revealed their roles in growth, sexual development and fertility
    Article Snippet: Amplification of actb2 (Forward primer– 5’-GTATCCTGACCCTGAAGTACCC-3’; Reverse primer– 5’-AGCACAGCCTGGATGGCAACG-3’) using 2 μl of diluted reaction mixture was performed as control for cDNA quality. .. For Sanger sequencing, the PCR products were treated with USB ExoSAP-IT (Affymetrix), and sequencing reactions were carried out with RT-PCR primers using the Bigdye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and run on ABI3730XL sequencer.

    Article Title: Fungal aneurism of the right posterior inferior cerebellar artery (PICA)
    Article Snippet: .. The obtained amplicon was purified by using QIAquick PCR Purification Kit (Qiagen) and sequenced with BigDye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystem). .. Reaction products were purified by 3 M Sodium Acetate Solution, pH 5.2 and ethanol precipitation, dissolved in distilled water and analyzed on 3130xl Genetic Analyzer under standard electrophoretic conditions ( ).

    Article Title: Differential Gene Expression in the Liver of the African Lungfish, Protopterus annectens, after 6 Months of Aestivation in Air or 1 Day of Arousal from 6 Months of Aestivation
    Article Snippet: The primary and secondary PCR amplification of these reciprocal subtractions of cDNA from the control and aestivated fish produced 1 forward and 1 reverse SSH libraries enriched in differentially expressed transcripts. .. Approximately 80–100 ng of plasmid DNA was used in BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Corporation) with 2 μM T7 primers.

    Article Title: Template properties of mutagenic cytosine analogues in reverse transcription
    Article Snippet: A reverse transcription reaction mixture (10 μl) containing 50 mM Tris–HCl (pH 8.3), 50 mM KCl, 1% Nonidet P-40, 10 mM MgCl2 , 3 mM DTT, 0.5 mM dNTPs, 50 nM template/primer, 5 U RNase inhibitor and 2 μM HIV reverse transcriptase was incubated at 37°C for 1 h and then heated at 70°C for 10 min. After the reaction, the RT products were amplified by PCR. .. PCR roducts were purified on 2% agarose gel, and a part of the purified DNA was sequenced directly using a BigDye terminator v3.1 Cycle Sequencing Kit and an ABI PRISM 3100-Avant Genetic Analyzer (Applied Biosystems).

    Article Title: Methylation Status of the Adeno-Associated Virus Type 2 (AAV2)
    Article Snippet: Sanger sequencing was performed with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s recommendations. .. For the amplification of the modified CpG-containing DNA fragments, 22 PCR primer pairs were designed using the MethPrimer program [ ] ( ).

    Synthesized:

    Article Title: CSL311, a novel, potent, therapeutic monoclonal antibody for the treatment of diseases mediated by the common β chain of the IL-3, GM-CSF and IL-5 receptors
    Article Snippet: Anti-IL-5Rα chain antibody cDNA was synthesized by (Geneart®, Invitrogen™, Thermo Fisher Scientific). .. The nt sequences of all plasmid constructs were verified by sequencing both strands using BigDye™ Terminator Version 3.1 Ready Reaction Cycle Sequencing (Invitrogen™, Thermo Fisher Scientific.4337455) and an Applied Biosystems 3130xl Genetic Analyzer.

    Construct:

    Article Title: CSL311, a novel, potent, therapeutic monoclonal antibody for the treatment of diseases mediated by the common β chain of the IL-3, GM-CSF and IL-5 receptors
    Article Snippet: .. The nt sequences of all plasmid constructs were verified by sequencing both strands using BigDye™ Terminator Version 3.1 Ready Reaction Cycle Sequencing (Invitrogen™, Thermo Fisher Scientific.4337455) and an Applied Biosystems 3130xl Genetic Analyzer. .. Transient transfections for generation of recombinant proteins Transient transfections of expression plasmids using FS293F cells were performed using 293fectin™ transfection reagent (Invitrogen™, Thermo Fisher Scientific.

    Article Title: Valine biosynthesis in Saccharomyces cerevisiae is regulated by the mitochondrial branched-chain amino acid aminotransferase Bat1
    Article Snippet: Site-direct mutagenesis was used to constructs pRS416-K219A-Bat1 and pRS415-K202A-Bat2 using mutagenic primers. .. DNA sequence was confirmed by DNA sequencing using BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems).

    SYBR Green Assay:

    Article Title: Does the prenatal bisphenol A exposure alter DNA methylation levels in the mouse hippocampus?: An analysis using a high-sensitivity methylome technique
    Article Snippet: TITANIUM Taq DNA polymerase was from Takara Bio (Kusatsu, Japan) and LightCycler® 480 SYBR Green I Master was from Roche (Diagnostics GmbH, Mannheim, Germany). .. POP-7™ Polymer, GeneScan™ 500 LIZ® Size Standard and BigDye® Terminator v3.1 Cycle Sequencing Kit were from ThermoFisher Scientific Inc., (San Diego, CA, USA).

