bigdye terminator cycle sequencing kit  (Thermo Fisher)

Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    BigDye Terminator v1.1 Cycle Sequencing Kit

    Catalog Number:
    Buy from Supplier
    BigDye Terminator v1.1 Cycle Sequencing Kit
    This BigDye Terminator v1.1 Cycle Sequencing Kit is designed for specialty applications that require optimal basecalling adjacent to the primer and for sequencing short PCR product templates with rapid electrophoresis run modules. • Improve the quality of your results for a wide range of sequencing applications. • Sequence challenging templates and sequences more successfully. • Get longer, higher-quality reads with more uniform peak heights and optimal signal balance. • Enhance your productivity and reduce costs.Tackle Tough Sequences With the BigDye Terminator v1.1 Cycle Sequencing Kit you get a robust, highly flexible chemistry for a wide range of applications, including de novo sequencing and resequencing.Get More Uniform Peak Heights, Improved AccuracyWith BigDye Terminator v1.1 kit's superior chemistry, you generate data with uniform peak heights and optimized signal balance-which results in longer, higher-quality reads. You also get more accurate base assignments for heterozygote and mutation detection. Easily Integrate into Your WorkflowBigDye Terminator v.1.1 kit's chemistry requires no new software or instrument recalibration.You can easily integrate either kit into your current workflow with minimal changes to your protocols. For Research Use Only. Not for use in diagnostics procedures.
    Catalog Number:
    Kits & Reagents for Sanger Sequencing|Sanger Sequencing|Sanger Sequencing Technology & Accessories|Sequencing
    24 reactions
    Kits and Assays, Sequencing Kits & Reagents, Sequencing Kits
    Buy from Supplier

    Structured Review

    Thermo Fisher bigdye terminator cycle sequencing kit
    This BigDye Terminator v1.1 Cycle Sequencing Kit is designed for specialty applications that require optimal basecalling adjacent to the primer and for sequencing short PCR product templates with rapid electrophoresis run modules. • Improve the quality of your results for a wide range of sequencing applications. • Sequence challenging templates and sequences more successfully. • Get longer, higher-quality reads with more uniform peak heights and optimal signal balance. • Enhance your productivity and reduce costs.Tackle Tough Sequences With the BigDye Terminator v1.1 Cycle Sequencing Kit you get a robust, highly flexible chemistry for a wide range of applications, including de novo sequencing and resequencing.Get More Uniform Peak Heights, Improved AccuracyWith BigDye Terminator v1.1 kit's superior chemistry, you generate data with uniform peak heights and optimized signal balance-which results in longer, higher-quality reads. You also get more accurate base assignments for heterozygote and mutation detection. Easily Integrate into Your WorkflowBigDye Terminator v.1.1 kit's chemistry requires no new software or instrument recalibration.You can easily integrate either kit into your current workflow with minimal changes to your protocols. For Research Use Only. Not for use in diagnostics procedures. terminator cycle sequencing kit/product/Thermo Fisher
    Average 99 stars, based on 896 article reviews
    Price from $9.99 to $1999.99
    bigdye terminator cycle sequencing kit - by Bioz Stars, 2019-10
    99/100 stars


    Related Articles

    Clone Assay:

    Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus
    Article Snippet: For mutagenesis, standard PCR based methods with thermostable Pfu polymerase (Promega, Heidelberg, Germany) and synthetic primers purchased from Metabion (München, Germany) were used. .. The cloned PCR products were all verified by nucleotide sequencing with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany). .. Further details of the cloning procedure and the sequences of the primers are available on request from the authors.

    Article Title: Association of crumbs homolog-2 with mTORC1 in developing podocyte
    Article Snippet: The sequence was confirmed using a BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA). .. Mutation of the CRB2 phosphorylation site (Y1255F) was performed using the mouse wild-type CRB2 full-length cDNA expression vector as a template and a KOD-Plus-Mutagenesis Kit according to the manufacturer’s protocol (TOYOBO, Osaka, Japan).

    Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories
    Article Snippet: Those samples positive for Plasmodium were each purified using Gel/PCR DNAFragment Extraction kit (Geneaid, Taiwan), cloned into the Zero Blunt® vector (ThermoFisher Scientific), transformed into One Shot® TOPO10 Chemically Competent E. coli using heat-shock, and then plated onto LB agar containing (50 μg/mL) kanamycin. .. The ClpM gene was sequenced using the BigDye® Terminator Cycle Sequencing kit (Applied Biosystems, USA) as described for the mtDNA genome.

    Article Title: Alternative splicing after gene duplication drives CEACAM1-paralog diversification in the horse
    Article Snippet: Paragraph title: cDNA cloning ... Nucleotide sequencing was performed with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems).

    Article Title: Two Alternative Ways of Start Site Selection in Human Norovirus Reinitiation of Translation
    Article Snippet: The mutant constructs for FCV were established on the basis of plasmid pCH1 ( ) and for RHDV on the basis of plasmid pRmRNA ( ). .. The cloned PCR products were all verified by nucleotide sequencing with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany). .. Details of the cloning procedure and the sequences of the primers are available on request.


    Article Title: Isolation of Treponema DNA from Necrophagous Flies in a Natural Ecosystem
    Article Snippet: Therefore, only PCR products amplified from two independent fly samples were Sanger sequenced to receive final proof of the correct PCR product (data not shown). .. Sanger sequencing was performed utilizing the BigDye Terminator Cycle Sequencing kit (Applied Biosystems, Cat# 4,337,455) and the respective forward and reverse amplification primers. .. Sequencing was conducted on an ABI 3130xl sequencer.

    Article Title: Spectrum of mutations underlying Propionic acidemia and further insight into a genotype-phenotype correlation for the common mutation in Saudi Arabia
    Article Snippet: Oligonucleotide primers for PCR amplification of genomic DNA were designed using Primer3 software ( ) and synthesized by Metabion International AG (Munich, Germany). .. PCR products were sequenced using BigDye Terminator Cycle Sequencing kit (PE Applied Biosystems, Beverly, MA, USA) as described by the manufacturer.

    Article Title: Mutations in the DNA methyltransferase gene, DNMT3A, cause an overgrowth syndrome with intellectual disability
    Article Snippet: Products were sequenced with the original PCR primers or internal sequencing primers (exons 3, 6, 8, 10, 14 and 22) using the BigDye Terminator Cycle Sequencing Kit and an ABI 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA,USA). .. Sequences were analyzed using Mutation Surveyor software v3.97 (SoftGenetics, State College, PA, USA), and verified by manual inspection.

    Article Title: Postepizootic Persistence of Asymptomatic Mycoplasma conjunctivae Infection in Iberian Ibex
    Article Snippet: The reactions were performed according to Belloy et al. , with minor modifications of the primers, using the Serstart3 (5′-TTTAGTAGACTCCACTTCACC-3′) and LppTA2 (5′-TTTGATCTCTCCACCTTCAGC-3′) primers for the first PCR and Serstart2 (5′-CACTATACTTAACAGATAGTCC-3′) and LppTA (5′-GGCACTAATAGTGCGTAATTC-3′) primers in a nested reaction if the first amplification was not enough. .. The sequencing of the amplicons was performed using the Ser_start2, Ser_start0 (5′-ATACTCAAAGTGGAAATAATGGAA-3′), and Ser_end0 (5′-GCAACAACAATAGTAAGAGCAG-3′) primers using the BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA).

    Article Title: AGK‐BRAF gene fusion is a recurrent event in sporadic pediatric thyroid carcinoma
    Article Snippet: The PCR products were resolved on a 2% agarose gel and visualized on a Bio‐Rad Gel Doc EZ system (Bio‐Rad). .. To confirm the identity of the amplified products, positive samples were sequenced using the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA). .. The primers used to detect the AGK‐BRAF fusion transcript, located in exon 2 of AGK and exon 8 of BRAF , were previously described and validated .

