bigdye terminator cycle sequencing kit (Thermo Fisher)

Name:
BigDye Terminator v1.1 Cycle Sequencing Kit
Description:
Catalog Number:
BTVCSK3693469
Price:
None
Score:
85
|
Buy from Supplier |
Name:
BigDye Terminator v1.1 Cycle Sequencing Kit
Description:
This BigDye Terminator v1.1 Cycle Sequencing Kit is designed for specialty applications that require optimal basecalling adjacent to the primer and for sequencing short PCR product templates with rapid electrophoresis run modules. • Improve the quality of your results for a wide range of sequencing applications. • Sequence challenging templates and sequences more successfully. • Get longer, higher-quality reads with more uniform peak heights and optimal signal balance. • Enhance your productivity and reduce costs.Tackle Tough Sequences With the BigDye Terminator v1.1 Cycle Sequencing Kit you get a robust, highly flexible chemistry for a wide range of applications, including de novo sequencing and resequencing.Get More Uniform Peak Heights, Improved AccuracyWith BigDye Terminator v1.1 kit's superior chemistry, you generate data with uniform peak heights and optimized signal balance-which results in longer, higher-quality reads. You also get more accurate base assignments for heterozygote and mutation detection. Easily Integrate into Your WorkflowBigDye Terminator v.1.1 kit's chemistry requires no new software or instrument recalibration.You can easily integrate either kit into your current workflow with minimal changes to your protocols. For Research Use Only. Not for use in diagnostics procedures.
Catalog Number:
4337449
Price:
None
Applications:
Kits & Reagents for Sanger Sequencing|Sanger Sequencing|Sanger Sequencing Technology & Accessories|Sequencing
Size:
24 reactions
Category:
Kits and Assays, Sequencing Kits & Reagents, Sequencing Kits
Score:
85
|
Buy from Supplier |
Structured Review
This BigDye Terminator v1.1 Cycle Sequencing Kit is designed for specialty applications that require optimal basecalling adjacent to the primer and for sequencing short PCR product templates with rapid electrophoresis run modules. • Improve the quality of your results for a wide range of sequencing applications. • Sequence challenging templates and sequences more successfully. • Get longer, higher-quality reads with more uniform peak heights and optimal signal balance. • Enhance your productivity and reduce costs.Tackle Tough Sequences With the BigDye Terminator v1.1 Cycle Sequencing Kit you get a robust, highly flexible chemistry for a wide range of applications, including de novo sequencing and resequencing.Get More Uniform Peak Heights, Improved AccuracyWith BigDye Terminator v1.1 kit's superior chemistry, you generate data with uniform peak heights and optimized signal balance-which results in longer, higher-quality reads. You also get more accurate base assignments for heterozygote and mutation detection. Easily Integrate into Your WorkflowBigDye Terminator v.1.1 kit's chemistry requires no new software or instrument recalibration.You can easily integrate either kit into your current workflow with minimal changes to your protocols. For Research Use Only. Not for use in diagnostics procedures.
https://www.bioz.com/result/bigdye terminator cycle sequencing kit/product/Thermo Fisher
Average 99 stars, based on 896 article reviews
Price from $9.99 to $1999.99
Related Products / Commonly Used Together
Images
Related Articles
Clone Assay:Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus Article Snippet: For mutagenesis, standard PCR based methods with thermostable Pfu polymerase (Promega, Heidelberg, Germany) and synthetic primers purchased from Metabion (München, Germany) were used. .. The cloned PCR products were all verified by nucleotide sequencing with the Article Title: Association of crumbs homolog-2 with mTORC1 in developing podocyte Article Snippet: The sequence was confirmed using a Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories Article Snippet: Those samples positive for Plasmodium were each purified using Gel/PCR DNAFragment Extraction kit (Geneaid, Taiwan), cloned into the Zero Blunt® vector (ThermoFisher Scientific), transformed into One Shot® TOPO10 Chemically Competent E. coli using heat-shock, and then plated onto LB agar containing (50 μg/mL) kanamycin. .. The ClpM gene was sequenced using the Article Title: Alternative splicing after gene duplication drives CEACAM1-paralog diversification in the horse Article Snippet: Paragraph title: cDNA cloning ... Nucleotide sequencing was performed with the Article Title: Two Alternative Ways of Start Site Selection in Human Norovirus Reinitiation of Translation Article Snippet: The mutant constructs for FCV were established on the basis of plasmid pCH1 ( ) and for RHDV on the basis of plasmid pRmRNA ( ). .. The cloned PCR products were all verified by nucleotide sequencing with the Amplification:Article Title: Isolation of Treponema DNA from Necrophagous Flies in a Natural Ecosystem Article Snippet: Therefore, only PCR products amplified from two independent fly samples were Sanger sequenced to receive final proof of the correct PCR product (data not shown). .. Sanger sequencing was performed utilizing the Article Title: Spectrum of mutations underlying Propionic acidemia and further insight into a genotype-phenotype correlation for the common mutation in Saudi Arabia Article Snippet: Oligonucleotide primers for PCR amplification of genomic DNA were designed using Primer3 software ( http://frodo.wi.mit.edu/ ) and synthesized by Metabion International AG (Munich, Germany). .. PCR products were sequenced using Article Title: Mutations in the DNA methyltransferase gene, DNMT3A, cause an overgrowth syndrome with intellectual disability Article Snippet: Products were sequenced with the original PCR primers or internal sequencing primers (exons 3, 6, 8, 10, 14 and 22) using the Article Title: Postepizootic Persistence of Asymptomatic Mycoplasma conjunctivae Infection in Iberian Ibex Article Snippet: The reactions were performed according to Belloy