bigdye terminator v3 1 cycle sequencing kit  (Thermo Fisher)

Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    BigDye Terminator v3.1 Cycle Sequencing Kit
    The BigDye Terminator v3.1 Cycle Sequencing Kit's robust, highly flexible chemistry is ideal for de novo sequencing, resequencing, and finishing with PCR product, Plasmid, Fosmid, and BAC templates. • Improve the quality of your results for a wide range of sequencing applications. • Optimized for long read lengths. • Better dye mobility characteristics • Improved performance reading through GT rich regions. • Get longer, higher-quality reads with more uniform peak heights and optimal signal balance. • Enhance your productivity and reduce costs.Get More Uniform Peak Heights, Improved AccuracyWith BigDye Terminator v3.1 kit superior chemistry, you generate data with uniform peak heights and optimized signal balance. This results in longer, higher-quality reads and more accurate base assignments for heterozygote and mutation detection.For Research Use Only. Not for use in diagnostics procedures.
    Catalog Number:
    Kits & Reagents for Sanger Sequencing|Sanger Sequencing|Sanger Sequencing Technology & Accessories|Sequencing
    24 reactions
    Kits and Assays, Sequencing Kits & Reagents, Sequencing Kits
    Buy from Supplier

    Structured Review

    Thermo Fisher bigdye terminator v3 1 cycle sequencing kit
    DNA cleavage and strand exchange by SprA. ( A ) Direct sequencing of the intermediates of the SprA-mediated integration reaction. The intermediates: the left and right half-sites of attP , were directly sequenced using a <t>BigDye</t> Terminator <t>v3.1</t> Cycle Sequencing Kit and an ABI 3500 DNA analyzer. The 16 bp overlapping sequence is underlined. The 3΄-end nucleotides indicated by the circles are adenines added by the terminal transferase activity of Taq polymerase used for the cycle sequencing reaction. The cleavage point of attP is shown to the left (indicated by the lines and triangles). ( B ) Effects of point mutations of the central dinucleotides on DNA recombination. Point mutations were introduced into the AAA nucleotides at the center of the attB site (A→T). In vitro integration recombination was performed using 0.5 μM SprA and 50 ng each of the wild-type attP and the mutated attB substrates.
    The BigDye Terminator v3.1 Cycle Sequencing Kit's robust, highly flexible chemistry is ideal for de novo sequencing, resequencing, and finishing with PCR product, Plasmid, Fosmid, and BAC templates. • Improve the quality of your results for a wide range of sequencing applications. • Optimized for long read lengths. • Better dye mobility characteristics • Improved performance reading through GT rich regions. • Get longer, higher-quality reads with more uniform peak heights and optimal signal balance. • Enhance your productivity and reduce costs.Get More Uniform Peak Heights, Improved AccuracyWith BigDye Terminator v3.1 kit superior chemistry, you generate data with uniform peak heights and optimized signal balance. This results in longer, higher-quality reads and more accurate base assignments for heterozygote and mutation detection.For Research Use Only. Not for use in diagnostics procedures. terminator v3 1 cycle sequencing kit/product/Thermo Fisher
    Average 99 stars, based on 670 article reviews
    Price from $9.99 to $1999.99
    bigdye terminator v3 1 cycle sequencing kit - by Bioz Stars, 2019-12
    99/100 stars


    1) Product Images from "Mechanism of bacterial gene rearrangement: SprA-catalyzed precise DNA recombination and its directionality control by SprB ensure the gene rearrangement and stable expression of spsM during sporulation in Bacillus subtilis"

    Article Title: Mechanism of bacterial gene rearrangement: SprA-catalyzed precise DNA recombination and its directionality control by SprB ensure the gene rearrangement and stable expression of spsM during sporulation in Bacillus subtilis

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx466

    DNA cleavage and strand exchange by SprA. ( A ) Direct sequencing of the intermediates of the SprA-mediated integration reaction. The intermediates: the left and right half-sites of attP , were directly sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit and an ABI 3500 DNA analyzer. The 16 bp overlapping sequence is underlined. The 3΄-end nucleotides indicated by the circles are adenines added by the terminal transferase activity of Taq polymerase used for the cycle sequencing reaction. The cleavage point of attP is shown to the left (indicated by the lines and triangles). ( B ) Effects of point mutations of the central dinucleotides on DNA recombination. Point mutations were introduced into the AAA nucleotides at the center of the attB site (A→T). In vitro integration recombination was performed using 0.5 μM SprA and 50 ng each of the wild-type attP and the mutated attB substrates.
    Figure Legend Snippet: DNA cleavage and strand exchange by SprA. ( A ) Direct sequencing of the intermediates of the SprA-mediated integration reaction. The intermediates: the left and right half-sites of attP , were directly sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit and an ABI 3500 DNA analyzer. The 16 bp overlapping sequence is underlined. The 3΄-end nucleotides indicated by the circles are adenines added by the terminal transferase activity of Taq polymerase used for the cycle sequencing reaction. The cleavage point of attP is shown to the left (indicated by the lines and triangles). ( B ) Effects of point mutations of the central dinucleotides on DNA recombination. Point mutations were introduced into the AAA nucleotides at the center of the attB site (A→T). In vitro integration recombination was performed using 0.5 μM SprA and 50 ng each of the wild-type attP and the mutated attB substrates.

    Techniques Used: Sequencing, Activity Assay, In Vitro

    Related Articles

    Clone Assay:

    Article Title: Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers
    Article Snippet: Cisplatin-resistant Capan-1 clones were generated by long-term culture in cisplatin (2 μM)-containing medium. .. PCR-amplified BRCA2 gene fragments were analyzed for sequence alterations with BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems).

    Article Title: Splice variants of the endonucleases XPF and XPG contain residual DNA repair capabilities and could be a valuable tool for personalized medicine
    Article Snippet: Paragraph title: Cloning ... Sequences were verified by Sanger sequencing using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) as described in Schäfer et al. [ ] (primer see Table ).


    Article Title: Limited airborne transmission of influenza A/H7N9 virus between ferrets
    Article Snippet: Viral RNA was extracted from respiratory swab samples collected from the ferrets that were infected via the airborne route and the virus inoculum, using the High Pure RNA Isolation Kit (Roche). .. All eight gene segments of the influenza viruses were amplified by RT-PCR using 8 primer sets that cover the full viral genome which specifically amplify each gene segment and sequenced using a BigDye Terminator v3.1 Cycle sequencing kit (Applied Biosystems, Nieuwerkerk a/d IJssel, the Netherlands) and a 3130XL genetic analyzer (Applied Biosystems), according to the instructions of the manufacturer. .. The consensus sequence was determined for viruses isolated from the following samples: virus inoculum obtained after three egg passages and one MDCK passage, recipient F1: nose swab 7 dpe, recipient F2: throat swab 5 dpe, recipient F3: nose swab 5 dpe, and recipient F5: nose swab 5 dpe.

    Article Title: A de novo variant in ADGRL2 suggests a novel mechanism underlying the previously undescribed association of extreme microcephaly with severely reduced sulcation and rhombencephalosynapsis
    Article Snippet: These DNA samples were first amplified using the Whole Genome Amplification GenomePlex2 kit (Sigma-Aldrich, St Louis, MO, USA). .. Sanger sequencing of these fragments was performed using the BigDye® Terminator v3.1 Cycle sequencing Kit (Applied Biosystems, Courtabœuf, France).

    Article Title: Splice variants of the endonucleases XPF and XPG contain residual DNA repair capabilities and could be a valuable tool for personalized medicine
    Article Snippet: Amplification fragments as well as the target vector were digested with appropriate restriction enzymes (listed in Table ) according to manufacturer’s protocol (NEB, Ipswich, MA, USA). .. Sequences were verified by Sanger sequencing using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) as described in Schäfer et al. [ ] (primer see Table ).