    Article Title: Multimodal Analysis of SCN1A Missense Variants Improves Interpretation of Clinically Relevant Variants in Dravet Syndrome
    Article Snippet: DNA samples for each patient and their parents, when available, were obtained from peripheral blood lymphocytes by standard procedures ( ). .. All 26 coding exons and intron-exon boundaries of SCN1A were amplified by PCR (primer sequences available upon request) and Sanger sequenced by capillary electrophoresis in an ABI 3500xL Genetic Analyzer using the BigDye® Terminator Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA). .. Sequence variants were described according to the conventional nomenclature ( ) based on the full-length SCN1A isoform (GenBank AB093548 ) and deposited in a public genomic database of epileptic encephalopathies .

    Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice
    Article Snippet: The linearized product was then amplified by PCR with BAC inverse primers (327D13-R1 inverse_5′-CCCTAATGATGACCACGTGA-3′ and pTARBAC-R inverse_5′-TAGTGTCACCTAAATGTCGAC-3′). .. DNA was eluted in water for subsequent sequencing with each of the inverse primers (BigDye Terminator Cycle Sequencing kit, Applied Biosystems).

    Article Title: Clinical Validation of Newly Developed Multiplex Kit Using Luminex xMAP Technology for Detecting Simultaneous RAS and BRAF Mutations in Colorectal Cancer: Results of the RASKET-B Study
    Article Snippet: Briefly, each extracted DNA was amplified using six sets of primers to amplify exon 2, exon 3, and exon 4 in KRAS and NRAS , and exon 15 in BRAF . .. The mutations in these regions were detected using the BigDye Terminator Cycle Sequencing Kit (Thermo Fischer Scientific, Waltham, MA).

    Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories
    Article Snippet: PCR amplification of the ClpM gene was performed in a 20 μL reaction mixture containing 2 μL of purified genomic DNA, 200 μM each deoxyribonucleotide triphosphate (dNTP) (Promega,Madison WI, USA), Phusion HF buffer (1.5 mM MgCl2 ), 0.02 U/ μL of Phusion DNA polymerase (ThermoScientific, USA) and 0.5 μM of each primer (ACLP-F1 and ACLP-R1) under the following conditions: 98 °C for 30s for first denaturation, 35 cycles at 98 °C for 7 s, 60 °C for 20s and 72 °C for 30s, followed by a final extension for 10mins at 72 °C. .. The ClpM gene was sequenced using the BigDye® Terminator Cycle Sequencing kit (Applied Biosystems, USA) as described for the mtDNA genome.

    Article Title: Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency, et al. Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency
    Article Snippet: 3.3 Measurement of SCEH enzyme activity and immunoblotting, were performed in cultured skin fibroblasts from Patient 1 and Patient 3 as described in Peters et al. ( ). .. 3.4 All exons and flanking intronic sequences of the ECHS1 gene of Patient 1 were Sanger sequenced after amplification by PCR from genomic DNA isolated from cultured fibroblasts and using a BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA). .. WES was conducted on Patients 3 and 4 according to standard protocols as previously reported (Besse et al., ; Bonnen et al., ).

    Article Title: Alternative splicing after gene duplication drives CEACAM1-paralog diversification in the horse
    Article Snippet: For cDNA cloning the RT product was amplified by polymerase chain reaction (PCR) with Easy-A High-Fidelity PCR Cloning Enzyme (Agilent) and analyzed by agarose gel electrophoresis. .. Nucleotide sequencing was performed with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems).


    Article Title: Spectrum of mutations underlying Propionic acidemia and further insight into a genotype-phenotype correlation for the common mutation in Saudi Arabia
    Article Snippet: Oligonucleotide primers for PCR amplification of genomic DNA were designed using Primer3 software ( ) and synthesized by Metabion International AG (Munich, Germany). .. PCR products were sequenced using BigDye Terminator Cycle Sequencing kit (PE Applied Biosystems, Beverly, MA, USA) as described by the manufacturer.


    Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus
    Article Snippet: Since transcription templated by this construct yielded several bands, construct pStr was established with a smaller cDNA fragment generated by PCR with primers rw4f (GCGGCCGCGATATCATTTAGGTGACACTATAGAGCTCAACC) rw4r: ATGCATTGCTCAGGGATCCGATATCGGCACCTGCAAGTCCC, and inserted into the BamHI and NotI sites of a modified pBR322. .. The cloned PCR products were all verified by nucleotide sequencing with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany).

    Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins
    Article Snippet: Small-scale isolation of plasmid DNA was performed by GeneJET miniprep kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the BigDye Terminator Cycle Sequencing kit (Applied Biosystems). .. Site-directed mutagenesis and randomization of targeted codons was performed with either the QuikChange Lightning Single or Multi kit (Agilent Technologies).

    Article Title: Two Alternative Ways of Start Site Selection in Human Norovirus Reinitiation of Translation
    Article Snippet: The mutant constructs for FCV were established on the basis of plasmid pCH1 ( ) and for RHDV on the basis of plasmid pRmRNA ( ). .. The cloned PCR products were all verified by nucleotide sequencing with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany).


    Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins
    Article Snippet: PCR products and products of restriction digests were routinely purified using preparative agarose gel electrophoresis followed by DNA isolation using the GeneJET gel extraction kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the BigDye Terminator Cycle Sequencing kit (Applied Biosystems).

    Article Title: Multimodal Analysis of SCN1A Missense Variants Improves Interpretation of Clinically Relevant Variants in Dravet Syndrome
    Article Snippet: DNA samples for each patient and their parents, when available, were obtained from peripheral blood lymphocytes by standard procedures ( ). .. All 26 coding exons and intron-exon boundaries of SCN1A were amplified by PCR (primer sequences available upon request) and Sanger sequenced by capillary electrophoresis in an ABI 3500xL Genetic Analyzer using the BigDye® Terminator Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA). .. Sequence variants were described according to the conventional nomenclature ( ) based on the full-length SCN1A isoform (GenBank AB093548 ) and deposited in a public genomic database of epileptic encephalopathies .

    Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories
    Article Snippet: PCR products were separated by electrophoresis in a 1% agarose gel, stained with SYBR® DNA gel stain (Invitrogen, USA) and visualised under a UV transilluminator (GBOX from Syngene). .. The ClpM gene was sequenced using the BigDye® Terminator Cycle Sequencing kit (Applied Biosystems, USA) as described for the mtDNA genome.

    Nested PCR:

    Article Title: Postepizootic Persistence of Asymptomatic Mycoplasma conjunctivae Infection in Iberian Ibex
    Article Snippet: For DNA sequence analyses, all products from the nested PCR were purified with the High Pure PCR product purification kit (Roche Diagnostics, Rotkreuz, Switzerland). .. The sequencing of the amplicons was performed using the Ser_start2, Ser_start0 (5′-ATACTCAAAGTGGAAATAATGGAA-3′), and Ser_end0 (5′-GCAACAACAATAGTAAGAGCAG-3′) primers using the BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA).


    Article Title: AGK‐BRAF gene fusion is a recurrent event in sporadic pediatric thyroid carcinoma
    Article Snippet: To confirm the identity of the amplified products, positive samples were sequenced using the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA). .. To confirm the identity of the amplified products, positive samples were sequenced using the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA).

    Formalin-fixed Paraffin-Embedded:

    Article Title: Clinical Validation of Newly Developed Multiplex Kit Using Luminex xMAP Technology for Detecting Simultaneous RAS and BRAF Mutations in Colorectal Cancer: Results of the RASKET-B Study
    Article Snippet: DNA extraction was performed with QIAamp DNA FFPE Tissue Kit (Qiagen, Venlo, Netherlands) according to the manufacturer's protocol and as previously reported , . .. The mutations in these regions were detected using the BigDye Terminator Cycle Sequencing Kit (Thermo Fischer Scientific, Waltham, MA).

    In Silico:

    Article Title: Spectrum of mutations underlying Propionic acidemia and further insight into a genotype-phenotype correlation for the common mutation in Saudi Arabia
    Article Snippet: PCR products were sequenced using BigDye Terminator Cycle Sequencing kit (PE Applied Biosystems, Beverly, MA, USA) as described by the manufacturer. .. Sequences were analysed using Mutation Surveyor software Version 3.24 (SoftGenetics LLC, State College, PA, USA) and SeqMan II software 6.1 (DNAStar, Madison, WI, USA).