    Random Hexamer Labeling:

    Article Title: Multiplexed CRISPR/Cas9-mediated knockout of 19 Fanconi anemia pathway genes in zebrafish revealed their roles in growth, sexual development and fertility
    Article Snippet: Random hexamer primer and 1 μg of total RNA were used to synthesize cDNA using Superscript IV First-Strand Synthesis system for RT-PCR (Invitrogen). .. For Sanger sequencing, the PCR products were treated with USB ExoSAP-IT (Affymetrix), and sequencing reactions were carried out with RT-PCR primers using the Bigdye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and run on ABI3730XL sequencer.

    Formalin-fixed Paraffin-Embedded:

    Article Title: Fungal aneurism of the right posterior inferior cerebellar artery (PICA)
    Article Snippet: For extraction and purification of DNA from formalin-fixed paraffin-embedded tissues (FFPE) was used QIAamp DNA FFPE Tissue Kit (Qiagen). .. The obtained amplicon was purified by using QIAquick PCR Purification Kit (Qiagen) and sequenced with BigDye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystem).

    Expressing:

    Article Title: CSL311, a novel, potent, therapeutic monoclonal antibody for the treatment of diseases mediated by the common β chain of the IL-3, GM-CSF and IL-5 receptors
    Article Snippet: Paragraph title: Generation of cDNA expression plasmids ... The nt sequences of all plasmid constructs were verified by sequencing both strands using BigDye™ Terminator Version 3.1 Ready Reaction Cycle Sequencing (Invitrogen™, Thermo Fisher Scientific.4337455) and an Applied Biosystems 3130xl Genetic Analyzer.

    Article Title: Multiplexed CRISPR/Cas9-mediated knockout of 19 Fanconi anemia pathway genes in zebrafish revealed their roles in growth, sexual development and fertility
    Article Snippet: Paragraph title: Analysis of expression of mutant alleles by RT-PCR and sequencing ... For Sanger sequencing, the PCR products were treated with USB ExoSAP-IT (Affymetrix), and sequencing reactions were carried out with RT-PCR primers using the Bigdye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and run on ABI3730XL sequencer.

    Modification:

    Article Title: Generation of Single-Copy Transposon Insertions in Clostridium perfringens by Electroporation of Phage Mu DNA Transposition Complexes ▿
    Article Snippet: To amplify the transposon-flanking genome sequences, a modification of the method of Kwon and Ricke ( ) was used. .. Nucleotide sequences were analyzed using a BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA), a DyeEx 2.0 spin kit (Qiagen), and an ABI Prism 3100 genetic analyzer (Applied Biosystems).

    Article Title: Methylation Status of the Adeno-Associated Virus Type 2 (AAV2)
    Article Snippet: Sanger sequencing was performed with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s recommendations. .. For the amplification of the modified CpG-containing DNA fragments, 22 PCR primer pairs were designed using the MethPrimer program [ ] ( ).

    Transformation Assay:

    Article Title: Valine biosynthesis in Saccharomyces cerevisiae is regulated by the mitochondrial branched-chain amino acid aminotransferase Bat1
    Article Snippet: DNA sequence was confirmed by DNA sequencing using BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). .. Plasmids were subsequently transformed to wild-type cells for observation of protein localization or to ∆bat1∆bat2 cells for phenotypic study.

    Article Title: Differential Gene Expression in the Liver of the African Lungfish, Protopterus annectens, after 6 Months of Aestivation in Air or 1 Day of Arousal from 6 Months of Aestivation
    Article Snippet: Differentially expressed cDNAs were cloned using pGEM-T easy vector system kit (Promega Corporation, Madison, WI, USA), transformed into chemically competent JM109 Escherichia coli (Promega Corporation), and plated onto Luria-Bertani (LB) agar with ampicillin, 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) and isopropyl β-D-thiogalactopyranoside (IPTG). .. Approximately 80–100 ng of plasmid DNA was used in BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Corporation) with 2 μM T7 primers.

    Derivative Assay:

    Article Title: Methylation Status of the Adeno-Associated Virus Type 2 (AAV2)
    Article Snippet: The methylation pattern of the AAV genomes derived from total Detroit 6 cell DNA, from the isolated high molecular weight DNA, and from the packaged viral DNA was determined by bisulfite PCR. .. Sanger sequencing was performed with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s recommendations.

    Genomic Sequencing:

    Article Title: Generation of Single-Copy Transposon Insertions in Clostridium perfringens by Electroporation of Phage Mu DNA Transposition Complexes ▿
    Article Snippet: Nucleotide sequences were analyzed using a BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA), a DyeEx 2.0 spin kit (Qiagen), and an ABI Prism 3100 genetic analyzer (Applied Biosystems). .. Genomic transposon insertion sites were identified by comparing the sequences to the publicly available genomic sequences of C. perfringens strains 13, ATCC 13124, and SM101, using BLAST on the European Bioinformatics Institute server.

    Methylation:

    Article Title: Methylation Status of the Adeno-Associated Virus Type 2 (AAV2)
    Article Snippet: The methylation pattern of the AAV genomes derived from total Detroit 6 cell DNA, from the isolated high molecular weight DNA, and from the packaged viral DNA was determined by bisulfite PCR. .. Sanger sequencing was performed with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s recommendations.