    Article Title: Transcribed ultraconserved region 339 promotes carcinogenesis by modulating tumor suppressor microRNAs
    Article Snippet: The fragment between exons 2 and 11 of the TP53 gene was amplified with the primers F2 and R11 (listed in Supplementary Table ), at an annealing temperature of 68 °C with the LA Taq® DNA Polymerase (Takara). .. Exons 5–8 were sequenced with the BigDye® Terminator v3.1 Cycle Sequencing kit (Life Technologies) at 56 °C annealing temperature, using primers 5F, 5R, 6F, 6R, 7F, 7R, 8F, and 8R listed in Supplementary Table .

    Article Title: Microencapsulation of Lactic Acid Bacteria Improves the Gastrointestinal Delivery and in situ Expression of Recombinant Fluorescent Protein
    Article Snippet: The ORF of reporter gene mCherry was amplified by PCR technique using Hot Start® high-fidelity DNA Polymerase (Qiagen, Hilden, Germany). .. Sequence analysis was done to confirm the insert integrity using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, United States) and ABI3130 sequencing equipment.

    Article Title: First records of molluscs naturally infected with Angiostrongylus cantonensis (Nematoda: Metastrongyloidea) in Northeastern Brazil, including new global records of natural intermediate hosts
    Article Snippet: The PCR products were purified using the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare, Little Chalfont, UK) following the manufacturer's protocol. .. Purified products after amplification were bidirectionally sequenced using BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, California, USA) according to the manufacturer's instructions. .. Chromatograms of the sequences obtained were analyzed and edited using Geneious version R9 software ( ), resulting in a consensus sequence (contig).

    Article Title: Detection of BRAF mutations in patients with hairy cell leukemia and related lymphoproliferative disorders
    Article Snippet: Primers for the 88bp amplicon were 5′-CCTCACAGTAAAAATAGGTGATTTTGG-3′ and 5′-GGATCCAGACAACTGTTCAAACTGA-3′. .. PCR conditions included an activation step of 15 min at 95°C followed by 55 cycles of 95°C for 10 s, annealing for 10 s comprising 10 cycles of a touchdown from 65°C to 55°C at 1°C/cycle followed by 35 cycles at 55°C, and extension at 72°C for 30 s. Samples with aberrant melting curves were directly sequenced from a 1/10 dilution of the HRM product using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions.

    Whole Genome Amplification:

    Article Title: A de novo variant in ADGRL2 suggests a novel mechanism underlying the previously undescribed association of extreme microcephaly with severely reduced sulcation and rhombencephalosynapsis
    Article Snippet: These DNA samples were first amplified using the Whole Genome Amplification GenomePlex2 kit (Sigma-Aldrich, St Louis, MO, USA). .. Sanger sequencing of these fragments was performed using the BigDye® Terminator v3.1 Cycle sequencing Kit (Applied Biosystems, Courtabœuf, France).

    Positive Control:

    Article Title: First records of molluscs naturally infected with Angiostrongylus cantonensis (Nematoda: Metastrongyloidea) in Northeastern Brazil, including new global records of natural intermediate hosts
    Article Snippet: For all the reactions, ultrapure water was used as a negative control template, and the positive control was performed with genomic DNA of A. cantonensis as template. .. Purified products after amplification were bidirectionally sequenced using BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, California, USA) according to the manufacturer's instructions.

    Polymerase Chain Reaction:

    Article Title: Mechanism of bacterial gene rearrangement: SprA-catalyzed precise DNA recombination and its directionality control by SprB ensure the gene rearrangement and stable expression of spsM during sporulation in Bacillus subtilis
    Article Snippet: Two microgram of the PCR product were mixed with 0.3 μM SprA in 100 μl of the reaction solution containing 10 mM Tris–HCl (pH 8.0), 20 mM NaCl and 0.1 mM DTT. .. DNA pellets were dissolved in TE buffer, gel purified, and directly sequenced using the P107 (for the left half- site of attP ) or P109 (for the right half- site) primers, a BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, WI, USA) and an ABI 3500 DNA analyzer (Thermo Fisher Scientific).

    Article Title: Familial STAG2 germline mutation defines a new human cohesinopathy
    Article Snippet: Paragraph title: Allele-specific PCR and Sanger sequencing ... Sanger sequencing was achieved by standard methods using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems® ) and the Applied Biosystems (ABI) 3130 Genetic Analyzer.

    Article Title: Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers
    Article Snippet: PCR was performed using Expand High Fidelity PCR System (Roche). .. Sequences of PCR products were analyzed with BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems; Foster City, CA). .. All nucleotide numbers refer to the wild-type cDNA human sequence of BRCA2 (accession no. ; version GI: 1161383) and BRCA1 ( ) (GenBank database).

    Article Title: Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers
    Article Snippet: Cisplatin-resistant Capan-1 clones were generated by long-term culture in cisplatin (2 μM)-containing medium. .. PCR-amplified BRCA2 gene fragments were analyzed for sequence alterations with BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). .. All nucleotide numbers refer to the wild-type cDNA human sequence of BRCA2 (accession no. ; version GI: 1161383) and BRCA1 ( ).

    Article Title: MC1R Genotype and Plumage Colouration in the Zebra Finch (Taeniopygia guttata): Population Structure Generates Artefactual Associations
    Article Snippet: 10 µl of the resulting PCR product was purified using shrimp alkaline phosphatase and exonuclease I (New England Biolabs) following the manufacturer's recommended protocol. .. All fragments were then sequenced in both directions using the Applied Biosystems BigDye® Terminator v3.1 Cycle Sequencing Kit and analysed on an ABI 3730xl capillary sequencer.

    Article Title: Voxel-based morphometric brain comparison between healthy subjects and major depressive disorder patients in Japanese with the s/s genotype of 5-HTTLPR
    Article Snippet: DNA was isolated from peripheral blood mononuclearcells using the QIAamp DNA Mini-Kit (QIAGEN, Tokyo, Japan). .. Genotyping was carried out with a polymerase chain reaction (PCR) SNP genotyping system using the BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Japan, Tokyo, Japan). .. The DNA was read using a BMG Applied Biosystem 3730xI DNA Analyzer (Life Technologies Japan).

    Article Title: Ratiometric biosensors based on dimerization-dependent fluorescent protein exchange
    Article Snippet: PCR products and products of restriction digests were purified by gel electrophoresis and extracted by GeneJET gel extraction kit (Thermo scientific) according to the manufacturer's protocols. .. The cDNA sequences were confirmed by dye terminator cycle sequencing using the BigDye Terminator v3.1 Cycle Sequencing kit (Life Technologies).

    Article Title: A Point Mutation in a lincRNA Upstream of GDNF Is Associated to a Canine Insensitivity to Pain: A Spontaneous Model for Human Sensory Neuropathies
    Article Snippet: We re-sequenced the GDNF gene and the variant on 16 affected and 16 unaffected French Spaniel using the Type-it Microsatellite PCR kit (Qiagen) on C1000 and S1000 thermocyclers (Bio-Rad). .. PCR products were cleaned using the Illustra Exostar-1 Step reagent (Dutscher) and sequenced by Sanger method using the BigDye Terminator v3.1 cycle sequencing kit (Thermo Fisher Scientific). .. Electrophoresis of the products was realized on a 370 ABI sequencer.

    Article Title: A de novo variant in ADGRL2 suggests a novel mechanism underlying the previously undescribed association of extreme microcephaly with severely reduced sulcation and rhombencephalosynapsis
    Article Snippet: The 20 ADGRL2 exons, 100 bp exon-intron boundaries and UTRs were PCR amplified from 50 to 100 ng of genomic DNA extracted from peripheral blood (exome trio) and from fœtal tissues coming from the Department of Genetics, Rennes University Hospital. .. Sanger sequencing of these fragments was performed using the BigDye® Terminator v3.1 Cycle sequencing Kit (Applied Biosystems, Courtabœuf, France).

    Article Title: Splice variants of the endonucleases XPF and XPG contain residual DNA repair capabilities and could be a valuable tool for personalized medicine
    Article Snippet: Restriction sites for specific restriction enzymes were added by a second PCR reaction of the purified fragments and afterwards precipitated with ethanol under high salt conditions. .. Sequences were verified by Sanger sequencing using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) as described in Schäfer et al. [ ] (primer see Table ).

