Structured Review

Promega bglii
Bglii, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 129 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bglii/product/Promega
Average 93 stars, based on 129 article reviews
Price from $9.99 to $1999.99
bglii - by Bioz Stars, 2020-07
93/100 stars

Images

Related Articles

Clone Assay:

Article Title: Cooperation between NRF-2 and YY-1 transcription factors is essential for triggering the expression of the PREPL-C2ORF34 bidirectional gene pair
Article Snippet: .. Each amplified fragment was digested with BglII and HindIII and then cloned into pGL3-Basic vector (Promega) followed by autosequencing to ensure no mutations had been introduced during the amplification reaction. .. In order to facilitate subsequent characterization of the promoter activity of the intergenic region, the positions of the most 5' exon of PREPL (exon 1a) or C2ORF34 (exon 1) are numbered as +1 and -406, respectively.

Article Title: Adenovirus VA RNA-derived miRNAs target cellular genes involved in cell growth, gene expression and DNA repair
Article Snippet: .. The amplified fragment was digested with BglII and HindIII, gel purified and cloned in the same sites of pSuper. pmivaRNAI-138 was constructed by cloning the hybridized oligonucleotides shVAI-15′ (GATCCCCGGGCACTCTTCCGTGGTCTTT CAAGAGAGACAACGGGGGAGCGCTCCTTTTTGGAAA) and shVAI-13′ (AGCTTTTCCAAAAAGGAGCGCTCCCC CGTTGTCTCTCTTGAAAGACCACGGAAGAGTGCCCGGG) into the BglII and HindIII sites of pSuper. pHA-TIA-1 was obtained from Juan Valcárcel and expresses TIA-1 protein fused to a HA peptide. pGL3-Promoter (Promega) expressing Firefly luciferase was used as a transfection control. pRL-SV40 (Promega) was used to construct the plasmids that express TIA-1 target sequences in the 3′UTR of renilla mRNA. .. Proper oligonucleotide sequences were cloned in the Xba I– Not I site of pRL-SV40 to obtain pRL-TIA-1 (CAGGGAGUGUAGUAAAGCCGUUGUUUACUUAAAG) and pRL-TIA-1Mut (CAGGGAGUGUAGUAAAGGGCAACAUUACUUAAAG).

Transfection:

Article Title: Adenovirus VA RNA-derived miRNAs target cellular genes involved in cell growth, gene expression and DNA repair
Article Snippet: .. The amplified fragment was digested with BglII and HindIII, gel purified and cloned in the same sites of pSuper. pmivaRNAI-138 was constructed by cloning the hybridized oligonucleotides shVAI-15′ (GATCCCCGGGCACTCTTCCGTGGTCTTT CAAGAGAGACAACGGGGGAGCGCTCCTTTTTGGAAA) and shVAI-13′ (AGCTTTTCCAAAAAGGAGCGCTCCCC CGTTGTCTCTCTTGAAAGACCACGGAAGAGTGCCCGGG) into the BglII and HindIII sites of pSuper. pHA-TIA-1 was obtained from Juan Valcárcel and expresses TIA-1 protein fused to a HA peptide. pGL3-Promoter (Promega) expressing Firefly luciferase was used as a transfection control. pRL-SV40 (Promega) was used to construct the plasmids that express TIA-1 target sequences in the 3′UTR of renilla mRNA. .. Proper oligonucleotide sequences were cloned in the Xba I– Not I site of pRL-SV40 to obtain pRL-TIA-1 (CAGGGAGUGUAGUAAAGCCGUUGUUUACUUAAAG) and pRL-TIA-1Mut (CAGGGAGUGUAGUAAAGGGCAACAUUACUUAAAG).

Amplification:

Article Title: Cooperation between NRF-2 and YY-1 transcription factors is essential for triggering the expression of the PREPL-C2ORF34 bidirectional gene pair
Article Snippet: .. Each amplified fragment was digested with BglII and HindIII and then cloned into pGL3-Basic vector (Promega) followed by autosequencing to ensure no mutations had been introduced during the amplification reaction. .. In order to facilitate subsequent characterization of the promoter activity of the intergenic region, the positions of the most 5' exon of PREPL (exon 1a) or C2ORF34 (exon 1) are numbered as +1 and -406, respectively.

Article Title: Adenovirus VA RNA-derived miRNAs target cellular genes involved in cell growth, gene expression and DNA repair
Article Snippet: .. The amplified fragment was digested with BglII and HindIII, gel purified and cloned in the same sites of pSuper. pmivaRNAI-138 was constructed by cloning the hybridized oligonucleotides shVAI-15′ (GATCCCCGGGCACTCTTCCGTGGTCTTT CAAGAGAGACAACGGGGGAGCGCTCCTTTTTGGAAA) and shVAI-13′ (AGCTTTTCCAAAAAGGAGCGCTCCCC CGTTGTCTCTCTTGAAAGACCACGGAAGAGTGCCCGGG) into the BglII and HindIII sites of pSuper. pHA-TIA-1 was obtained from Juan Valcárcel and expresses TIA-1 protein fused to a HA peptide. pGL3-Promoter (Promega) expressing Firefly luciferase was used as a transfection control. pRL-SV40 (Promega) was used to construct the plasmids that express TIA-1 target sequences in the 3′UTR of renilla mRNA. .. Proper oligonucleotide sequences were cloned in the Xba I– Not I site of pRL-SV40 to obtain pRL-TIA-1 (CAGGGAGUGUAGUAAAGCCGUUGUUUACUUAAAG) and pRL-TIA-1Mut (CAGGGAGUGUAGUAAAGGGCAACAUUACUUAAAG).