    Generated:

    Article Title: CSL311, a novel, potent, therapeutic monoclonal antibody for the treatment of diseases mediated by the common β chain of the IL-3, GM-CSF and IL-5 receptors
    Article Snippet: Recombinant Fab fragments of 9A2 and affinity matured variants were generated by cloning the entire light chain and a truncated heavy chain, where a stop codon was introduced after amino acid 241, separately into pcDNA3.1 as described above. .. The nt sequences of all plasmid constructs were verified by sequencing both strands using BigDye™ Terminator Version 3.1 Ready Reaction Cycle Sequencing (Invitrogen™, Thermo Fisher Scientific.4337455) and an Applied Biosystems 3130xl Genetic Analyzer.

    Polymerase Chain Reaction:

    Article Title: New Insights into Samango Monkey Speciation in South Africa
    Article Snippet: .. Cycle sequencing of the PCR products obtained was performed with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer’s protocol. .. Sequencing products were purified with the ZR DNA Sequencing Clean-Up Kit (Zymo Research) and sequenced on an ABI 3130 genetic analyser in forward and reverse.

    Article Title: A New Zearalenone Biodegradation Strategy Using Non-Pathogenic Rhodococcus pyridinivorans K408 Strain
    Article Snippet: PCR products were purified with the Viogene DNA/RNA Extraction Kit (Viogene BioTek Corp., Taiwan). .. The almost complete 16 S rRNA gene sequence of strain K408 was determined by using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA) in accordance with the instructions of the manufacturer.

    Article Title: Multiplexed CRISPR/Cas9-mediated knockout of 19 Fanconi anemia pathway genes in zebrafish revealed their roles in growth, sexual development and fertility
    Article Snippet: .. For Sanger sequencing, the PCR products were treated with USB ExoSAP-IT (Affymetrix), and sequencing reactions were carried out with RT-PCR primers using the Bigdye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and run on ABI3730XL sequencer. .. The sequencing data was evaluated by aligning it to Danio rerio reference sequence using Sequencher software (Gene Codes Corporation).

    Article Title: Molecular Identification and Phylogenetic Analysis of Nuclear rDNA Sequences of Clonorchis sinensis Isolates From Human Fecal Samples in Heilongjiang Province, China
    Article Snippet: .. Nucleotide Sequencing All the PCR products of expected size were directly sequenced on an ABI PRISM 3730 XL DNA Analyzer by Sinogeno-max Biotechnology Co., Ltd. (Beijing, China), using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, United States). .. DNA Sequence Analysis The positive results in electrophoresis were selected for sequencing.

    Article Title: A HAND2 Loss-of-Function Mutation Causes Familial Ventricular Septal Defect and Pulmonary Stenosis
    Article Snippet: PCR was performed with HotStar Taq DNA Polymerase (Qiagen, Hilden, Germany) on a Veriti Thermal Cycler (Applied Biosystems, Foster, CA). .. The amplicons were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), under an ABI PRISM 3130 XL DNA Analyzer (Applied Biosystems).

    Article Title: Valine biosynthesis in Saccharomyces cerevisiae is regulated by the mitochondrial branched-chain amino acid aminotransferase Bat1
    Article Snippet: PCR products were then digested with Dpn I before introduction into E. coli DH5α cells . .. DNA sequence was confirmed by DNA sequencing using BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems).

    Article Title: Fungal aneurism of the right posterior inferior cerebellar artery (PICA)
    Article Snippet: .. The obtained amplicon was purified by using QIAquick PCR Purification Kit (Qiagen) and sequenced with BigDye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystem). .. Reaction products were purified by 3 M Sodium Acetate Solution, pH 5.2 and ethanol precipitation, dissolved in distilled water and analyzed on 3130xl Genetic Analyzer under standard electrophoretic conditions ( ).

    Article Title: Differential Gene Expression in the Liver of the African Lungfish, Protopterus annectens, after 6 Months of Aestivation in Air or 1 Day of Arousal from 6 Months of Aestivation
    Article Snippet: The primary and secondary PCR amplification of these reciprocal subtractions of cDNA from the control and aestivated fish produced 1 forward and 1 reverse SSH libraries enriched in differentially expressed transcripts. .. Approximately 80–100 ng of plasmid DNA was used in BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Corporation) with 2 μM T7 primers.

    Article Title: Template properties of mutagenic cytosine analogues in reverse transcription
    Article Snippet: .. PCR roducts were purified on 2% agarose gel, and a part of the purified DNA was sequenced directly using a BigDye terminator v3.1 Cycle Sequencing Kit and an ABI PRISM 3100-Avant Genetic Analyzer (Applied Biosystems). .. The remaining cDNA was ligated into pBluescript II SK (−) after digestion by SacI and KpnI, and cloned in E.coli , and the integrated plasmid obtained from the bacteria were sequenced with ABI PRISM 3100-Avant Genetic Analyzer.

    Article Title: Methylation Status of the Adeno-Associated Virus Type 2 (AAV2)
    Article Snippet: Treatment of the genomic DNA was optimized by adding an extra denaturation step (95 °C, 5 min) followed by incubation at 60 °C for 2 h. The conversion efficiency of the unmethylated cytosines was verified by Sanger sequencing of several PCR fragments from the 27 CpG sites containing fragment AAV11 ( ). .. Sanger sequencing was performed with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s recommendations.