    Article Title: Association of crumbs homolog-2 with mTORC1 in developing podocyte
    Article Snippet: A full-length cDNA clone of mouse wild-type CRB2 was obtained from a mouse kidney cDNA library, excised using EcoRI and subcloned into the EcoRI site of the mammalian expression vector pcDNA3.1/Zeo(-) (Invitrogen, Carlsbad, CA, USA). .. The sequence was confirmed using a BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA).

    Article Title: Two Alternative Ways of Start Site Selection in Human Norovirus Reinitiation of Translation
    Article Snippet: The huNV expression construct pNVΔCdM lacking all internal methionine codons was established synthetically (Invitrogen). .. The cloned PCR products were all verified by nucleotide sequencing with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany).


    Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus
    Article Snippet: Since transcription templated by this construct yielded several bands, construct pStr was established with a smaller cDNA fragment generated by PCR with primers rw4f (GCGGCCGCGATATCATTTAGGTGACACTATAGAGCTCAACC) rw4r: ATGCATTGCTCAGGGATCCGATATCGGCACCTGCAAGTCCC, and inserted into the BamHI and NotI sites of a modified pBR322. .. The cloned PCR products were all verified by nucleotide sequencing with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany).

    Transformation Assay:

    Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories
    Article Snippet: To determine whether the transformed E. coli harbouring recombinant plasmid with ClpM insert, the colonies were examined by PCR using the ClpM-specific primers ACLP-F1 and ACLP-R1. .. The ClpM gene was sequenced using the BigDye® Terminator Cycle Sequencing kit (Applied Biosystems, USA) as described for the mtDNA genome.

    Derivative Assay:

    Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories
    Article Snippet: The ClpM gene was sequenced using the BigDye® Terminator Cycle Sequencing kit (Applied Biosystems, USA) as described for the mtDNA genome. .. At least 2 clones from each PCR set of each sample were sequenced using M13 primers.


    Article Title: A splice donor variant in CCDC189 is associated with asthenospermia in Nordic Red dairy cattle
    Article Snippet: PCR products were purified and directly sequenced using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, CA, US). .. PCR products were purified and directly sequenced using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, CA, US).

    Inverse PCR:

    Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice
    Article Snippet: Paragraph title: BAC localization by inverse PCR ... DNA was eluted in water for subsequent sequencing with each of the inverse primers (BigDye Terminator Cycle Sequencing kit, Applied Biosystems).


    Article Title: Multimodal Analysis of SCN1A Missense Variants Improves Interpretation of Clinically Relevant Variants in Dravet Syndrome
    Article Snippet: All 26 coding exons and intron-exon boundaries of SCN1A were amplified by PCR (primer sequences available upon request) and Sanger sequenced by capillary electrophoresis in an ABI 3500xL Genetic Analyzer using the BigDye® Terminator Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA). .. Sequence variants were described according to the conventional nomenclature ( ) based on the full-length SCN1A isoform (GenBank AB093548 ) and deposited in a public genomic database of epileptic encephalopathies .

    Cell Culture:

    Article Title: Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency, et al. Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency
    Article Snippet: 3.3 Measurement of SCEH enzyme activity and immunoblotting, were performed in cultured skin fibroblasts from Patient 1 and Patient 3 as described in Peters et al. ( ). .. 3.4 All exons and flanking intronic sequences of the ECHS1 gene of Patient 1 were Sanger sequenced after amplification by PCR from genomic DNA isolated from cultured fibroblasts and using a BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA). .. WES was conducted on Patients 3 and 4 according to standard protocols as previously reported (Besse et al., ; Bonnen et al., ).


    Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus
    Article Snippet: Since transcription templated by this construct yielded several bands, construct pStr was established with a smaller cDNA fragment generated by PCR with primers rw4f (GCGGCCGCGATATCATTTAGGTGACACTATAGAGCTCAACC) rw4r: ATGCATTGCTCAGGGATCCGATATCGGCACCTGCAAGTCCC, and inserted into the BamHI and NotI sites of a modified pBR322. .. The cloned PCR products were all verified by nucleotide sequencing with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany).

    Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice
    Article Snippet: DNA was eluted in water for subsequent sequencing with each of the inverse primers (BigDye Terminator Cycle Sequencing kit, Applied Biosystems). .. Sequence tags did not show 100% identity with a specific chromosomal location owing to variation between the unique curly tail genetic background and the C57BL/6 reference sequence.

    Article Title: Two Alternative Ways of Start Site Selection in Human Norovirus Reinitiation of Translation
    Article Snippet: For detection of downstream initiation close to the original stop/start site, pNVΔC, a 3′-terminally truncated version of pNVWT was generated; this construct lacks the codons coding for the C-terminal residues 107–268 of VP2. .. The cloned PCR products were all verified by nucleotide sequencing with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany).

    DNA Sequencing:

    Article Title: Isolation of Treponema DNA from Necrophagous Flies in a Natural Ecosystem
    Article Snippet: Paragraph title: Gel Electrophoresis, Purification and DNA Sequencing ... Sanger sequencing was performed utilizing the BigDye Terminator Cycle Sequencing kit (Applied Biosystems, Cat# 4,337,455) and the respective forward and reverse amplification primers.


    Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus
    Article Snippet: For mutagenesis, standard PCR based methods with thermostable Pfu polymerase (Promega, Heidelberg, Germany) and synthetic primers purchased from Metabion (München, Germany) were used. .. The cloned PCR products were all verified by nucleotide sequencing with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany). .. Further details of the cloning procedure and the sequences of the primers are available on request from the authors.

    Article Title: Isolation of Treponema DNA from Necrophagous Flies in a Natural Ecosystem
    Article Snippet: Therefore, only PCR products amplified from two independent fly samples were Sanger sequenced to receive final proof of the correct PCR product (data not shown). .. Sanger sequencing was performed utilizing the BigDye Terminator Cycle Sequencing kit (Applied Biosystems, Cat# 4,337,455) and the respective forward and reverse amplification primers. .. Sequencing was conducted on an ABI 3130xl sequencer.

    Article Title: Spectrum of mutations underlying Propionic acidemia and further insight into a genotype-phenotype correlation for the common mutation in Saudi Arabia
    Article Snippet: PCR products were treated with the Agencourt AMPure PCR purification system (Agencourt Bioscience Corporation, Beverly, MA, USA). .. PCR products were sequenced using BigDye Terminator Cycle Sequencing kit (PE Applied Biosystems, Beverly, MA, USA) as described by the manufacturer. .. Sequences were analysed using Mutation Surveyor software Version 3.24 (SoftGenetics LLC, State College, PA, USA) and SeqMan II software 6.1 (DNAStar, Madison, WI, USA).

    Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins
    Article Snippet: Small-scale isolation of plasmid DNA was performed by GeneJET miniprep kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the BigDye Terminator Cycle Sequencing kit (Applied Biosystems). .. Site-directed mutagenesis and randomization of targeted codons was performed with either the QuikChange Lightning Single or Multi kit (Agilent Technologies).

    Article Title: Postepizootic Persistence of Asymptomatic Mycoplasma conjunctivae Infection in Iberian Ibex
    Article Snippet: For DNA sequence analyses, all products from the nested PCR were purified with the High Pure PCR product purification kit (Roche Diagnostics, Rotkreuz, Switzerland). .. The sequencing of the amplicons was performed using the Ser_start2, Ser_start0 (5′-ATACTCAAAGTGGAAATAATGGAA-3′), and Ser_end0 (5′-GCAACAACAATAGTAAGAGCAG-3′) primers using the BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA). .. The resulting sequences were trimmed to obtain the variable part of the lppS gene corresponding to nucleotide positions 3935 to 5035 of lppS of the M. conjunctivae type strain HRC/581 (accession no. ).

    Article Title: AGK‐BRAF gene fusion is a recurrent event in sporadic pediatric thyroid carcinoma
    Article Snippet: The PCR products were resolved on a 2% agarose gel and visualized on a Bio‐Rad Gel Doc EZ system (Bio‐Rad). .. To confirm the identity of the amplified products, positive samples were sequenced using the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA). .. The primers used to detect the AGK‐BRAF fusion transcript, located in exon 2 of AGK and exon 8 of BRAF , were previously described and validated .