et al. , with minor modifications of the primers, using the Serstart3 (5′-TTTAGTAGACTCCACTTCACC-3′) and LppTA2 (5′-TTTGATCTCTCCACCTTCAGC-3′) primers for the first PCR and Serstart2 (5′-CACTATACTTAACAGATAGTCC-3′) and LppTA (5′-GGCACTAATAGTGCGTAATTC-3′) primers in a nested reaction if the first amplification was not enough. .. The sequencing of the amplicons was performed using the Ser_start2, Ser_start0 (5′-ATACTCAAAGTGGAAATAATGGAA-3′), and Ser_end0 (5′-GCAACAACAATAGTAAGAGCAG-3′) primers using the Article Title: AGK‐BRAF gene fusion is a recurrent event in sporadic pediatric thyroid carcinoma Article Snippet: The PCR products were resolved on a 2% agarose gel and visualized on a Bio‐Rad Gel Doc EZ system (Bio‐Rad). .. To confirm the identity of the amplified products, positive samples were sequenced using the Article Title: Multimodal Analysis of SCN1A Missense Variants Improves Interpretation of Clinically Relevant Variants in Dravet Syndrome Article Snippet: DNA samples for each patient and their parents, when available, were obtained from peripheral blood lymphocytes by standard procedures ( ). .. All 26 coding exons and intron-exon boundaries of SCN1A were amplified by PCR (primer sequences available upon request) and Sanger sequenced by capillary electrophoresis in an ABI 3500xL Genetic Analyzer using the Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice Article Snippet: The linearized product was then amplified by PCR with BAC inverse primers (327D13-R1 inverse_5′-CCCTAATGATGACCACGTGA-3′ and pTARBAC-R inverse_5′-TAGTGTCACCTAAATGTCGAC-3′). .. DNA was eluted in water for subsequent sequencing with each of the inverse primers ( Article Title: Clinical Validation of Newly Developed Multiplex Kit Using Luminex xMAP Technology for Detecting Simultaneous RAS and BRAF Mutations in Colorectal Cancer: Results of the RASKET-B Study Article Snippet: Briefly, each extracted DNA was amplified using six sets of primers to amplify exon 2, exon 3, and exon 4 in KRAS and NRAS , and exon 15 in BRAF . .. The mutations in these regions were detected using the Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories Article Snippet: PCR amplification of the ClpM gene was performed in a 20 μL reaction mixture containing 2 μL of purified genomic DNA, 200 μM each deoxyribonucleotide triphosphate (dNTP) (Promega,Madison WI, USA), Phusion HF buffer (1.5 mM MgCl2 ), 0.02 U/ μL of Phusion DNA polymerase (ThermoScientific, USA) and 0.5 μM of each primer (ACLP-F1 and ACLP-R1) under the following conditions: 98 °C for 30s for first denaturation, 35 cycles at 98 °C for 7 s, 60 °C for 20s and 72 °C for 30s, followed by a final extension for 10mins at 72 °C. .. The ClpM gene was sequenced using the Article Title: Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency, et al. Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency Article Snippet: 3.3 Measurement of SCEH enzyme activity and immunoblotting, were performed in cultured skin fibroblasts from Patient 1 and Patient 3 as described in Peters et al. ( ). .. 3.4 All exons and flanking intronic sequences of the ECHS1 gene of Patient 1 were Sanger sequenced after amplification by PCR from genomic DNA isolated from cultured fibroblasts and using a Article Title: Alternative splicing after gene duplication drives CEACAM1-paralog diversification in the horse Article Snippet: For cDNA cloning the RT product was amplified by polymerase chain reaction (PCR) with Easy-A High-Fidelity PCR Cloning Enzyme (Agilent) and analyzed by agarose gel electrophoresis. .. Nucleotide sequencing was performed with the Synthesized:Article Title: Spectrum of mutations underlying Propionic acidemia and further insight into a genotype-phenotype correlation for the common mutation in Saudi Arabia Article Snippet: Oligonucleotide primers for PCR amplification of genomic DNA were designed using Primer3 software ( http://frodo.wi.mit.edu/ ) and synthesized by Metabion International AG (Munich, Germany). .. PCR products were sequenced using Construct:Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus Article Snippet: Since transcription templated by this construct yielded several bands, construct pStr was established with a smaller cDNA fragment generated by PCR with primers rw4f (GCGGCCGCGATATCATTTAGGTGACACTATAGAGCTCAACC) rw4r: ATGCATTGCTCAGGGATCCGATATCGGCACCTGCAAGTCCC, and inserted into the BamHI and NotI sites of a modified pBR322. .. The cloned PCR products were all verified by nucleotide sequencing with the Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins Article Snippet: Small-scale isolation of plasmid DNA was performed by GeneJET miniprep kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the Article Title: Two Alternative Ways of Start Site Selection in Human Norovirus Reinitiation of Translation Article Snippet: The mutant constructs for FCV were established on the basis of plasmid pCH1 ( ) and for RHDV on the basis of plasmid pRmRNA ( ). .. The cloned PCR products were all verified by nucleotide sequencing with the Electrophoresis:Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins Article Snippet: PCR products and products of restriction digests were routinely purified using preparative agarose gel electrophoresis followed by DNA isolation using the GeneJET gel extraction kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the Article Title: Multimodal Analysis of SCN1A Missense Variants Improves Interpretation of Clinically Relevant Variants in Dravet Syndrome Article Snippet: DNA samples for each patient and their parents, when available, were obtained from peripheral blood lymphocytes by standard procedures ( ). .. All 26 coding exons and intron-exon boundaries of SCN1A were amplified by PCR (primer sequences available upon request) and Sanger sequenced by capillary electrophoresis in an ABI 3500xL Genetic Analyzer using the Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories Article Snippet: PCR products were separated by electrophoresis in a 1% agarose gel, stained with SYBR® DNA gel stain (Invitrogen, USA) and