    DNA Sequencing:

    Article Title: New Insights into Samango Monkey Speciation in South Africa
    Article Snippet: Cycle sequencing of the PCR products obtained was performed with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer’s protocol. .. Sequencing products were purified with the ZR DNA Sequencing Clean-Up Kit (Zymo Research) and sequenced on an ABI 3130 genetic analyser in forward and reverse.

    Article Title: Valine biosynthesis in Saccharomyces cerevisiae is regulated by the mitochondrial branched-chain amino acid aminotransferase Bat1
    Article Snippet: .. DNA sequence was confirmed by DNA sequencing using BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). .. Transformants of E. coli DH5α cells were selected based on blue-white colony screening.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Multiplexed CRISPR/Cas9-mediated knockout of 19 Fanconi anemia pathway genes in zebrafish revealed their roles in growth, sexual development and fertility
    Article Snippet: .. For Sanger sequencing, the PCR products were treated with USB ExoSAP-IT (Affymetrix), and sequencing reactions were carried out with RT-PCR primers using the Bigdye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and run on ABI3730XL sequencer. .. The sequencing data was evaluated by aligning it to Danio rerio reference sequence using Sequencher software (Gene Codes Corporation).

    Recombinant:

    Article Title: CSL311, a novel, potent, therapeutic monoclonal antibody for the treatment of diseases mediated by the common β chain of the IL-3, GM-CSF and IL-5 receptors
    Article Snippet: Recombinant Fab fragments of 9A2 and affinity matured variants were generated by cloning the entire light chain and a truncated heavy chain, where a stop codon was introduced after amino acid 241, separately into pcDNA3.1 as described above. .. The nt sequences of all plasmid constructs were verified by sequencing both strands using BigDye™ Terminator Version 3.1 Ready Reaction Cycle Sequencing (Invitrogen™, Thermo Fisher Scientific.4337455) and an Applied Biosystems 3130xl Genetic Analyzer.

    Article Title: Majority of Children With Type 1 Diabetes Produce and Deposit Anti-Tissue Transglutaminase Antibodies in the Small Intestine
    Article Snippet: Recombinant human TG2 was obtained by amplifying as described previously ( ). .. The V genes from the different anti-TG2 scFv clones were sequenced (BigDye Terminator v3.1 Cycle Sequencing kit; Applied Biosystems), and the VH gene families used were assessed by screening against the V BASE ( http://vbase.mrc-cpe.cam.ac.uk ) database ( ).

    Immunofluorescence:

    Article Title: Majority of Children With Type 1 Diabetes Produce and Deposit Anti-Tissue Transglutaminase Antibodies in the Small Intestine
    Article Snippet: The V genes from the different anti-TG2 scFv clones were sequenced (BigDye Terminator v3.1 Cycle Sequencing kit; Applied Biosystems), and the VH gene families used were assessed by screening against the V BASE ( http://vbase.mrc-cpe.cam.ac.uk ) database ( ). .. Immunofluorescence analysis with the different gene family anti-TG2 scFvs was performed on histological sections of monkey esophagus (MeDiCa, Encinitas, CA).

    Molecular Weight:

    Article Title: Methylation Status of the Adeno-Associated Virus Type 2 (AAV2)
    Article Snippet: The methylation pattern of the AAV genomes derived from total Detroit 6 cell DNA, from the isolated high molecular weight DNA, and from the packaged viral DNA was determined by bisulfite PCR. .. Sanger sequencing was performed with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s recommendations.

    DNA Extraction:

    Article Title: A New Zearalenone Biodegradation Strategy Using Non-Pathogenic Rhodococcus pyridinivorans K408 Strain
    Article Snippet: 2.1 Identification of strain K408 Genomic DNA was extracted from strain K408 using G-spinTM Genomic DNA Extraction Kit (Intron Biotechnology Inc., South Korea). .. The almost complete 16 S rRNA gene sequence of strain K408 was determined by using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA) in accordance with the instructions of the manufacturer.

    Magnetic Beads:

    Article Title: Does the prenatal bisphenol A exposure alter DNA methylation levels in the mouse hippocampus?: An analysis using a high-sensitivity methylome technique
    Article Snippet: Oligonucleotides were from Operon (Alameda, Calif., USA) and streptavidin-coated magnetic beads (Dynabeads M-280 Streptavidin) were from Dynal (Oslo, Norway). .. POP-7™ Polymer, GeneScan™ 500 LIZ® Size Standard and BigDye® Terminator v3.1 Cycle Sequencing Kit were from ThermoFisher Scientific Inc., (San Diego, CA, USA).

    Mutagenesis:

    Article Title: Multiplexed CRISPR/Cas9-mediated knockout of 19 Fanconi anemia pathway genes in zebrafish revealed their roles in growth, sexual development and fertility
    Article Snippet: Paragraph title: Analysis of expression of mutant alleles by RT-PCR and sequencing ... For Sanger sequencing, the PCR products were treated with USB ExoSAP-IT (Affymetrix), and sequencing reactions were carried out with RT-PCR primers using the Bigdye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and run on ABI3730XL sequencer.