    Article Title: Transcribed ultraconserved region 339 promotes carcinogenesis by modulating tumor suppressor microRNAs
    Article Snippet: The PCR fragment was purified with MinElute PCR Purification kit (Qiagen), according to the manufacturer’s instructions. .. Exons 5–8 were sequenced with the BigDye® Terminator v3.1 Cycle Sequencing kit (Life Technologies) at 56 °C annealing temperature, using primers 5F, 5R, 6F, 6R, 7F, 7R, 8F, and 8R listed in Supplementary Table .

    Article Title: Microencapsulation of Lactic Acid Bacteria Improves the Gastrointestinal Delivery and in situ Expression of Recombinant Fluorescent Protein
    Article Snippet: The digested vector and insert were purified by IllustraTM GFXTM PCR DNA kit and then were ligated with T4 DNA ligase (Invitrogen, Carlsbad, CA, United States) and transformed into E. coli Top10, creating the E. coli Top10 (pExu:mCherry ) strain. .. Sequence analysis was done to confirm the insert integrity using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, United States) and ABI3130 sequencing equipment.

    Article Title: First records of molluscs naturally infected with Angiostrongylus cantonensis (Nematoda: Metastrongyloidea) in Northeastern Brazil, including new global records of natural intermediate hosts
    Article Snippet: The PCR products were purified using the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare, Little Chalfont, UK) following the manufacturer's protocol. .. Purified products after amplification were bidirectionally sequenced using BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, California, USA) according to the manufacturer's instructions.

    Article Title: Detection of BRAF mutations in patients with hairy cell leukemia and related lymphoproliferative disorders
    Article Snippet: The reaction mixture included 1× PCR buffer, 2.5 mM MgCl2 , 200 nM of each primer, 200 μM of dNTPs, 5 μM of SYTO 9 (Invitrogen, Carlsbad, CA, USA), 0.5U of HotStarTaq polymerase (Qiagen), 10ng DNA and PCR grade water in a total volume of 10 μL. .. PCR conditions included an activation step of 15 min at 95°C followed by 55 cycles of 95°C for 10 s, annealing for 10 s comprising 10 cycles of a touchdown from 65°C to 55°C at 1°C/cycle followed by 35 cycles at 55°C, and extension at 72°C for 30 s. Samples with aberrant melting curves were directly sequenced from a 1/10 dilution of the HRM product using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. .. Fifty-nine samples (58 bone marrow aspirates and one peripheral blood) from 51 patients with HCL and 34 samples (33 bone marrow aspirates and one peripheral blood) from 34 patients with other hematologic malignancies were identified.

    Article Title: MAP1B mutations cause intellectual disability and extensive white matter deficit
    Article Snippet: DNA was fragmented, end-repaired, size-selected and purified, followed by PCR enrichment and sequencing libraries were assessed for quality and concentration. .. Applied Biosystems BigDye Terminator v3.1 Cycle Sequencing Kit was used to confirm MAP1B LoF carrier status.


    Article Title: Splice variants of the endonucleases XPF and XPG contain residual DNA repair capabilities and could be a valuable tool for personalized medicine
    Article Snippet: Constructs were transformed in chemically competent DH5α (E.coli) cells and isolated from single clones grown on LB Agar plates using the NucleoBond Mini plasmid kit (Machery + Nagel, Düren, DE). .. Sequences were verified by Sanger sequencing using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) as described in Schäfer et al. [ ] (primer see Table ).


    Article Title: Mechanism of bacterial gene rearrangement: SprA-catalyzed precise DNA recombination and its directionality control by SprB ensure the gene rearrangement and stable expression of spsM during sporulation in Bacillus subtilis
    Article Snippet: DNA pellets were dissolved in TE buffer, gel purified, and directly sequenced using the P107 (for the left half- site of attP ) or P109 (for the right half- site) primers, a BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, WI, USA) and an ABI 3500 DNA analyzer (Thermo Fisher Scientific). .. DNA pellets were dissolved in TE buffer, gel purified, and directly sequenced using the P107 (for the left half- site of attP ) or P109 (for the right half- site) primers, a BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, WI, USA) and an ABI 3500 DNA analyzer (Thermo Fisher Scientific).

    Cell Culture:

    Article Title: Ratiometric biosensors based on dimerization-dependent fluorescent protein exchange
    Article Snippet: The cDNA sequences were confirmed by dye terminator cycle sequencing using the BigDye Terminator v3.1 Cycle Sequencing kit (Life Technologies). .. Sequencing reactions were analyzed at the University of Alberta Molecular Biology Service Unit.

    Mass Spectrometry:

    Article Title: Mosaicism for GNAS methylation defects associated with pseudohypoparathyroidism type 1B arose in early post-zygotic phases
    Article Snippet: Mutation analysis was performed by direct sequencing (BigDye™Terminator v3.1 Cycle Sequencing Kit, cod.4337456, Applied Biosystems) of GNAS 1–13 exons and flanking intronic sequences (ENSEMBL ID: ENSG00000087460). .. For variable number tandem repeat (VNTR) genotyping, we set up a cost-effective three-primer approach based on the simultaneous use of a couple of sequence-specific primers, the reverse one containing a poliA tail at the 5′ end to allow easier allele scoring, associated with a fluorescently labeled universal forward M13-tailed FAM oligonucleotide.

    Western Blot:

    Article Title: Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers
    Article Snippet: PCR-amplified BRCA2 gene fragments were analyzed for sequence alterations with BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). .. All nucleotide numbers refer to the wild-type cDNA human sequence of BRCA2 (accession no. ; version GI: 1161383) and BRCA1 ( ).

    Transformation Assay:

    Article Title: Splice variants of the endonucleases XPF and XPG contain residual DNA repair capabilities and could be a valuable tool for personalized medicine
    Article Snippet: Constructs were transformed in chemically competent DH5α (E.coli) cells and isolated from single clones grown on LB Agar plates using the NucleoBond Mini plasmid kit (Machery + Nagel, Düren, DE). .. Sequences were verified by Sanger sequencing using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) as described in Schäfer et al. [ ] (primer see Table ).

    Article Title: Microencapsulation of Lactic Acid Bacteria Improves the Gastrointestinal Delivery and in situ Expression of Recombinant Fluorescent Protein
    Article Snippet: The digested vector and insert were purified by IllustraTM GFXTM PCR DNA kit and then were ligated with T4 DNA ligase (Invitrogen, Carlsbad, CA, United States) and transformed into E. coli Top10, creating the E. coli Top10 (pExu:mCherry ) strain. .. Sequence analysis was done to confirm the insert integrity using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, United States) and ABI3130 sequencing equipment.

    Derivative Assay:

    Article Title: Mosaicism for GNAS methylation defects associated with pseudohypoparathyroidism type 1B arose in early post-zygotic phases
    Article Snippet: Buccal epithelial cells are of ectodermal derivation and urine sediment cells are derived from the mesoderm, while leukocytes are from the endoderm. .. Mutation analysis was performed by direct sequencing (BigDye™Terminator v3.1 Cycle Sequencing Kit, cod.4337456, Applied Biosystems) of GNAS 1–13 exons and flanking intronic sequences (ENSEMBL ID: ENSG00000087460).


    Article Title: MAP1B mutations cause intellectual disability and extensive white matter deficit
    Article Snippet: Following hybridisation of sequencing libraries to flowcells using the Illumina cBot, Illumina GAIIx, HiSeq 2,000/2,500 or HiSeq X instruments were used to perform sequencing-by-synthesis on paired-end libraries followed by imaging and base-calling in real-time. .. Applied Biosystems BigDye Terminator v3.1 Cycle Sequencing Kit was used to confirm MAP1B LoF carrier status.

    Gas Chromatography:

    Article Title: Voxel-based morphometric brain comparison between healthy subjects and major depressive disorder patients in Japanese with the s/s genotype of 5-HTTLPR
    Article Snippet: Genotyping was carried out with a polymerase chain reaction (PCR) SNP genotyping system using the BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Japan, Tokyo, Japan). .. Genotyping was carried out with a polymerase chain reaction (PCR) SNP genotyping system using the BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Japan, Tokyo, Japan).