visualised under a UV transilluminator (GBOX from Syngene). .. The ClpM gene was sequenced using the Nested PCR:Article Title: Postepizootic Persistence of Asymptomatic Mycoplasma conjunctivae Infection in Iberian Ibex Article Snippet: For DNA sequence analyses, all products from the nested PCR were purified with the High Pure PCR product purification kit (Roche Diagnostics, Rotkreuz, Switzerland). .. The sequencing of the amplicons was performed using the Ser_start2, Ser_start0 (5′-ATACTCAAAGTGGAAATAATGGAA-3′), and Ser_end0 (5′-GCAACAACAATAGTAAGAGCAG-3′) primers using the Incubation:Article Title: AGK‐BRAF gene fusion is a recurrent event in sporadic pediatric thyroid carcinoma Article Snippet: To confirm the identity of the amplified products, positive samples were sequenced using the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA). .. To confirm the identity of the amplified products, positive samples were sequenced using the Formalin-fixed Paraffin-Embedded:Article Title: Clinical Validation of Newly Developed Multiplex Kit Using Luminex xMAP Technology for Detecting Simultaneous RAS and BRAF Mutations in Colorectal Cancer: Results of the RASKET-B Study Article Snippet: DNA extraction was performed with QIAamp DNA FFPE Tissue Kit (Qiagen, Venlo, Netherlands) according to the manufacturer's protocol and as previously reported , . .. The mutations in these regions were detected using the In Silico:Article Title: Spectrum of mutations underlying Propionic acidemia and further insight into a genotype-phenotype correlation for the common mutation in Saudi Arabia Article Snippet: PCR products were sequenced using Expressing:Article Title: Association of crumbs homolog-2 with mTORC1 in developing podocyte Article Snippet: A full-length cDNA clone of mouse wild-type CRB2 was obtained from a mouse kidney cDNA library, excised using EcoRI and subcloned into the EcoRI site of the mammalian expression vector pcDNA3.1/Zeo(-) (Invitrogen, Carlsbad, CA, USA). .. The sequence was confirmed using a Article Title: Two Alternative Ways of Start Site Selection in Human Norovirus Reinitiation of Translation Article Snippet: The huNV expression construct pNVΔCdM lacking all internal methionine codons was established synthetically (Invitrogen). .. The cloned PCR products were all verified by nucleotide sequencing with the Modification:Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus Article Snippet: Since transcription templated by this construct yielded several bands, construct pStr was established with a smaller cDNA fragment generated by PCR with primers rw4f (GCGGCCGCGATATCATTTAGGTGACACTATAGAGCTCAACC) rw4r: ATGCATTGCTCAGGGATCCGATATCGGCACCTGCAAGTCCC, and inserted into the BamHI and NotI sites of a modified pBR322. .. The cloned PCR products were all verified by nucleotide sequencing with the Transformation Assay:Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories Article Snippet: To determine whether the transformed E. coli harbouring recombinant plasmid with ClpM insert, the colonies were examined by PCR using the ClpM-specific primers ACLP-F1 and ACLP-R1. .. The ClpM gene was sequenced using the Derivative Assay:Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories Article Snippet: The ClpM gene was sequenced using the Hybridization:Article Title: A splice donor variant in CCDC189 is associated with asthenospermia in Nordic Red dairy cattle Article Snippet: PCR products were purified and directly sequenced using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, CA, US). .. PCR products were purified and directly sequenced using the Inverse PCR:Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice Article Snippet: Paragraph title: BAC localization by inverse PCR ... DNA was eluted in water for subsequent sequencing with each of the inverse primers ( Ligation:Article Title: Multimodal Analysis of SCN1A Missense Variants Improves Interpretation of Clinically Relevant Variants in Dravet Syndrome Article Snippet: All 26 coding exons and intron-exon boundaries of SCN1A were amplified by PCR (primer sequences available upon request) and Sanger sequenced by capillary electrophoresis in an ABI 3500xL Genetic Analyzer using the Cell Culture:Article Title: Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency, et al. Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency Article Snippet: 3.3 Measurement of SCEH enzyme activity and immunoblotting, were performed in cultured skin fibroblasts from Patient 1 and Patient 3 as described in Peters et al. ( ). .. 3.4 All exons and flanking intronic sequences of the ECHS1 gene of Patient 1 were Sanger sequenced after amplification by PCR from genomic DNA isolated from cultured fibroblasts and using a Generated:Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus Article Snippet: Since transcription templated by this construct yielded several bands, construct pStr was established with a smaller cDNA fragment generated by PCR with primers rw4f (GCGGCCGCGATATCATTTAGGTGACACTATAGAGCTCAACC) rw4r: ATGCATTGCTCAGGGATCCGATATCGGCACCTGCAAGTCCC, and inserted into the BamHI and NotI sites of a modified pBR322. .. The cloned PCR products were all verified by nucleotide sequencing with the Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice Article Snippet: DNA was eluted in water for subsequent sequencing with each of the inverse primers ( Article Title: Two Alternative Ways of Start Site Selection in Human Norovirus Reinitiation of Translation Article Snippet: For detection of downstream initiation close to the original stop/start site, pNVΔC, a 3′-terminally truncated version of pNVWT was generated; this construct lacks the codons coding for the C-terminal residues 107–268 of VP2. .. The cloned PCR products were all verified by nucleotide sequencing with the DNA Sequencing:Article Title: Isolation of Treponema DNA from Necrophagous Flies in a Natural Ecosystem Article Snippet: Paragraph title: Gel Electrophoresis, Purification and DNA Sequencing ... Sanger sequencing was performed utilizing the