Article Title: Transcriptional Regulation of Oncogenic Protein Kinase Cϵ (PKCϵ) by STAT1 and Sp1 Proteins *
Article Snippet: .. PRKCE promoter truncated fragments (−1933/+219, −1416/+219, −808/+219, −531/+219, −401/+219, −320/+219, and −105/+219) were amplified by PCR from human genomic DNA prepared from T-47D cells using BglII- and NheI-flanked following primers and subcloned into the pGL3-enhancer luciferase reporter vector (Promega, Madison, WI). ..

Article Title:
Article Snippet: .. The amplified ∼2 Kb fragment was digested with XhoI and BglII and ligated into the promoterless pGL4.10 [ luc2 ] luciferase reporter vector (Promega Corporation, Madison, WI), resulting in the (−1991:+13)-UGT2B4-Luc reporter plasmid. .. This plasmid served as the template to create a series of deletion constructs containing nucleotides −1648:+13, −1119:+13, −804:+13, −484:+13, and −112:+13 (primer sets are listed in ).

Isolation:

Article Title: Requirement for RAR-mediated gene repression in skeletal progenitor differentiation
Article Snippet: .. The fragment containing the 4X48 repeat and minimal promoter was isolated as a BamHI/HindIII fragment from the original 4X48-p89Luc reporter plasmid described previously ( ) and was subcloned into the BglII and HindIII sites of pGL3-basic (Promega) to generate pGL3(4X48). .. The reporter pW1-Col2-Luc was generated from the original p309i(182X2)βgeoCol2a1 ( ) by subcloning the regulatory region (consisting of a 309-bp promoter region and two tandem repeats of a 182-bp intron-1 fragment) into pW1 ( ) as an EcoRI/BamHI fragment.

Construct:

Article Title: Adenovirus VA RNA-derived miRNAs target cellular genes involved in cell growth, gene expression and DNA repair
Article Snippet: .. The amplified fragment was digested with BglII and HindIII, gel purified and cloned in the same sites of pSuper. pmivaRNAI-138 was constructed by cloning the hybridized oligonucleotides shVAI-15′ (GATCCCCGGGCACTCTTCCGTGGTCTTT CAAGAGAGACAACGGGGGAGCGCTCCTTTTTGGAAA) and shVAI-13′ (AGCTTTTCCAAAAAGGAGCGCTCCCC CGTTGTCTCTCTTGAAAGACCACGGAAGAGTGCCCGGG) into the BglII and HindIII sites of pSuper. pHA-TIA-1 was obtained from Juan Valcárcel and expresses TIA-1 protein fused to a HA peptide. pGL3-Promoter (Promega) expressing Firefly luciferase was used as a transfection control. pRL-SV40 (Promega) was used to construct the plasmids that express TIA-1 target sequences in the 3′UTR of renilla mRNA. .. Proper oligonucleotide sequences were cloned in the Xba I– Not I site of pRL-SV40 to obtain pRL-TIA-1 (CAGGGAGUGUAGUAAAGCCGUUGUUUACUUAAAG) and pRL-TIA-1Mut (CAGGGAGUGUAGUAAAGGGCAACAUUACUUAAAG).

Article Title: A Genome-Wide Screen of CREB Occupancy Identifies the RhoA Inhibitors Par6C and Rnd3 as Regulators of BDNF-Induced Synaptogenesis
Article Snippet: .. Luciferase Reporter Constructs: The canonical CRE (CRE: 5′ agcttggctcatgacgtagtaagca, 3′ gatctgcttactacgtcatgagcca) and the novel CRE (novel: 5′ agcttggctcatggcgtagtaagca, 3′ gatctgcttactacgccatgagcca) were phosphorylated and ligated into the BglII and XhoI sites of dephosphorylated pGL3 basic (promega). .. Antibodies: anti-pErk (rabbit, Cell signaling), anti-Erk1/2 (mouse Santa Cruz), anti-pCREB (mouse, Chemicon), anti-c-Myc (mouse, Sigma), anti-Rnd3 (mouse, Millipore), anti-Par6 (rabbit, Sigma), anti-Synapsin1 (mouse, Synaptic systems), anti-VGlut1 (mouse, Neuromab).

Purification:

Article Title: Adenovirus VA RNA-derived miRNAs target cellular genes involved in cell growth, gene expression and DNA repair
Article Snippet: .. The amplified fragment was digested with BglII and HindIII, gel purified and cloned in the same sites of pSuper. pmivaRNAI-138 was constructed by cloning the hybridized oligonucleotides shVAI-15′ (GATCCCCGGGCACTCTTCCGTGGTCTTT CAAGAGAGACAACGGGGGAGCGCTCCTTTTTGGAAA) and shVAI-13′ (AGCTTTTCCAAAAAGGAGCGCTCCCC CGTTGTCTCTCTTGAAAGACCACGGAAGAGTGCCCGGG) into the BglII and HindIII sites of pSuper. pHA-TIA-1 was obtained from Juan Valcárcel and expresses TIA-1 protein fused to a HA peptide. pGL3-Promoter (Promega) expressing Firefly luciferase was used as a transfection control. pRL-SV40 (Promega) was used to construct the plasmids that express TIA-1 target sequences in the 3′UTR of renilla mRNA. .. Proper oligonucleotide sequences were cloned in the Xba I– Not I site of pRL-SV40 to obtain pRL-TIA-1 (CAGGGAGUGUAGUAAAGCCGUUGUUUACUUAAAG) and pRL-TIA-1Mut (CAGGGAGUGUAGUAAAGGGCAACAUUACUUAAAG).