    Article Title: A HAND2 Loss-of-Function Mutation Causes Familial Ventricular Septal Defect and Pulmonary Stenosis
    Article Snippet: Paragraph title: Genetic scan of HAND2 for mutation ... The amplicons were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), under an ABI PRISM 3130 XL DNA Analyzer (Applied Biosystems).

    Article Title: Valine biosynthesis in Saccharomyces cerevisiae is regulated by the mitochondrial branched-chain amino acid aminotransferase Bat1
    Article Snippet: Site-direct mutagenesis was used to constructs pRS416-K219A-Bat1 and pRS415-K202A-Bat2 using mutagenic primers. .. DNA sequence was confirmed by DNA sequencing using BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems).

    Isolation:

    Article Title: A HAND2 Loss-of-Function Mutation Causes Familial Ventricular Septal Defect and Pulmonary Stenosis
    Article Snippet: Genomic DNA was isolated from blood leukocytes using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI). .. The amplicons were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), under an ABI PRISM 3130 XL DNA Analyzer (Applied Biosystems).

    Article Title: Methylation Status of the Adeno-Associated Virus Type 2 (AAV2)
    Article Snippet: The methylation pattern of the AAV genomes derived from total Detroit 6 cell DNA, from the isolated high molecular weight DNA, and from the packaged viral DNA was determined by bisulfite PCR. .. Sanger sequencing was performed with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s recommendations.

    Size-exclusion Chromatography:

    Article Title: New Insights into Samango Monkey Speciation in South Africa
    Article Snippet: PCR cycling conditions were as follows: Initial denaturation at 95°C for 5 min, annealing at 52°C for 50 sec and extension at 72°C for 1 min, 30 cycles of denaturation at 94°C for 30 sec, annealing at 50°C for 50 sec and extension at 72°C for 1 min. A final extension step of 72°C for 20 min concluded the cycling. .. Cycle sequencing of the PCR products obtained was performed with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer’s protocol.

    Purification:

    Article Title: New Insights into Samango Monkey Speciation in South Africa
    Article Snippet: After the initial PCR amplification, products were purified according to the Exo/Sap amplicon purification method described by Werle [ ]. .. Cycle sequencing of the PCR products obtained was performed with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer’s protocol.

    Article Title: A New Zearalenone Biodegradation Strategy Using Non-Pathogenic Rhodococcus pyridinivorans K408 Strain
    Article Snippet: PCR products were purified with the Viogene DNA/RNA Extraction Kit (Viogene BioTek Corp., Taiwan). .. The almost complete 16 S rRNA gene sequence of strain K408 was determined by using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA) in accordance with the instructions of the manufacturer.

    Article Title: Fungal aneurism of the right posterior inferior cerebellar artery (PICA)
    Article Snippet: .. The obtained amplicon was purified by using QIAquick PCR Purification Kit (Qiagen) and sequenced with BigDye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystem). .. Reaction products were purified by 3 M Sodium Acetate Solution, pH 5.2 and ethanol precipitation, dissolved in distilled water and analyzed on 3130xl Genetic Analyzer under standard electrophoretic conditions ( ).

    Article Title: Template properties of mutagenic cytosine analogues in reverse transcription
    Article Snippet: .. PCR roducts were purified on 2% agarose gel, and a part of the purified DNA was sequenced directly using a BigDye terminator v3.1 Cycle Sequencing Kit and an ABI PRISM 3100-Avant Genetic Analyzer (Applied Biosystems). .. The remaining cDNA was ligated into pBluescript II SK (−) after digestion by SacI and KpnI, and cloned in E.coli , and the integrated plasmid obtained from the bacteria were sequenced with ABI PRISM 3100-Avant Genetic Analyzer.

    Article Title: Majority of Children With Type 1 Diabetes Produce and Deposit Anti-Tissue Transglutaminase Antibodies in the Small Intestine
    Article Snippet: Purified α-gliadin was prepared as described previously ( ). .. The V genes from the different anti-TG2 scFv clones were sequenced (BigDye Terminator v3.1 Cycle Sequencing kit; Applied Biosystems), and the VH gene families used were assessed by screening against the V BASE ( http://vbase.mrc-cpe.cam.ac.uk ) database ( ).

    Sequencing:

    Article Title: New Insights into Samango Monkey Speciation in South Africa
    Article Snippet: .. Cycle sequencing of the PCR products obtained was performed with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer’s protocol. .. Sequencing products were purified with the ZR DNA Sequencing Clean-Up Kit (Zymo Research) and sequenced on an ABI 3130 genetic analyser in forward and reverse.

    Article Title: Generation of Single-Copy Transposon Insertions in Clostridium perfringens by Electroporation of Phage Mu DNA Transposition Complexes ▿
    Article Snippet: .. Nucleotide sequences were analyzed using a BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA), a DyeEx 2.0 spin kit (Qiagen), and an ABI Prism 3100 genetic analyzer (Applied Biosystems). .. Genomic transposon insertion sites were identified by comparing the sequences to the publicly available genomic sequences of C. perfringens strains 13, ATCC 13124, and SM101, using BLAST on the European Bioinformatics Institute server.