    Article Title: Splice variants of the endonucleases XPF and XPG contain residual DNA repair capabilities and could be a valuable tool for personalized medicine
    Article Snippet: Ligation was performed in a 3:1 (fragment : vector) ratio using a T4 Ligase (Thermo Fisher Scientific, Waltham, MA, USA). .. Sequences were verified by Sanger sequencing using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) as described in Schäfer et al. [ ] (primer see Table ).


    Article Title: Limited airborne transmission of influenza A/H7N9 virus between ferrets
    Article Snippet: Viral RNA was extracted from respiratory swab samples collected from the ferrets that were infected via the airborne route and the virus inoculum, using the High Pure RNA Isolation Kit (Roche). .. All eight gene segments of the influenza viruses were amplified by RT-PCR using 8 primer sets that cover the full viral genome which specifically amplify each gene segment and sequenced using a BigDye Terminator v3.1 Cycle sequencing kit (Applied Biosystems, Nieuwerkerk a/d IJssel, the Netherlands) and a 3130XL genetic analyzer (Applied Biosystems), according to the instructions of the manufacturer.


    Article Title: Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers
    Article Snippet: Cisplatin-resistant Capan-1 clones were generated by long-term culture in cisplatin (2 μM)-containing medium. .. PCR-amplified BRCA2 gene fragments were analyzed for sequence alterations with BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems).

    Article Title: MC1R Genotype and Plumage Colouration in the Zebra Finch (Taeniopygia guttata): Population Structure Generates Artefactual Associations
    Article Snippet: The full length (945 bp) MC1R receptor sequence (the MC1R does not contain any introns) was downloaded from Genbank (accession number NC_011475, chromosome Tgu 11, 11,645,486–11,646,430 in the WUSTL v3.2.4 assembly) and 919 bp of contiguous sequence (corresponding to sites 27–945 in the sequence) was generated for each individual using two sets of primer pairs ( 5′-ctgcgtgagccctcgaat-3′ / 5′-gcgtcatgatgctgtggtag-3′ and 5′-gtcgaccgctacatcaccat-3′ / 5′-taccaggagcacgtcaccac-3′ ) designed to PCR amplify two overlapping fragments of length 439 and 533 nucleotides respectively. .. All fragments were then sequenced in both directions using the Applied Biosystems BigDye® Terminator v3.1 Cycle Sequencing Kit and analysed on an ABI 3730xl capillary sequencer.


    Article Title: Ratiometric biosensors based on dimerization-dependent fluorescent protein exchange
    Article Snippet: The cDNA sequences were confirmed by dye terminator cycle sequencing using the BigDye Terminator v3.1 Cycle Sequencing kit (Life Technologies). .. Sequencing reactions were analyzed at the University of Alberta Molecular Biology Service Unit.

    Article Title: MAP1B mutations cause intellectual disability and extensive white matter deficit
    Article Snippet: Following hybridisation of sequencing libraries to flowcells using the Illumina cBot, Illumina GAIIx, HiSeq 2,000/2,500 or HiSeq X instruments were used to perform sequencing-by-synthesis on paired-end libraries followed by imaging and base-calling in real-time. .. Applied Biosystems BigDye Terminator v3.1 Cycle Sequencing Kit was used to confirm MAP1B LoF carrier status.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Limited airborne transmission of influenza A/H7N9 virus between ferrets
    Article Snippet: Viral RNA was extracted from respiratory swab samples collected from the ferrets that were infected via the airborne route and the virus inoculum, using the High Pure RNA Isolation Kit (Roche). .. All eight gene segments of the influenza viruses were amplified by RT-PCR using 8 primer sets that cover the full viral genome which specifically amplify each gene segment and sequenced using a BigDye Terminator v3.1 Cycle sequencing kit (Applied Biosystems, Nieuwerkerk a/d IJssel, the Netherlands) and a 3130XL genetic analyzer (Applied Biosystems), according to the instructions of the manufacturer. .. The consensus sequence was determined for viruses isolated from the following samples: virus inoculum obtained after three egg passages and one MDCK passage, recipient F1: nose swab 7 dpe, recipient F2: throat swab 5 dpe, recipient F3: nose swab 5 dpe, and recipient F5: nose swab 5 dpe.


    Article Title: First records of molluscs naturally infected with Angiostrongylus cantonensis (Nematoda: Metastrongyloidea) in Northeastern Brazil, including new global records of natural intermediate hosts
    Article Snippet: The polymerase chain reaction (PCR) mixtures were prepared in a volume of 20 μL containing 8 μL of ultrapure water, 5 μL of 10% trehalose, 2.5 μL of 10x PCR Reaction Buffer, 2 μL of 2.5 mM dNTPs, 1.25 μL 50 mM MgCl2 , 0.5 μL each of 5 μM forward and reverse primer (Nem 3 from Prosser et al. ), and 0.25 μL of recombinant Taq DNA polymerase (Thermo Fisher Scientific). .. Purified products after amplification were bidirectionally sequenced using BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, California, USA) according to the manufacturer's instructions.


    Article Title: Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers
    Article Snippet: PCR-amplified BRCA2 gene fragments were analyzed for sequence alterations with BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). .. For western blot analysis, anti-BRCA2 Ab-1 (1:100; OP95, EMD Biosciences), anti-BRCA2 Ab-2 (1:100; PC146, EMD Biosciences), and anti-FANCA (1:1000, (#7488) (a gift from Dr. M Hoatlin)) were used.

    DNA Extraction:

    Article Title: Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers
    Article Snippet: Paragraph title: Genomic DNA extraction, PCR and Sequencing of BRCA2 and BRCA1 ... Sequences of PCR products were analyzed with BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems; Foster City, CA).

    Article Title: MC1R Genotype and Plumage Colouration in the Zebra Finch (Taeniopygia guttata): Population Structure Generates Artefactual Associations
    Article Snippet: Paragraph title: Blood sampling, DNA extraction and MC1R sequencing ... All fragments were then sequenced in both directions using the Applied Biosystems BigDye® Terminator v3.1 Cycle Sequencing Kit and analysed on an ABI 3730xl capillary sequencer.

    Nucleic Acid Electrophoresis:

    Article Title: Ratiometric biosensors based on dimerization-dependent fluorescent protein exchange
    Article Snippet: PCR products and products of restriction digests were purified by gel electrophoresis and extracted by GeneJET gel extraction kit (Thermo scientific) according to the manufacturer's protocols. .. The cDNA sequences were confirmed by dye terminator cycle sequencing using the BigDye Terminator v3.1 Cycle Sequencing kit (Life Technologies).


    Article Title: Mosaicism for GNAS methylation defects associated with pseudohypoparathyroidism type 1B arose in early post-zygotic phases
    Article Snippet: Mutation analysis was performed by direct sequencing (BigDye™Terminator v3.1 Cycle Sequencing Kit, cod.4337456, Applied Biosystems) of GNAS 1–13 exons and flanking intronic sequences (ENSEMBL ID: ENSG00000087460). .. For variable number tandem repeat (VNTR) genotyping, we set up a cost-effective three-primer approach based on the simultaneous use of a couple of sequence-specific primers, the reverse one containing a poliA tail at the 5′ end to allow easier allele scoring, associated with a fluorescently labeled universal forward M13-tailed FAM oligonucleotide.


    Article Title: Familial STAG2 germline mutation defines a new human cohesinopathy
    Article Snippet: Allele-specific PCR was achieved by synthesizing long primers that differed on their 3′ extremity, where the mutation was located. .. Sanger sequencing was achieved by standard methods using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems® ) and the Applied Biosystems (ABI) 3130 Genetic Analyzer.

    Article Title: Mosaicism for GNAS methylation defects associated with pseudohypoparathyroidism type 1B arose in early post-zygotic phases
    Article Snippet: Buccal epithelial cells are of ectodermal derivation and urine sediment cells are derived from the mesoderm, while leukocytes are from the endoderm. .. Mutation analysis was performed by direct sequencing (BigDye™Terminator v3.1 Cycle Sequencing Kit, cod.4337456, Applied Biosystems) of GNAS 1–13 exons and flanking intronic sequences (ENSEMBL ID: ENSG00000087460). .. Informative genetic markers in the 20q region were evaluated to exclude a possible misdiagnosis of spor-PHP1B in the presence of aneuploidies (monosomy or trisomy) or uniparental disomy (UPD).