Article Title: Anti-Inflammatory Cytokine Interleukin-4 Inhibits Inducible Nitric Oxide Synthase Gene Expression in the Mouse Macrophage Cell Line RAW264.7 through the Repression of Octamer-Dependent Transcription
Article Snippet: .. The purified PCR product (−996~+104) was then subcloned into an MluI - and BglII -digested pGL2 luciferase reporter plasmid (Promega), and the resulting plasmid was designated as pNOS-996. .. A series of deletion mutants of the 5′-flanking region of the Nos2 gene was constructed by restriction enzyme digestion of pNOS-996 (SmaI for −772, SacI for −333, and PstI for −44).

Luciferase:

Article Title: Adenovirus VA RNA-derived miRNAs target cellular genes involved in cell growth, gene expression and DNA repair
Article Snippet: .. The amplified fragment was digested with BglII and HindIII, gel purified and cloned in the same sites of pSuper. pmivaRNAI-138 was constructed by cloning the hybridized oligonucleotides shVAI-15′ (GATCCCCGGGCACTCTTCCGTGGTCTTT CAAGAGAGACAACGGGGGAGCGCTCCTTTTTGGAAA) and shVAI-13′ (AGCTTTTCCAAAAAGGAGCGCTCCCC CGTTGTCTCTCTTGAAAGACCACGGAAGAGTGCCCGGG) into the BglII and HindIII sites of pSuper. pHA-TIA-1 was obtained from Juan Valcárcel and expresses TIA-1 protein fused to a HA peptide. pGL3-Promoter (Promega) expressing Firefly luciferase was used as a transfection control. pRL-SV40 (Promega) was used to construct the plasmids that express TIA-1 target sequences in the 3′UTR of renilla mRNA. .. Proper oligonucleotide sequences were cloned in the Xba I– Not I site of pRL-SV40 to obtain pRL-TIA-1 (CAGGGAGUGUAGUAAAGCCGUUGUUUACUUAAAG) and pRL-TIA-1Mut (CAGGGAGUGUAGUAAAGGGCAACAUUACUUAAAG).

Article Title: Transcriptional Regulation of Oncogenic Protein Kinase Cϵ (PKCϵ) by STAT1 and Sp1 Proteins *
Article Snippet: .. PRKCE promoter truncated fragments (−1933/+219, −1416/+219, −808/+219, −531/+219, −401/+219, −320/+219, and −105/+219) were amplified by PCR from human genomic DNA prepared from T-47D cells using BglII- and NheI-flanked following primers and subcloned into the pGL3-enhancer luciferase reporter vector (Promega, Madison, WI). ..

Article Title:
Article Snippet: .. The amplified ∼2 Kb fragment was digested with XhoI and BglII and ligated into the promoterless pGL4.10 [ luc2 ] luciferase reporter vector (Promega Corporation, Madison, WI), resulting in the (−1991:+13)-UGT2B4-Luc reporter plasmid. .. This plasmid served as the template to create a series of deletion constructs containing nucleotides −1648:+13, −1119:+13, −804:+13, −484:+13, and −112:+13 (primer sets are listed in ).

Article Title: Anti-Inflammatory Cytokine Interleukin-4 Inhibits Inducible Nitric Oxide Synthase Gene Expression in the Mouse Macrophage Cell Line RAW264.7 through the Repression of Octamer-Dependent Transcription
Article Snippet: .. The purified PCR product (−996~+104) was then subcloned into an MluI - and BglII -digested pGL2 luciferase reporter plasmid (Promega), and the resulting plasmid was designated as pNOS-996. .. A series of deletion mutants of the 5′-flanking region of the Nos2 gene was constructed by restriction enzyme digestion of pNOS-996 (SmaI for −772, SacI for −333, and PstI for −44).

Article Title: A Genome-Wide Screen of CREB Occupancy Identifies the RhoA Inhibitors Par6C and Rnd3 as Regulators of BDNF-Induced Synaptogenesis
Article Snippet: .. Luciferase Reporter Constructs: The canonical CRE (CRE: 5′ agcttggctcatgacgtagtaagca, 3′ gatctgcttactacgtcatgagcca) and the novel CRE (novel: 5′ agcttggctcatggcgtagtaagca, 3′ gatctgcttactacgccatgagcca) were phosphorylated and ligated into the BglII and XhoI sites of dephosphorylated pGL3 basic (promega). .. Antibodies: anti-pErk (rabbit, Cell signaling), anti-Erk1/2 (mouse Santa Cruz), anti-pCREB (mouse, Chemicon), anti-c-Myc (mouse, Sigma), anti-Rnd3 (mouse, Millipore), anti-Par6 (rabbit, Sigma), anti-Synapsin1 (mouse, Synaptic systems), anti-VGlut1 (mouse, Neuromab).