    Article Title: Does the prenatal bisphenol A exposure alter DNA methylation levels in the mouse hippocampus?: An analysis using a high-sensitivity methylome technique
    Article Snippet: .. POP-7™ Polymer, GeneScan™ 500 LIZ® Size Standard and BigDye® Terminator v3.1 Cycle Sequencing Kit were from ThermoFisher Scientific Inc., (San Diego, CA, USA). .. Animals and treatments Pregnant C57BL/6 J mice were purchased from CLEA Japan (Tokyo, Japan).

    Article Title: A New Zearalenone Biodegradation Strategy Using Non-Pathogenic Rhodococcus pyridinivorans K408 Strain
    Article Snippet: .. The almost complete 16 S rRNA gene sequence of strain K408 was determined by using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA) in accordance with the instructions of the manufacturer. .. Sequencing products were separated on a Model 310 Genetic Analyzer (Applied Biosystems).

    Article Title: CSL311, a novel, potent, therapeutic monoclonal antibody for the treatment of diseases mediated by the common β chain of the IL-3, GM-CSF and IL-5 receptors
    Article Snippet: .. The nt sequences of all plasmid constructs were verified by sequencing both strands using BigDye™ Terminator Version 3.1 Ready Reaction Cycle Sequencing (Invitrogen™, Thermo Fisher Scientific.4337455) and an Applied Biosystems 3130xl Genetic Analyzer. .. Transient transfections for generation of recombinant proteins Transient transfections of expression plasmids using FS293F cells were performed using 293fectin™ transfection reagent (Invitrogen™, Thermo Fisher Scientific.

    Article Title: Multiplexed CRISPR/Cas9-mediated knockout of 19 Fanconi anemia pathway genes in zebrafish revealed their roles in growth, sexual development and fertility
    Article Snippet: .. For Sanger sequencing, the PCR products were treated with USB ExoSAP-IT (Affymetrix), and sequencing reactions were carried out with RT-PCR primers using the Bigdye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and run on ABI3730XL sequencer. .. The sequencing data was evaluated by aligning it to Danio rerio reference sequence using Sequencher software (Gene Codes Corporation).

    Article Title: Molecular Identification and Phylogenetic Analysis of Nuclear rDNA Sequences of Clonorchis sinensis Isolates From Human Fecal Samples in Heilongjiang Province, China
    Article Snippet: .. Nucleotide Sequencing All the PCR products of expected size were directly sequenced on an ABI PRISM 3730 XL DNA Analyzer by Sinogeno-max Biotechnology Co., Ltd. (Beijing, China), using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, United States). .. DNA Sequence Analysis The positive results in electrophoresis were selected for sequencing.

    Article Title: A HAND2 Loss-of-Function Mutation Causes Familial Ventricular Septal Defect and Pulmonary Stenosis
    Article Snippet: .. The amplicons were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), under an ABI PRISM 3130 XL DNA Analyzer (Applied Biosystems). .. For an identified sequence variation, the Single Nucleotide Polymorphism (SNP; http://www.ncbi.nlm.nicch.gov/SNP ), the 1000 Genomes Project (1000 GP; http://www.1000genomes.org ), and the Exome Variant Server (EVS; http://evs.gs.washington.edu/EVS ) databases were consulted to verify its novelty.

    Article Title: Valine biosynthesis in Saccharomyces cerevisiae is regulated by the mitochondrial branched-chain amino acid aminotransferase Bat1
    Article Snippet: .. DNA sequence was confirmed by DNA sequencing using BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). .. Transformants of E. coli DH5α cells were selected based on blue-white colony screening.

    Article Title: Next generation sequencing in the identification of a rare genetic disease from preconceptional couple screening to preimplantation genetic diagnosis
    Article Snippet: .. The mutations identified as pathologies were confirmed using the Sanger method following the standard protocol (BigDye® Terminator v3.1 Cycle Sequencing Kit, Applied Biosystems®). .. The PGD primers were created using a Primer Express (Applied Biosystems®).

    Article Title: Fungal aneurism of the right posterior inferior cerebellar artery (PICA)
    Article Snippet: .. The obtained amplicon was purified by using QIAquick PCR Purification Kit (Qiagen) and sequenced with BigDye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystem). .. Reaction products were purified by 3 M Sodium Acetate Solution, pH 5.2 and ethanol precipitation, dissolved in distilled water and analyzed on 3130xl Genetic Analyzer under standard electrophoretic conditions ( ).

    Article Title: Differential Gene Expression in the Liver of the African Lungfish, Protopterus annectens, after 6 Months of Aestivation in Air or 1 Day of Arousal from 6 Months of Aestivation
    Article Snippet: .. Approximately 80–100 ng of plasmid DNA was used in BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Corporation) with 2 μM T7 primers. .. Excess fluorescent nucleotides and salts were removed from the samples by ethanol precipitation.

    Article Title: Template properties of mutagenic cytosine analogues in reverse transcription
    Article Snippet: .. PCR roducts were purified on 2% agarose gel, and a part of the purified DNA was sequenced directly using a BigDye terminator v3.1 Cycle Sequencing Kit and an ABI PRISM 3100-Avant Genetic Analyzer (Applied Biosystems). .. The remaining cDNA was ligated into pBluescript II SK (−) after digestion by SacI and KpnI, and cloned in E.coli , and the integrated plasmid obtained from the bacteria were sequenced with ABI PRISM 3100-Avant Genetic Analyzer.