Sequencing:Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus Article Snippet: For mutagenesis, standard PCR based methods with thermostable Pfu polymerase (Promega, Heidelberg, Germany) and synthetic primers purchased from Metabion (München, Germany) were used. .. The cloned PCR products were all verified by nucleotide sequencing with the Article Title: Isolation of Treponema DNA from Necrophagous Flies in a Natural Ecosystem Article Snippet: Therefore, only PCR products amplified from two independent fly samples were Sanger sequenced to receive final proof of the correct PCR product (data not shown). .. Sanger sequencing was performed utilizing the Article Title: Spectrum of mutations underlying Propionic acidemia and further insight into a genotype-phenotype correlation for the common mutation in Saudi Arabia Article Snippet: PCR products were treated with the Agencourt AMPure PCR purification system (Agencourt Bioscience Corporation, Beverly, MA, USA). .. PCR products were sequenced using Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins Article Snippet: Small-scale isolation of plasmid DNA was performed by GeneJET miniprep kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the Article Title: Postepizootic Persistence of Asymptomatic Mycoplasma conjunctivae Infection in Iberian Ibex Article Snippet: For DNA sequence analyses, all products from the nested PCR were purified with the High Pure PCR product purification kit (Roche Diagnostics, Rotkreuz, Switzerland). .. The sequencing of the amplicons was performed using the Ser_start2, Ser_start0 (5′-ATACTCAAAGTGGAAATAATGGAA-3′), and Ser_end0 (5′-GCAACAACAATAGTAAGAGCAG-3′) primers using the Article Title: AGK‐BRAF gene fusion is a recurrent event in sporadic pediatric thyroid carcinoma Article Snippet: The PCR products were resolved on a 2% agarose gel and visualized on a Bio‐Rad Gel Doc EZ system (Bio‐Rad). .. To confirm the identity of the amplified products, positive samples were sequenced using the Article Title: Multimodal Analysis of SCN1A Missense Variants Improves Interpretation of Clinically Relevant Variants in Dravet Syndrome Article Snippet: DNA samples for each patient and their parents, when available, were obtained from peripheral blood lymphocytes by standard procedures ( ). .. All 26 coding exons and intron-exon boundaries of SCN1A were amplified by PCR (primer sequences available upon request) and Sanger sequenced by capillary electrophoresis in an ABI 3500xL Genetic Analyzer using the Article Title: A splice donor variant in CCDC189 is associated with asthenospermia in Nordic Red dairy cattle Article Snippet: The cycling conditions were the following: a) an initial denaturation at 95 °C for 3 min, b) 29 cycles of 30 s denaturation (94 °C), 30 s hybridization (58 °C), 30 s elongation (72 °C), and c) a final 3 min elongation (72 °C). .. PCR products were purified and directly sequenced using the Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice Article Snippet: PCR products were separated on a 1% agarose gel and all obvious bands were excised from the gel and purified using QIAquick Gel Extraction kit (Qiagen). .. DNA was eluted in water for subsequent sequencing with each of the inverse primers ( Article Title: Association of crumbs homolog-2 with mTORC1 in developing podocyte Article Snippet: A full-length cDNA clone of mouse wild-type CRB2 was obtained from a mouse kidney cDNA library, excised using EcoRI and subcloned into the EcoRI site of the mammalian expression vector pcDNA3.1/Zeo(-) (Invitrogen, Carlsbad, CA, USA). .. The sequence was confirmed using a Article Title: Clinical Validation of Newly Developed Multiplex Kit Using Luminex xMAP Technology for Detecting Simultaneous RAS and BRAF Mutations in Colorectal Cancer: Results of the RASKET-B Study Article Snippet: Briefly, each extracted DNA was amplified using six sets of primers to amplify exon 2, exon 3, and exon 4 in KRAS and NRAS , and exon 15 in BRAF . .. The mutations in these regions were detected using the Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories Article Snippet: Recombinant plasmids containing the ClpM gene fragment were purified using PureLink® Quick Plasmid DNA Miniprep Kits (Invitrogen, USA). .. The ClpM gene was sequenced using the Article Title: The manner of decay of genetically defective EYS gene transcripts in photoreceptor-directed fibroblasts derived from retinitis pigmentosa patients depends on the type of mutation Article Snippet: The design of PCR primer sets is shown in our previous paper [ ] and Additional file : Table S1. .. Direct sequencing was performed with a Article Title: Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency, et al. Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency Article Snippet: 3.3 Measurement of SCEH enzyme activity and immunoblotting, were performed in cultured skin fibroblasts from Patient 1 and Patient 3 as described in Peters et al. ( ). .. 3.4 All exons and flanking intronic sequences of the ECHS1 gene of Patient 1 were Sanger sequenced after amplification by PCR from genomic DNA isolated from cultured fibroblasts and using a Article Title: Alternative splicing after gene duplication drives CEACAM1-paralog diversification in the horse Article Snippet: Plasmid DNA isolated from various clones were analyzed by PCR and sequencing. .. Nucleotide sequencing was performed with the Article Title: Functional modelling of a novel mutation in BBS5 Article Snippet: Primer sequences are available upon request. .. PCR products were sequenced using Article Title: Two Alternative Ways of Start Site Selection in Human Norovirus Reinitiation of Translation Article Snippet: The mutant constructs for FCV were established on the basis of plasmid pCH1 ( ) and for RHDV on the basis of plasmid pRmRNA ( ). .. The cloned PCR products were all verified by nucleotide sequencing with the Recombinant:Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus Article Snippet: Paragraph title: Construction of recombinant plasmids ... The cloned PCR products were