    Article Title: Multimodal Analysis of SCN1A Missense Variants Improves Interpretation of Clinically Relevant Variants in Dravet Syndrome
    Article Snippet: DNA samples for each patient and their parents, when available, were obtained from peripheral blood lymphocytes by standard procedures ( ). .. All 26 coding exons and intron-exon boundaries of SCN1A were amplified by PCR (primer sequences available upon request) and Sanger sequenced by capillary electrophoresis in an ABI 3500xL Genetic Analyzer using the BigDye® Terminator Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA). .. Sequence variants were described according to the conventional nomenclature ( ) based on the full-length SCN1A isoform (GenBank AB093548 ) and deposited in a public genomic database of epileptic encephalopathies .

    Article Title: A splice donor variant in CCDC189 is associated with asthenospermia in Nordic Red dairy cattle
    Article Snippet: The cycling conditions were the following: a) an initial denaturation at 95 °C for 3 min, b) 29 cycles of 30 s denaturation (94 °C), 30 s hybridization (58 °C), 30 s elongation (72 °C), and c) a final 3 min elongation (72 °C). .. PCR products were purified and directly sequenced using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, CA, US). .. Electrophoresis of sequencing reactions was performed on 3500xL Genetic Analyzers (Applied Biosystems, CA, US), and sequences were visualized with Sequencher 5.4.6 (Gene Codes Corporation, MI, US).

    Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice
    Article Snippet: PCR products were separated on a 1% agarose gel and all obvious bands were excised from the gel and purified using QIAquick Gel Extraction kit (Qiagen). .. DNA was eluted in water for subsequent sequencing with each of the inverse primers (BigDye Terminator Cycle Sequencing kit, Applied Biosystems). .. Sequence tags did not show 100% identity with a specific chromosomal location owing to variation between the unique curly tail genetic background and the C57BL/6 reference sequence.

    Article Title: Association of crumbs homolog-2 with mTORC1 in developing podocyte
    Article Snippet: A full-length cDNA clone of mouse wild-type CRB2 was obtained from a mouse kidney cDNA library, excised using EcoRI and subcloned into the EcoRI site of the mammalian expression vector pcDNA3.1/Zeo(-) (Invitrogen, Carlsbad, CA, USA). .. The sequence was confirmed using a BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA). .. Mutation of the CRB2 phosphorylation site (Y1255F) was performed using the mouse wild-type CRB2 full-length cDNA expression vector as a template and a KOD-Plus-Mutagenesis Kit according to the manufacturer’s protocol (TOYOBO, Osaka, Japan).

    Article Title: Clinical Validation of Newly Developed Multiplex Kit Using Luminex xMAP Technology for Detecting Simultaneous RAS and BRAF Mutations in Colorectal Cancer: Results of the RASKET-B Study
    Article Snippet: Briefly, each extracted DNA was amplified using six sets of primers to amplify exon 2, exon 3, and exon 4 in KRAS and NRAS , and exon 15 in BRAF . .. The mutations in these regions were detected using the BigDye Terminator Cycle Sequencing Kit (Thermo Fischer Scientific, Waltham, MA). .. DNA samples were analyzed for codon 600 in exon 15 of BRAF with the Therascreen BRAF Pyro Kit (Qiagen) as described by the manufacturer's protocol.

    Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories
    Article Snippet: Recombinant plasmids containing the ClpM gene fragment were purified using PureLink® Quick Plasmid DNA Miniprep Kits (Invitrogen, USA). .. The ClpM gene was sequenced using the BigDye® Terminator Cycle Sequencing kit (Applied Biosystems, USA) as described for the mtDNA genome. .. The products were then sequenced on a AB1377 sequencer (Applied Biosystems).

    Article Title: The manner of decay of genetically defective EYS gene transcripts in photoreceptor-directed fibroblasts derived from retinitis pigmentosa patients depends on the type of mutation
    Article Snippet: The design of PCR primer sets is shown in our previous paper [ ] and Additional file : Table S1. .. Direct sequencing was performed with a BigDye® Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA). .. Sequencing reaction products were run on an automated capillary sequencer (3130xl Genetic Analyzer; Applied Biosystems).

    Article Title: Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency, et al. Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency
    Article Snippet: 3.3 Measurement of SCEH enzyme activity and immunoblotting, were performed in cultured skin fibroblasts from Patient 1 and Patient 3 as described in Peters et al. ( ). .. 3.4 All exons and flanking intronic sequences of the ECHS1 gene of Patient 1 were Sanger sequenced after amplification by PCR from genomic DNA isolated from cultured fibroblasts and using a BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA). .. WES was conducted on Patients 3 and 4 according to standard protocols as previously reported (Besse et al., ; Bonnen et al., ).

    Article Title: Alternative splicing after gene duplication drives CEACAM1-paralog diversification in the horse
    Article Snippet: Plasmid DNA isolated from various clones were analyzed by PCR and sequencing. .. Nucleotide sequencing was performed with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems). .. For expression of equine CEACAMs by eukaryotic cells, full length cDNA was transferred from the StrataClone Cloning vector into the shuttle vector pFLAG-CMV3 (Sigma-Aldrich).

    Article Title: Functional modelling of a novel mutation in BBS5
    Article Snippet: Primer sequences are available upon request. .. PCR products were sequenced using BigDye™ Terminator Cycle Sequencing kit (PE Applied Biosystems, Bedford, MA, USA). .. Sequences were analysed using Mutation Surveyor® software Version 3.24 (SoftGenetics LLC, State College, PA 16803, USA).

    Article Title: Two Alternative Ways of Start Site Selection in Human Norovirus Reinitiation of Translation
    Article Snippet: The mutant constructs for FCV were established on the basis of plasmid pCH1 ( ) and for RHDV on the basis of plasmid pRmRNA ( ). .. The cloned PCR products were all verified by nucleotide sequencing with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany). .. Details of the cloning procedure and the sequences of the primers are available on request.


    Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus
    Article Snippet: Paragraph title: Construction of recombinant plasmids ... The cloned PCR products were all verified by nucleotide sequencing with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany).

    Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories
    Article Snippet: Recombinant plasmids containing the ClpM gene fragment were purified using PureLink® Quick Plasmid DNA Miniprep Kits (Invitrogen, USA). .. The ClpM gene was sequenced using the BigDye® Terminator Cycle Sequencing kit (Applied Biosystems, USA) as described for the mtDNA genome.

    Article Title: Two Alternative Ways of Start Site Selection in Human Norovirus Reinitiation of Translation
    Article Snippet: Paragraph title: Construction of Recombinant Plasmids ... The cloned PCR products were all verified by nucleotide sequencing with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany).

    DNA Extraction:

    Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins
    Article Snippet: PCR products and products of restriction digests were routinely purified using preparative agarose gel electrophoresis followed by DNA isolation using the GeneJET gel extraction kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the BigDye Terminator Cycle Sequencing kit (Applied Biosystems).

    Article Title: Clinical Validation of Newly Developed Multiplex Kit Using Luminex xMAP Technology for Detecting Simultaneous RAS and BRAF Mutations in Colorectal Cancer: Results of the RASKET-B Study
    Article Snippet: DNA extraction was performed with QIAamp DNA FFPE Tissue Kit (Qiagen, Venlo, Netherlands) according to the manufacturer's protocol and as previously reported , . .. The mutations in these regions were detected using the BigDye Terminator Cycle Sequencing Kit (Thermo Fischer Scientific, Waltham, MA).

    Nucleic Acid Electrophoresis:

    Article Title: Isolation of Treponema DNA from Necrophagous Flies in a Natural Ecosystem
    Article Snippet: Paragraph title: Gel Electrophoresis, Purification and DNA Sequencing ... Sanger sequencing was performed utilizing the BigDye Terminator Cycle Sequencing kit (Applied Biosystems, Cat# 4,337,455) and the respective forward and reverse amplification primers.