Expressing:

Article Title: Adenovirus VA RNA-derived miRNAs target cellular genes involved in cell growth, gene expression and DNA repair
Article Snippet: .. The amplified fragment was digested with BglII and HindIII, gel purified and cloned in the same sites of pSuper. pmivaRNAI-138 was constructed by cloning the hybridized oligonucleotides shVAI-15′ (GATCCCCGGGCACTCTTCCGTGGTCTTT CAAGAGAGACAACGGGGGAGCGCTCCTTTTTGGAAA) and shVAI-13′ (AGCTTTTCCAAAAAGGAGCGCTCCCC CGTTGTCTCTCTTGAAAGACCACGGAAGAGTGCCCGGG) into the BglII and HindIII sites of pSuper. pHA-TIA-1 was obtained from Juan Valcárcel and expresses TIA-1 protein fused to a HA peptide. pGL3-Promoter (Promega) expressing Firefly luciferase was used as a transfection control. pRL-SV40 (Promega) was used to construct the plasmids that express TIA-1 target sequences in the 3′UTR of renilla mRNA. .. Proper oligonucleotide sequences were cloned in the Xba I– Not I site of pRL-SV40 to obtain pRL-TIA-1 (CAGGGAGUGUAGUAAAGCCGUUGUUUACUUAAAG) and pRL-TIA-1Mut (CAGGGAGUGUAGUAAAGGGCAACAUUACUUAAAG).

Polymerase Chain Reaction:

Article Title: Transcriptional Regulation of Oncogenic Protein Kinase Cϵ (PKCϵ) by STAT1 and Sp1 Proteins *
Article Snippet: .. PRKCE promoter truncated fragments (−1933/+219, −1416/+219, −808/+219, −531/+219, −401/+219, −320/+219, and −105/+219) were amplified by PCR from human genomic DNA prepared from T-47D cells using BglII- and NheI-flanked following primers and subcloned into the pGL3-enhancer luciferase reporter vector (Promega, Madison, WI). ..

Article Title: Anti-Inflammatory Cytokine Interleukin-4 Inhibits Inducible Nitric Oxide Synthase Gene Expression in the Mouse Macrophage Cell Line RAW264.7 through the Repression of Octamer-Dependent Transcription
Article Snippet: .. The purified PCR product (−996~+104) was then subcloned into an MluI - and BglII -digested pGL2 luciferase reporter plasmid (Promega), and the resulting plasmid was designated as pNOS-996. .. A series of deletion mutants of the 5′-flanking region of the Nos2 gene was constructed by restriction enzyme digestion of pNOS-996 (SmaI for −772, SacI for −333, and PstI for −44).

Plasmid Preparation:

Article Title: Cooperation between NRF-2 and YY-1 transcription factors is essential for triggering the expression of the PREPL-C2ORF34 bidirectional gene pair
Article Snippet: .. Each amplified fragment was digested with BglII and HindIII and then cloned into pGL3-Basic vector (Promega) followed by autosequencing to ensure no mutations had been introduced during the amplification reaction. .. In order to facilitate subsequent characterization of the promoter activity of the intergenic region, the positions of the most 5' exon of PREPL (exon 1a) or C2ORF34 (exon 1) are numbered as +1 and -406, respectively.

Article Title: Transcriptional Regulation of Oncogenic Protein Kinase Cϵ (PKCϵ) by STAT1 and Sp1 Proteins *
Article Snippet: .. PRKCE promoter truncated fragments (−1933/+219, −1416/+219, −808/+219, −531/+219, −401/+219, −320/+219, and −105/+219) were amplified by PCR from human genomic DNA prepared from T-47D cells using BglII- and NheI-flanked following primers and subcloned into the pGL3-enhancer luciferase reporter vector (Promega, Madison, WI). ..

Article Title: Requirement for RAR-mediated gene repression in skeletal progenitor differentiation
Article Snippet: .. The fragment containing the 4X48 repeat and minimal promoter was isolated as a BamHI/HindIII fragment from the original 4X48-p89Luc reporter plasmid described previously ( ) and was subcloned into the BglII and HindIII sites of pGL3-basic (Promega) to generate pGL3(4X48). .. The reporter pW1-Col2-Luc was generated from the original p309i(182X2)βgeoCol2a1 ( ) by subcloning the regulatory region (consisting of a 309-bp promoter region and two tandem repeats of a 182-bp intron-1 fragment) into pW1 ( ) as an EcoRI/BamHI fragment.

Article Title:
Article Snippet: .. The amplified ∼2 Kb fragment was digested with XhoI and BglII and ligated into the promoterless pGL4.10 [ luc2 ] luciferase reporter vector (Promega Corporation, Madison, WI), resulting in the (−1991:+13)-UGT2B4-Luc reporter plasmid. .. This plasmid served as the template to create a series of deletion constructs containing nucleotides −1648:+13, −1119:+13, −804:+13, −484:+13, and −112:+13 (primer sets are listed in ).