all verified by nucleotide sequencing with the Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories Article Snippet: Recombinant plasmids containing the ClpM gene fragment were purified using PureLink® Quick Plasmid DNA Miniprep Kits (Invitrogen, USA). .. The ClpM gene was sequenced using the Article Title: Two Alternative Ways of Start Site Selection in Human Norovirus Reinitiation of Translation Article Snippet: Paragraph title: Construction of Recombinant Plasmids ... The cloned PCR products were all verified by nucleotide sequencing with the DNA Extraction:Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins Article Snippet: PCR products and products of restriction digests were routinely purified using preparative agarose gel electrophoresis followed by DNA isolation using the GeneJET gel extraction kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the Article Title: Clinical Validation of Newly Developed Multiplex Kit Using Luminex xMAP Technology for Detecting Simultaneous RAS and BRAF Mutations in Colorectal Cancer: Results of the RASKET-B Study Article Snippet: DNA extraction was performed with QIAamp DNA FFPE Tissue Kit (Qiagen, Venlo, Netherlands) according to the manufacturer's protocol and as previously reported , . .. The mutations in these regions were detected using the Nucleic Acid Electrophoresis:Article Title: Isolation of Treponema DNA from Necrophagous Flies in a Natural Ecosystem Article Snippet: Paragraph title: Gel Electrophoresis, Purification and DNA Sequencing ... Sanger sequencing was performed utilizing the Fluorescence:Article Title: Postepizootic Persistence of Asymptomatic Mycoplasma conjunctivae Infection in Iberian Ibex Article Snippet: The cycle threshold was set at 0.05, and the PCR cycle when the sample fluorescence crossed the threshold was recorded as the CT value, which inversely corresponds to the initial amount of target DNA in the test sample. .. The sequencing of the amplicons was performed using the Ser_start2, Ser_start0 (5′-ATACTCAAAGTGGAAATAATGGAA-3′), and Ser_end0 (5′-GCAACAACAATAGTAAGAGCAG-3′) primers using the Mutagenesis:Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus Article Snippet: For mutagenesis, standard PCR based methods with thermostable Pfu polymerase (Promega, Heidelberg, Germany) and synthetic primers purchased from Metabion (München, Germany) were used. .. The cloned PCR products were all verified by nucleotide sequencing with the Article Title: Spectrum of mutations underlying Propionic acidemia and further insight into a genotype-phenotype correlation for the common mutation in Saudi Arabia Article Snippet: PCR products were sequenced using Article Title: Mutations in the DNA methyltransferase gene, DNMT3A, cause an overgrowth syndrome with intellectual disability Article Snippet: Paragraph title: DNMT3A mutation analysis ... Products were sequenced with the original PCR primers or internal sequencing primers (exons 3, 6, 8, 10, 14 and 22) using the Article Title: Multimodal Analysis of SCN1A Missense Variants Improves Interpretation of Clinically Relevant Variants in Dravet Syndrome Article Snippet: Paragraph title: Mutation Screening ... All 26 coding exons and intron-exon boundaries of SCN1A were amplified by PCR (primer sequences available upon request) and Sanger sequenced by capillary electrophoresis in an ABI 3500xL Genetic Analyzer using the Article Title: Functional modelling of a novel mutation in BBS5 Article Snippet: Paragraph title: Homozygosity mapping and mutation analysis ... PCR products were sequenced using Article Title: Two Alternative Ways of Start Site Selection in Human Norovirus Reinitiation of Translation Article Snippet: The mutant constructs for FCV were established on the basis of plasmid pCH1 ( ) and for RHDV on the basis of plasmid pRmRNA ( ). .. The cloned PCR products were all verified by nucleotide sequencing with the Isolation:Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins Article Snippet: Small-scale isolation of plasmid DNA was performed by GeneJET miniprep kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the Article Title: Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency, et al. Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency Article Snippet: 3.3 Measurement of SCEH enzyme activity and immunoblotting, were performed in cultured skin fibroblasts from Patient 1 and Patient 3 as described in Peters et al. ( ). .. 3.4 All exons and flanking intronic sequences of the ECHS1 gene of Patient 1 were Sanger sequenced after amplification by PCR from genomic DNA isolated from cultured fibroblasts and using a Article Title: Alternative splicing after gene duplication drives CEACAM1-paralog diversification in the horse Article Snippet: Plasmid DNA isolated from various clones were analyzed by PCR and sequencing. .. Nucleotide sequencing was performed with the Multiplex Assay:Article Title: Mutations in the DNA methyltransferase gene, DNMT3A, cause an overgrowth syndrome with intellectual disability Article Snippet: The PCR was carried out using a Qiagen Multiplex PCR kit according to the manufacturer’s instructions. .. Products were sequenced with the original PCR primers or internal sequencing primers (exons 3, 6, 8, 10, 14 and 22) using the Article Title: Multimodal Analysis of SCN1A Missense Variants Improves Interpretation of Clinically Relevant Variants in Dravet Syndrome Article Snippet: All 26 coding exons and intron-exon boundaries of SCN1A were amplified by PCR (primer sequences available upon request) and Sanger sequenced by capillary electrophoresis in an ABI 3500xL Genetic Analyzer using the Purification:Article Title: Isolation of Treponema DNA from Necrophagous Flies in a Natural Ecosystem Article Snippet: Paragraph title: Gel Electrophoresis, Purification and DNA Sequencing ... Sanger sequencing was performed utilizing the Article Title: Spectrum of mutations underlying Propionic acidemia and further insight into a genotype-phenotype correlation for the common mutation in Saudi Arabia Article Snippet: PCR products were treated with the Agencourt AMPure PCR purification system (Agencourt Bioscience Corporation, Beverly, MA, USA). .. PCR products were sequenced using Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins Article Snippet: PCR products and products of restriction digests were routinely purified using preparative agarose gel electrophoresis followed by DNA isolation using the GeneJET gel extraction kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the Article Title: Postepizootic Persistence of Asymptomatic Mycoplasma conjunctivae Infection in Iberian Ibex Article Snippet: For DNA sequence analyses, all products from the nested PCR were purified with the High Pure PCR product purification kit (Roche Diagnostics, Rotkreuz, Switzerland). .. The sequencing of the amplicons was performed using the Ser_start2, Ser_start0 (5′-ATACTCAAAGTGGAAATAATGGAA-3′), and Ser_end0 (5′-GCAACAACAATAGTAAGAGCAG-3′) primers using the Article Title: A splice donor variant in CCDC189 is associated with asthenospermia in Nordic Red dairy cattle Article Snippet: The cycling conditions were the following: a) an initial denaturation at 95 °C for 3 min, b) 29 cycles of 30 s denaturation (94 °C), 30 s hybridization (58 °C), 30 s elongation (72 °C), and c) a final 3 min elongation (72 °C). .. PCR products were purified and directly sequenced using the Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice Article Snippet: PCR products were separated on a 1% agarose gel and all obvious bands were excised from the gel and purified using QIAquick Gel Extraction kit (Qiagen). .. DNA was eluted in water for subsequent sequencing with each of the inverse primers ( Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories Article Snippet: Recombinant plasmids containing the ClpM gene fragment were purified using PureLink® Quick Plasmid DNA Miniprep Kits (Invitrogen, USA). .. The ClpM gene was sequenced using the Polymerase Chain Reaction:Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus Article Snippet: For mutagenesis, standard PCR based methods with thermostable Pfu polymerase (Promega, Heidelberg, Germany) and synthetic primers purchased from Metabion (München, Germany) were used. .. The cloned PCR products were all verified by nucleotide sequencing with the Article Title: Isolation of Treponema DNA from Necrophagous Flies in a Natural Ecosystem Article Snippet: Sanger sequencing was performed utilizing the BigDye Terminator Cycle Sequencing kit (Applied Biosystems, Cat# 4,337,455) and the respective forward and reverse amplification primers. .. Sanger sequencing was performed utilizing the Article Title: Spectrum of mutations underlying Propionic acidemia and further insight into a genotype-phenotype correlation for the common mutation in Saudi Arabia Article Snippet: PCR products were treated with the Agencourt AMPure PCR purification system (Agencourt Bioscience Corporation, Beverly, MA, USA). .. PCR products were sequenced using Article Title: Mutations in the DNA methyltransferase gene, DNMT3A, cause an overgrowth syndrome with intellectual disability Article Snippet: The PCR was carried out using a Qiagen Multiplex PCR kit according to the manufacturer’s instructions. .. Products were sequenced with the original PCR primers or internal sequencing primers (exons 3, 6, 8, 10, 14 and 22) using the Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins Article Snippet: PCR products and products of restriction digests were routinely purified using preparative agarose gel electrophoresis followed by DNA isolation using the GeneJET gel extraction kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the Article Title: Postepizootic Persistence of Asymptomatic Mycoplasma conjunctivae Infection in Iberian Ibex Article Snippet: For DNA sequence analyses, all products from the nested PCR were purified with the High Pure PCR product purification kit (Roche Diagnostics, Rotkreuz, Switzerland). .. The sequencing of the amplicons was performed using the Ser_start2, Ser_start0 (5′-ATACTCAAAGTGGAAATAATGGAA-3′), and Ser_end0 (5′-GCAACAACAATAGTAAGAGCAG-3′) primers using the Article Title: AGK‐BRAF gene fusion is a recurrent event in sporadic pediatric thyroid carcinoma Article Snippet: The PCR products were resolved on a 2% agarose gel and visualized on a Bio‐Rad Gel Doc EZ system (Bio‐Rad). .. To confirm the identity of the amplified products, positive samples were sequenced using the Article Title: Multimodal Analysis of SCN1A Missense Variants Improves Interpretation of Clinically Relevant Variants in Dravet Syndrome Article Snippet: DNA samples for each patient and their parents, when available, were obtained from peripheral blood lymphocytes by standard procedures ( ). .. All 26 coding exons and intron-exon boundaries of SCN1A were amplified by PCR (primer sequences available upon request) and Sanger sequenced by capillary electrophoresis in an ABI 3500xL Genetic Analyzer using the Article Title: A splice donor variant in CCDC189 is associated with asthenospermia in Nordic Red dairy cattle Article Snippet: The cycling conditions were the following: a) an initial denaturation at 95 °C for 3 min, b) 29 cycles of 30 s denaturation (94 °C), 30 s hybridization (58 °C), 30 s elongation (72 °C), and c) a final 3 min elongation (72 °C). .. PCR products were purified and directly sequenced using the Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice Article Snippet: PCR products were separated on a 1% agarose gel and all obvious bands were excised from the gel and purified using QIAquick Gel Extraction kit (Qiagen). .. DNA was eluted in water for subsequent sequencing with each of the inverse primers ( Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories Article Snippet: To determine whether the transformed E. coli harbouring recombinant plasmid with ClpM insert, the colonies were examined by PCR using the ClpM-specific primers ACLP-F1 and ACLP-R1. .. The ClpM gene was sequenced using the Article Title: Mutation status and prognostic values of KRAS, NRAS, BRAF and PIK3CA in 353 Chinese colorectal cancer patients Article Snippet: Paragraph title: PCR and Direct sequencing ... The presence of mutations was detected by direct sequencing at Beijing Genomic Institute (BGI, ABI 3730xL Genetic analyzer, Shenzhen, China), using the Article Title: Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency, et al. Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency Article Snippet: 3.3 Measurement of SCEH enzyme activity and immunoblotting, were performed in cultured skin fibroblasts from Patient 1 and Patient 3 as described in Peters et al. ( ). .. 3.4 All exons and flanking intronic sequences of the ECHS1 gene of Patient 1 were Sanger sequenced after amplification by PCR from genomic DNA isolated from cultured fibroblasts and using a Article Title: Alternative splicing after gene duplication drives CEACAM1-paralog diversification in the horse Article Snippet: Plasmid DNA isolated from various clones were analyzed by PCR and sequencing. .. Nucleotide sequencing was performed with the Article Title: Functional modelling of a novel mutation in BBS5 Article Snippet: Primer sequences are available upon request. .. PCR products were sequenced using Article Title: Two Alternative Ways of Start Site Selection in Human Norovirus Reinitiation of Translation Article Snippet: The mutant constructs for FCV were established on the basis of plasmid pCH1 ( ) and for RHDV on the basis of plasmid pRmRNA ( ). .. The cloned PCR products were all verified by nucleotide sequencing with the Gel Extraction:Article Title: Isolation of Treponema DNA from Necrophagous Flies in a Natural Ecosystem Article Snippet: PCR products of polA and tp0548 of the correct size were excised from the gel and purified with the Qiagen Gel Extraction Kit (Qiagen, Cat# 28,706) according to the manufacturer's protocol. .. Sanger sequencing was performed utilizing the Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins Article Snippet: PCR products and products of restriction digests were routinely purified using preparative agarose gel electrophoresis followed by DNA isolation using the GeneJET gel extraction kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice Article Snippet: PCR products were separated on a 1% agarose gel and all obvious bands were excised from the gel and purified using QIAquick Gel Extraction kit (Qiagen). .. DNA was eluted in water for subsequent sequencing with each of the inverse primers ( Article Title: Alternative splicing after gene duplication drives CEACAM1-paralog diversification in the horse Article Snippet: Specific bands were extracted from the agarose gel using QIAEX II Gel Extraction Kit (Qiagen). .. Nucleotide sequencing was performed with the cDNA Library Assay:Article Title: Association of crumbs homolog-2 with mTORC1 in developing podocyte Article Snippet: A full-length cDNA clone of mouse wild-type CRB2 was obtained from a mouse kidney cDNA library, excised using EcoRI and subcloned into the EcoRI site of the mammalian expression vector pcDNA3.1/Zeo(-) (Invitrogen, Carlsbad, CA, USA). .. The sequence was confirmed using a Multiplex Ligation-dependent Probe Amplification:Article Title: Multimodal Analysis of SCN1A Missense Variants Improves Interpretation of Clinically Relevant Variants in Dravet Syndrome Article Snippet: All 26 coding exons and intron-exon boundaries of SCN1A were amplified by PCR (primer sequences available upon request) and Sanger sequenced by capillary electrophoresis in an ABI 3500xL Genetic Analyzer using the Plasmid Preparation:Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus Article Snippet: As a first step for secondary structure analysis, plasmid pBlue-SP6-TURBS was established via insertion of a 139 bp cDNA fragment starting with a SacI site introduced by mutagenesis 123 nt upstream of the start/stop site and ending with the EagI site in the polylinker of pRmRNA ( ) into the pBluescript-SK+ vector, followed by insertion of a SP6 promotor sequence into the SacI site and introduction of a EcoRV site 39 nt downstream of the ORF2 start site. .. The cloned PCR products were all verified by nucleotide sequencing with the Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins Article Snippet: Small-scale isolation of plasmid DNA was performed by GeneJET miniprep kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the Article Title: Association of crumbs homolog-2 with mTORC1 in developing podocyte Article Snippet: Paragraph title: Plasmid construction ... The sequence was confirmed using a Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories Article Snippet: Recombinant plasmids containing the ClpM gene fragment were purified using PureLink® Quick Plasmid DNA Miniprep Kits (Invitrogen, USA). .. The ClpM gene was sequenced using the Article Title: Alternative splicing after gene duplication drives CEACAM1-paralog diversification in the horse Article Snippet: Plasmid DNA isolated from various clones were analyzed by PCR and sequencing. .. Nucleotide sequencing was performed with the Article Title: Two Alternative Ways of Start Site Selection in Human Norovirus Reinitiation of Translation Article Snippet: The mutant constructs for FCV were established on the basis of plasmid pCH1 ( ) and for RHDV on the basis of plasmid pRmRNA ( ). .. The cloned PCR products were all verified by nucleotide sequencing with the Software:Article Title: Spectrum of mutations underlying Propionic acidemia and further insight into a genotype-phenotype correlation for the common mutation in Saudi Arabia Article Snippet: Oligonucleotide primers for PCR amplification of genomic DNA were designed using Primer3 software ( http://frodo.wi.mit.edu/ ) and synthesized by Metabion International AG (Munich, Germany). .. PCR products were sequenced using Article Title: Postepizootic Persistence of Asymptomatic Mycoplasma conjunctivae Infection in Iberian Ibex Article Snippet: The sequencing of the amplicons was performed using the Ser_start2, Ser_start0 (5′-ATACTCAAAGTGGAAATAATGGAA-3′), and Ser_end0 (5′-GCAACAACAATAGTAAGAGCAG-3′) primers