    Article Title: Postepizootic Persistence of Asymptomatic Mycoplasma conjunctivae Infection in Iberian Ibex
    Article Snippet: The cycle threshold was set at 0.05, and the PCR cycle when the sample fluorescence crossed the threshold was recorded as the CT value, which inversely corresponds to the initial amount of target DNA in the test sample. .. The sequencing of the amplicons was performed using the Ser_start2, Ser_start0 (5′-ATACTCAAAGTGGAAATAATGGAA-3′), and Ser_end0 (5′-GCAACAACAATAGTAAGAGCAG-3′) primers using the BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA).


    Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus
    Article Snippet: For mutagenesis, standard PCR based methods with thermostable Pfu polymerase (Promega, Heidelberg, Germany) and synthetic primers purchased from Metabion (München, Germany) were used. .. The cloned PCR products were all verified by nucleotide sequencing with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany).

    Article Title: Spectrum of mutations underlying Propionic acidemia and further insight into a genotype-phenotype correlation for the common mutation in Saudi Arabia
    Article Snippet: PCR products were sequenced using BigDye Terminator Cycle Sequencing kit (PE Applied Biosystems, Beverly, MA, USA) as described by the manufacturer. .. Sequences were analysed using Mutation Surveyor software Version 3.24 (SoftGenetics LLC, State College, PA, USA) and SeqMan II software 6.1 (DNAStar, Madison, WI, USA).

    Article Title: Mutations in the DNA methyltransferase gene, DNMT3A, cause an overgrowth syndrome with intellectual disability
    Article Snippet: Paragraph title: DNMT3A mutation analysis ... Products were sequenced with the original PCR primers or internal sequencing primers (exons 3, 6, 8, 10, 14 and 22) using the BigDye Terminator Cycle Sequencing Kit and an ABI 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA,USA).

    Article Title: Multimodal Analysis of SCN1A Missense Variants Improves Interpretation of Clinically Relevant Variants in Dravet Syndrome
    Article Snippet: Paragraph title: Mutation Screening ... All 26 coding exons and intron-exon boundaries of SCN1A were amplified by PCR (primer sequences available upon request) and Sanger sequenced by capillary electrophoresis in an ABI 3500xL Genetic Analyzer using the BigDye® Terminator Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA).

    Article Title: Functional modelling of a novel mutation in BBS5
    Article Snippet: Paragraph title: Homozygosity mapping and mutation analysis ... PCR products were sequenced using BigDye™ Terminator Cycle Sequencing kit (PE Applied Biosystems, Bedford, MA, USA).

    Article Title: Two Alternative Ways of Start Site Selection in Human Norovirus Reinitiation of Translation
    Article Snippet: The mutant constructs for FCV were established on the basis of plasmid pCH1 ( ) and for RHDV on the basis of plasmid pRmRNA ( ). .. The cloned PCR products were all verified by nucleotide sequencing with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany).


    Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins
    Article Snippet: Small-scale isolation of plasmid DNA was performed by GeneJET miniprep kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the BigDye Terminator Cycle Sequencing kit (Applied Biosystems).

    Article Title: Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency, et al. Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency
    Article Snippet: 3.3 Measurement of SCEH enzyme activity and immunoblotting, were performed in cultured skin fibroblasts from Patient 1 and Patient 3 as described in Peters et al. ( ). .. 3.4 All exons and flanking intronic sequences of the ECHS1 gene of Patient 1 were Sanger sequenced after amplification by PCR from genomic DNA isolated from cultured fibroblasts and using a BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA). .. WES was conducted on Patients 3 and 4 according to standard protocols as previously reported (Besse et al., ; Bonnen et al., ).

    Article Title: Alternative splicing after gene duplication drives CEACAM1-paralog diversification in the horse
    Article Snippet: Plasmid DNA isolated from various clones were analyzed by PCR and sequencing. .. Nucleotide sequencing was performed with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems).

    Multiplex Assay:

    Article Title: Mutations in the DNA methyltransferase gene, DNMT3A, cause an overgrowth syndrome with intellectual disability
    Article Snippet: The PCR was carried out using a Qiagen Multiplex PCR kit according to the manufacturer’s instructions. .. Products were sequenced with the original PCR primers or internal sequencing primers (exons 3, 6, 8, 10, 14 and 22) using the BigDye Terminator Cycle Sequencing Kit and an ABI 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA,USA).

    Article Title: Multimodal Analysis of SCN1A Missense Variants Improves Interpretation of Clinically Relevant Variants in Dravet Syndrome
    Article Snippet: All 26 coding exons and intron-exon boundaries of SCN1A were amplified by PCR (primer sequences available upon request) and Sanger sequenced by capillary electrophoresis in an ABI 3500xL Genetic Analyzer using the BigDye® Terminator Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA). .. Sequence variants were described according to the conventional nomenclature ( ) based on the full-length SCN1A isoform (GenBank AB093548 ) and deposited in a public genomic database of epileptic encephalopathies .


    Article Title: Isolation of Treponema DNA from Necrophagous Flies in a Natural Ecosystem
    Article Snippet: Paragraph title: Gel Electrophoresis, Purification and DNA Sequencing ... Sanger sequencing was performed utilizing the BigDye Terminator Cycle Sequencing kit (Applied Biosystems, Cat# 4,337,455) and the respective forward and reverse amplification primers.

    Article Title: Spectrum of mutations underlying Propionic acidemia and further insight into a genotype-phenotype correlation for the common mutation in Saudi Arabia
    Article Snippet: PCR products were treated with the Agencourt AMPure PCR purification system (Agencourt Bioscience Corporation, Beverly, MA, USA). .. PCR products were sequenced using BigDye Terminator Cycle Sequencing kit (PE Applied Biosystems, Beverly, MA, USA) as described by the manufacturer.

    Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins
    Article Snippet: PCR products and products of restriction digests were routinely purified using preparative agarose gel electrophoresis followed by DNA isolation using the GeneJET gel extraction kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the BigDye Terminator Cycle Sequencing kit (Applied Biosystems).

    Article Title: Postepizootic Persistence of Asymptomatic Mycoplasma conjunctivae Infection in Iberian Ibex
    Article Snippet: For DNA sequence analyses, all products from the nested PCR were purified with the High Pure PCR product purification kit (Roche Diagnostics, Rotkreuz, Switzerland). .. The sequencing of the amplicons was performed using the Ser_start2, Ser_start0 (5′-ATACTCAAAGTGGAAATAATGGAA-3′), and Ser_end0 (5′-GCAACAACAATAGTAAGAGCAG-3′) primers using the BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA).

    Article Title: A splice donor variant in CCDC189 is associated with asthenospermia in Nordic Red dairy cattle
    Article Snippet: The cycling conditions were the following: a) an initial denaturation at 95 °C for 3 min, b) 29 cycles of 30 s denaturation (94 °C), 30 s hybridization (58 °C), 30 s elongation (72 °C), and c) a final 3 min elongation (72 °C). .. PCR products were purified and directly sequenced using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, CA, US). .. Electrophoresis of sequencing reactions was performed on 3500xL Genetic Analyzers (Applied Biosystems, CA, US), and sequences were visualized with Sequencher 5.4.6 (Gene Codes Corporation, MI, US).

    Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice
    Article Snippet: PCR products were separated on a 1% agarose gel and all obvious bands were excised from the gel and purified using QIAquick Gel Extraction kit (Qiagen). .. DNA was eluted in water for subsequent sequencing with each of the inverse primers (BigDye Terminator Cycle Sequencing kit, Applied Biosystems).

    Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories
    Article Snippet: Recombinant plasmids containing the ClpM gene fragment were purified using PureLink® Quick Plasmid DNA Miniprep Kits (Invitrogen, USA). .. The ClpM gene was sequenced using the BigDye® Terminator Cycle Sequencing kit (Applied Biosystems, USA) as described for the mtDNA genome.

    Polymerase Chain Reaction:

    Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus
    Article Snippet: For mutagenesis, standard PCR based methods with thermostable Pfu polymerase (Promega, Heidelberg, Germany) and synthetic primers purchased from Metabion (München, Germany) were used. .. The cloned PCR products were all verified by nucleotide sequencing with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany). .. Further details of the cloning procedure and the sequences of the primers are available on request from the authors.