    Article Title: Ratiometric biosensors based on dimerization-dependent fluorescent protein exchange
    Article Snippet: Site-directed mutagenesis was performed using Quikchange Lightning kit (Agilent), following the manufacturer's instruction. .. The cDNA sequences were confirmed by dye terminator cycle sequencing using the BigDye Terminator v3.1 Cycle Sequencing kit (Life Technologies).

    Article Title: Transcribed ultraconserved region 339 promotes carcinogenesis by modulating tumor suppressor microRNAs
    Article Snippet: Paragraph title: Study of the TP53 gene mutation status in primary NSCLC samples ... Exons 5–8 were sequenced with the BigDye® Terminator v3.1 Cycle Sequencing kit (Life Technologies) at 56 °C annealing temperature, using primers 5F, 5R, 6F, 6R, 7F, 7R, 8F, and 8R listed in Supplementary Table .


    Article Title: Limited airborne transmission of influenza A/H7N9 virus between ferrets
    Article Snippet: Viral RNA was extracted from respiratory swab samples collected from the ferrets that were infected via the airborne route and the virus inoculum, using the High Pure RNA Isolation Kit (Roche). .. All eight gene segments of the influenza viruses were amplified by RT-PCR using 8 primer sets that cover the full viral genome which specifically amplify each gene segment and sequenced using a BigDye Terminator v3.1 Cycle sequencing kit (Applied Biosystems, Nieuwerkerk a/d IJssel, the Netherlands) and a 3130XL genetic analyzer (Applied Biosystems), according to the instructions of the manufacturer.

    Article Title: Voxel-based morphometric brain comparison between healthy subjects and major depressive disorder patients in Japanese with the s/s genotype of 5-HTTLPR
    Article Snippet: DNA was isolated from peripheral blood mononuclearcells using the QIAamp DNA Mini-Kit (QIAGEN, Tokyo, Japan). .. Genotyping was carried out with a polymerase chain reaction (PCR) SNP genotyping system using the BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Japan, Tokyo, Japan).

    Article Title: Splice variants of the endonucleases XPF and XPG contain residual DNA repair capabilities and could be a valuable tool for personalized medicine
    Article Snippet: Constructs were transformed in chemically competent DH5α (E.coli) cells and isolated from single clones grown on LB Agar plates using the NucleoBond Mini plasmid kit (Machery + Nagel, Düren, DE). .. Sequences were verified by Sanger sequencing using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) as described in Schäfer et al. [ ] (primer see Table ).

    Article Title: MAP1B mutations cause intellectual disability and extensive white matter deficit
    Article Snippet: In brief, DNA samples, isolated from blood or buccal swabs, were prepared using TruSeq DNA, TruSeq Nano or TruSeq PCR-Free kits as per Illuminas instructions. .. Applied Biosystems BigDye Terminator v3.1 Cycle Sequencing Kit was used to confirm MAP1B LoF carrier status.

    Activation Assay:

    Article Title: Detection of BRAF mutations in patients with hairy cell leukemia and related lymphoproliferative disorders
    Article Snippet: The reaction mixture included 1× PCR buffer, 2.5 mM MgCl2 , 200 nM of each primer, 200 μM of dNTPs, 5 μM of SYTO 9 (Invitrogen, Carlsbad, CA, USA), 0.5U of HotStarTaq polymerase (Qiagen), 10ng DNA and PCR grade water in a total volume of 10 μL. .. PCR conditions included an activation step of 15 min at 95°C followed by 55 cycles of 95°C for 10 s, annealing for 10 s comprising 10 cycles of a touchdown from 65°C to 55°C at 1°C/cycle followed by 35 cycles at 55°C, and extension at 72°C for 30 s. Samples with aberrant melting curves were directly sequenced from a 1/10 dilution of the HRM product using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. .. Fifty-nine samples (58 bone marrow aspirates and one peripheral blood) from 51 patients with HCL and 34 samples (33 bone marrow aspirates and one peripheral blood) from 34 patients with other hematologic malignancies were identified.


    Article Title: Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers
    Article Snippet: PCR-amplified BRCA2 gene fragments were analyzed for sequence alterations with BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). .. For western blot analysis, anti-BRCA2 Ab-1 (1:100; OP95, EMD Biosciences), anti-BRCA2 Ab-2 (1:100; PC146, EMD Biosciences), and anti-FANCA (1:1000, (#7488) (a gift from Dr. M Hoatlin)) were used.


    Article Title: Mechanism of bacterial gene rearrangement: SprA-catalyzed precise DNA recombination and its directionality control by SprB ensure the gene rearrangement and stable expression of spsM during sporulation in Bacillus subtilis
    Article Snippet: The cleavage products were treated by proteinase K, extracted by phenol, and precipitated using 100% ethanol. .. DNA pellets were dissolved in TE buffer, gel purified, and directly sequenced using the P107 (for the left half- site of attP ) or P109 (for the right half- site) primers, a BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, WI, USA) and an ABI 3500 DNA analyzer (Thermo Fisher Scientific). .. DNA fragments containing the att sites were amplified with the primer sets P110/P61 (for attP ; 89 bp), P111/P87 (for attB ; 106 bp), P111/P58 (for attL ; 111 bp), and P7/P87 (for attR ; 132 bp).

    Article Title: MC1R Genotype and Plumage Colouration in the Zebra Finch (Taeniopygia guttata): Population Structure Generates Artefactual Associations
    Article Snippet: 10 µl of the resulting PCR product was purified using shrimp alkaline phosphatase and exonuclease I (New England Biolabs) following the manufacturer's recommended protocol. .. All fragments were then sequenced in both directions using the Applied Biosystems BigDye® Terminator v3.1 Cycle Sequencing Kit and analysed on an ABI 3730xl capillary sequencer.

    Article Title: Ratiometric biosensors based on dimerization-dependent fluorescent protein exchange
    Article Snippet: PCR products and products of restriction digests were purified by gel electrophoresis and extracted by GeneJET gel extraction kit (Thermo scientific) according to the manufacturer's protocols. .. The cDNA sequences were confirmed by dye terminator cycle sequencing using the BigDye Terminator v3.1 Cycle Sequencing kit (Life Technologies).

    Article Title: Splice variants of the endonucleases XPF and XPG contain residual DNA repair capabilities and could be a valuable tool for personalized medicine
    Article Snippet: Restriction sites for specific restriction enzymes were added by a second PCR reaction of the purified fragments and afterwards precipitated with ethanol under high salt conditions. .. Sequences were verified by Sanger sequencing using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) as described in Schäfer et al. [ ] (primer see Table ).

    Article Title: Transcribed ultraconserved region 339 promotes carcinogenesis by modulating tumor suppressor microRNAs
    Article Snippet: The PCR fragment was purified with MinElute PCR Purification kit (Qiagen), according to the manufacturer’s instructions. .. Exons 5–8 were sequenced with the BigDye® Terminator v3.1 Cycle Sequencing kit (Life Technologies) at 56 °C annealing temperature, using primers 5F, 5R, 6F, 6R, 7F, 7R, 8F, and 8R listed in Supplementary Table .

    Article Title: Microencapsulation of Lactic Acid Bacteria Improves the Gastrointestinal Delivery and in situ Expression of Recombinant Fluorescent Protein
    Article Snippet: The digested vector and insert were purified by IllustraTM GFXTM PCR DNA kit and then were ligated with T4 DNA ligase (Invitrogen, Carlsbad, CA, United States) and transformed into E. coli Top10, creating the E. coli Top10 (pExu:mCherry ) strain. .. Sequence analysis was done to confirm the insert integrity using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, United States) and ABI3130 sequencing equipment.