Article Title: Anti-Inflammatory Cytokine Interleukin-4 Inhibits Inducible Nitric Oxide Synthase Gene Expression in the Mouse Macrophage Cell Line RAW264.7 through the Repression of Octamer-Dependent Transcription
Article Snippet: .. The purified PCR product (−996~+104) was then subcloned into an MluI - and BglII -digested pGL2 luciferase reporter plasmid (Promega), and the resulting plasmid was designated as pNOS-996. .. A series of deletion mutants of the 5′-flanking region of the Nos2 gene was constructed by restriction enzyme digestion of pNOS-996 (SmaI for −772, SacI for −333, and PstI for −44).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Promega bglii sites
    Targeted disruption of Sox12 in mice. (A) Schematic representation of the targeting construct (top), the Sox12 wild-type locus (upper middle), and the mutant locus before Cre recombination in ES cells (lower middle) and after Cre recombination in mice (bottom). The transcribed region of the Sox12 gene is shown as a box, and flanking regions are shown as bars. Sox12 coding sequences (open reading frames [ORF]), including the position of the start codon (ATG), an intron (I) predicted in the annotated mouse genome, and neomycin resistance cassette (neo), IRES-EGFP cassette, loxP , and FRT sites, are highlighted. Tk, thymidine kinase. Regions of homology, in which recombination between wild-type locus and targeting vector occurred, are marked by crossed lines. Restriction sites for BamHI (B), <t>BglII</t> (G), and PstI (P) are shown as well as the locations of 5′ and 3′ probes and of primers a, b, and c for genotyping (arrowheads). (B) Southern blot analysis of <t>DNA</t> from ES cells before (+/+) and after (+/flox [fl]) successful homologous recombination. Correct integration of the targeting construct was verified after digestion with PstI by use of the 5′ probe and after digestion with BamHI by use of the 3′ probe. The sizes of fragments corresponding to the wild type and the targeted allele are given in kb on the left of the panels. (C) Southern blot analysis of DNA from adult wild-type (+/+), heterozygous (+/−), and homozygous (−/−) mice after Cre-mediated deletion. The loss of all sequences between the first and third loxP sites, including the complete Sox12 open reading frame, was verified after digestion with BglII by use of the 5′ probe. The sizes of fragments corresponding to the wild type and the targeted allele are given in kb on the left of the panel. (D) Genotyping PCR on DNA from adult wild-type (+/+), heterozygous (+/−), and homozygous (−/−) mice. The lower band of 468 bp is indicative of the wild-type allele, the upper band of 580 bp of the Sox12 deletion allele. (E) Analysis of Sox12 expression in heads and trunks of 12.5-dpc-old wild-type (+/+) and Sox12-deficient (−/−) embryos by RT-PCR using primers specific for Sox12 , GFP , and β-actin . (F) In situ hybridization of transverse sections from the trunks of wild-type (+/+) and Sox12 -deficient (−/−) embryos at 12.5 dpc by use of an antisense riboprobe complementary to part of the 3′-untranslated region of Sox12 .
    Bglii Sites, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 79 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bglii sites/product/Promega
    Average 92 stars, based on 79 article reviews
    Price from $9.99 to $1999.99
    bglii sites - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    91
    Promega bglii site
    Sequence of the human CALB2 promoter region containing putative Bt-responsive elements BRE7–13 a The region of 1278 bp contains 7 putative BREs (cyan). Primer sequences to amplify the 1278-bp fragment are marked in yellow including restriction sites for <t>SacI</t> (Table 1 ) and <t>BglII</t> (red). The start site of translation is marked in red (bold). Primers used to amplify truncated versions are boxed in gray (details are shown in Table 1 ). b Sequence alignment of BRE5 - BRE13 with the BRE consensus sequence (15) shown at the bottom. Nucleotide sequences fully complying with the consensus (100% identity) are marked in blue, medium-conserved sequences are marked in green and nucleotides not conferring to the consensus sequence are marked in black; percentages of identity with the consensus sequence are given in the right lane. c , d Luc + reporter assay in MSTO-211H (upper) and ZL55 MM (lower) cells with CALB2 promoter fragments containing variable numbers of BREs. Luc + activities were normalized to the signal obtained with the control plasmid pGl3-P. As reference for the statistical analysis, BRE5–6 [ 15 ] was used. The number of independent experiments ranged from n = 4 (e.g. BRE10–13) to n = 11 (e.g. BRE7–13). Values represent mean ± S.D. * p
    Bglii Site, supplied by Promega, used in various techniques. Bioz Stars score: 91/100, based on 50 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bglii site/product/Promega
    Average 91 stars, based on 50 article reviews
    Price from $9.99 to $1999.99
    bglii site - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    88
    Promega kpni bglii
    cdc6 upstream region containing Esg-binding E2 boxes is responsible for reduced cdc6 expression in non-endoreplicating cells. ( A ) Scaled diagram of the human cdc6 gene showing the E2 boxes with perfect match to Esg consensus binding sites (referred to as Esg -specific E2 Boxes A, B and C) and E2 boxes corresponding to much less specific Esg binding sites and E2F-binding elements. The arrow indicates the transcription initiation site. Relevant restriction sites are also shown: X, XhoI; B, BamHI; H, HinDIII; K, <t>KpnI;</t> and B, <t>BglII.</t> ( B and C ) HEL, HEL( Esg +) and K562cells were transfected with pHscdc6(−4537) (B) or pHscdc6(−2800) (C), cultured in the absence or in the presence of TPA or hemin, as indicated, collected and assayed for luciferase activity. ( D ) HEL, HEL( Esg +) and K562 and cells were transfected with pHscdc6 (−4537/−2800), cultured in the absence or in the presence of TPA or hemin, as indicated, collected and assayed for luciferase activity. The data represent the mean ± SD of at least three independent experiments.
    Kpni Bglii, supplied by Promega, used in various techniques. Bioz Stars score: 88/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/kpni bglii/product/Promega
    Average 88 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    kpni bglii - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    Image Search Results