    Article Title: Isolation of Treponema DNA from Necrophagous Flies in a Natural Ecosystem
    Article Snippet: Sanger sequencing was performed utilizing the BigDye Terminator Cycle Sequencing kit (Applied Biosystems, Cat# 4,337,455) and the respective forward and reverse amplification primers. .. Sanger sequencing was performed utilizing the BigDye Terminator Cycle Sequencing kit (Applied Biosystems, Cat# 4,337,455) and the respective forward and reverse amplification primers.

    Article Title: Spectrum of mutations underlying Propionic acidemia and further insight into a genotype-phenotype correlation for the common mutation in Saudi Arabia
    Article Snippet: PCR products were treated with the Agencourt AMPure PCR purification system (Agencourt Bioscience Corporation, Beverly, MA, USA). .. PCR products were sequenced using BigDye Terminator Cycle Sequencing kit (PE Applied Biosystems, Beverly, MA, USA) as described by the manufacturer. .. Sequences were analysed using Mutation Surveyor software Version 3.24 (SoftGenetics LLC, State College, PA, USA) and SeqMan II software 6.1 (DNAStar, Madison, WI, USA).

    Article Title: Mutations in the DNA methyltransferase gene, DNMT3A, cause an overgrowth syndrome with intellectual disability
    Article Snippet: The PCR was carried out using a Qiagen Multiplex PCR kit according to the manufacturer’s instructions. .. Products were sequenced with the original PCR primers or internal sequencing primers (exons 3, 6, 8, 10, 14 and 22) using the BigDye Terminator Cycle Sequencing Kit and an ABI 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA,USA). .. Sequences were analyzed using Mutation Surveyor software v3.97 (SoftGenetics, State College, PA, USA), and verified by manual inspection.

    Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins
    Article Snippet: PCR products and products of restriction digests were routinely purified using preparative agarose gel electrophoresis followed by DNA isolation using the GeneJET gel extraction kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the BigDye Terminator Cycle Sequencing kit (Applied Biosystems).

    Article Title: Postepizootic Persistence of Asymptomatic Mycoplasma conjunctivae Infection in Iberian Ibex
    Article Snippet: For DNA sequence analyses, all products from the nested PCR were purified with the High Pure PCR product purification kit (Roche Diagnostics, Rotkreuz, Switzerland). .. The sequencing of the amplicons was performed using the Ser_start2, Ser_start0 (5′-ATACTCAAAGTGGAAATAATGGAA-3′), and Ser_end0 (5′-GCAACAACAATAGTAAGAGCAG-3′) primers using the BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA).

    Article Title: AGK‐BRAF gene fusion is a recurrent event in sporadic pediatric thyroid carcinoma
    Article Snippet: The PCR products were resolved on a 2% agarose gel and visualized on a Bio‐Rad Gel Doc EZ system (Bio‐Rad). .. To confirm the identity of the amplified products, positive samples were sequenced using the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA).

    Article Title: Multimodal Analysis of SCN1A Missense Variants Improves Interpretation of Clinically Relevant Variants in Dravet Syndrome
    Article Snippet: DNA samples for each patient and their parents, when available, were obtained from peripheral blood lymphocytes by standard procedures ( ). .. All 26 coding exons and intron-exon boundaries of SCN1A were amplified by PCR (primer sequences available upon request) and Sanger sequenced by capillary electrophoresis in an ABI 3500xL Genetic Analyzer using the BigDye® Terminator Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA). .. Sequence variants were described according to the conventional nomenclature ( ) based on the full-length SCN1A isoform (GenBank AB093548 ) and deposited in a public genomic database of epileptic encephalopathies .

    Article Title: A splice donor variant in CCDC189 is associated with asthenospermia in Nordic Red dairy cattle
    Article Snippet: The cycling conditions were the following: a) an initial denaturation at 95 °C for 3 min, b) 29 cycles of 30 s denaturation (94 °C), 30 s hybridization (58 °C), 30 s elongation (72 °C), and c) a final 3 min elongation (72 °C). .. PCR products were purified and directly sequenced using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, CA, US). .. Electrophoresis of sequencing reactions was performed on 3500xL Genetic Analyzers (Applied Biosystems, CA, US), and sequences were visualized with Sequencher 5.4.6 (Gene Codes Corporation, MI, US).

    Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice
    Article Snippet: PCR products were separated on a 1% agarose gel and all obvious bands were excised from the gel and purified using QIAquick Gel Extraction kit (Qiagen). .. DNA was eluted in water for subsequent sequencing with each of the inverse primers (BigDye Terminator Cycle Sequencing kit, Applied Biosystems).

    Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories
    Article Snippet: To determine whether the transformed E. coli harbouring recombinant plasmid with ClpM insert, the colonies were examined by PCR using the ClpM-specific primers ACLP-F1 and ACLP-R1. .. The ClpM gene was sequenced using the BigDye® Terminator Cycle Sequencing kit (Applied Biosystems, USA) as described for the mtDNA genome.

    Article Title: Mutation status and prognostic values of KRAS, NRAS, BRAF and PIK3CA in 353 Chinese colorectal cancer patients
    Article Snippet: Paragraph title: PCR and Direct sequencing ... The presence of mutations was detected by direct sequencing at Beijing Genomic Institute (BGI, ABI 3730xL Genetic analyzer, Shenzhen, China), using the BigDye Terminator Cycle Sequencing kit (Applied Biosystems).

    Article Title: Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency, et al. Clinical, biochemical, and genetic features of four patients with short‐chain enoyl‐CoA hydratase (ECHS1) deficiency
    Article Snippet: 3.3 Measurement of SCEH enzyme activity and immunoblotting, were performed in cultured skin fibroblasts from Patient 1 and Patient 3 as described in Peters et al. ( ). .. 3.4 All exons and flanking intronic sequences of the ECHS1 gene of Patient 1 were Sanger sequenced after amplification by PCR from genomic DNA isolated from cultured fibroblasts and using a BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA). .. WES was conducted on Patients 3 and 4 according to standard protocols as previously reported (Besse et al., ; Bonnen et al., ).

    Article Title: Alternative splicing after gene duplication drives CEACAM1-paralog diversification in the horse
    Article Snippet: Plasmid DNA isolated from various clones were analyzed by PCR and sequencing. .. Nucleotide sequencing was performed with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems).

    Article Title: Functional modelling of a novel mutation in BBS5
    Article Snippet: Primer sequences are available upon request. .. PCR products were sequenced using BigDye™ Terminator Cycle Sequencing kit (PE Applied Biosystems, Bedford, MA, USA). .. Sequences were analysed using Mutation Surveyor® software Version 3.24 (SoftGenetics LLC, State College, PA 16803, USA).

    Article Title: Two Alternative Ways of Start Site Selection in Human Norovirus Reinitiation of Translation
    Article Snippet: The mutant constructs for FCV were established on the basis of plasmid pCH1 ( ) and for RHDV on the basis of plasmid pRmRNA ( ). .. The cloned PCR products were all verified by nucleotide sequencing with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany). .. Details of the cloning procedure and the sequences of the primers are available on request.

    Gel Extraction:

    Article Title: Isolation of Treponema DNA from Necrophagous Flies in a Natural Ecosystem
    Article Snippet: PCR products of polA and tp0548 of the correct size were excised from the gel and purified with the Qiagen Gel Extraction Kit (Qiagen, Cat# 28,706) according to the manufacturer's protocol. .. Sanger sequencing was performed utilizing the BigDye Terminator Cycle Sequencing kit (Applied Biosystems, Cat# 4,337,455) and the respective forward and reverse amplification primers.

    Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins
    Article Snippet: PCR products and products of restriction digests were routinely purified using preparative agarose gel electrophoresis followed by DNA isolation using the GeneJET gel extraction kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the BigDye Terminator Cycle Sequencing kit (Applied Biosystems).

    Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice
    Article Snippet: PCR products were separated on a 1% agarose gel and all obvious bands were excised from the gel and purified using QIAquick Gel Extraction kit (Qiagen). .. DNA was eluted in water for subsequent sequencing with each of the inverse primers (BigDye Terminator Cycle Sequencing kit, Applied Biosystems).