    Article Title: First records of molluscs naturally infected with Angiostrongylus cantonensis (Nematoda: Metastrongyloidea) in Northeastern Brazil, including new global records of natural intermediate hosts
    Article Snippet: The PCR products were purified using the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare, Little Chalfont, UK) following the manufacturer's protocol. .. Purified products after amplification were bidirectionally sequenced using BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, California, USA) according to the manufacturer's instructions. .. Chromatograms of the sequences obtained were analyzed and edited using Geneious version R9 software ( ), resulting in a consensus sequence (contig).

    Article Title: MAP1B mutations cause intellectual disability and extensive white matter deficit
    Article Snippet: DNA was fragmented, end-repaired, size-selected and purified, followed by PCR enrichment and sequencing libraries were assessed for quality and concentration. .. Applied Biosystems BigDye Terminator v3.1 Cycle Sequencing Kit was used to confirm MAP1B LoF carrier status.


    Article Title: Mechanism of bacterial gene rearrangement: SprA-catalyzed precise DNA recombination and its directionality control by SprB ensure the gene rearrangement and stable expression of spsM during sporulation in Bacillus subtilis
    Article Snippet: The cleavage products were treated by proteinase K, extracted by phenol, and precipitated using 100% ethanol. .. DNA pellets were dissolved in TE buffer, gel purified, and directly sequenced using the P107 (for the left half- site of attP ) or P109 (for the right half- site) primers, a BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, WI, USA) and an ABI 3500 DNA analyzer (Thermo Fisher Scientific). .. DNA fragments containing the att sites were amplified with the primer sets P110/P61 (for attP ; 89 bp), P111/P87 (for attB ; 106 bp), P111/P58 (for attL ; 111 bp), and P7/P87 (for attR ; 132 bp).

    Article Title: Familial STAG2 germline mutation defines a new human cohesinopathy
    Article Snippet: The final sequences were: WT_forward—5′-ATGAAGATGTATAGTGATGCCTTTCTTAATGAC C G-3′; c.980 G > A_forward—5′-GATGAAGATGTATAGTGATGCCTTTCTTAATGAC T A-3′; Reverse—5′-TGTCACCAGGTATACATACTGGGAGATAACTCATG-3′. .. Sanger sequencing was achieved by standard methods using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems® ) and the Applied Biosystems (ABI) 3130 Genetic Analyzer. .. Sequencing data was analyzed using the software Sequencher version 4.1.4 (Gene Code).

    Article Title: Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers
    Article Snippet: PCR was performed using Expand High Fidelity PCR System (Roche). .. Sequences of PCR products were analyzed with BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems; Foster City, CA). .. All nucleotide numbers refer to the wild-type cDNA human sequence of BRCA2 (accession no. ; version GI: 1161383) and BRCA1 ( ) (GenBank database).

    Article Title: Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers
    Article Snippet: Cisplatin-resistant Capan-1 clones were generated by long-term culture in cisplatin (2 μM)-containing medium. .. PCR-amplified BRCA2 gene fragments were analyzed for sequence alterations with BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). .. All nucleotide numbers refer to the wild-type cDNA human sequence of BRCA2 (accession no. ; version GI: 1161383) and BRCA1 ( ).

    Article Title: Limited airborne transmission of influenza A/H7N9 virus between ferrets
    Article Snippet: Viral RNA was extracted from respiratory swab samples collected from the ferrets that were infected via the airborne route and the virus inoculum, using the High Pure RNA Isolation Kit (Roche). .. All eight gene segments of the influenza viruses were amplified by RT-PCR using 8 primer sets that cover the full viral genome which specifically amplify each gene segment and sequenced using a BigDye Terminator v3.1 Cycle sequencing kit (Applied Biosystems, Nieuwerkerk a/d IJssel, the Netherlands) and a 3130XL genetic analyzer (Applied Biosystems), according to the instructions of the manufacturer. .. The consensus sequence was determined for viruses isolated from the following samples: virus inoculum obtained after three egg passages and one MDCK passage, recipient F1: nose swab 7 dpe, recipient F2: throat swab 5 dpe, recipient F3: nose swab 5 dpe, and recipient F5: nose swab 5 dpe.

    Article Title: MC1R Genotype and Plumage Colouration in the Zebra Finch (Taeniopygia guttata): Population Structure Generates Artefactual Associations
    Article Snippet: 10 µl of the resulting PCR product was purified using shrimp alkaline phosphatase and exonuclease I (New England Biolabs) following the manufacturer's recommended protocol. .. All fragments were then sequenced in both directions using the Applied Biosystems BigDye® Terminator v3.1 Cycle Sequencing Kit and analysed on an ABI 3730xl capillary sequencer. .. Pedigree data were not available for all of the zebra finch stocks, as the majority of individuals were bred in aviaries containing numerous individuals rather than through controlled pairings.

    Article Title: A Semi-Synthetic Organism with an Expanded Genetic Alphabet
    Article Snippet: The sequenced fragment (304 bp) with primer regions underlined and the unnatural nucleotide in bold ( X = d NaM ) is 5’- GCTGCAAGGCGATTAAGTTGGGTAACGCC AGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACA X TTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTT CCAGTCGGGAAACCTGTCGTGCCAG .. Sanger sequencing The cycle sequencing reactions (10 µl) were performed on a 9800 Fast Thermal Cycler (Applied Biosystems) with the Cycle Sequencing Mix (0.5 µl) of the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) containing 1 ng template and 6 pmol of sequencing primer pUC19-seq-rev under the following thermal cycling conditions: initial denaturation (98 °C, 1 min); and 25 cycles of denaturation (96 °C, 10 s), annealing (60 °C, 15 s), and extension (68 °C, 2.5 min). .. Upon completion, the residual dye terminators were removed from the reaction with Agencourt CleanSEQ (Beckman-Coulter, Danvers, MA).

    Article Title: Voxel-based morphometric brain comparison between healthy subjects and major depressive disorder patients in Japanese with the s/s genotype of 5-HTTLPR
    Article Snippet: DNA was isolated from peripheral blood mononuclearcells using the QIAamp DNA Mini-Kit (QIAGEN, Tokyo, Japan). .. Genotyping was carried out with a polymerase chain reaction (PCR) SNP genotyping system using the BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Japan, Tokyo, Japan). .. The DNA was read using a BMG Applied Biosystem 3730xI DNA Analyzer (Life Technologies Japan).

    Article Title: Mosaicism for GNAS methylation defects associated with pseudohypoparathyroidism type 1B arose in early post-zygotic phases
    Article Snippet: Buccal epithelial cells are of ectodermal derivation and urine sediment cells are derived from the mesoderm, while leukocytes are from the endoderm. .. Mutation analysis was performed by direct sequencing (BigDye™Terminator v3.1 Cycle Sequencing Kit, cod.4337456, Applied Biosystems) of GNAS 1–13 exons and flanking intronic sequences (ENSEMBL ID: ENSG00000087460). .. Informative genetic markers in the 20q region were evaluated to exclude a possible misdiagnosis of spor-PHP1B in the presence of aneuploidies (monosomy or trisomy) or uniparental disomy (UPD).

    Article Title: Ratiometric biosensors based on dimerization-dependent fluorescent protein exchange
    Article Snippet: Site-directed mutagenesis was performed using Quikchange Lightning kit (Agilent), following the manufacturer's instruction. .. The cDNA sequences were confirmed by dye terminator cycle sequencing using the BigDye Terminator v3.1 Cycle Sequencing kit (Life Technologies). .. Sequencing reactions were analyzed at the University of Alberta Molecular Biology Service Unit.

    Article Title: A Point Mutation in a lincRNA Upstream of GDNF Is Associated to a Canine Insensitivity to Pain: A Spontaneous Model for Human Sensory Neuropathies
    Article Snippet: We re-sequenced the GDNF gene and the variant on 16 affected and 16 unaffected French Spaniel using the Type-it Microsatellite PCR kit (Qiagen) on C1000 and S1000 thermocyclers (Bio-Rad). .. PCR products were cleaned using the Illustra Exostar-1 Step reagent (Dutscher) and sequenced by Sanger method using the BigDye Terminator v3.1 cycle sequencing kit (Thermo Fisher Scientific). .. Electrophoresis of the products was realized on a 370 ABI sequencer.