    Article Title: Majority of Children With Type 1 Diabetes Produce and Deposit Anti-Tissue Transglutaminase Antibodies in the Small Intestine
    Article Snippet: .. The V genes from the different anti-TG2 scFv clones were sequenced (BigDye Terminator v3.1 Cycle Sequencing kit; Applied Biosystems), and the VH gene families used were assessed by screening against the V BASE ( http://vbase.mrc-cpe.cam.ac.uk ) database ( ). .. Immunofluorescence analysis with the different gene family anti-TG2 scFvs was performed on histological sections of monkey esophagus (MeDiCa, Encinitas, CA).

    Article Title: Methylation Status of the Adeno-Associated Virus Type 2 (AAV2)
    Article Snippet: .. Sanger sequencing was performed with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s recommendations. .. For the amplification of the modified CpG-containing DNA fragments, 22 PCR primer pairs were designed using the MethPrimer program [ ] ( ).

    Plasmid Preparation:

    Article Title: CSL311, a novel, potent, therapeutic monoclonal antibody for the treatment of diseases mediated by the common β chain of the IL-3, GM-CSF and IL-5 receptors
    Article Snippet: .. The nt sequences of all plasmid constructs were verified by sequencing both strands using BigDye™ Terminator Version 3.1 Ready Reaction Cycle Sequencing (Invitrogen™, Thermo Fisher Scientific.4337455) and an Applied Biosystems 3130xl Genetic Analyzer. .. Transient transfections for generation of recombinant proteins Transient transfections of expression plasmids using FS293F cells were performed using 293fectin™ transfection reagent (Invitrogen™, Thermo Fisher Scientific.

    Article Title: Differential Gene Expression in the Liver of the African Lungfish, Protopterus annectens, after 6 Months of Aestivation in Air or 1 Day of Arousal from 6 Months of Aestivation
    Article Snippet: .. Approximately 80–100 ng of plasmid DNA was used in BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Corporation) with 2 μM T7 primers. .. Excess fluorescent nucleotides and salts were removed from the samples by ethanol precipitation.

    Article Title: Template properties of mutagenic cytosine analogues in reverse transcription
    Article Snippet: PCR roducts were purified on 2% agarose gel, and a part of the purified DNA was sequenced directly using a BigDye terminator v3.1 Cycle Sequencing Kit and an ABI PRISM 3100-Avant Genetic Analyzer (Applied Biosystems). .. The remaining cDNA was ligated into pBluescript II SK (−) after digestion by SacI and KpnI, and cloned in E.coli , and the integrated plasmid obtained from the bacteria were sequenced with ABI PRISM 3100-Avant Genetic Analyzer.

    Software:

    Article Title: New Insights into Samango Monkey Speciation in South Africa
    Article Snippet: Cycle sequencing of the PCR products obtained was performed with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer’s protocol. .. The raw sequence data were analyzed using the ABI Prism DNA Sequencer software v3.4.1.

    Article Title: Multiplexed CRISPR/Cas9-mediated knockout of 19 Fanconi anemia pathway genes in zebrafish revealed their roles in growth, sexual development and fertility
    Article Snippet: For Sanger sequencing, the PCR products were treated with USB ExoSAP-IT (Affymetrix), and sequencing reactions were carried out with RT-PCR primers using the Bigdye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and run on ABI3730XL sequencer. .. The sequencing data was evaluated by aligning it to Danio rerio reference sequence using Sequencher software (Gene Codes Corporation).

    Article Title: Differential Gene Expression in the Liver of the African Lungfish, Protopterus annectens, after 6 Months of Aestivation in Air or 1 Day of Arousal from 6 Months of Aestivation
    Article Snippet: Approximately 80–100 ng of plasmid DNA was used in BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Corporation) with 2 μM T7 primers. .. Sequence output was exported as text and edited manually to remove vector sequences using BioEdit Sequence Alignment Editor software version 7.0.9 [ ].

    Agarose Gel Electrophoresis:

    Article Title: Template properties of mutagenic cytosine analogues in reverse transcription
    Article Snippet: .. PCR roducts were purified on 2% agarose gel, and a part of the purified DNA was sequenced directly using a BigDye terminator v3.1 Cycle Sequencing Kit and an ABI PRISM 3100-Avant Genetic Analyzer (Applied Biosystems). .. The remaining cDNA was ligated into pBluescript II SK (−) after digestion by SacI and KpnI, and cloned in E.coli , and the integrated plasmid obtained from the bacteria were sequenced with ABI PRISM 3100-Avant Genetic Analyzer.

    Article Title: Methylation Status of the Adeno-Associated Virus Type 2 (AAV2)
    Article Snippet: To detect and separate the integrated form of the genome from spontaneously released AAV genomes, total Detroit 6 cell DNA was run on an agarose gel. .. Sanger sequencing was performed with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s recommendations.