    Targeted disruption of Sox12 in mice. (A) Schematic representation of the targeting construct (top), the Sox12 wild-type locus (upper middle), and the mutant locus before Cre recombination in ES cells (lower middle) and after Cre recombination in mice (bottom). The transcribed region of the Sox12 gene is shown as a box, and flanking regions are shown as bars. Sox12 coding sequences (open reading frames [ORF]), including the position of the start codon (ATG), an intron (I) predicted in the annotated mouse genome, and neomycin resistance cassette (neo), IRES-EGFP cassette, loxP , and FRT sites, are highlighted. Tk, thymidine kinase. Regions of homology, in which recombination between wild-type locus and targeting vector occurred, are marked by crossed lines. Restriction sites for BamHI (B), BglII (G), and PstI (P) are shown as well as the locations of 5′ and 3′ probes and of primers a, b, and c for genotyping (arrowheads). (B) Southern blot analysis of DNA from ES cells before (+/+) and after (+/flox [fl]) successful homologous recombination. Correct integration of the targeting construct was verified after digestion with PstI by use of the 5′ probe and after digestion with BamHI by use of the 3′ probe. The sizes of fragments corresponding to the wild type and the targeted allele are given in kb on the left of the panels. (C) Southern blot analysis of DNA from adult wild-type (+/+), heterozygous (+/−), and homozygous (−/−) mice after Cre-mediated deletion. The loss of all sequences between the first and third loxP sites, including the complete Sox12 open reading frame, was verified after digestion with BglII by use of the 5′ probe. The sizes of fragments corresponding to the wild type and the targeted allele are given in kb on the left of the panel. (D) Genotyping PCR on DNA from adult wild-type (+/+), heterozygous (+/−), and homozygous (−/−) mice. The lower band of 468 bp is indicative of the wild-type allele, the upper band of 580 bp of the Sox12 deletion allele. (E) Analysis of Sox12 expression in heads and trunks of 12.5-dpc-old wild-type (+/+) and Sox12-deficient (−/−) embryos by RT-PCR using primers specific for Sox12 , GFP , and β-actin . (F) In situ hybridization of transverse sections from the trunks of wild-type (+/+) and Sox12 -deficient (−/−) embryos at 12.5 dpc by use of an antisense riboprobe complementary to part of the 3′-untranslated region of Sox12 .

    Journal: Molecular and Cellular Biology

    Article Title: Sox12 Deletion in the Mouse Reveals Nonreciprocal Redundancy with the Related Sox4 and Sox11 Transcription Factors

    doi: 10.1128/MCB.00338-08

    Figure Lengend Snippet: Targeted disruption of Sox12 in mice. (A) Schematic representation of the targeting construct (top), the Sox12 wild-type locus (upper middle), and the mutant locus before Cre recombination in ES cells (lower middle) and after Cre recombination in mice (bottom). The transcribed region of the Sox12 gene is shown as a box, and flanking regions are shown as bars. Sox12 coding sequences (open reading frames [ORF]), including the position of the start codon (ATG), an intron (I) predicted in the annotated mouse genome, and neomycin resistance cassette (neo), IRES-EGFP cassette, loxP , and FRT sites, are highlighted. Tk, thymidine kinase. Regions of homology, in which recombination between wild-type locus and targeting vector occurred, are marked by crossed lines. Restriction sites for BamHI (B), BglII (G), and PstI (P) are shown as well as the locations of 5′ and 3′ probes and of primers a, b, and c for genotyping (arrowheads). (B) Southern blot analysis of DNA from ES cells before (+/+) and after (+/flox [fl]) successful homologous recombination. Correct integration of the targeting construct was verified after digestion with PstI by use of the 5′ probe and after digestion with BamHI by use of the 3′ probe. The sizes of fragments corresponding to the wild type and the targeted allele are given in kb on the left of the panels. (C) Southern blot analysis of DNA from adult wild-type (+/+), heterozygous (+/−), and homozygous (−/−) mice after Cre-mediated deletion. The loss of all sequences between the first and third loxP sites, including the complete Sox12 open reading frame, was verified after digestion with BglII by use of the 5′ probe. The sizes of fragments corresponding to the wild type and the targeted allele are given in kb on the left of the panel. (D) Genotyping PCR on DNA from adult wild-type (+/+), heterozygous (+/−), and homozygous (−/−) mice. The lower band of 468 bp is indicative of the wild-type allele, the upper band of 580 bp of the Sox12 deletion allele. (E) Analysis of Sox12 expression in heads and trunks of 12.5-dpc-old wild-type (+/+) and Sox12-deficient (−/−) embryos by RT-PCR using primers specific for Sox12 , GFP , and β-actin . (F) In situ hybridization of transverse sections from the trunks of wild-type (+/+) and Sox12 -deficient (−/−) embryos at 12.5 dpc by use of an antisense riboprobe complementary to part of the 3′-untranslated region of Sox12 .

    Article Snippet: Additionally, we PCR amplified a 622-bp fragment spanning positions −566 to +54 of the Tubb3 promoter ( ) from mouse genomic DNA and inserted it between the SacI and BglII sites of the luciferase reporter plasmid pGL2 (Promega).