    Article Title: Splice variants of the endonucleases XPF and XPG contain residual DNA repair capabilities and could be a valuable tool for personalized medicine
    Article Snippet: Constructs were transformed in chemically competent DH5α (E.coli) cells and isolated from single clones grown on LB Agar plates using the NucleoBond Mini plasmid kit (Machery + Nagel, Düren, DE). .. Sequences were verified by Sanger sequencing using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) as described in Schäfer et al. [ ] (primer see Table ). .. Stable cell lines overexpressing the full-length protein or respective splice variants were generated via spontaneous integration of a linearized expression plasmid into MRC5Vi WT cells.

    Article Title: Transcribed ultraconserved region 339 promotes carcinogenesis by modulating tumor suppressor microRNAs
    Article Snippet: The PCR fragment was purified with MinElute PCR Purification kit (Qiagen), according to the manufacturer’s instructions. .. Exons 5–8 were sequenced with the BigDye® Terminator v3.1 Cycle Sequencing kit (Life Technologies) at 56 °C annealing temperature, using primers 5F, 5R, 6F, 6R, 7F, 7R, 8F, and 8R listed in Supplementary Table . .. Subsequently, the sequences were purified with the DyeEx 2.0 Spin kit (Qiagen) and loaded in a 3130 Genetic Analyzer (Applied Biosystems) with Montage Injection Solution (Millipore).

    Article Title: Microencapsulation of Lactic Acid Bacteria Improves the Gastrointestinal Delivery and in situ Expression of Recombinant Fluorescent Protein
    Article Snippet: The digested vector and insert were purified by IllustraTM GFXTM PCR DNA kit and then were ligated with T4 DNA ligase (Invitrogen, Carlsbad, CA, United States) and transformed into E. coli Top10, creating the E. coli Top10 (pExu:mCherry ) strain. .. Sequence analysis was done to confirm the insert integrity using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, United States) and ABI3130 sequencing equipment. .. Lastly, pExu:mCherry was transformed into competent cells of L. lactis ssp. cremoris MG1363 strain generating L. lactis MG1363 (pExu:mCherry ) strain, used in this study.

    Article Title: First records of molluscs naturally infected with Angiostrongylus cantonensis (Nematoda: Metastrongyloidea) in Northeastern Brazil, including new global records of natural intermediate hosts
    Article Snippet: The PCR products were purified using the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare, Little Chalfont, UK) following the manufacturer's protocol. .. Purified products after amplification were bidirectionally sequenced using BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, California, USA) according to the manufacturer's instructions. .. Chromatograms of the sequences obtained were analyzed and edited using Geneious version R9 software ( ), resulting in a consensus sequence (contig).

    Article Title: Detection of BRAF mutations in patients with hairy cell leukemia and related lymphoproliferative disorders
    Article Snippet: The reaction mixture included 1× PCR buffer, 2.5 mM MgCl2 , 200 nM of each primer, 200 μM of dNTPs, 5 μM of SYTO 9 (Invitrogen, Carlsbad, CA, USA), 0.5U of HotStarTaq polymerase (Qiagen), 10ng DNA and PCR grade water in a total volume of 10 μL. .. PCR conditions included an activation step of 15 min at 95°C followed by 55 cycles of 95°C for 10 s, annealing for 10 s comprising 10 cycles of a touchdown from 65°C to 55°C at 1°C/cycle followed by 35 cycles at 55°C, and extension at 72°C for 30 s. Samples with aberrant melting curves were directly sequenced from a 1/10 dilution of the HRM product using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. .. Fifty-nine samples (58 bone marrow aspirates and one peripheral blood) from 51 patients with HCL and 34 samples (33 bone marrow aspirates and one peripheral blood) from 34 patients with other hematologic malignancies were identified.

    Article Title: MAP1B mutations cause intellectual disability and extensive white matter deficit
    Article Snippet: Reads were aligned to NCBI Build 38 of the human reference sequence and then merged into a single BAM file, followed by multi-sample variant calling performed with GenomeAnalysisTK (GATK) version 2.3.9. .. Applied Biosystems BigDye Terminator v3.1 Cycle Sequencing Kit was used to confirm MAP1B LoF carrier status. .. PCR and cycle sequencing reactions were performed on MJ Research PTC-225 thermal cyclers.


    Article Title: Mosaicism for GNAS methylation defects associated with pseudohypoparathyroidism type 1B arose in early post-zygotic phases
    Article Snippet: Mutation analysis was performed by direct sequencing (BigDye™Terminator v3.1 Cycle Sequencing Kit, cod.4337456, Applied Biosystems) of GNAS 1–13 exons and flanking intronic sequences (ENSEMBL ID: ENSG00000087460). .. Informative genetic markers in the 20q region were evaluated to exclude a possible misdiagnosis of spor-PHP1B in the presence of aneuploidies (monosomy or trisomy) or uniparental disomy (UPD).

    Plasmid Preparation:

    Article Title: Splice variants of the endonucleases XPF and XPG contain residual DNA repair capabilities and could be a valuable tool for personalized medicine
    Article Snippet: Constructs were transformed in chemically competent DH5α (E.coli) cells and isolated from single clones grown on LB Agar plates using the NucleoBond Mini plasmid kit (Machery + Nagel, Düren, DE). .. Sequences were verified by Sanger sequencing using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) as described in Schäfer et al. [ ] (primer see Table ).

    Article Title: Microencapsulation of Lactic Acid Bacteria Improves the Gastrointestinal Delivery and in situ Expression of Recombinant Fluorescent Protein
    Article Snippet: The digested vector and insert were purified by IllustraTM GFXTM PCR DNA kit and then were ligated with T4 DNA ligase (Invitrogen, Carlsbad, CA, United States) and transformed into E. coli Top10, creating the E. coli Top10 (pExu:mCherry ) strain. .. Sequence analysis was done to confirm the insert integrity using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, United States) and ABI3130 sequencing equipment.


    Article Title: A Semi-Synthetic Organism with an Expanded Genetic Alphabet
    Article Snippet: Sanger sequencing The cycle sequencing reactions (10 µl) were performed on a 9800 Fast Thermal Cycler (Applied Biosystems) with the Cycle Sequencing Mix (0.5 µl) of the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) containing 1 ng template and 6 pmol of sequencing primer pUC19-seq-rev under the following thermal cycling conditions: initial denaturation (98 °C, 1 min); and 25 cycles of denaturation (96 °C, 10 s), annealing (60 °C, 15 s), and extension (68 °C, 2.5 min). .. Sanger sequencing The cycle sequencing reactions (10 µl) were performed on a 9800 Fast Thermal Cycler (Applied Biosystems) with the Cycle Sequencing Mix (0.5 µl) of the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) containing 1 ng template and 6 pmol of sequencing primer pUC19-seq-rev under the following thermal cycling conditions: initial denaturation (98 °C, 1 min); and 25 cycles of denaturation (96 °C, 10 s), annealing (60 °C, 15 s), and extension (68 °C, 2.5 min).

    Article Title: A Point Mutation in a lincRNA Upstream of GDNF Is Associated to a Canine Insensitivity to Pain: A Spontaneous Model for Human Sensory Neuropathies
    Article Snippet: PCR products were cleaned using the Illustra Exostar-1 Step reagent (Dutscher) and sequenced by Sanger method using the BigDye Terminator v3.1 cycle sequencing kit (Thermo Fisher Scientific). .. Electrophoresis of the products was realized on a 370 ABI sequencer.

    Negative Control:

    Article Title: First records of molluscs naturally infected with Angiostrongylus cantonensis (Nematoda: Metastrongyloidea) in Northeastern Brazil, including new global records of natural intermediate hosts
    Article Snippet: For all the reactions, ultrapure water was used as a negative control template, and the positive control was performed with genomic DNA of A. cantonensis as template. .. Purified products after amplification were bidirectionally sequenced using BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, California, USA) according to the manufacturer's instructions.