    Ethanol Precipitation:

    Article Title: Fungal aneurism of the right posterior inferior cerebellar artery (PICA)
    Article Snippet: The obtained amplicon was purified by using QIAquick PCR Purification Kit (Qiagen) and sequenced with BigDye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystem). .. Reaction products were purified by 3 M Sodium Acetate Solution, pH 5.2 and ethanol precipitation, dissolved in distilled water and analyzed on 3130xl Genetic Analyzer under standard electrophoretic conditions ( ).

    Article Title: Differential Gene Expression in the Liver of the African Lungfish, Protopterus annectens, after 6 Months of Aestivation in Air or 1 Day of Arousal from 6 Months of Aestivation
    Article Snippet: Approximately 80–100 ng of plasmid DNA was used in BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Corporation) with 2 μM T7 primers. .. Excess fluorescent nucleotides and salts were removed from the samples by ethanol precipitation.

    Incubation:

    Article Title: Template properties of mutagenic cytosine analogues in reverse transcription
    Article Snippet: A reverse transcription reaction mixture (10 μl) containing 50 mM Tris–HCl (pH 8.3), 50 mM KCl, 1% Nonidet P-40, 10 mM MgCl2 , 3 mM DTT, 0.5 mM dNTPs, 50 nM template/primer, 5 U RNase inhibitor and 2 μM HIV reverse transcriptase was incubated at 37°C for 1 h and then heated at 70°C for 10 min. After the reaction, the RT products were amplified by PCR. .. PCR roducts were purified on 2% agarose gel, and a part of the purified DNA was sequenced directly using a BigDye terminator v3.1 Cycle Sequencing Kit and an ABI PRISM 3100-Avant Genetic Analyzer (Applied Biosystems).

    Article Title: Methylation Status of the Adeno-Associated Virus Type 2 (AAV2)
    Article Snippet: Treatment of the genomic DNA was optimized by adding an extra denaturation step (95 °C, 5 min) followed by incubation at 60 °C for 2 h. The conversion efficiency of the unmethylated cytosines was verified by Sanger sequencing of several PCR fragments from the 27 CpG sites containing fragment AAV11 ( ). .. Sanger sequencing was performed with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s recommendations.

    Spectrophotometry:

    Article Title: Differential Gene Expression in the Liver of the African Lungfish, Protopterus annectens, after 6 Months of Aestivation in Air or 1 Day of Arousal from 6 Months of Aestivation
    Article Snippet: The plasmids were quantified by the NanoDrop ND-1000 spectrophotometer. .. Approximately 80–100 ng of plasmid DNA was used in BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Corporation) with 2 μM T7 primers.

    Colony Assay:

    Article Title: Valine biosynthesis in Saccharomyces cerevisiae is regulated by the mitochondrial branched-chain amino acid aminotransferase Bat1
    Article Snippet: DNA sequence was confirmed by DNA sequencing using BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). .. Transformants of E. coli DH5α cells were selected based on blue-white colony screening.

    Produced:

    Article Title: Differential Gene Expression in the Liver of the African Lungfish, Protopterus annectens, after 6 Months of Aestivation in Air or 1 Day of Arousal from 6 Months of Aestivation
    Article Snippet: The primary and secondary PCR amplification of these reciprocal subtractions of cDNA from the control and aestivated fish produced 1 forward and 1 reverse SSH libraries enriched in differentially expressed transcripts. .. Approximately 80–100 ng of plasmid DNA was used in BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Corporation) with 2 μM T7 primers.

    DNA Purification:

    Article Title: A HAND2 Loss-of-Function Mutation Causes Familial Ventricular Septal Defect and Pulmonary Stenosis
    Article Snippet: Genomic DNA was isolated from blood leukocytes using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI). .. The amplicons were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), under an ABI PRISM 3130 XL DNA Analyzer (Applied Biosystems).

    Variant Assay:

    Article Title: A HAND2 Loss-of-Function Mutation Causes Familial Ventricular Septal Defect and Pulmonary Stenosis
    Article Snippet: The amplicons were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), under an ABI PRISM 3130 XL DNA Analyzer (Applied Biosystems). .. For an identified sequence variation, the Single Nucleotide Polymorphism (SNP; http://www.ncbi.nlm.nicch.gov/SNP ), the 1000 Genomes Project (1000 GP; http://www.1000genomes.org ), and the Exome Variant Server (EVS; http://evs.gs.washington.edu/EVS ) databases were consulted to verify its novelty.

    Fluorescence In Situ Hybridization:

    Article Title: Differential Gene Expression in the Liver of the African Lungfish, Protopterus annectens, after 6 Months of Aestivation in Air or 1 Day of Arousal from 6 Months of Aestivation
    Article Snippet: The primary and secondary PCR amplification of these reciprocal subtractions of cDNA from the control and aestivated fish produced 1 forward and 1 reverse SSH libraries enriched in differentially expressed transcripts. .. Approximately 80–100 ng of plasmid DNA was used in BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Corporation) with 2 μM T7 primers.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher bigdye terminater v3 1 cycle sequencing kit
    Bigdye Terminater V3 1 Cycle Sequencing Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bigdye terminater v3 1 cycle sequencing kit/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bigdye terminater v3 1 cycle sequencing kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results