    Techniques: Mouse Assay, Construct, Mutagenesis, Plasmid Preparation, Southern Blot, Homologous Recombination, Polymerase Chain Reaction, Expressing, Reverse Transcription Polymerase Chain Reaction, In Situ Hybridization

    Sequence of the human CALB2 promoter region containing putative Bt-responsive elements BRE7–13 a The region of 1278 bp contains 7 putative BREs (cyan). Primer sequences to amplify the 1278-bp fragment are marked in yellow including restriction sites for SacI (Table 1 ) and BglII (red). The start site of translation is marked in red (bold). Primers used to amplify truncated versions are boxed in gray (details are shown in Table 1 ). b Sequence alignment of BRE5 - BRE13 with the BRE consensus sequence (15) shown at the bottom. Nucleotide sequences fully complying with the consensus (100% identity) are marked in blue, medium-conserved sequences are marked in green and nucleotides not conferring to the consensus sequence are marked in black; percentages of identity with the consensus sequence are given in the right lane. c , d Luc + reporter assay in MSTO-211H (upper) and ZL55 MM (lower) cells with CALB2 promoter fragments containing variable numbers of BREs. Luc + activities were normalized to the signal obtained with the control plasmid pGl3-P. As reference for the statistical analysis, BRE5–6 [ 15 ] was used. The number of independent experiments ranged from n = 4 (e.g. BRE10–13) to n = 11 (e.g. BRE7–13). Values represent mean ± S.D. * p

    Journal: BMC Cancer

    Article Title: Regulation of calretinin in malignant mesothelioma is mediated by septin 7 binding to the CALB2 promoter

    doi: 10.1186/s12885-018-4385-7

    Figure Lengend Snippet: Sequence of the human CALB2 promoter region containing putative Bt-responsive elements BRE7–13 a The region of 1278 bp contains 7 putative BREs (cyan). Primer sequences to amplify the 1278-bp fragment are marked in yellow including restriction sites for SacI (Table 1 ) and BglII (red). The start site of translation is marked in red (bold). Primers used to amplify truncated versions are boxed in gray (details are shown in Table 1 ). b Sequence alignment of BRE5 - BRE13 with the BRE consensus sequence (15) shown at the bottom. Nucleotide sequences fully complying with the consensus (100% identity) are marked in blue, medium-conserved sequences are marked in green and nucleotides not conferring to the consensus sequence are marked in black; percentages of identity with the consensus sequence are given in the right lane. c , d Luc + reporter assay in MSTO-211H (upper) and ZL55 MM (lower) cells with CALB2 promoter fragments containing variable numbers of BREs. Luc + activities were normalized to the signal obtained with the control plasmid pGl3-P. As reference for the statistical analysis, BRE5–6 [ 15 ] was used. The number of independent experiments ranged from n = 4 (e.g. BRE10–13) to n = 11 (e.g. BRE7–13). Values represent mean ± S.D. * p

    Article Snippet: The amplicon of 1292 bp containing a SacI and a BglII site at the 5′- and 3′-end, respectively, was cloned into the plasmid pGL3-Promotor (pGL3-P; Promega; # U47298; Wallisellen, Switzerland) linearized with the same restriction enzymes. pGL3-P contains a multiple cloning site, followed by a minimal SV40 promoter; the luciferase cassette (luc) in the plasmid is followed by a SV40 late poly (A) signal.

    Techniques: Sequencing, Reporter Assay, Plasmid Preparation

    Analysis of the higher order chromatin structure of rat and human Mcs5a/MCS5A . ( A ) Maps of the rat and human Mcs5a/MCS5A locus. The relative position of Mcs5a1/MCS5A1 , Mcs5a2/MCS5A2 , all BglII restriction site, the transcripts Fbxo10/FBXO10 , Tomm5/TOMM5 and Frmpd1/FRMPD1 , and the human breast cancer risk-associated variants is indicated. The primers matching the fixed fragments used to generate panels ( B–E ) are indicated by black vertical triangles. (B–D) 3C profiles of the Mcs5a locus in T cells of susceptible congenic control (susc.) and Mcs5a resistant congenic ( Mcs5a ) rats. The position of the fixed fragments is indicated with a black bar and F, and the primer within the fixed fragment is indicated with a vertical triangle. In (B) the fixed fragment contains the CpG island associated with the predicted promoter of Fbxo10 in Mcs5a1 . In (C) the fixed fragment is located five BglII restriction fragments (~10 kb) upstream of the previous fixed fragment that contains the CpG island in Mcs5a1 . In (D) the fixed fragment was located in the first looping fragment in Mcs5a2 . ( E ) Comparison of the rat and human Mcs5a/MCS5A 3 C profile. Dashed lines represent the 3C profile with the fixed fragment containing the predicted Fbxo10/FBXO10 promoter in Mcs5a1/MCS5A1 and does not display looping to Mcs5a2/MCS5A2 . In the human, this fixed fragment also contains the four correlated MCS5A1 polymorphisms associated with breast cancer risk. Solid lines represents the 3C profile with the fixed fragment located five (rat) or two (human) BglII restriction fragments (~10 kb) upstream of the BglII fragment containing the predicted Fbxo10/FBXO10 promoter in Mcs5a1/MCS5A1 . The chromatin fragments in Mcs5a2/MCS5A2 looping to the fixed fragment in Mcs5a1/MCS5A1 are indicated with PEAK 1 and PEAK 2. Graphed are the average ± SEM relative interaction frequencies of a fixed BglII fragment with other BglII fragments in Mcs5a/MCS5A . The genomic distance (in kilobases) represents the distance of the midpoint of a BglII fragment to the Mcs5a1/MCS5A1-Mcs5a2/MCS5A2 border.