    Article Title: MC1R Genotype and Plumage Colouration in the Zebra Finch (Taeniopygia guttata): Population Structure Generates Artefactual Associations
    Article Snippet: Paragraph title: Blood sampling, DNA extraction and MC1R sequencing ... All fragments were then sequenced in both directions using the Applied Biosystems BigDye® Terminator v3.1 Cycle Sequencing Kit and analysed on an ABI 3730xl capillary sequencer.

    Concentration Assay:

    Article Title: MAP1B mutations cause intellectual disability and extensive white matter deficit
    Article Snippet: DNA was fragmented, end-repaired, size-selected and purified, followed by PCR enrichment and sequencing libraries were assessed for quality and concentration. .. Applied Biosystems BigDye Terminator v3.1 Cycle Sequencing Kit was used to confirm MAP1B LoF carrier status.

    DNA Purification:

    Article Title: Mosaicism for GNAS methylation defects associated with pseudohypoparathyroidism type 1B arose in early post-zygotic phases
    Article Snippet: Genomic DNA was extracted from samples of the peripheral blood (Nucleon BACC2 genomic DNA purification kit, cod.RPN8502, GE Healthcare), saliva, and urine (Puregene Core kit, cod. .. Mutation analysis was performed by direct sequencing (BigDye™Terminator v3.1 Cycle Sequencing Kit, cod.4337456, Applied Biosystems) of GNAS 1–13 exons and flanking intronic sequences (ENSEMBL ID: ENSG00000087460).

    CTG Assay:

    Article Title: Voxel-based morphometric brain comparison between healthy subjects and major depressive disorder patients in Japanese with the s/s genotype of 5-HTTLPR
    Article Snippet: Genotyping was carried out with a polymerase chain reaction (PCR) SNP genotyping system using the BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Japan, Tokyo, Japan). .. Genotyping was carried out with a polymerase chain reaction (PCR) SNP genotyping system using the BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Japan, Tokyo, Japan).

    Gel Extraction:

    Article Title: Ratiometric biosensors based on dimerization-dependent fluorescent protein exchange
    Article Snippet: PCR products and products of restriction digests were purified by gel electrophoresis and extracted by GeneJET gel extraction kit (Thermo scientific) according to the manufacturer's protocols. .. The cDNA sequences were confirmed by dye terminator cycle sequencing using the BigDye Terminator v3.1 Cycle Sequencing kit (Life Technologies).

    Article Title: Splice variants of the endonucleases XPF and XPG contain residual DNA repair capabilities and could be a valuable tool for personalized medicine
    Article Snippet: Sequences were verified by Sanger sequencing using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) as described in Schäfer et al. [ ] (primer see Table ). .. Sequences were verified by Sanger sequencing using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) as described in Schäfer et al. [ ] (primer see Table ).

    Variant Assay:

    Article Title: Familial STAG2 germline mutation defines a new human cohesinopathy
    Article Snippet: The presence of the c.980 G > A variant in STAG2 gene in the proband and his relatives was confirmed using allele-specific PCR and Sanger sequencing. .. Sanger sequencing was achieved by standard methods using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems® ) and the Applied Biosystems (ABI) 3130 Genetic Analyzer.

    Article Title: Mosaicism for GNAS methylation defects associated with pseudohypoparathyroidism type 1B arose in early post-zygotic phases
    Article Snippet: Mutation analysis was performed by direct sequencing (BigDye™Terminator v3.1 Cycle Sequencing Kit, cod.4337456, Applied Biosystems) of GNAS 1–13 exons and flanking intronic sequences (ENSEMBL ID: ENSG00000087460). .. For variable number tandem repeat (VNTR) genotyping, we set up a cost-effective three-primer approach based on the simultaneous use of a couple of sequence-specific primers, the reverse one containing a poliA tail at the 5′ end to allow easier allele scoring, associated with a fluorescently labeled universal forward M13-tailed FAM oligonucleotide.

    Article Title: A Point Mutation in a lincRNA Upstream of GDNF Is Associated to a Canine Insensitivity to Pain: A Spontaneous Model for Human Sensory Neuropathies
    Article Snippet: Paragraph title: Identification of the candidate variant in dogs ... PCR products were cleaned using the Illustra Exostar-1 Step reagent (Dutscher) and sequenced by Sanger method using the BigDye Terminator v3.1 cycle sequencing kit (Thermo Fisher Scientific).

    Article Title: MAP1B mutations cause intellectual disability and extensive white matter deficit
    Article Snippet: Reads were aligned to NCBI Build 38 of the human reference sequence and then merged into a single BAM file, followed by multi-sample variant calling performed with GenomeAnalysisTK (GATK) version 2.3.9. .. Applied Biosystems BigDye Terminator v3.1 Cycle Sequencing Kit was used to confirm MAP1B LoF carrier status.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher bigdye terminator v3 1 cycle sequencing kit
    DNA cleavage and strand exchange by SprA. ( A ) Direct sequencing of the intermediates of the SprA-mediated integration reaction. The intermediates: the left and right half-sites of attP , were directly sequenced using a <t>BigDye</t> Terminator <t>v3.1</t> Cycle Sequencing Kit and an ABI 3500 DNA analyzer. The 16 bp overlapping sequence is underlined. The 3΄-end nucleotides indicated by the circles are adenines added by the terminal transferase activity of Taq polymerase used for the cycle sequencing reaction. The cleavage point of attP is shown to the left (indicated by the lines and triangles). ( B ) Effects of point mutations of the central dinucleotides on DNA recombination. Point mutations were introduced into the AAA nucleotides at the center of the attB site (A→T). In vitro integration recombination was performed using 0.5 μM SprA and 50 ng each of the wild-type attP and the mutated attB substrates.
    Bigdye Terminator V3 1 Cycle Sequencing Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 546 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more terminator v3 1 cycle sequencing kit/product/Thermo Fisher
    Average 99 stars, based on 546 article reviews
    Price from $9.99 to $1999.99
    bigdye terminator v3 1 cycle sequencing kit - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results

    DNA cleavage and strand exchange by SprA. ( A ) Direct sequencing of the intermediates of the SprA-mediated integration reaction. The intermediates: the left and right half-sites of attP , were directly sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit and an ABI 3500 DNA analyzer. The 16 bp overlapping sequence is underlined. The 3΄-end nucleotides indicated by the circles are adenines added by the terminal transferase activity of Taq polymerase used for the cycle sequencing reaction. The cleavage point of attP is shown to the left (indicated by the lines and triangles). ( B ) Effects of point mutations of the central dinucleotides on DNA recombination. Point mutations were introduced into the AAA nucleotides at the center of the attB site (A→T). In vitro integration recombination was performed using 0.5 μM SprA and 50 ng each of the wild-type attP and the mutated attB substrates.

    Journal: Nucleic Acids Research

    Article Title: Mechanism of bacterial gene rearrangement: SprA-catalyzed precise DNA recombination and its directionality control by SprB ensure the gene rearrangement and stable expression of spsM during sporulation in Bacillus subtilis

    doi: 10.1093/nar/gkx466

    Figure Lengend Snippet: DNA cleavage and strand exchange by SprA. ( A ) Direct sequencing of the intermediates of the SprA-mediated integration reaction. The intermediates: the left and right half-sites of attP , were directly sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit and an ABI 3500 DNA analyzer. The 16 bp overlapping sequence is underlined. The 3΄-end nucleotides indicated by the circles are adenines added by the terminal transferase activity of Taq polymerase used for the cycle sequencing reaction. The cleavage point of attP is shown to the left (indicated by the lines and triangles). ( B ) Effects of point mutations of the central dinucleotides on DNA recombination. Point mutations were introduced into the AAA nucleotides at the center of the attB site (A→T). In vitro integration recombination was performed using 0.5 μM SprA and 50 ng each of the wild-type attP and the mutated attB substrates.

    Article Snippet: DNA pellets were dissolved in TE buffer, gel purified, and directly sequenced using the P107 (for the left half- site of attP ) or P109 (for the right half- site) primers, a BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, WI, USA) and an ABI 3500 DNA analyzer (Thermo Fisher Scientific).

    Techniques: Sequencing, Activity Assay, In Vitro