    Article Title: Alternative splicing after gene duplication drives CEACAM1-paralog diversification in the horse
    Article Snippet: Specific bands were extracted from the agarose gel using QIAEX II Gel Extraction Kit (Qiagen). .. Nucleotide sequencing was performed with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems).

    cDNA Library Assay:

    Article Title: Association of crumbs homolog-2 with mTORC1 in developing podocyte
    Article Snippet: A full-length cDNA clone of mouse wild-type CRB2 was obtained from a mouse kidney cDNA library, excised using EcoRI and subcloned into the EcoRI site of the mammalian expression vector pcDNA3.1/Zeo(-) (Invitrogen, Carlsbad, CA, USA). .. The sequence was confirmed using a BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA).

    Multiplex Ligation-dependent Probe Amplification:

    Article Title: Multimodal Analysis of SCN1A Missense Variants Improves Interpretation of Clinically Relevant Variants in Dravet Syndrome
    Article Snippet: All 26 coding exons and intron-exon boundaries of SCN1A were amplified by PCR (primer sequences available upon request) and Sanger sequenced by capillary electrophoresis in an ABI 3500xL Genetic Analyzer using the BigDye® Terminator Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA). .. Sequence variants were described according to the conventional nomenclature ( ) based on the full-length SCN1A isoform (GenBank AB093548 ) and deposited in a public genomic database of epileptic encephalopathies .

    Plasmid Preparation:

    Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus
    Article Snippet: As a first step for secondary structure analysis, plasmid pBlue-SP6-TURBS was established via insertion of a 139 bp cDNA fragment starting with a SacI site introduced by mutagenesis 123 nt upstream of the start/stop site and ending with the EagI site in the polylinker of pRmRNA ( ) into the pBluescript-SK+ vector, followed by insertion of a SP6 promotor sequence into the SacI site and introduction of a EcoRV site 39 nt downstream of the ORF2 start site. .. The cloned PCR products were all verified by nucleotide sequencing with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany).

    Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins
    Article Snippet: Small-scale isolation of plasmid DNA was performed by GeneJET miniprep kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the BigDye Terminator Cycle Sequencing kit (Applied Biosystems).

    Article Title: Association of crumbs homolog-2 with mTORC1 in developing podocyte
    Article Snippet: Paragraph title: Plasmid construction ... The sequence was confirmed using a BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA).

    Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories
    Article Snippet: Recombinant plasmids containing the ClpM gene fragment were purified using PureLink® Quick Plasmid DNA Miniprep Kits (Invitrogen, USA). .. The ClpM gene was sequenced using the BigDye® Terminator Cycle Sequencing kit (Applied Biosystems, USA) as described for the mtDNA genome.

    Article Title: Alternative splicing after gene duplication drives CEACAM1-paralog diversification in the horse
    Article Snippet: Plasmid DNA isolated from various clones were analyzed by PCR and sequencing. .. Nucleotide sequencing was performed with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems).

    Article Title: Two Alternative Ways of Start Site Selection in Human Norovirus Reinitiation of Translation
    Article Snippet: The mutant constructs for FCV were established on the basis of plasmid pCH1 ( ) and for RHDV on the basis of plasmid pRmRNA ( ). .. The cloned PCR products were all verified by nucleotide sequencing with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany).


    Article Title: Spectrum of mutations underlying Propionic acidemia and further insight into a genotype-phenotype correlation for the common mutation in Saudi Arabia
    Article Snippet: Oligonucleotide primers for PCR amplification of genomic DNA were designed using Primer3 software ( ) and synthesized by Metabion International AG (Munich, Germany). .. PCR products were sequenced using BigDye Terminator Cycle Sequencing kit (PE Applied Biosystems, Beverly, MA, USA) as described by the manufacturer.

    Article Title: Postepizootic Persistence of Asymptomatic Mycoplasma conjunctivae Infection in Iberian Ibex
    Article Snippet: The sequencing of the amplicons was performed using the Ser_start2, Ser_start0 (5′-ATACTCAAAGTGGAAATAATGGAA-3′), and Ser_end0 (5′-GCAACAACAATAGTAAGAGCAG-3′) primers using the BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA). .. The sequencing of the amplicons was performed using the Ser_start2, Ser_start0 (5′-ATACTCAAAGTGGAAATAATGGAA-3′), and Ser_end0 (5′-GCAACAACAATAGTAAGAGCAG-3′) primers using the BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA).

    Article Title: Multimodal Analysis of SCN1A Missense Variants Improves Interpretation of Clinically Relevant Variants in Dravet Syndrome
    Article Snippet: All 26 coding exons and intron-exon boundaries of SCN1A were amplified by PCR (primer sequences available upon request) and Sanger sequenced by capillary electrophoresis in an ABI 3500xL Genetic Analyzer using the BigDye® Terminator Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA). .. MLPA reactions were conducted according to the manufacturer's instructions, and the fragments were separated in an ABI 3500xL Genetic Analyzer.

    Article Title: Functional modelling of a novel mutation in BBS5
    Article Snippet: The primary data was analysed using Chromosome Analysis Suite (ChAS) software (Affymetrix). .. PCR products were sequenced using BigDye™ Terminator Cycle Sequencing kit (PE Applied Biosystems, Bedford, MA, USA).

    Real-time Polymerase Chain Reaction:

    Article Title: Postepizootic Persistence of Asymptomatic Mycoplasma conjunctivae Infection in Iberian Ibex
    Article Snippet: Paragraph title: Mycoplasma conjunctivae qPCR detection and sequencing. ... The sequencing of the amplicons was performed using the Ser_start2, Ser_start0 (5′-ATACTCAAAGTGGAAATAATGGAA-3′), and Ser_end0 (5′-GCAACAACAATAGTAAGAGCAG-3′) primers using the BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA).

    Article Title: AGK‐BRAF gene fusion is a recurrent event in sporadic pediatric thyroid carcinoma
    Article Snippet: A positive and negative control was included in each real‐time PCR run. .. To confirm the identity of the amplified products, positive samples were sequenced using the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA).

    Negative Control:

    Article Title: AGK‐BRAF gene fusion is a recurrent event in sporadic pediatric thyroid carcinoma
    Article Snippet: A positive and negative control was included in each real‐time PCR run. .. To confirm the identity of the amplified products, positive samples were sequenced using the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA).


    Article Title: A splice donor variant in CCDC189 is associated with asthenospermia in Nordic Red dairy cattle
    Article Snippet: We estimated the frequency of the asthenospermia-associated haplotype in 8557 Nordic Red cattle from the Nordic genomic selection reference population that had been genotyped at more than 50,000 SNPs [ ]. .. PCR products were purified and directly sequenced using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, CA, US).

    Agarose Gel Electrophoresis:

    Article Title: All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins
    Article Snippet: PCR products and products of restriction digests were routinely purified using preparative agarose gel electrophoresis followed by DNA isolation using the GeneJET gel extraction kit (Fermentas). .. The cDNA sequences for all Arch variants and fusion constructs were confirmed by dye terminator cycle sequencing using the BigDye Terminator Cycle Sequencing kit (Applied Biosystems).

    Article Title: AGK‐BRAF gene fusion is a recurrent event in sporadic pediatric thyroid carcinoma
    Article Snippet: The PCR products were resolved on a 2% agarose gel and visualized on a Bio‐Rad Gel Doc EZ system (Bio‐Rad). .. To confirm the identity of the amplified products, positive samples were sequenced using the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA).

    Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice
    Article Snippet: PCR products were separated on a 1% agarose gel and all obvious bands were excised from the gel and purified using QIAquick Gel Extraction kit (Qiagen). .. DNA was eluted in water for subsequent sequencing with each of the inverse primers (BigDye Terminator Cycle Sequencing kit, Applied Biosystems).

    Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories
    Article Snippet: PCR products were separated by electrophoresis in a 1% agarose gel, stained with SYBR® DNA gel stain (Invitrogen, USA) and visualised under a UV transilluminator (GBOX from Syngene). .. The ClpM gene was sequenced using the BigDye® Terminator Cycle Sequencing kit (Applied Biosystems, USA) as described for the mtDNA genome.