    Journal: Nucleic Acids Research

    Article Title: An insulator loop resides between the synthetically interacting elements of the human/rat conserved breast cancer susceptibility locus MCS5A/Mcs5a

    doi: 10.1093/nar/gkr610

    Figure Lengend Snippet: Analysis of the higher order chromatin structure of rat and human Mcs5a/MCS5A . ( A ) Maps of the rat and human Mcs5a/MCS5A locus. The relative position of Mcs5a1/MCS5A1 , Mcs5a2/MCS5A2 , all BglII restriction site, the transcripts Fbxo10/FBXO10 , Tomm5/TOMM5 and Frmpd1/FRMPD1 , and the human breast cancer risk-associated variants is indicated. The primers matching the fixed fragments used to generate panels ( B–E ) are indicated by black vertical triangles. (B–D) 3C profiles of the Mcs5a locus in T cells of susceptible congenic control (susc.) and Mcs5a resistant congenic ( Mcs5a ) rats. The position of the fixed fragments is indicated with a black bar and F, and the primer within the fixed fragment is indicated with a vertical triangle. In (B) the fixed fragment contains the CpG island associated with the predicted promoter of Fbxo10 in Mcs5a1 . In (C) the fixed fragment is located five BglII restriction fragments (~10 kb) upstream of the previous fixed fragment that contains the CpG island in Mcs5a1 . In (D) the fixed fragment was located in the first looping fragment in Mcs5a2 . ( E ) Comparison of the rat and human Mcs5a/MCS5A 3 C profile. Dashed lines represent the 3C profile with the fixed fragment containing the predicted Fbxo10/FBXO10 promoter in Mcs5a1/MCS5A1 and does not display looping to Mcs5a2/MCS5A2 . In the human, this fixed fragment also contains the four correlated MCS5A1 polymorphisms associated with breast cancer risk. Solid lines represents the 3C profile with the fixed fragment located five (rat) or two (human) BglII restriction fragments (~10 kb) upstream of the BglII fragment containing the predicted Fbxo10/FBXO10 promoter in Mcs5a1/MCS5A1 . The chromatin fragments in Mcs5a2/MCS5A2 looping to the fixed fragment in Mcs5a1/MCS5A1 are indicated with PEAK 1 and PEAK 2. Graphed are the average ± SEM relative interaction frequencies of a fixed BglII fragment with other BglII fragments in Mcs5a/MCS5A . The genomic distance (in kilobases) represents the distance of the midpoint of a BglII fragment to the Mcs5a1/MCS5A1-Mcs5a2/MCS5A2 border.

    Article Snippet: First, the FBXO10 -TSS constructs were made by inserting the BamHI-, SalI-digested genomic FBXO10 -TSS fragment using the XhoI and BglII site located upstream of Luc+ in pGL3-Basic (Promega).

    Techniques:

    cdc6 upstream region containing Esg-binding E2 boxes is responsible for reduced cdc6 expression in non-endoreplicating cells. ( A ) Scaled diagram of the human cdc6 gene showing the E2 boxes with perfect match to Esg consensus binding sites (referred to as Esg -specific E2 Boxes A, B and C) and E2 boxes corresponding to much less specific Esg binding sites and E2F-binding elements. The arrow indicates the transcription initiation site. Relevant restriction sites are also shown: X, XhoI; B, BamHI; H, HinDIII; K, KpnI; and B, BglII. ( B and C ) HEL, HEL( Esg +) and K562cells were transfected with pHscdc6(−4537) (B) or pHscdc6(−2800) (C), cultured in the absence or in the presence of TPA or hemin, as indicated, collected and assayed for luciferase activity. ( D ) HEL, HEL( Esg +) and K562 and cells were transfected with pHscdc6 (−4537/−2800), cultured in the absence or in the presence of TPA or hemin, as indicated, collected and assayed for luciferase activity. The data represent the mean ± SD of at least three independent experiments.

    Journal: Nucleic Acids Research

    Article Title: A novel E2 box-GATA element modulates Cdc6 transcription during human cells polyploidization

    doi: 10.1093/nar/gkh981

    Figure Lengend Snippet: cdc6 upstream region containing Esg-binding E2 boxes is responsible for reduced cdc6 expression in non-endoreplicating cells. ( A ) Scaled diagram of the human cdc6 gene showing the E2 boxes with perfect match to Esg consensus binding sites (referred to as Esg -specific E2 Boxes A, B and C) and E2 boxes corresponding to much less specific Esg binding sites and E2F-binding elements. The arrow indicates the transcription initiation site. Relevant restriction sites are also shown: X, XhoI; B, BamHI; H, HinDIII; K, KpnI; and B, BglII. ( B and C ) HEL, HEL( Esg +) and K562cells were transfected with pHscdc6(−4537) (B) or pHscdc6(−2800) (C), cultured in the absence or in the presence of TPA or hemin, as indicated, collected and assayed for luciferase activity. ( D ) HEL, HEL( Esg +) and K562 and cells were transfected with pHscdc6 (−4537/−2800), cultured in the absence or in the presence of TPA or hemin, as indicated, collected and assayed for luciferase activity. The data represent the mean ± SD of at least three independent experiments.

    Article Snippet: To construct pHscdc6(4537/−2800), a 1.7 kb KpnI/BamHI fragment from pHscdc6(4537) was inserted in between the KpnI/BglII of pGL2Promoter (Promega).

    Techniques: Binding Assay, Expressing, Transfection, Cell Culture, Luciferase, Activity Assay