using the Article Title: Multimodal Analysis of SCN1A Missense Variants Improves Interpretation of Clinically Relevant Variants in Dravet Syndrome Article Snippet: All 26 coding exons and intron-exon boundaries of SCN1A were amplified by PCR (primer sequences available upon request) and Sanger sequenced by capillary electrophoresis in an ABI 3500xL Genetic Analyzer using the Article Title: Functional modelling of a novel mutation in BBS5 Article Snippet: The primary data was analysed using Chromosome Analysis Suite (ChAS) software (Affymetrix). .. PCR products were sequenced using Real-time Polymerase Chain Reaction:Article Title: Postepizootic Persistence of Asymptomatic Mycoplasma conjunctivae Infection in Iberian Ibex Article Snippet: Paragraph title: Mycoplasma conjunctivae qPCR detection and sequencing. ... The sequencing of the amplicons was performed using the Ser_start2, Ser_start0 (5′-ATACTCAAAGTGGAAATAATGGAA-3′), and Ser_end0 (5′-GCAACAACAATAGTAAGAGCAG-3′) primers using the Article Title: AGK‐BRAF gene fusion is a recurrent event in sporadic pediatric thyroid carcinoma Article Snippet: A positive and negative control was included in each real‐time PCR run. .. To confirm the identity of the amplified products, positive samples were sequenced using the Negative Control:Article Title: AGK‐BRAF gene fusion is a recurrent event in sporadic pediatric thyroid carcinoma Article Snippet: A positive and negative control was included in each real‐time PCR run. .. To confirm the identity of the amplified products, positive samples were sequenced using the Selection:Article Title: A splice donor variant in CCDC189 is associated with asthenospermia in Nordic Red dairy cattle Article Snippet: We estimated the frequency of the asthenospermia-associated haplotype in 8557 Nordic Red cattle from the Nordic genomic selection reference population that had been genotyped at more than 50,000 SNPs [ ]. .. PCR products were purified and directly sequenced using the Agarose Gel Electrophoresis:Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins Article Snippet: PCR products and products of restriction digests were routinely purified using preparative agarose gel electrophoresis followed by DNA isolation using the GeneJET gel extraction kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the Article Title: AGK‐BRAF gene fusion is a recurrent event in sporadic pediatric thyroid carcinoma Article Snippet: The PCR products were resolved on a 2% agarose gel and visualized on a Bio‐Rad Gel Doc EZ system (Bio‐Rad). .. To confirm the identity of the amplified products, positive samples were sequenced using the Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice Article Snippet: PCR products were separated on a 1% agarose gel and all obvious bands were excised from the gel and purified using QIAquick Gel Extraction kit (Qiagen). .. DNA was eluted in water for subsequent sequencing with each of the inverse primers ( Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories Article Snippet: PCR products were separated by electrophoresis in a 1% agarose gel, stained with SYBR® DNA gel stain (Invitrogen, USA) and visualised under a UV transilluminator (GBOX from Syngene). .. The ClpM gene was sequenced using the Article Title: Alternative splicing after gene duplication drives CEACAM1-paralog diversification in the horse Article Snippet: Specific bands were extracted from the agarose gel using QIAEX II Gel Extraction Kit (Qiagen). .. Nucleotide sequencing was performed with the In Vitro:Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus Article Snippet: The rw4f primer introduced an EcoRV site upstream of the SP6 promotor, so that the complete cassette can be released with EcoRV prior to in vitro transcription. .. The cloned PCR products were all verified by nucleotide sequencing with the Size-exclusion Chromatography:Article Title: AGK‐BRAF gene fusion is a recurrent event in sporadic pediatric thyroid carcinoma Article Snippet: To confirm the identity of the amplified products, positive samples were sequenced using the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA). .. To confirm the identity of the amplified products, positive samples were sequenced using the Transgenic Assay:Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice Article Snippet: DNA was extracted from transgenic embryos using the QIAamp DNA Mini kit (Qiagen), digested with RsaI (Invitrogen) or HaeIII (Fermentas), circularized and re-linearized with BamHI (Promega). .. DNA was eluted in water for subsequent sequencing with each of the inverse primers ( BAC Assay:Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice Article Snippet: Paragraph title: BAC localization by inverse PCR ... DNA was eluted in water for subsequent sequencing with each of the inverse primers ( Standard Deviation:Article Title: Postepizootic Persistence of Asymptomatic Mycoplasma conjunctivae Infection in Iberian Ibex Article Snippet: All samples were analyzed in duplicate, including positive and negative controls, and positive-sample reactions were repeated if standard deviation between the replicates was more than one CT . .. The sequencing of the amplicons was performed using the Ser_start2, Ser_start0 (5′-ATACTCAAAGTGGAAATAATGGAA-3′), and Ser_end0 (5′-GCAACAACAATAGTAAGAGCAG-3′) primers using the Staining:Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories Article Snippet: PCR products were separated by electrophoresis in a 1% agarose gel, stained with SYBR® DNA gel stain (Invitrogen, USA) and visualised under a UV transilluminator (GBOX from Syngene). .. The ClpM gene was sequenced using the Variant Assay:Article Title: A splice donor variant in CCDC189 is associated with asthenospermia in Nordic Red dairy cattle Article Snippet: Paragraph title: Validating the CCDC189 splice donor variant in Nordic red cattle ... PCR products were purified and directly sequenced using the Article Title: Functional modelling of a novel mutation in BBS5 Article Snippet: PCR products were sequenced using |