    Article Title: Alternative splicing after gene duplication drives CEACAM1-paralog diversification in the horse
    Article Snippet: Specific bands were extracted from the agarose gel using QIAEX II Gel Extraction Kit (Qiagen). .. Nucleotide sequencing was performed with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems).

    In Vitro:

    Article Title: Structure–function relationship in the ‘termination upstream ribosomal binding site’ of the calicivirus rabbit hemorrhagic disease virus
    Article Snippet: The rw4f primer introduced an EcoRV site upstream of the SP6 promotor, so that the complete cassette can be released with EcoRV prior to in vitro transcription. .. The cloned PCR products were all verified by nucleotide sequencing with the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Weiterstadt, Germany).

    Size-exclusion Chromatography:

    Article Title: AGK‐BRAF gene fusion is a recurrent event in sporadic pediatric thyroid carcinoma
    Article Snippet: To confirm the identity of the amplified products, positive samples were sequenced using the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA). .. To confirm the identity of the amplified products, positive samples were sequenced using the BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA).

    Transgenic Assay:

    Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice
    Article Snippet: DNA was extracted from transgenic embryos using the QIAamp DNA Mini kit (Qiagen), digested with RsaI (Invitrogen) or HaeIII (Fermentas), circularized and re-linearized with BamHI (Promega). .. DNA was eluted in water for subsequent sequencing with each of the inverse primers (BigDye Terminator Cycle Sequencing kit, Applied Biosystems).

    BAC Assay:

    Article Title: Overexpression of Grainyhead-like 3 causes spina bifida and interacts genetically with mutant alleles of Grhl2 and Vangl2 in mice
    Article Snippet: Paragraph title: BAC localization by inverse PCR ... DNA was eluted in water for subsequent sequencing with each of the inverse primers (BigDye Terminator Cycle Sequencing kit, Applied Biosystems).

    Standard Deviation:

    Article Title: Postepizootic Persistence of Asymptomatic Mycoplasma conjunctivae Infection in Iberian Ibex
    Article Snippet: All samples were analyzed in duplicate, including positive and negative controls, and positive-sample reactions were repeated if standard deviation between the replicates was more than one CT . .. The sequencing of the amplicons was performed using the Ser_start2, Ser_start0 (5′-ATACTCAAAGTGGAAATAATGGAA-3′), and Ser_end0 (5′-GCAACAACAATAGTAAGAGCAG-3′) primers using the BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA).


    Article Title: Malaria parasites of long-tailed macaques in Sarawak, Malaysian Borneo: a novel species and demographic and evolutionary histories
    Article Snippet: PCR products were separated by electrophoresis in a 1% agarose gel, stained with SYBR® DNA gel stain (Invitrogen, USA) and visualised under a UV transilluminator (GBOX from Syngene). .. The ClpM gene was sequenced using the BigDye® Terminator Cycle Sequencing kit (Applied Biosystems, USA) as described for the mtDNA genome.

    Variant Assay:

    Article Title: A splice donor variant in CCDC189 is associated with asthenospermia in Nordic Red dairy cattle
    Article Snippet: Paragraph title: Validating the CCDC189 splice donor variant in Nordic red cattle ... PCR products were purified and directly sequenced using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, CA, US).

    Article Title: Functional modelling of a novel mutation in BBS5
    Article Snippet: PCR products were sequenced using BigDye™ Terminator Cycle Sequencing kit (PE Applied Biosystems, Bedford, MA, USA). .. PCR products were sequenced using BigDye™ Terminator Cycle Sequencing kit (PE Applied Biosystems, Bedford, MA, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher bigdye terminator v3 1 cycle sequencing kit
    DNA cleavage and strand exchange by SprA. ( A ) Direct sequencing of the intermediates of the SprA-mediated integration reaction. The intermediates: the left and right half-sites of attP , were directly sequenced using a <t>BigDye</t> Terminator <t>v3.1</t> Cycle Sequencing Kit and an ABI 3500 DNA analyzer. The 16 bp overlapping sequence is underlined. The 3΄-end nucleotides indicated by the circles are adenines added by the terminal transferase activity of Taq polymerase used for the cycle sequencing reaction. The cleavage point of attP is shown to the left (indicated by the lines and triangles). ( B ) Effects of point mutations of the central dinucleotides on DNA recombination. Point mutations were introduced into the AAA nucleotides at the center of the attB site (A→T). In vitro integration recombination was performed using 0.5 μM SprA and 50 ng each of the wild-type attP and the mutated attB substrates.
    Bigdye Terminator V3 1 Cycle Sequencing Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 546 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more terminator v3 1 cycle sequencing kit/product/Thermo Fisher
    Average 99 stars, based on 546 article reviews
    Price from $9.99 to $1999.99
    bigdye terminator v3 1 cycle sequencing kit - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Thermo Fisher bigdye terminator v1 1 cycle sequencing kit
    DNA cleavage and strand exchange by SprA. ( A ) Direct sequencing of the intermediates of the SprA-mediated integration reaction. The intermediates: the left and right half-sites of attP , were directly sequenced using a <t>BigDye</t> Terminator <t>v3.1</t> Cycle Sequencing Kit and an ABI 3500 DNA analyzer. The 16 bp overlapping sequence is underlined. The 3΄-end nucleotides indicated by the circles are adenines added by the terminal transferase activity of Taq polymerase used for the cycle sequencing reaction. The cleavage point of attP is shown to the left (indicated by the lines and triangles). ( B ) Effects of point mutations of the central dinucleotides on DNA recombination. Point mutations were introduced into the AAA nucleotides at the center of the attB site (A→T). In vitro integration recombination was performed using 0.5 μM SprA and 50 ng each of the wild-type attP and the mutated attB substrates.
    Bigdye Terminator V1 1 Cycle Sequencing Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 308 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more terminator v1 1 cycle sequencing kit/product/Thermo Fisher
    Average 99 stars, based on 308 article reviews
    Price from $9.99 to $1999.99
    bigdye terminator v1 1 cycle sequencing kit - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results

    DNA cleavage and strand exchange by SprA. ( A ) Direct sequencing of the intermediates of the SprA-mediated integration reaction. The intermediates: the left and right half-sites of attP , were directly sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit and an ABI 3500 DNA analyzer. The 16 bp overlapping sequence is underlined. The 3΄-end nucleotides indicated by the circles are adenines added by the terminal transferase activity of Taq polymerase used for the cycle sequencing reaction. The cleavage point of attP is shown to the left (indicated by the lines and triangles). ( B ) Effects of point mutations of the central dinucleotides on DNA recombination. Point mutations were introduced into the AAA nucleotides at the center of the attB site (A→T). In vitro integration recombination was performed using 0.5 μM SprA and 50 ng each of the wild-type attP and the mutated attB substrates.

    Journal: Nucleic Acids Research

    Article Title: Mechanism of bacterial gene rearrangement: SprA-catalyzed precise DNA recombination and its directionality control by SprB ensure the gene rearrangement and stable expression of spsM during sporulation in Bacillus subtilis

    doi: 10.1093/nar/gkx466

    Figure Lengend Snippet: DNA cleavage and strand exchange by SprA. ( A ) Direct sequencing of the intermediates of the SprA-mediated integration reaction. The intermediates: the left and right half-sites of attP , were directly sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit and an ABI 3500 DNA analyzer. The 16 bp overlapping sequence is underlined. The 3΄-end nucleotides indicated by the circles are adenines added by the terminal transferase activity of Taq polymerase used for the cycle sequencing reaction. The cleavage point of attP is shown to the left (indicated by the lines and triangles). ( B ) Effects of point mutations of the central dinucleotides on DNA recombination. Point mutations were introduced into the AAA nucleotides at the center of the attB site (A→T). In vitro integration recombination was performed using 0.5 μM SprA and 50 ng each of the wild-type attP and the mutated attB substrates.

    Article Snippet: DNA pellets were dissolved in TE buffer, gel purified, and directly sequenced using the P107 (for the left half- site of attP ) or P109 (for the right half- site) primers, a BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, WI, USA) and an ABI 3500 DNA analyzer (Thermo Fisher Scientific).

    Techniques: Sequencing, Activity Assay, In Vitro